DOCSLIB.ORG

Broad-Spectrum Antiviral That Interferes with De Novo Pyrimidine Biosynthesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Broad-Spectrum Antiviral That Interferes with De Novo Pyrimidine Biosynthesis Broad-spectrum antiviral that interferes with de novo pyrimidine biosynthesis Hans-Heinrich Hoffmanna, Andrea Kunza,b,1, Viviana A. Simona,b,c, Peter Palesea,b,2, and Megan L. Shawa,2 aDepartment of Microbiology, bDepartment of Medicine, and cGlobal Health and Emerging Pathogens Institute, Mount Sinai School of Medicine, New York, NY 10029 Edited by Thomas E. Shenk, Princeton University, Princeton, NJ, and approved February 25, 2011 (received for review February 4, 2011) Compound A3 was identified in a high-throughput screen for Favipiravir (T-705), which is currently in Phase III trials in inhibitors of influenza virus replication. It displays broad-spectrum Japan, also displays broad-spectrum antiviral activity, but only antiviral activity, and at noncytotoxic concentrations it is shown to among RNA viruses. In vivo efficacy has been demonstrated for inhibit the replication of negative-sense RNA viruses (influenza influenza viruses (A, B, and C), flaviviruses (West Nile virus, viruses A and B, Newcastle disease virus, and vesicular stomatitis Yellow Fever virus), bunyaviruses (Punta Toro virus, Rift Valley virus), positive-sense RNA viruses (Sindbis virus, hepatitis C virus, fever), arenaviruses (Pichinde virus), and picornaviruses (foot- West Nile virus, and dengue virus), DNA viruses (vaccinia virus and and-mouth disease virus) (11, 12). T-705 is converted to the human adenovirus), and retroviruses (HIV). In contrast to mamma- ribofuranosyl triphosphate form by host cell enzymes, and it was lian cells, inhibition of viral replication by A3 is absent in chicken shown that the antiviral activity of T-705 can be reversed by an cells, which suggests species-specific activity of A3. Correspond- excess of purines (13). Nevertheless, the mechanism of T-705 is ingly, the antiviral activity of A3 can be linked to a cellular protein, not fully understood. It does not affect the synthesis of cellular dihydroorotate dehydrogenase (DHODH), which is an enzyme in DNA or RNA (13, 14), and may therefore target viral RNA- the de novo pyrimidine biosynthesis pathway. Viral replication of dependent RNA polymerases directly or may be preferentially both RNA and DNA viruses can be restored in the presence of excess incorporated into viral RNA, thereby causing hypermutations. uracil, which promotes pyrimidine salvage, or excess orotic acid, Brequinar was described as a broad-spectrum antiviral agent ca- which is the product of DHODH in the de novo pyrimidine bio- pable of inhibiting both negative- and positive-strand RNA viruses synthesis pathway. Based on these findings, it is proposed that A3 (15), and leflunomide and a derivative, FK778, have been repor- acts by depleting pyrimidine pools, which are crucial for efficient ted to inhibit human cytomegalovirus (HCMV) and herpes sim- virus replication. plex virus 1 (HSV-1) (16–19). This group of compounds all target the cellular enzyme dihydroorotate dehydrogenase (DHODH) (20–22), although leflunomide shows the weakest activity against mall-molecular-weight compounds with antiviral activity can this enzyme (23). DHODH is a key player in the pyrimidine de act by inhibiting viral proteins or host cell proteins that are S novo biosynthesis pathway and converts dihydroorotate (DHO) required for virus replication. Although drugs directed at viral into orotate (24). Both the pyrimidine de novo biosynthesis proteins are more virus specific, they can easily lead to the se- pathway and the uracil salvage pathway channel into the pro- lection of resistant mutants. For example, the use of adamant- duction of uridine monophosphate (UMP) (25), which is the anes which target the M2 ion channel of influenza A viruses is precursor for all pyrimidine nucleotides needed for RNA (UTP, now precluded due to wide-spread resistance (1, 2). By targeting CTP) and DNA (dTTP, dCTP) synthesis. Leflunomide (Arava) is host cell proteins, resistance is less likely to occur, and if that a Food and Drug Administration (FDA)-approved therapy for protein is necessary for replication of a variety of different vi- rheumatoid arthritis, and its immunosuppressive properties are ruses, broad-spectrum antiviral activity can be achieved. Such related to inhibition of T-cell proliferation, which is heavily reliant compounds are presumed to be more prone to toxicity, and it is on pyrimidine pools (26). Virus replication is also dependent on important to identify targets that are not critical for cell growth large nucleotide pools, and therefore the antiviral activity of these but that are absolutely essential for the virus. compounds is likely due to pyrimidine depletion. Recently, two small molecules were reported, LJ-001 (3) and Here we report that the small-molecular-weight compound dUY11 (4), that demonstrate broad antiviral activity against all A3, which was identified in a previously reported influenza virus enveloped viruses. These so-called rigid amphiphiles resemble high-throughput screen (27), possesses broad-spectrum activity phospholipids and are incorporated into viral membranes, where against RNA-, DNA-, and retroviruses and acts by targeting they modulate the membrane curvature needed for the mem- pyrimidine metabolism. brane fusion event and they therefore inhibit viral entry. The fi virus speci city of these compounds takes advantage of struc- Results tural differences in virion membranes versus cellular membranes Antiviral Activity of Compound A3. Approximately 61,600 com- and also the lack of repair mechanisms for viral membranes. To mercial, small-molecular-weight compounds were screened in date, the only approved broad-spectrum antiviral that is effective duplicate in a high-throughput screen (HTS) assay described against both RNA and DNA viruses is ribavirin (5), which is currently used in combination with IFN for hepatitis C therapy (6). Ribavirin is a ribosyl purine analog, the carboxamide group of which can resemble adenosine or guanosine, depending on its Author contributions: H.-H.H., P.P., and M.L.S. designed research; H.-H.H. and A.K. per- formed research; A.K. and V.A.S. contributed new reagents/analytic tools; H.-H.H., A.K., rotation. As a prodrug, it is sequentially phosphorylated by cel- V.A.S., P.P., and M.L.S. analyzed data; and H.-H.H., V.A.S., and M.L.S. wrote the paper. MICROBIOLOGY lular kinases, and all its intermediates such as ribavirin mono- Conflict of interest statement: A provisional patent application has been filed by Mount (RMP), di-(RDP) and triphosphate (RTP) are inhibitors of certain Sinai School of Medicine covering the A3 compound. viral RNA-dependent RNA polymerases (7). RTP is incorporated This article is a PNAS Direct Submission. into RNA and pairs equally well with uracil and cytosine, inducing 1Present address: Institute of Tropical Medicine and International Health, Charité, Univer- lethal hypermutations (8), and RMP has been shown to target sity Medicine Berlin, Berlin 14050, Germany. the cellular inosine monophosphate dehydrogenase (IMPDH) and 2To whom correspondence may be addressed. E-mail: [email protected] or peter. thereby depletes intracellular pools of GTP (9, 10). This lack of [email protected]. GTP may explain the inhibition of DNA viruses, as well as the This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. general cytotoxicity of ribavirin. 