DOCSLIB.ORG

Cartera De Servicios 2017

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cartera De Servicios 2017 Nº Proceso CODIGO INGEMM NOMBRE Nombre que aparecerá de la Prueba (para la cabecera del informe) URVCOSTE (1) IVA no incluidoCOSTE (2) Sección 5 00 PREANALITICA 10 PROC-A-Preanalitica PRUIN0000008 Muestra de sangre primaria para guardar sin extracción de ADN Muestra de sangre primaria para guardar sin extracción de ADN 2 2 2 Preanalitica 12 PROC-A-Preanalitica PRUIN0000010 Extracción de ADN para guardar (segundo tubo) Extracción de ADN para guardar (segundo tubo) 2 16 16 Preanalitica 15 PROC-A-Preanalitica PRUIN0000030 Extracción de ADN para guardar y no analizar (primer tubo) Extracción de ADN para guardar y no analizar (primer tubo) 2 16 16 Preanalitica 20 PROC-A-Preanalitica PRUIN0000050 Extracción de ADN de sangre periférica Extracción de ADN de sangre periférica 2 16 16 Preanalitica 25 PROC-A-Preanalitica PRUIN0000100 Extracción de ADN de sangre fetal Extracción de ADN de sangre fetal 2 16 16 Preanalitica 30 PROC-A-Preanalitica PRUIN0000200 Extracción de ADN de líquido amniótico Extracción de ADN de líquido amniótico 3 20 20 Preanalitica 35 PROC-A-Preanalitica PRUIN0000300 Extracción de ADN de tejidos (incluyendo biopsia corial) Extracción de ADN de tejidos (incluyendo biopsia corial) 3 25 25 Preanalitica 40 PROC-A-Preanalitica PRUIN0000400 Extracción de ADN otros fluidos orgánicos Extracción de ADN otros fluidos orgánicos 2 35 35 Preanalitica 45 PROC-A-Preanalitica PRUIN0000500 Extracción de ADN de saliva (Oragene) Extracción de ADN de saliva (Oragene) 3 40 40 Preanalitica 50 PROC-A-Preanalitica PRUIN0000600 Extracción de ADN de parafina Extracción de ADN de parafina 3 40 40 Preanalitica 55 PROC-A-Preanalitica PRUIN0000610 Extracción de ADN circulante fetal en sangre periférica Extracción de ADN circulante fetal en sangre periférica 5 50 50 Preanalitica 60 PROC-A-Preanalitica PRUIN0000620 Extracción de ADN tumoral en sangre periférica Extracción de ADN tumoral en sangre periférica 5 50 50 Preanalitica 65 PROC-A-Preanalitica PRUIN0001010 Extracción de ARN de sangre periférica Extracción de ARN de sangre periférica 5 30 30 Preanalitica 70 PROC-A-Preanalitica PRUIN0001100 Extracción de ARN de sangre fetal Extracción de ARN de sangre fetal 5 30 30 Preanalitica 75 PROC-A-Preanalitica PRUIN0001200 Extracción de ARN de líquido amniótico Extracción de ARN de líquido amniótico 5 17 17 Preanalitica 80 PROC-A-Preanalitica PRUIN0001300 Extracción de ARN de tejidos (incluyendo biopsia corial) Extracción de ARN de tejidos (incluyendo biopsia corial) 5 25 25 Preanalitica 85 PROC-A-Preanalitica PRUIN0001400 Extracción de ARN de otros fluidos orgánicos Extracción de ARN de otros fluidos orgánicos 5 35 35 Preanalitica 90 PROC-A-Preanalitica PRUIN0001500 Extracción de ARN de saliva (Oragene) Extracción de ARN de saliva (Oragene) 5 40 40 Preanalitica 95 PROC-A-Preanalitica PRUIN0001600 Extracción de ARN de parafina Extracción de ARN de parafina 6 40 40 Preanalitica 100 PROC-A-Preanalitica PRUIN0001610 Extracción de ARN circulante fetal en sangre periférica Extracción de ARN circulante fetal en sangre periférica 5 50 50 Preanalitica 105 PROC-A-Preanalitica PRUIN0001620 Extracción de ARN tumoral en sangre periférica Extracción de ARN tumoral en sangre periférica 5 50 50 Preanalitica 110 PROC-A-Preanalitica PRUIN0002010 Extracción de proteínas de sangre periférica Extracción de proteínas de sangre periférica 5 50 50 Preanalitica 115 PROC-A-Preanalitica PRUIN0002100 Extracción de proteínas de tejidos Extracción de proteínas de tejidos 6 50 50 Preanalitica 120 PROC-A-Preanalitica PRUIN0002200 Extracción de proteínas de parafina Extracción de proteínas de parafina 6 50 50 Preanalitica 125 PROC-A-Preanalitica