The Real Meaning of Technological Literacy
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Librarian As Fair Witness: a Comparison of Heinlein's Futuristic
LIBRES Library and Information Science Research Electronic Journal Volume 21, Issue 1, March 2011 Librarian as Fair Witness: A Comparison of Heinlein’s Futuristic Occupation and Today’s Evolving Information Professional Julie M. Still Paul Robeson Library Rutgers University Camden, NJ [email protected] There has been a continuing discussion in library literature on the library as place and on the image of librarians in popular media, but there is little information on the librarian as person. The discussion on librarianship as a profession tends to focus on technology and not so much the people, other than the people skills needed in reference or teaching skills needed for instruction. The worth of the individual librarian tends to get lost in the shuffle. Before we disappear into the machine, it is useful to look at other future scenarios and similar occupations, either reality based or fiction. In this particular case, it is interesting to compare librarians to those in an occupation created by a renowned science fiction author. Robert Heinlein’s Stranger in a Strange Land, his most famous and most controversial novel, is a science fiction classic. The science fiction community recognized it with a Hugo Award, and the book was the first science fiction title to be on the New York Times bestseller list (Stover, 1987, p. 45). Heinlein outlined the novel in 1949 and finished the first draft in 1955 but on the advice of his wife set it aside. It was not published until 1961. The manuscript was edited heavily and an uncut version was published in 1991. -
Grumbles from the Grave
GRUMBLES FROM THE GRAVE Robert A. Heinlein Edited by Virginia Heinlein A Del Rey Book BALLANTINE BOOKS • NEW YORK For Heinlein's Children A Del Rey Book Published by Ballantine Books Copyright © 1989 by the Robert A. and Virginia Heinlein Trust, UDT 20 June 1983 All rights reserved under International and Pan-American Copyright Conventions. Published in the United States by Ballantine Books, a division of Random House, Inc., New York, and simultaneously in Canada by Random House of Canada Limited, Toronto. Grateful acknowledgment is made to the following for permission to reprint the following material: Davis Publications, Inc. Excerpts from ten letters written by John W. Campbell as editor of Astounding Science Fiction. Copyright ® 1989 by Davis Publications, Inc. Putnam Publishing Group: Excerpt from the original manuscript of Podkayne of Mars by Robert A. Heinlein. Copyright ® 1963 by Robert A. Heinlein. Reprinted by permission of the Putnam Publishing Group. Library of Congress Catalog Card Number: 89-6859 ISBN 0-345-36941-6 Manufactured in the United States of America First Hardcover Edition: January 1990 First Mass Market Edition: December 1990 CONTENTS Foreword A Short Biography of Robert A. Heinlein by Virginia Heinlein CHAPTER I In the Beginning CHAPTER II Beginnings CHAPTER III The Slicks and the Scribner's Juveniles CHAPTER IV The Last of the Juveniles CHAPTER V The Best Laid Plans CHAPTER VI About Writing Methods and Cutting CHAPTER VII Building CHAPTER VIII Fan Mail and Other Time Wasters CHAPTER IX Miscellany CHAPTER X Sales and Rejections CHAPTER XI Adult Novels CHAPTER XII Travel CHAPTER XIII Potpourri CHAPTER XIV Stranger CHAPTER XV Echoes from Stranger AFTERWORD APPENDIX A Cuts in Red Planet APPENDIX B Postlude to Podkayne of Mars—Original Version APPENDIX C Heinlein Retrospective, October 6, 1988 Bibliography Index FOREWORD This book does not contain the polished prose one normally associates with the Heinlein stories and articles of later years. -
Acme: a User Interface for Programmers Rob Pike [email protected]−Labs.Com
Acme: A User Interface for Programmers Rob Pike [email protected]−labs.com ABSTRACT A hybrid of window system, shell, and editor, Acme gives text-oriented applications a clean, expressive, and consistent style of interaction. Tradi tional window systems support interactive client programs and offer libraries of pre-defined operations such as pop-up menus and buttons to promote a consistent user interface among the clients. Acme instead pro vides its clients with a fixed user interface and simple conventions to encourage its uniform use. Clients access the facilities of Acme through a file system interface; Acme is in part a file server that exports device-like files that may be manipulated to access and control the contents of its win dows. Written in a concurrent