Am J Cancer Res 2020;10(8):2446-2463 www.ajcr.us /ISSN:2156-6976/ajcr0116754 Original Article Transcription factor NFYA promotes G1/S cell cycle transition and cell proliferation by transactivating cyclin D1 and CDK4 in clear cell renal cell carcinoma Yu Li1, Xing Xiao2, Hengxing Chen1, Zhen Chen1, Kaishun Hu1*, Dong Yin1* 1Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Medical Research Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120, Guangdong, China; 2Department of Dermatology, Shenzhen Children’s Hospital, Shenzhen 518000, Guangdong, China. *Equal con- tributors. Received June 22, 2020; Accepted July 10, 2020; Epub August 1, 2020; Published August 15, 2020 Abstract: NFYA (nuclear transcription factor Y, subunit A) is a CCAAT-binding transcription factor. Accumulating evi- dence suggests that NFYA plays an important role in breast, ovarian, lung and gastric cancer. However, the role of NFYA in clear cell renal cell carcinoma (ccRCC) remains unclear. In this study, it was discovered that the expres- sion of NFYA is elevated in tissues of ccRCC patient and high NFYA expression is linked to poor overall survival in ccRCC patient. Inhibition of G1/S cell cycle transition and decreased cell proliferation were observed upon NFYA knockdown in ccRCC cells. Moreover, further investigation revealed that NFYA binds directly to the promoter region of both CDK4 and cyclin D1 (CCND1) thus transactivating their expression, resulting in RB phosphorylation and the activation of subsequent E2F pathway activation. Taken together, these findings imply the oncogenic role of NFYA in ccRCC progression and its potential as a target for ccRCC therapy. Keywords: NFYA, G1/S transition, cyclin D1, CDK4, ccRCC Introduction Transcription factors are protein molecules that bind with specific DNA sequence to control Renal cell carcinoma (RCC) is one of the most the transcription of genetic information [10]. common types of malignancy. Its incidence and Emerging evidences have shown that transcrip- mortality rates have ascended steadily in the tion factors play important role in physiological past decade [1, 2]. RCC can be classified into and pathological processes, including neurode- three major subtypes based on its histological- generative pathologies, diabetes and cancers ly characteristic: chromophobe RCC (chRCC), [11]. Transcription factors are dysregulated in papillary RCC (pRCC) and clear cell RCC (ccRCC) various types of cancers and play key roles in [3]. Among them, ccRCC accounts for more regulating self-renewal, differentiation, chemo- than 80% of all RCCs and represents the most therapy resistance, immune evasion, EMT (epi- malignant subtype [4]. Advanced RCC shows thelial-mesenchymal transition), and prolifera- poor prognosis with 5-year survival of only tion of cancer cells [12]. Several transcription 11.7% [5], and it usually exhibits resistance to factors have been identified to involve in the traditional radiotherapy and chemotherapy [6, progression of ccRCC [13]. The most famous 7]. Immunotherapy and tyrosine kinase inhibi- one is HIF1α, which is induced in oxygen-defi- tor have been developed for RCC therapy in cient tumor microenvironment and promotes recent years, however, the prognosis for ccRCC aggressiveness by activating a number advanced RCC remains suboptimal [8, 9]. Thus, of oncogenes, such as VEGFA, HK2 and PGK1 identification of genes involved in the patho- [14]. Hence, the HIF1α inhibitor CRLX101 is logical procession of RCC might helpful for designed for ccRCC therapy and shows benefi- uncovering novel target. cial in clinical trials [15]. Thus, transcription fac- Oncogenic role of NFYA in clear cell renal cell carcinoma tor is potential ccRCC therapy target [12] Academy of Science; while, A498 cells were and identifying novel ccRCC-associtated tran- derived from ATCC. Cells were cultivated in scription factors will be helpful for ccRCC DMEM supplemented with 10% FBS and 1% treatment. penicillin/streptomycin under standard cell cul- ture environment (37°C with 5% CO2). Small- As a subunit of nuclear transcription factor Y interfering RNA (Si-RNA) transfection was per- (NF-Y), NFYA usually forms a complex with NFYB formed using Lipofectamine RNAiMAX Reagent and NFYC and specifically binding to the CCAAT (Invitrogen) according to its manual. siRNAs cis-elements [16]. NFYA binds directly to DNA targeting NFYA (NFYA-1: CTACGTGAATGCCAA- elements through its DNA-binding domain and ACAA; NFYA-2: GGAGGCCAGCTAATCACAT), and is differentially expressed, severing as the regu- negative control si-RNAs were purchased from latory subunit, while NFYB and NFYC form het- RiboBio. erodimers to interact with NFYA and are consti- tutively expressed [17]. More and more evi- Cell proliferation assay dences have emerged to suggest that NFYA plays an important role in various cancers, with siRNA transfected ccRCC cells were seeded in its expression being elevated in lung cancer, 96-well plate at 1000 cells/well and cultured in ovarian cancer, breast cancer and gastric DMEM (10% FBS) for specific period of time as cancer [18-22]. Besides, it also regulates the indicated. 