PRUIN0003010 Extracción de plasma de sangre periférica Extracción de plasma de sangre periférica 3 50 50 Preanalitica 130 135 01 GENETICA CLINICA 140 PROC-B-GenClin PRUIN0100000 Consulta de evaluación dismorfológica Consulta de evaluación dismorfológica 20 150 150 Genética Clínica 145 PROC-B-GenClin PRUIN0105000 Consulta consejo genético prenatal Consulta consejo genético prenatal 10 150 150 Genética Clínica 150 PROC-B-GenClin PRUIN0110000 Consulta consejo genético postnatal Consulta consejo genético postnatal 15 150 150 Genética Clínica 155 PROC-B-GenClin PRUIN0115000 Consulta consejo genético de cáncer familiar Consulta consejo genético cáncer familiar 15 150 150 Genética Clínica 160 PROC-B-GenClin PRUIN0120000 Consulta asesoramiento para parejas esterilidad/Infertilidad/abortosConsulta consejo parejas esterilidad/Infertilidad/abortos 10 150 150 Genética Clínica 165 PROC-B-GenClin PRUIN0125000 Consulta de enfermedades metabólicas Consulta de enfermedades metabólicas 20 150 150 Genética Clínica 170 PROC-B-GenClin PRUIN0130000 Consulta Interdisciplinaria de Dermatología/Genética Consulta Interdisciplinaria de Dermatología/Genética 20 150 150 Genética Clínica 175 PROC-B-GenClin PRUIN0135000 Consulta de Farmacogenética-Farmacogenómica Consulta de Farmacogenética-Farmacogenómica 15 150 150 Genética Clínica 180 PROC-B-GenClin PRUIN0140000 Consulta de Displasias Esqueléticas Consulta Monográfica de Displasias Esqueléticas 20 150 150 Genética Clínica 185 PROC-B-GenClin PRUIN0150000 Consulta rápida de Genética Clínica Consulta de Asesoramiento Genético 20 100 100 Genética Clínica 190 195 02 CITOGENETICA 200 02.1 CITOGENETICA POSTNATAL CONVENCIONAL 205 PROC-D-CitPost PRUIN0212000 Estudio citogenético en sangre periférica con técnicas de bandas GTLEstudio : Cariotipo citogenético (20 metafases) en sangre periférica con técnicas de bandas GTL : Cariotipo5 (20 metafases) 125 125 Citogenética 210 PROC-D-CitPost PRUIN0213000 Estudio citogenético en sangre periférica con técnicas de bandas GTL:Estudio Cariotipo citogenético (50 metafases) en sangre periférica con técnicas de bandas GTL: Cariotipo10 (50 metafases) 150 150 Citogenética 215 PROC-D-CitPost PRUIN0214000 Estudio citogenético en sangre periférica con técnicas de bandas GTL:Estudio Cariotipo citogenético (100 metafases) en sangre periférica con técnicas de bandas GTL: Cariotipo20 (100 metafases) 180 180 Citogenética 220 PROC-D-CitPost PRUIN0215000 Estudio citogenético en sangre periférica con técnicas de bandas GTLEstudio de alta citogenético resolución. en sangre periférica con técnicas de bandas GTL de alta5 resolución. 200 200 Citogenética 225 PROC-D-CitPost PRUIN0216000 Aplicación de técnicas citogenéticas específicas: Bandas NOR-Ag Aplicación de técnicas citogenéticas específicas: Bandas NOR-Ag 5 30 30 Citogenética 230 PROC-D-CitPost PRUIN0217000 Cultivo de tejidos (sin realizaciónde cariotipo) Cultivo de tejidos sin realización de cariotipo 15 100 100 Citogenética 235 PROC-D-CitPost PRUIN0218000 Estudio citogenético en tejidos Estudio citogenético en tejidos 15 150 150 Citogenética 240 PROC-D-CitPost PRUIN0219000 Estudio citogenético en otros fluidos Estudio citogenético en otros fluidos 15 125 125 Citogenética 245 PROC-D-CitPost PRUIN0220000 Estudio citogenético en médula ósea con técnicas de bandas GTL :Estudio Cariotipo citogenético (20 metafases) en médula ósea con técnicas de bandas GTL : Cariotipo15 (20 metafases) 150 150 Citogenética 250 PROC-D-CitPost PRUIN0221000 Estudio de cromatina sexual : Cromatina X Estudio de cromatina sexual : Cromatina X 5 60 60 Citogenética 255 02.2 CITOGENETICA PRENATAL CONVENCIONAL 260 PROC-C-CitPren PRUIN0220000 Estudio citogenético en amniocitos con técnicas de bandas GTL: CariotipoEstudio citogenético fetal en amniocitos con