Using the Go Programming Language in Practice
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Acme: a User Interface for Programmers Rob Pike [email protected]−Labs.Com
Acme: A User Interface for Programmers Rob Pike [email protected]−labs.com ABSTRACT A hybrid of window system, shell, and editor, Acme gives text-oriented applications a clean, expressive, and consistent style of interaction. Tradi tional window systems support interactive client programs and offer libraries of pre-defined operations such as pop-up menus and buttons to promote a consistent user interface among the clients. Acme instead pro vides its clients with a fixed user interface and simple conventions to encourage its uniform use. Clients access the facilities of Acme through a file system interface; Acme is in part a file server that exports device-like files that may be manipulated to access and control the contents of its win dows. Written in a concurrent programming language, Acme is structured as a set of communicating processes that neatly subdivide the various aspects of its tasks: display management, input, file server, and so on. Acme attaches distinct functions to the three mouse buttons: the left selects text; the middle executes textual commands; and the right com bines context search and file opening functions to integrate the various applications and files in the system. Acme works well enough to have developed a community that uses it exclusively. Although Acme discourages the traditional style of interaction based on typescript windowsߞteletypesߞits users find Acmeߣs other ser vices render typescripts obsolete. History and motivation The usual typescript style of interaction with Unix and its relatives is an old one. The typescriptߞan intermingling of textual commands and their outputߞoriginates with the scrolls of paper on teletypes. -
Opencobol Manual for Opencobol 2.0
OpenCOBOL Manual for OpenCOBOL 2.0 Keisuke Nishida / Roger While Edition 2.0 Updated for OpenCOBOL 2.0 26 January 2012 OpenCOBOL is an open-source COBOL compiler, which translates COBOL programs to C code and compiles it using GCC or other C compiler system. This manual corresponds to OpenCOBOL 2.0. Copyright c 2002,2003,2004,2005,2006 Keisuke Nishida Copyright c 2007-2012 Roger While Permission is granted to make and distribute verbatim copies of this manual provided the copy- right notice and this permission notice are preserved on all copies. Permission is granted to copy and distribute modified versions of this manual under the condi- tions for verbatim copying, provided that the entire resulting derived work is distributed under the terms of a permission notice identical to this one. Permission is granted to copy and distribute translations of this manual into another language, under the above conditions for modified versions, except that this permission notice maybe stated in a translation approved by the Free Software Foundation. i Table of Contents 1 Getting Started :::::::::::::::::::::::::::::::::::::::::::::::: 1 1.1 Hello World!::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: 1 2 Compile :::::::::::::::::::::::::::::::::::::::::::::::::::::::: 2 2.1 Compiler Options ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: 2 2.1.1 Help Options ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: 2 2.1.2 Built Target :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: -
Tiny Tools Gerard J
Tiny Tools Gerard J. Holzmann Jet Propulsion Laboratory, California Institute of Technology Many programmers like the convenience of integrated development environments (IDEs) when developing code. The best examples are Microsoft’s Visual Studio for Windows and Eclipse for Unix-like systems, which have both been around for many years. You get all the features you need to build and debug software, and lots of other things that you will probably never realize are also there. You can use all these features without having to know very much about what goes on behind the screen. And there’s the rub. If you’re like me, you want to know precisely what goes on behind the screen, and you want to be able to control every bit of it. The IDEs can sometimes feel as if they are taking over every last corner of your computer, leaving you wondering how much bigger your machine would have to be to make things run a little more smoothly. So what follows is for those of us who don’t use IDEs. It’s for the bare metal programmers, who prefer to write code using their own screen editor, and who do everything else with command-line tools. There are no real conveniences that you need to give up to work this way, but what you gain is a better understanding your development environment, and the control to change, extend, or improve it whenever you find better ways to do things. Bare Metal Programming Many developers who write embedded software work in precisely this way. -