programming language, Acme is structured as a set of communicating processes that neatly subdivide the various aspects of its tasks: display management, input, file server, and so on. Acme attaches distinct functions to the three mouse buttons: the left selects text; the middle executes textual commands; and the right com bines context search and file opening functions to integrate the various applications and files in the system. Acme works well enough to have developed a community that uses it exclusively. Although Acme discourages the traditional style of interaction based on typescript windowsߞteletypesߞits users find Acmeߣs other ser vices render typescripts obsolete. History and motivation The usual typescript style of interaction with Unix and its relatives is an old one. The typescriptߞan intermingling of textual commands and their outputߞoriginates with the scrolls of paper on teletypes. -
Tiny Tools Gerard J
Tiny Tools Gerard J. Holzmann Jet Propulsion Laboratory, California Institute of Technology Many programmers like the convenience of integrated development environments (IDEs) when developing code. The best examples are Microsoft’s Visual Studio for Windows and Eclipse for Unix-like systems, which have both been around for many years. You get all the features you need to build and debug software, and lots of other things that you will probably never realize are also there. You can use all these features without having to know very much about what goes on behind the screen. And there’s the rub. If you’re like me, you want to know precisely what goes on behind the screen, and you want to be able to control every bit of it. The IDEs can sometimes feel as if they are taking over every last corner of your computer, leaving you wondering how much bigger your machine would have to be to make things run a little more smoothly. So what follows is for those of us who don’t use IDEs. It’s for the bare metal programmers, who prefer to write code using their own screen editor, and who do everything else with command-line tools. There are no real conveniences that you need to give up to work this way, but what you gain is a better understanding your development environment, and the control to change, extend, or improve it whenever you find better ways to do things. Bare Metal Programming Many developers who write embedded software work in precisely this way. -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
Revenues 1010 1020 1030 1040 1045 1060 1090 82,958 139,250
FCC Paper Report 43-01 ARMIS Annual Summary Report COMPANY Northern New England Telephone Telephone Operallons LLC ST UDY AREA. New Hempsh1 re PERIOD From: Jan 201 1 To Dec 2011 COSA FPNH A ACCOUNT LEVEL REPORTING (Dollars on thousands) ROW CLASSIFICATION T otal Nonreg AdJu stments Subject To Slate Interstate (a) (b) (C) (d) Separations (g) (h) (f) Revenues 1010 Besoc Local Servoces 82,958 N/A 0 82,958 82,958 0 1020 Network Access Services 139,250 N/A 0 139,250 9,443 129,807 1030 Toil Network Servoces 13,911 N/A 0 13,911 13,881 31 1040 Mosceltaneous 33,250 N/A 0 33,250 22,165 11,084 1045 Nonregutated 7,540 7,540 N/A N/A N/A N/A 1060 Uncoltecllbles 3,597 101 0 3,497 1,615 1,882 1090 Total Operalong Revenues 273,312 7,439 0 265,872 126,832 139,040 Imputation or Dtrectory Revenue 23,300 Total Assessed Revenue 296,612 Assessment 942,999 403,229 Assessment Factor $0.00318 $ 0.0031 8 The revenue data above os avaolable on the FCC ARMIS websote at http)/fjallrossJcc.gov/eafs7/adhoc/table year tal Profile and Historic Information! AT&T Labs! AT&T Page 1 of 5 Personal Business About AT&T ·~ ~ at&t Backgrounder In today's rapidly changing business environment, many of the most exciting innovations are being spearheaded by AT&T Labs, the long-respected research and development arm of AT&T. History The year was 1901...the beginning of a new century. -
{PDF EPUB} the Day After Tomorrow by Robert A. Heinlein Sixth Column (The Day After Tomorrow) by Robert A