técnicas de bandas GTL :Cariotipo fetal8 200 150 Citogenética 265 PROC-C-CitPren PRUIN0225000 Estudio citogenético en vellosidades coriónicas con técnicas de bandasEstudio GTL: citogenético Cariotipo enfetal vellosidades coriónicas con técnicas de bandas GTL 10: Cariotipo fetal 200 150 Citogenética 270 PROC-C-CitPren PRUIN0230000 Estudio citogenético en restos abortivos con técnicas de bandas GTL:Estudio Cariotipo citogenético fetal en restos abortivos con técnicas de bandas GTL : Cariotipo8 fetal 200 150 Citogenética 275 PROC-C-CitPren PRUIN0235000 Estudio citogenético en sangre fetal con técnicas de bandas GTL: CariotipoEstudio citogenético fetal en sangre fetal con técnicas de bandas GTL :Cariotipo fetal5 125 125 Citogenética 280 PROC-C-CitPren PRUIN0240000 Aplicación de técnicas citogenéticas específicas: Bandas CBG Aplicación de técnicas citogenéticas específicas: Bandas CBG 5 30 125 Citogenética 285 PROC-C-CitPren PRUIN0245000 Aplicación de técnicas citogenéticas específicas: Bandas NOR-Ag Aplicación de técnicas citogenéticas específicas: Bandas NOR-Ag 5 30 12 Citogenética 290 02.3 CITOGENETICA MOLECULAR-FISH 295 PROC-E-CitMolFISH PRUIN0230020 Estudio por FISH en núcleos de amniocitos sin cultivar: Screening deAmniocitos aneuploidías sin cultivar: mas comunes. Screening de aneuploidías mas comunes. 10 300 300 Citogenética 300 PROC-E-CitMolFISH PRUIN0230040 Estudio por FISH en núcleos de biopsia corial sin cultivar: ScreeningNúcleos de aneuploidias de biopsia mascorial comunes sin cultivar: Screening de aneuploidias mas comunes20 300 300 Citogenética 305 PROC-E-CitMolFISH PRUIN0230060 Estudio por FISH en núcleos de amniocitos cultivados: Screening deNúcleos aneuploidias de amniocitos mas comunes cultivados: Screening de aneuploidias mas comunes 10 200 200 Citogenética 310 PROC-E-CitMolFISH PRUIN0230080 Estudio por FISH en metafases de amniocitos cultivados : ScreeningMetafases de aneuploidias de amniocitos mas comunes cultivados : Screening de aneuploidias mas comunes10 200 200 Citogenética 315 PROC-E-CitMolFISH PRUIN0230100 Estudio por FISH en metafases de biopsia corial cultivada : ScreeningMetafases de aneuploidias
Load more

Recommended publications
  • UNIVERSITY of CALIFORNIA RIVERSIDE Investigations Into The
    UNIVERSITY OF CALIFORNIA RIVERSIDE Investigations into the Role of TAF1-mediated Phosphorylation in Gene Regulation A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Cell, Molecular and Developmental Biology by Brian James Gadd December 2012 Dissertation Committee: Dr. Xuan Liu, Chairperson Dr. Frank Sauer Dr. Frances M. Sladek Copyright by Brian James Gadd 2012 The Dissertation of Brian James Gadd is approved Committee Chairperson University of California, Riverside Acknowledgments I am thankful to Dr. Liu for her patience and support over the last eight years. I am deeply indebted to my committee members, Dr. Frank Sauer and Dr. Frances Sladek for the insightful comments on my research and this dissertation. Thanks goes out to CMDB, especially Dr. Bachant, Dr. Springer and Kathy Redd for their support. Thanks to all the members of the Liu lab both past and present. A very special thanks to the members of the Sauer lab, including Silvia, Stephane, David, Matt, Stephen, Ninuo, Toby, Josh, Alice, Alex and Flora. You have made all the years here fly by and made them so enjoyable. From the Sladek lab I want to thank Eugene, John, Linh and Karthi. Special thanks go out to all the friends I’ve made over the years here. Chris, Amber, Stephane and David, thank you so much for feeding me, encouraging me and keeping me sane. Thanks to the brothers for all your encouragement and prayers. To any I haven’t mentioned by name, I promise I haven’t forgotten all you’ve done for me during my graduate years.