1073/pnas.1101143108/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1101143108 PNAS | April 5, 2011 | vol. 108 | no. 14 | 5777–5782 Downloaded by guest on September 28, 2021 A B 1E+8 120 100 1E+7 Fig. 1. Compound A3 and its antiviral activity against influenza A/WSN/33 virus. (A) Chemical 80 structure of compound A3 and its molecular 1E+6 IC50=0.178μM CC50=268μM weight (MW). (B) A549 cells were infected with 60 influenza A/WSN/33 virus (MOI = 0.01) in the 1E+5 ter [pfu/ml] ter presence of increasing concentrations of com- 40 cell viability [%] pound A3. Viral titers were determined at 24 h MW: 356 g/mol viral 1E+4 20 postinfection and the IC50 calculated (left-hand scale, blue curve). Mean of three replicates ± SD 1E+3 0 are shown. Cell viability (CC50) was determined 0.001 0.01 0.1 1 10 100 independently for a 24-h incubation period (right- hand scale, red curve). Mean of five replicates ± compound concentraon [μM] SD are shown. previously (27). Briefly, a compound was defined to be a strong the viral life cycle, leading to the hypothesis that replication and inhibitor of influenza virus replication if the luminescence signal transcription may be targeted. of an influenza virus inducible firefly luciferase reporter was We addressed this question by performing an influenza virus decreased by at least 90% compared with that in untreated cells. minigenome assay to determine whether influenza virus poly- Compound A3 (Fig. 1A) from the Asinex1 library displayed a merase activity is affected by A3. A549 cells were transfected very strong effect on viral replication, such that there was no with expression plasmids for the influenza virus polymerase luminescence detectable. The compound was further evaluated proteins (PB1, PB2, and PA), the nucleoprotein (NP), and the for cytotoxity, and its CC50 in A549 cells was determined to be previously described influenza virus-specific firefly luciferase re- 268 μM over a 24-h incubation period (Fig. 1B). To confirm the porter (27). To normalize for transfection efficiency, a Renilla results of the primary screen, A3 was tested at noncytotoxic luciferase plasmid was cotransfected. Compounds were added at concentrations in viral replication assays performed at an MOI 4 h before transfection and were present for the duration of the of 0.01. A reduction in viral titers of 4 logs was detected at a assay. A3 strongly inhibits influenza virus polymerase function by concentration of 2 μM, and the IC50 over a 24-h replication 98% compared with the DMSO control, without affecting cel- period was determined as 0.178 μM (Fig. 1B). This resulted in lular gene expression as monitored by Renilla luciferase activity a selective index (SI = CC50/IC50) of 1,505, which indicates (Fig.
Load more

Recommended publications
  • UNIVERSITY of CALIFORNIA RIVERSIDE Investigations Into The
    UNIVERSITY OF CALIFORNIA RIVERSIDE Investigations into the Role of TAF1-mediated Phosphorylation in Gene Regulation A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Cell, Molecular and Developmental Biology by Brian James Gadd December 2012 Dissertation Committee: Dr. Xuan Liu, Chairperson Dr. Frank Sauer Dr. Frances M. Sladek Copyright by Brian James Gadd 2012 The Dissertation of Brian James Gadd is approved Committee Chairperson University of California, Riverside Acknowledgments I am thankful to Dr. Liu for her patience and support over the last eight years. I am deeply indebted to my committee members, Dr. Frank Sauer and Dr. Frances Sladek for the insightful comments on my research and this dissertation. Thanks goes out to CMDB, especially Dr. Bachant, Dr. Springer and Kathy Redd for their support. Thanks to all the members of the Liu lab both past and present. A very special thanks to the members of the Sauer lab, including Silvia, Stephane, David, Matt, Stephen, Ninuo, Toby, Josh, Alice, Alex and Flora. You have made all the years here fly by and made them so enjoyable. From the Sladek lab I want to thank Eugene, John, Linh and Karthi. Special thanks go out to all the friends I’ve made over the years here. Chris, Amber, Stephane and David, thank you so much for feeding me, encouraging me and keeping me sane. Thanks to the brothers for all your encouragement and prayers. To any I haven’t mentioned by name, I promise I haven’t forgotten all you’ve done for me during my graduate years.