Read Ebook {PDF EPUB} The Day After Tomorrow by Robert A. Heinlein Sixth Column (The Day After Tomorrow) by Robert A. Heinlein. Published 1949. Originally published as The Day After Tomorrow by Anson McDonald in Astounding Magazine , (later Analog ),1941. 241 pages (from the Virginia Heinlein edition, based on the 1949 Gnome Press hardback.) Review by Mark Yon. Here’s one of my occasional re-reads of Robert Anson Heinlein’s novels. This one is what they call ‘a fixup’, originally being in three parts in the January, February and March editions of Astounding Magazine , under the editorial tuition of John W. Campbell. It became a slightly revised novel in 1949, with the author’s real name rather than his pseudonym, and a little tidying up. Putting it in the context of Heinlein’s other writing, it was published as a novel after his juvenile book Red Planet and before Farmer in the Sky . As written by Anson McDonald, however, it was not written with the intention of being for the juvenile market, but as something more adult. I found it less satisfying than Red Planet and Farmer in the Sky , its adult voice both uncertain and unreal. It reflects the fact that it was written before Heinlein had had any novels published, and seems a little wobbly both in its concept and its delivery: something which would become much less noticeable as Heinlein becomes more confident in later writing. This lack of success may also be partly due to the fact that Sixth Column was based upon an idea given to Heinlein from Campbell, the only major work of Heinlein’s career to be plotted by someone else. -
Sam Quick Reference Card
Sam______________________ quick reference card ___________________________Addresses _Sam_______________________________________________________________________ idioms n,m line n to line m X/.*/,x/<cr>/d strip <cr> from all files ’ address mark, see k below x/ˆ/ .,/0d strip C comments from selection . correct selection/position -/ˆ/+#10 goto the 10th colum in the current line 0 start of file -0+,+0- round dot down to whole lines only ˆ start of line ,x/ +/ v/ˆ/ c/ / compress runs of spaces, leaving indentation $ end of line/file s/"([ˆ"]*)"/‘‘1’’/ replace "hello" with ‘‘hello’’ in selection , equivalent to 0,$ f <nl> set current file-name to null < echo "" insert ascii code xxx at current pos ______________________________Regular Expressions , > wc -l count lines in file . any character /text/+-p highlight the lines containing <pat> -/text/ search for text backwards * 0 or more of previous $-/text/ search for the last occurrence of text in file + 1 or more of previous [ˆn] any char but n ,x/<text>/+-p grep for text [nm] n or m .x/<pat>/ c/<rep>/ search for <pat> and replace with <rep> [a-z] class a thru z B < echo *.c add all the C files in current dir to file list B < grep -l <pat> * add all the files containing <pat> to file list (re) tag pattern # substitute #’th tagged pattern X/’/w write all modified files Y/.c/D remove all non C files from file list _Text________________________________________ commands fmt pipe selection through the text formatter > mail <user> send selection as Email -
Computer Oral History Collection, 1969-1973, 1977
Computer Oral History Collection, 1969-1973, 1977 Interviewee: B. Holbrook Interviewer: Uta C. Merzbach Date: May 10, 1969 Repository: Archives Center, National Museum of American History MERZBACH: Do you mind starting out by giving a little basic background as to your early interest, training, and schooling, how you came to go to Bell Labs. HOLBROOK: I was educated to be an X-ray physicist, and I came to Bell Laboratories in 1930 expecting to work in some branch of physics, and I have worked in almost everything except physics ever since. I was in transmission research for a good many years. I worked on voice-operated devices for transatlantic radio and things like this for awhile. Most of the War I spent in a group that was developing electrical analog anti aircraft fire control equipment for the Navy. And then I worked for several years in the Switching Research Department, and in 1957 became head of what was ultimately called the computing systems research department, where I was for the remaining eleven years at Bell Laboratories. I never had anything officially to do with computers until 1957. I was interested in what was going on and thereby acquired some knowledge of it. MERZBACH: Could you tell about the early activities which I guess were taking place just about the time that you came to the Labs? HOLBROOK: Well, of course, from the standpoint of the history of computers of the major advances was made in 1927 or 1938 with Harold Black's invention of the feedback amplifier which changed an amplifier from something which had gain into a precision measuring instrument which was the essential part of building an electric analog computer and was extremely convenient in handling signals through electronic digital computers. -
The New Heinlein Opus List