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]
  • Antibody List
    產品編號 產品名稱 PA569955 1110059E24Rik Polyclonal Antibody PA569956 1110059E24Rik Polyclonal Antibody PA570131 1190002N15Rik Polyclonal Antibody 01-1234-42 123count eBeads Counting Beads MA512242 14.3.3 Pan Monoclonal Antibody (CG15) LFMA0074 14-3-3 beta Monoclonal Antibody (60C10) LFPA0077 14-3-3 beta Polyclonal Antibody PA137002 14-3-3 beta Polyclonal Antibody PA14647 14-3-3 beta Polyclonal Antibody PA515477 14-3-3 beta Polyclonal Antibody PA517425 14-3-3 beta Polyclonal Antibody PA522264 14-3-3 beta Polyclonal Antibody PA529689 14-3-3 beta Polyclonal Antibody MA134561 14-3-3 beta/epsilon/zeta Monoclonal Antibody (3C8) MA125492 14-3-3 beta/zeta Monoclonal Antibody (22-IID8B) MA125665 14-3-3 beta/zeta Monoclonal Antibody (4E2) 702477 14-3-3 delta/zeta Antibody (1H9L19), ABfinity Rabbit Monoclonal 711507 14-3-3 delta/zeta Antibody (1HCLC), ABfinity Rabbit Oligoclonal 702241 14-3-3 epsilon Antibody (5H10L5), ABfinity Rabbit Monoclonal 711273 14-3-3 epsilon Antibody (5HCLC), ABfinity Rabbit Oligoclonal PA517104 14-3-3 epsilon Polyclonal Antibody PA528937 14-3-3 epsilon Polyclonal Antibody PA529773 14-3-3 epsilon Polyclonal Antibody PA575298 14-3-3 eta (Lys81) Polyclonal Antibody MA524792 14-3-3 eta Monoclonal Antibody PA528113 14-3-3 eta Polyclonal Antibody PA529774 14-3-3 eta Polyclonal Antibody PA546811 14-3-3 eta Polyclonal Antibody MA116588 14-3-3 gamma Monoclonal Antibody (HS23) MA116587 14-3-3 gamma Monoclonal Antibody (KC21) PA529690 14-3-3 gamma Polyclonal Antibody PA578233 14-3-3 gamma Polyclonal Antibody 510700 14-3-3 Pan Polyclonal
    [Show full text]
  • WO2019226953A1.Pdf
    ) ( 2 (51) International Patent Classification: Street, Brookline, MA 02446 (US). WILSON, Christo¬ C12N 9/22 (2006.01) pher, Gerard; 696 Main Street, Apartment 311, Waltham, MA 0245 1(US). DOMAN, Jordan, Leigh; 25 Avon Street, (21) International Application Number: Somverville, MA 02143 (US). PCT/US20 19/033 848 (74) Agent: HEBERT, Alan, M. et al. ;Wolf, Greenfield, Sacks, (22) International Filing Date: P.C., 600 Atlanitc Avenue, Boston, MA 02210-2206 (US). 23 May 2019 (23.05.2019) (81) Designated States (unless otherwise indicated, for every (25) Filing Language: English kind of national protection av ailable) . AE, AG, AL, AM, (26) Publication Language: English AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (30) Priority Data: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, 62/675,726 23 May 2018 (23.05.2018) US HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, 62/677,658 29 May 2018 (29.05.2018) US KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (71) Applicants: THE BROAD INSTITUTE, INC. [US/US]; MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 415 Main Street, Cambridge, MA 02142 (US). PRESI¬ OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, DENT AND FELLOWS OF HARVARD COLLEGE SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, [US/US]; 17 Quincy Street, Cambridge, MA 02138 (US).