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]
  • Antibody List
    產品編號 產品名稱 PA569955 1110059E24Rik Polyclonal Antibody PA569956 1110059E24Rik Polyclonal Antibody PA570131 1190002N15Rik Polyclonal Antibody 01-1234-42 123count eBeads Counting Beads MA512242 14.3.3 Pan Monoclonal Antibody (CG15) LFMA0074 14-3-3 beta Monoclonal Antibody (60C10) LFPA0077 14-3-3 beta Polyclonal Antibody PA137002 14-3-3 beta Polyclonal Antibody PA14647 14-3-3 beta Polyclonal Antibody PA515477 14-3-3 beta Polyclonal Antibody PA517425 14-3-3 beta Polyclonal Antibody PA522264 14-3-3 beta Polyclonal Antibody PA529689 14-3-3 beta Polyclonal Antibody MA134561 14-3-3 beta/epsilon/zeta Monoclonal Antibody (3C8) MA125492 14-3-3 beta/zeta Monoclonal Antibody (22-IID8B) MA125665 14-3-3 beta/zeta Monoclonal Antibody (4E2) 702477 14-3-3 delta/zeta Antibody (1H9L19), ABfinity Rabbit Monoclonal 711507 14-3-3 delta/zeta Antibody (1HCLC), ABfinity Rabbit Oligoclonal 702241 14-3-3 epsilon Antibody (5H10L5), ABfinity Rabbit Monoclonal 711273 14-3-3 epsilon Antibody (5HCLC), ABfinity Rabbit Oligoclonal PA517104 14-3-3 epsilon Polyclonal Antibody PA528937 14-3-3 epsilon Polyclonal Antibody PA529773 14-3-3 epsilon Polyclonal Antibody PA575298 14-3-3 eta (Lys81) Polyclonal Antibody MA524792 14-3-3 eta Monoclonal Antibody PA528113 14-3-3 eta Polyclonal Antibody PA529774 14-3-3 eta Polyclonal Antibody PA546811 14-3-3 eta Polyclonal Antibody MA116588 14-3-3 gamma Monoclonal Antibody (HS23) MA116587 14-3-3 gamma Monoclonal Antibody (KC21) PA529690 14-3-3 gamma Polyclonal Antibody PA578233 14-3-3 gamma Polyclonal Antibody 510700 14-3-3 Pan Polyclonal
    [Show full text]
  • WO2019226953A1.Pdf
    ) ( 2 (51) International Patent Classification: Street, Brookline, MA 02446 (US). WILSON, Christo¬ C12N 9/22 (2006.01) pher, Gerard; 696 Main Street, Apartment 311, Waltham, MA 0245 1(US). DOMAN, Jordan, Leigh; 25 Avon Street, (21) International Application Number: Somverville, MA 02143 (US). PCT/US20 19/033 848 (74) Agent: HEBERT, Alan, M. et al. ;Wolf, Greenfield, Sacks, (22) International Filing Date: P.C., 600 Atlanitc Avenue, Boston, MA 02210-2206 (US). 23 May 2019 (23.05.2019) (81) Designated States (unless otherwise indicated, for every (25) Filing Language: English kind of national protection av ailable) . AE, AG, AL, AM, (26) Publication Language: English AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (30) Priority Data: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, 62/675,726 23 May 2018 (23.05.2018) US HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, 62/677,658 29 May 2018 (29.05.2018) US KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (71) Applicants: THE BROAD INSTITUTE, INC. [US/US]; MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 415 Main Street, Cambridge, MA 02142 (US). PRESI¬ OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, DENT AND FELLOWS OF HARVARD COLLEGE SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, [US/US]; 17 Quincy Street, Cambridge, MA 02138 (US).