10 μL of MTT (5 mg/mL) solution metastasis, proliferation and progression of was added into each well and was incubated cancer cells through transcriptional mecha- for 3-4 hours in a humidified chamber. The nism [23-26]. For instance, NFYA binds to the reaction was stopped by adding 100 μL of 20% CCAAT sites of EZH2 promoter, which would SDS and was mixed thoroughly until formazan then upregulate the expression of EZH2 and dissolved completely. The absorbance was H3K27me3, resulting in accelerated prolifera- then measured at 570 nm. tion of human epithelial ovarian cancer (EOC) cells [27]. Despite serving as an oncoprotein in For colony formation assay, ccRCC cells were several cancers, the role of NFYA in ccRCC is seeded in 96-well plate at 100 cells/well and still poorly characterized. cultured in DMEM (10% FBS) for approximately 10 days. After that, cells were fixed with 4% To identify ccRCC-associated transcription fac- paraformaldehyde for 20 minutes and stained tors, we analyzed the expression patterns of with crystal violet. The clones then dissolved 1665 human transcription factors in two ccRCC with 200 μL glacial acetic acid. The absorbance microarray cohorts, GSE6344 (10 ccRCC and was measured at 570 nm. paired-matched adjacent normal tissues) and GSE66272 (27 ccRCC and paired-matched ad- Cell cycle analysis jacent normal tissues). The upregulation of NF- YA was discovered in tissues of ccRCC patients. ccRCC cells were digested and harvested by Furthermore, it was observed that NFYA pro- trypsin, washed with PBS and fixed in 70% ice- motes G1/S cell cycle transition and cell prolif- cold ethanol overnight. Fixed cells were washed eration in ccRCC cell lines. Interestingly, NFYA with PBS for two times, followed by RNase A binds to the promoter region of both CDK4 and treatment and PI staining (50 mg/mL). PI la- cyclin D1, which then promotes the transcrip- beled samples were analyzed with a CytoFLEX tion of CDK4/cyclin D1 and subsequently lead- (Beckman) flow cytometer. The ModFit LT 5.0 ing to activation of RB-E2F pathways. These software was used to calculate cell cycle findings strongly suggest the involvement of the distribution. NFYA-CDK4/cyclin D1-RB-E2F axis in ccRCC Cell synchronization and release progression. Material and methods Control or NFYA si-RNAs were transfected into ACHN and 769-P cells. 24 hours later, the ACHN Cell culture and siRNA transfection and 769-P cells were synchronized in FBS-free DMEM for 48 hours. After that, cells were 769-P, ACHN, Caki-1, 786-O and 293T cells digested by trypsin and seeded into 6-cm dish- were obtained from the Cell Bank of the Chinese es for culturing in 10% FBS medium. Cells were 2447 Am J Cancer Res 2020;10(8):2446-2463 Oncogenic role of NFYA in clear cell renal cell carcinoma Table 1. The primers used in real time qPCR (ENCFF045NNJ) and NFYA (ENCFF000XIR) are listed as follows ChIP-seq bigwig files were downloaded in EN- Primer Name Sequence 5’-3’ CODE (https://www.encodeproject.org/) [39, CCND1 Forward GCTGCGAAGTGGAAACCATC 40] and visualized using IGV (Integrative Ge- nomics Viewer) software. CCND1 Reverse CCTCCTTCTGCACACATTTGAA CDK4 Forward GGACATGTGGAGTGTTGGCT RNA isolation and real time qPCR CDK4 Reverse CAACTGGTCGGCTTCAGAGT NFYA Forward CAGTGGAGGCCAGCTAATCAC Total RNA was purified using RNA Quick NFYA Reverse CCAGGTGGGACCAACTGTATT Purification kit (ESscience) according to the c-Myc Forward GTCAAGAGGCGAACACACAAC standard protocol. cDNA was synthesized with c-Myc Reverse TTGGACGGACAGGATGTATGC PrimerScript RT-PCR kit (Takara). The cDNA GAPDH Forward CGACCACTTTGTCAAGCTCA templates were amplified using CFX96 real GAPDH Reverse TTACTCCTTGGAGGCCATGT time instrument (Biorad). The expression of -ΔΔCt Abbreviations: CCND1: cyclin D1. each gene was calculated using the 2 meth- od. GAPDH was used as the internal control. The qPCR primers are listed in Table 1. harvested at the specific time (0, 15, 20 and 25 hours) and fixed in 70% ice-cold ethanol over- Western blot night. Cell cycle distribution was subsequently analyzed as previously described. Western blot was performed as previously described [41, 42]. Primary antibodies specific RNA-sequencing to CDK4 (CST, mouse), CCND1 (CST, mouse), RB (CST, mouse), p-RB S795 (CST, rabbit), p-RB To explore the transcriptome changes after S807/811 (CST, rabbit), C-Myc (Transgene, NFYA knockdown, ACHN, 769P