    [Show full text]
  • Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2013 Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance Alyssa Lea MacMillan University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Virology Commons Recommended Citation MacMillan, Alyssa Lea, "Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance" (2013). Publicly Accessible Penn Dissertations. 894. https://repository.upenn.edu/edissertations/894 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/894 For more information, please contact [email protected]. Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance Abstract APOBEC3 proteins are important for antiretroviral defense in mammals. The activity of these factors has been well characterized in vitro, identifying cytidine deamination as an active source of viral restriction leading to hypermutation of viral DNA synthesized during reverse transcription. These mutations can result in viral lethality via disruption of critical genes, but in some cases is insufficiento t completely obstruct viral replication. This sublethal level of mutagenesis could aid in viral evolution. A cytidine deaminase-independent mechanism of restriction has also been identified, as catalytically inactive proteins are still able to inhibit infection in vitro. Murine retroviruses do not exhibit characteristics of hypermutation by mouse APOBEC3 in vivo. However, human APOBEC3G protein expressed in transgenic mice maintains antiviral restriction and actively deaminates viral genomes. The mechanism by which endogenous APOBEC3 proteins function is unclear. The mouse provides a system amenable to studying the interaction of APOBEC3 and retroviral targets in vivo.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins
    microorganisms Review Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins Yoshiyuki Hakata 1,* and Masaaki Miyazawa 1,2 1 Department of Immunology, Kindai University Faculty of Medicine, 377-2 Ohno-Higashi, Osaka-Sayama, Osaka 589-8511, Japan; [email protected] 2 Kindai University Anti-Aging Center, 3-4-1 Kowakae, Higashiosaka, Osaka 577-8502, Japan * Correspondence: [email protected]; Tel.: +81-72-367-7660 Received: 8 December 2020; Accepted: 9 December 2020; Published: 12 December 2020 Abstract: Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3 (APOBEC3) proteins (APOBEC3s) are deaminases that convert cytosines to uracils predominantly on a single-stranded DNA, and function as intrinsic restriction factors in the innate immune system to suppress replication of viruses (including retroviruses) and movement of retrotransposons. Enzymatic activity is supposed to be essential for the APOBEC3 antiviral function. However, it is not the only way that APOBEC3s exert their biological function. Since the discovery of human APOBEC3G as a restriction factor for HIV-1, the deaminase-independent mode of action has been observed. At present, it is apparent that both the deaminase-dependent and -independent pathways are tightly involved not only in combating viruses but also in human tumorigenesis. Although the deaminase-dependent pathway has been extensively characterized so far, understanding of the deaminase-independent pathway remains immature. Here, we review existing knowledge regarding the deaminase-independent antiretroviral functions of APOBEC3s and their molecular mechanisms. We also discuss the possible unidentified molecular mechanism for the deaminase-independent antiretroviral function mediated by mouse APOBEC3. Keywords: APOBEC3; deaminase-independent antiretroviral function; innate immunity 1.