The Glib/GTK+ Development Platform
The GLib/GTK+ Development Platform A Getting Started Guide Version 0.8 Sébastien Wilmet March 29, 2019 Contents 1 Introduction 3 1.1 License . 3 1.2 Financial Support . 3 1.3 Todo List for this Book and a Quick 2019 Update . 4 1.4 What is GLib and GTK+? . 4 1.5 The GNOME Desktop . 5 1.6 Prerequisites . 6 1.7 Why and When Using the C Language? . 7 1.7.1 Separate the Backend from the Frontend . 7 1.7.2 Other Aspects to Keep in Mind . 8 1.8 Learning Path . 9 1.9 The Development Environment . 10 1.10 Acknowledgments . 10 I GLib, the Core Library 11 2 GLib, the Core Library 12 2.1 Basics . 13 2.1.1 Type Definitions . 13 2.1.2 Frequently Used Macros . 13 2.1.3 Debugging Macros . 14 2.1.4 Memory . 16 2.1.5 String Handling . 18 2.2 Data Structures . 20 2.2.1 Lists . 20 2.2.2 Trees . 24 2.2.3 Hash Tables . 29 2.3 The Main Event Loop . 31 2.4 Other Features . 33 II Object-Oriented Programming in C 35 3 Semi-Object-Oriented Programming in C 37 3.1 Header Example . 37 3.1.1 Project Namespace . 37 3.1.2 Class Namespace . 39 3.1.3 Lowercase, Uppercase or CamelCase? . 39 3.1.4 Include Guard . 39 3.1.5 C++ Support . 39 1 3.1.6 #include . 39 3.1.7 Type Definition . 40 3.1.8 Object Constructor . 40 3.1.9 Object Destructor . -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
Static Typing Where Possible, Dynamic Typing When Needed: the End of the Cold War Between Programming Languages
Intended for submission to the Revival of Dynamic Languages Static Typing Where Possible, Dynamic Typing When Needed: The End of the Cold War Between Programming Languages Erik Meijer and Peter Drayton Microsoft Corporation Abstract Advocates of dynamically typed languages argue that static typing is too rigid, and that the softness of dynamically lan- This paper argues that we should seek the golden middle way guages makes them ideally suited for prototyping systems with between dynamically and statically typed languages. changing or unknown requirements, or that interact with other systems that change unpredictably (data and application in- tegration). Of course, dynamically typed languages are indis- 1 Introduction pensable for dealing with truly dynamic program behavior such as method interception, dynamic loading, mobile code, runtime <NOTE to="reader"> Please note that this paper is still very reflection, etc. much work in progress and as such the presentation is unpol- In the mother of all papers on scripting [16], John Ousterhout ished and possibly incoherent. Obviously many citations to argues that statically typed systems programming languages related and relevant work are missing. We did however do our make code less reusable, more verbose, not more safe, and less best to make it provocative. </NOTE> expressive than dynamically typed scripting languages. This Advocates of static typing argue that the advantages of static argument is parroted literally by many proponents of dynami- typing include earlier detection of programming mistakes (e.g. cally typed scripting languages. We argue that this is a fallacy preventing adding an integer to a boolean), better documenta- and falls into the same category as arguing that the essence of tion in the form of type signatures (e.g. -
The Component Object Model Specification Version 0.9 October 24, 1995
http://scottge.wordpress.com The Component Object Model Specification Version 0.9 October 24, 1995 This document contains the specification to the Component Object Model (COM), an architecture and supporting infrastructure for building, using, and evolving component software in a robust manner. This specification contains the standard APIs supported by the COM Library, the standard suites of interfaces supported or used by software written in a COM environment, along with the network protocols used by COM in support of distributed computing. This specification is still in draft form, and thus subject to change. Note: This document is an early release of the final specification. It is meant to specify and accompany software that is still in development. Some of the information in this documentation may be inaccurate or may not be an accurate representation of the functionality of the final specification or software. Microsoft assumes no responsibility for any damages that might occur either directly or indirectly from these inaccuracies. Microsoft may have trademarks, copyrights, patents or pending patent applications, or other intellectual property rights covering subject matter in this document. The furnishing of this document does not give you a license to these trademarks, copyrights, patents, or other intellectual property rights. Copyright ? 