Nhol.fm Page 253 Wednesday, March 22, 2000 7:21 PM Excerpted from the book Robert A. Heinlein: A Reader’s Companion. This excerpt is from the final press version of the book, and the numbering scheme herein can be considered final. Any updates or changes to this list will use the addendum numbering described on the second page. ©1996–2000 James Gifford. All Rights Reserved. May be duplicated and quoted from according to the terms described in “Reproduction & Use of the Hew Heinlein Opus List” within. The author may be contacted at: [email protected] www.nitrosyncretic.com Nitrosyncretic Press PO Box 4313, Citrus Heights, CA 95611 916-723-4765 voice & fax The New Heinlein Opus List This section presents a complete listing of every known work by Robert A. Heinlein, in the order of creation. Each work is prefaced by a unique identify- ing number, the New Heinlein Opus Number. These numbers, in the format ‘G.nnn,’ have been used throughout this book to identify the work in ques- tion. These numbers have not been used previously for Heinlein’s works. Those readers who are familiar with Heinlein’s opus list may wonder why I did not use Heinlein’s own numbers for these works. The answer is simple: Heinlein’s list was developed and maintained as the core of a filing system for the business management of his works. It was not created until about 1948, with the number of existing works approaching three digits. It is neither complete nor completely accurate in its numbering: there are minor works that do not appear on it, as well as some works that appear out of sequence. -
Using the Go Programming Language in Practice
MASTER’S THESIS | LUND UNIVERSITY 2014 Using the Go Programming Language in Practice Fredrik Pettersson, Erik Westrup Department of Computer Science Faculty of Engineering LTH ISSN 1650-2884 LU-CS-EX 2014-19 Using the Go Programming Language in Practice Erik Westrup Fredrik Pettersson <[email protected]> <[email protected]> <[email protected]> <[email protected]> June 5, 2014 Master’s thesis work carried out at Axis Communications AB for the Department of Computer Science, Lund University. Supervisors: Jonas Skeppstedt <[email protected]> Mathias Bruce <[email protected]> Robert Rosengren <[email protected]> Examiner Jonas Skeppstedt Abstract When developing software today, we still use old tools and ideas. Maybe it is time to start from scratch and try tools and languages that are more in line with how we actually want to develop software. The Go Programming Language was created at Google by a rather famous trio: Rob Pike, Ken Thompson and Robert Griesemer. Before introducing Go, the company suffered from their development process not scaling well due to slow builds, uncontrolled dependencies, hard to read code, poor documenta- tion and so on. Go is set out to provide a solution for these issues. The purpose of this master’s thesis was to review the current state of the language. This is not only a study of the language itself but an investigation of the whole software development process using Go. The study was carried out from an embedded development perspective which includes an investigation of compilers and cross-compilation. We found that Go is exciting, fun to use and fulfills what is promised in many cases. -
Programming Languages
Introduction to Programming Languages Introduction to Programming Languages Anthony A. Aaby © 1996 by Anthony A. Aaby HTML Style Guide | To Do | Miscellenous (possible content) | Figures | Definitions Short Table of Contents Preface 1. Introduction 2. Syntax 3. Semantics 4. Translation 5. Pragmatics 6. Abstraction and Generalization 7. Data and Data Structuring 8. Logic Programming 9. Functional Programming 10. Imperative Programming 11. Concurrent Programming 12. Object-Oriented Programming 13. Evaluation Appendix Stack machine Unified Grammar Logic Bibliography Definitions Index Supplementary Material http://cs.wwc.edu/~aabyan/221_2/PLBOOK/ (1 de 6) [18/12/2001 10:33:41] Introduction to Programming Languages Code Answers Long Table of Contents HTML Style Guide | To Do Preface Syntax, translation, semantics and pragmatics 1 Introduction 1.1 Data 1.2 Models of Computation 1.3 Syntax and Semantics 1.4 Pragmatics 1.5 Language Design Principles 1.6 Historical Perspectives and Further Reading 1.7 Exercises 2 Syntax 2.1 Context-free Grammars 2.1.1 Alphabets and Languages 2.1.2 Grammars and Languages 2.1.3 Abstract Syntax 2.1.4 Parsing 2.1.5 Table-driven and recursive descent parsing 2.2 Nondeterministic Pushdown Automata 2.2.1 Equivalence of pda and cfgs 2.3 Regular Expressions 2.4 Deterministic and Non-deterministic Finite State Machines 2.4.1 Equivalence of deterministic and non-deterministic fsa 2.4.2 Equivalence of fsa and regular expressions 2.4.3 Graphical Representation 2.4.4 Tabular Representation 2.4.5 Implementation of FSAs 2.5 Historical