    [Show full text]
  • 1 APOBEC-Mediated Mutagenesis in Urothelial Carcinoma Is Associated
    bioRxiv preprint doi: https://doi.org/10.1101/123802; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. APOBEC-mediated mutagenesis in urothelial carcinoma is associated with improved survival, mutations in DNA damage response genes, and immune response Alexander P. Glaser MD, Damiano Fantini PhD, Kalen J. Rimar MD, Joshua J. Meeks MD PhD APG, DF, KJR, JJM: Northwestern University, Department of Urology, Chicago, IL, 60607 Running title: APOBEC mutagenesis in bladder cancer *Corresponding author: Joshua J. Meeks, MD PhD 303 E. Chicago Ave. Tarry 16-703 Chicago, IL 60611 Email: [email protected] Keywords (4-6): • Urinary bladder neoplasms • APOBEC Deaminases • Mutagenesis • DNA damage • Interferon Abbreviations and Acronyms: TCGA – The Cancer Genome Atlas ssDNA – single stranded DNA APOBEC –apolipoprotein B mRNA editing catalytic polypeptide-like GCAC – Genome Data Analysis Center MAF – mutation annotation format “APOBEC-high” – tumors enriched for APOBEC mutagenesis “APOBEC-low” – tumors not enriched for APOBEC mutagenesis 1 bioRxiv preprint doi: https://doi.org/10.1101/123802; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: Background: The APOBEC family of enzymes is responsible for a mutation signature characterized by a TCW>T/G mutation. APOBEC-mediated mutagenesis is implicated in a wide variety of tumors, including bladder cancer. In this study, we explore the APOBEC mutational signature in bladder cancer and the relationship with specific mutations, molecular subtype, gene expression, and survival.
    [Show full text]
  • Insights Into the Structures and Multimeric Status of APOBEC Proteins Involved in Viral Restriction and Other Cellular Functions
    viruses Review Insights into the Structures and Multimeric Status of APOBEC Proteins Involved in Viral Restriction and Other Cellular Functions Xiaojiang S. Chen 1,2,3 1 Molecular and Computational Biology, Departments of Biological Sciences, Chemistry, University of Southern California, Los Angeles, CA 90089, USA; [email protected]; Tel.: +1-213-740-5487 2 Genetic, Molecular and Cellular Biology Program, Keck School of Medicine, Norris Comprehensive Cancer Center, University of Southern California, Los Angeles, CA 90089, USA 3 Center of Excellence in NanoBiophysics/Structural Biology, University of Southern California, Los Angeles, CA 90089, USA Abstract: Apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) proteins belong to a family of deaminase proteins that can catalyze the deamination of cytosine to uracil on single- stranded DNA or/and RNA. APOBEC proteins are involved in diverse biological functions, including adaptive and innate immunity, which are critical for restricting viral infection and endogenous retroelements. Dysregulation of their functions can cause undesired genomic mutations and RNA modification, leading to various associated diseases, such as hyper-IgM syndrome and cancer. This review focuses on the structural and biochemical data on the multimerization status of individual APOBECs and the associated functional implications. Many APOBECs form various multimeric complexes, and multimerization is an important way to regulate functions for some of these proteins at several levels, such as deaminase activity, protein stability, subcellular localization, protein storage Citation: Chen, X.S. Insights into and activation, virion packaging, and antiviral activity. The multimerization of some APOBECs is the Structures and Multimeric Status more complicated than others, due to the associated complex RNA binding modes.
    [Show full text]
  • NMR Structure of Human Restriction Factor APOBEC3A Reveals Substrate Binding and Enzyme Specificity
    ARTICLE Received 29 Jan 2013 | Accepted 12 Apr 2013 | Published 21 May 2013 DOI: 10.1038/ncomms2883 NMR structure of human restriction factor APOBEC3A reveals substrate binding and enzyme specificity In-Ja L. Byeon1,2, Jinwoo Ahn1,2, Mithun Mitra3, Chang-Hyeock Byeon1,2, Kamil Hercı´k3,w, Jozef Hritz1,w, Lisa M. Charlton1,2, Judith G. Levin3,* & Angela M. Gronenborn1,2,* Human APOBEC3A is a single-stranded DNA cytidine deaminase that restricts viral patho- gens and endogenous retrotransposons, and has a role in the innate immune response. Furthermore, its potential to act as a genomic DNA mutator has implications for a role in carcinogenesis. A deeper understanding of APOBEC3A’s deaminase and nucleic acid-binding properties, which is central to its biological activities, has been limited by the lack of structural information. Here we report the nuclear magnetic resonance solution structure of APOBEC3A and show that the critical interface for interaction with single-stranded DNA substrates includes residues extending beyond the catalytic centre. Importantly, by monitoring deami- nase activity in real time, we find that A3A displays similar catalytic activity on APOBEC3A- specific TTCA- or A3G-specific CCCA-containing substrates, involving key determinants immediately 50 of the reactive C. Our results afford novel mechanistic insights into APOBEC3A-mediated deamination and provide the structural basis for further molecular studies. 1 Department of Structural Biology, University of Pittsburgh School of Medicine, 3501 Fifth Avenue, Pittsburgh, PA 15261, USA. 2 Pittsburgh Center for HIV Protein Interactions, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261, USA. 3 Section on Viral Gene Regulation, Program on Genomics of Differentiation, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892- 2780, USA.