    [Show full text]
  • Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2013 Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance Alyssa Lea MacMillan University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Virology Commons Recommended Citation MacMillan, Alyssa Lea, "Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance" (2013). Publicly Accessible Penn Dissertations. 894. https://repository.upenn.edu/edissertations/894 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/894 For more information, please contact [email protected]. Interactions Between APOBEC3 and Murine Retroviruses: Mechanisms of Restriction and Drug Resistance Abstract APOBEC3 proteins are important for antiretroviral defense in mammals. The activity of these factors has been well characterized in vitro, identifying cytidine deamination as an active source of viral restriction leading to hypermutation of viral DNA synthesized during reverse transcription. These mutations can result in viral lethality via disruption of critical genes, but in some cases is insufficiento t completely obstruct viral replication. This sublethal level of mutagenesis could aid in viral evolution. A cytidine deaminase-independent mechanism of restriction has also been identified, as catalytically inactive proteins are still able to inhibit infection in vitro. Murine retroviruses do not exhibit characteristics of hypermutation by mouse APOBEC3 in vivo. However, human APOBEC3G protein expressed in transgenic mice maintains antiviral restriction and actively deaminates viral genomes. The mechanism by which endogenous APOBEC3 proteins function is unclear. The mouse provides a system amenable to studying the interaction of APOBEC3 and retroviral targets in vivo.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins
    microorganisms Review Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins Yoshiyuki Hakata 1,* and Masaaki Miyazawa 1,2 1 Department of Immunology, Kindai University Faculty of Medicine, 377-2 Ohno-Higashi, Osaka-Sayama, Osaka 589-8511, Japan; [email protected] 2 Kindai University Anti-Aging Center, 3-4-1 Kowakae, Higashiosaka, Osaka 577-8502, Japan * Correspondence: [email protected]; Tel.: +81-72-367-7660 Received: 8 December 2020; Accepted: 9 December 2020; Published: 12 December 2020 Abstract: Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3 (APOBEC3) proteins (APOBEC3s) are deaminases that convert cytosines to uracils predominantly on a single-stranded DNA, and function as intrinsic restriction factors in the innate immune system to suppress replication of viruses (including retroviruses) and movement of retrotransposons. Enzymatic activity is supposed to be essential for the APOBEC3 antiviral function. However, it is not the only way that APOBEC3s exert their biological function. Since the discovery of human APOBEC3G as a restriction factor for HIV-1, the deaminase-independent mode of action has been observed. At present, it is apparent that both the deaminase-dependent and -independent pathways are tightly involved not only in combating viruses but also in human tumorigenesis. Although the deaminase-dependent pathway has been extensively characterized so far, understanding of the deaminase-independent pathway remains immature. Here, we review existing knowledge regarding the deaminase-independent antiretroviral functions of APOBEC3s and their molecular mechanisms. We also discuss the possible unidentified molecular mechanism for the deaminase-independent antiretroviral function mediated by mouse APOBEC3. Keywords: APOBEC3; deaminase-independent antiretroviral function; innate immunity 1.
    [Show full text]
  • 1 APOBEC-Mediated Mutagenesis in Urothelial Carcinoma Is Associated
    bioRxiv preprint doi: https://doi.org/10.1101/123802; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. APOBEC-mediated mutagenesis in urothelial carcinoma is associated with improved survival, mutations in DNA damage response genes, and immune response Alexander P. Glaser MD, Damiano Fantini PhD, Kalen J. Rimar MD, Joshua J. Meeks MD PhD APG, DF, KJR, JJM: Northwestern University, Department of Urology, Chicago, IL, 60607 Running title: APOBEC mutagenesis in bladder cancer *Corresponding author: Joshua J. Meeks, MD PhD 303 E. Chicago Ave. Tarry 16-703 Chicago, IL 60611 Email: [email protected] Keywords (4-6): • Urinary bladder neoplasms • APOBEC Deaminases • Mutagenesis • DNA damage • Interferon Abbreviations and Acronyms: TCGA – The Cancer Genome Atlas ssDNA – single stranded DNA APOBEC –apolipoprotein B mRNA editing catalytic polypeptide-like GCAC – Genome Data Analysis Center MAF – mutation annotation format “APOBEC-high” – tumors enriched for APOBEC mutagenesis “APOBEC-low” – tumors not enriched for APOBEC mutagenesis 1 bioRxiv preprint doi: https://doi.org/10.1101/123802; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: Background: The APOBEC family of enzymes is responsible for a mutation signature characterized by a TCW>T/G mutation. APOBEC-mediated mutagenesis is implicated in a wide variety of tumors, including bladder cancer. In this study, we explore the APOBEC mutational signature in bladder cancer and the relationship with specific mutations, molecular subtype, gene expression, and survival.
    [Show full text]
  • Insights Into the Structures and Multimeric Status of APOBEC Proteins Involved in Viral Restriction and Other Cellular Functions
    viruses Review Insights into the Structures and Multimeric Status of APOBEC Proteins Involved in Viral Restriction and Other Cellular Functions Xiaojiang S. Chen 1,2,3 1 Molecular and Computational Biology, Departments of Biological Sciences, Chemistry, University of Southern California, Los Angeles, CA 90089, USA; [email protected]; Tel.: +1-213-740-5487 2 Genetic, Molecular and Cellular Biology Program, Keck School of Medicine, Norris Comprehensive Cancer Center, University of Southern California, Los Angeles, CA 90089, USA 3 Center of Excellence in NanoBiophysics/Structural Biology, University of Southern California, Los Angeles, CA 90089, USA Abstract: Apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) proteins belong to a family of deaminase proteins that can catalyze the deamination of cytosine to uracil on single- stranded DNA or/and RNA. APOBEC proteins are involved in diverse biological functions, including adaptive and innate immunity, which are critical for restricting viral infection and endogenous retroelements. Dysregulation of their functions can cause undesired genomic mutations and RNA modification, leading to various associated diseases, such as hyper-IgM syndrome and cancer. This review focuses on the structural and biochemical data on the multimerization status of individual APOBECs and the associated functional implications. Many APOBECs form various multimeric complexes, and multimerization is an important way to regulate functions for some of these proteins at several levels, such as deaminase activity, protein stability, subcellular localization, protein storage Citation: Chen, X.S. Insights into and activation, virion packaging, and antiviral activity. The multimerization of some APOBECs is the Structures and Multimeric Status more complicated than others, due to the associated complex RNA binding modes.
    [Show full text]
  • NMR Structure of Human Restriction Factor APOBEC3A Reveals Substrate Binding and Enzyme Specificity
    ARTICLE Received 29 Jan 2013 | Accepted 12 Apr 2013 | Published 21 May 2013 DOI: 10.1038/ncomms2883 NMR structure of human restriction factor APOBEC3A reveals substrate binding and enzyme specificity In-Ja L. Byeon1,2, Jinwoo Ahn1,2, Mithun Mitra3, Chang-Hyeock Byeon1,2, Kamil Hercı´k3,w, Jozef Hritz1,w, Lisa M. Charlton1,2, Judith G. Levin3,* & Angela M. Gronenborn1,2,* Human APOBEC3A is a single-stranded DNA cytidine deaminase that restricts viral patho- gens and endogenous retrotransposons, and has a role in the innate immune response. Furthermore, its potential to act as a genomic DNA mutator has implications for a role in carcinogenesis. A deeper understanding of APOBEC3A’s deaminase and nucleic acid-binding properties, which is central to its biological activities, has been limited by the lack of structural information. Here we report the nuclear magnetic resonance solution structure of APOBEC3A and show that the critical interface for interaction with single-stranded DNA substrates includes residues extending beyond the catalytic centre. Importantly, by monitoring deami- nase activity in real time, we find that A3A displays similar catalytic activity on APOBEC3A- specific TTCA- or A3G-specific CCCA-containing substrates, involving key determinants immediately 50 of the reactive C. Our results afford novel mechanistic insights into APOBEC3A-mediated deamination and provide the structural basis for further molecular studies. 1 Department of Structural Biology, University of Pittsburgh School of Medicine, 3501 Fifth Avenue, Pittsburgh, PA 15261, USA. 2 Pittsburgh Center for HIV Protein Interactions, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261, USA. 3 Section on Viral Gene Regulation, Program on Genomics of Differentiation, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892- 2780, USA.