    [Show full text]
  • Broad-Spectrum Antiviral That Interferes with De Novo Pyrimidine Biosynthesis
    Broad-spectrum antiviral that interferes with de novo pyrimidine biosynthesis Hans-Heinrich Hoffmanna, Andrea Kunza,b,1, Viviana A. Simona,b,c, Peter Palesea,b,2, and Megan L. Shawa,2 aDepartment of Microbiology, bDepartment of Medicine, and cGlobal Health and Emerging Pathogens Institute, Mount Sinai School of Medicine, New York, NY 10029 Edited by Thomas E. Shenk, Princeton University, Princeton, NJ, and approved February 25, 2011 (received for review February 4, 2011) Compound A3 was identified in a high-throughput screen for Favipiravir (T-705), which is currently in Phase III trials in inhibitors of influenza virus replication. It displays broad-spectrum Japan, also displays broad-spectrum antiviral activity, but only antiviral activity, and at noncytotoxic concentrations it is shown to among RNA viruses. In vivo efficacy has been demonstrated for inhibit the replication of negative-sense RNA viruses (influenza influenza viruses (A, B, and C), flaviviruses (West Nile virus, viruses A and B, Newcastle disease virus, and vesicular stomatitis Yellow Fever virus), bunyaviruses (Punta Toro virus, Rift Valley virus), positive-sense RNA viruses (Sindbis virus, hepatitis C virus, fever), arenaviruses (Pichinde virus), and picornaviruses (foot- West Nile virus, and dengue virus), DNA viruses (vaccinia virus and and-mouth disease virus) (11, 12). T-705 is converted to the human adenovirus), and retroviruses (HIV). In contrast to mamma- ribofuranosyl triphosphate form by host cell enzymes, and it was lian cells, inhibition of viral replication by A3 is absent in chicken shown that the antiviral activity of T-705 can be reversed by an cells, which suggests species-specific activity of A3.
    [Show full text]
  • Polymorphisms in Human APOBEC3H Differentially Regulate Ubiquitination and Antiviral Activity
    viruses Article Polymorphisms in Human APOBEC3H Differentially Regulate Ubiquitination and Antiviral Activity Nicholas M. Chesarino and Michael Emerman * Divisions of Human Biology and Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA 98109, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-206-667-5058; Fax: +1-206-667-6523 Received: 7 February 2020; Accepted: 27 March 2020; Published: 30 March 2020 Abstract: The APOBEC3 family of cytidine deaminases are an important part of the host innate immune defense against endogenous retroelements and retroviruses like Human Immunodeficiency Virus (HIV). APOBEC3H (A3H) is the most polymorphic of the human APOBEC3 genes, with four major haplotypes circulating in the population. Haplotype II is the only antivirally-active variant of A3H, while the majority of the population possess independently destabilizing polymorphisms present in haplotype I (R105G) and haplotypes III and IV (N15del). In this paper, we show that instability introduced by either polymorphism is positively correlated with degradative ubiquitination, while haplotype II is protected from this modification. Inhibiting ubiquitination by mutating all of the A3H lysines increased the expression of haplotypes III and IV, but these stabilized forms of haplotype III and IV had a strict nuclear localization, and did not incorporate into virions, nor exhibit antiviral activity. Fusion chimeras with haplotype II allowed for stabilization, cytoplasmic retention, and packaging of the N15del-containing haplotype III, but the haplotype III component of these chimeras was unable to restrict HIV-1 on its own. Thus, the evolutionary loss of A3H activity in many humans involves functional deficiencies independent of protein stability. Keywords: APOBEC3H; ubiquitination; restriction factors; HIV 1.
    [Show full text]