    [Show full text]
  • Cartera De Servicios 2017
    Nº Proceso CODIGO INGEMM NOMBRE Nombre que aparecerá de la Prueba (para la cabecera del informe) URVCOSTE (1) IVA no incluidoCOSTE (2) Sección 5 00 PREANALITICA 10 PROC-A-Preanalitica PRUIN0000008 Muestra de sangre primaria para guardar sin extracción de ADN Muestra de sangre primaria para guardar sin extracción de ADN 2 2 2 Preanalitica 12 PROC-A-Preanalitica PRUIN0000010 Extracción de ADN para guardar (segundo tubo) Extracción de ADN para guardar (segundo tubo) 2 16 16 Preanalitica 15 PROC-A-Preanalitica PRUIN0000030 Extracción de ADN para guardar y no analizar (primer tubo) Extracción de ADN para guardar y no analizar (primer tubo) 2 16 16 Preanalitica 20 PROC-A-Preanalitica PRUIN0000050 Extracción de ADN de sangre periférica Extracción de ADN de sangre periférica 2 16 16 Preanalitica 25 PROC-A-Preanalitica PRUIN0000100 Extracción de ADN de sangre fetal Extracción de ADN de sangre fetal 2 16 16 Preanalitica 30 PROC-A-Preanalitica PRUIN0000200 Extracción de ADN de líquido amniótico Extracción de ADN de líquido amniótico 3 20 20 Preanalitica 35 PROC-A-Preanalitica PRUIN0000300 Extracción de ADN de tejidos (incluyendo biopsia corial) Extracción de ADN de tejidos (incluyendo biopsia corial) 3 25 25 Preanalitica 40 PROC-A-Preanalitica PRUIN0000400 Extracción de ADN otros fluidos orgánicos Extracción de ADN otros fluidos orgánicos 2 35 35 Preanalitica 45 PROC-A-Preanalitica PRUIN0000500 Extracción de ADN de saliva (Oragene) Extracción de ADN de saliva (Oragene) 3 40 40 Preanalitica 50 PROC-A-Preanalitica PRUIN0000600 Extracción de ADN de
    [Show full text]
  • Polymorphisms in Human APOBEC3H Differentially Regulate Ubiquitination and Antiviral Activity
    viruses Article Polymorphisms in Human APOBEC3H Differentially Regulate Ubiquitination and Antiviral Activity Nicholas M. Chesarino and Michael Emerman * Divisions of Human Biology and Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA 98109, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-206-667-5058; Fax: +1-206-667-6523 Received: 7 February 2020; Accepted: 27 March 2020; Published: 30 March 2020 Abstract: The APOBEC3 family of cytidine deaminases are an important part of the host innate immune defense against endogenous retroelements and retroviruses like Human Immunodeficiency Virus (HIV). APOBEC3H (A3H) is the most polymorphic of the human APOBEC3 genes, with four major haplotypes circulating in the population. Haplotype II is the only antivirally-active variant of A3H, while the majority of the population possess independently destabilizing polymorphisms present in haplotype I (R105G) and haplotypes III and IV (N15del). In this paper, we show that instability introduced by either polymorphism is positively correlated with degradative ubiquitination, while haplotype II is protected from this modification. Inhibiting ubiquitination by mutating all of the A3H lysines increased the expression of haplotypes III and IV, but these stabilized forms of haplotype III and IV had a strict nuclear localization, and did not incorporate into virions, nor exhibit antiviral activity. Fusion chimeras with haplotype II allowed for stabilization, cytoplasmic retention, and packaging of the N15del-containing haplotype III, but the haplotype III component of these chimeras was unable to restrict HIV-1 on its own. Thus, the evolutionary loss of A3H activity in many humans involves functional deficiencies independent of protein stability. Keywords: APOBEC3H; ubiquitination; restriction factors; HIV 1.
    [Show full text]