1992-95 Microsoft Corporation. All Rights Reserved The Component Object Model Specification The Component Object Model The Component Object Model Specification Draft Version 0.9, October 24, 1995 Microsoft Corporation and Digital Equipment Corporation Copyright ? 1992-95 Microsoft Corporation. Microsoft does not make any representation or warranty regarding the Specification or any product or item developed based on the Specification. -
Dynamic C++ Classes a Lightweight Mechanism to Update Code in a Running Program
The following paper was originally published in the Proceedings of the USENIX Annual Technical Conference (NO 98) New Orleans, Louisiana, June 1998 Dynamic C++ Classes A lightweight mechanism to update code in a running program Gísli Hjálmtÿsson AT&T Labs - Research Robert Gray Dartmouth College For more information about USENIX Association contact: 1. Phone: 510 528-8649 2. FAX: 510 548-5738 3. Email: [email protected] 4. WWW URL:http://www.usenix.org/ Dynamic C++ Classes A lightweight mechanism to update code in a running program Gísli Hjálmtýsson Robert Gray AT&T Labs – Research Thayer School of Engineering1 180 Park Avenue Dartmouth College Florham Park, NJ 07932 Hanover, NH 03755 [email protected] [email protected] has transformed many industries, continuous change has Abstract become just as important as continuous operation. Techniques for dynamically adding new code to a run- Rapid introduction of new functionality and dynamic ning program already exist in various operating sys- adaptation to volatile needs is essential. Systems, par- tems, programming languages and runtime environ- ticularly telecommunications systems, must be custom- ments. Most of these systems have not found their way ized on a very fine time scale, either due to user demand 1 into common use, however, since they require pro- or to load and usage fluctuations. grammer retraining and invalidate previous software An effective way to allow both continuous operation investments. In addition, many of the systems are too and continuous change is through dynamic code up- high-level for performance-critical applications. This dates. New code is added to a running program without paper presents an implementation of dynamic classes halting the program, thus introducing new functionality for the C++ language. -
Reprogramming Embedded Systems at Run-Time
Proceedings of the 8th International Conference on Sensing Technology, Sep. 2-4, 2014, Liverpool, UK Reprogramming Embedded Systems at Run-Time Richard Oliver, Adriana Wilde IEEE(S) and Ed Zaluska SMIEEE Electronics and Computer Science University of Southampton, United Kingdom {rjo2g10,agw106,ejz}@ecs.soton.ac.uk Abstract—The dynamic re-programming of embedded systems is load mechanisms. This paper aims to address the problem of a long-standing problem in the field. With the advent of wireless dynamic reprogramming of such systems, and will offer sensor networks and the ‘Internet of Things’ it has now become comparison and a critical appraisal of the methods currently necessary to be able to reprogram at run-time due to the being used in the field. difficulty of gaining access to such systems once deployed. The issues of power consumption, flexibility, and operating system The remainder of this paper is structured as follows. protections are examined for a range of approaches, and a Section II explains code execution on embedded devices, critical comparison is given. A combination of approaches is section III discusses various existing methods, focusing on the recommended for the implementation of real-world systems and issues of power consumption, flexibility of approach, and OS areas where further work is required are highlighted. protection. Section IV follows with conclusions and suggests future work in the area. Keywords-Wireless sensor networks; Programming; Runtime, Energy consumption II. BACKGROUND I. INTRODUCTION This section will cover the execution of code on microcontrollers. This is typically of no concern when flashing Embedded systems are pervasive in the modern world, a static image to a microcontroller but a greater understanding being found in systems as widely ranging as fridges, cars, is required to implement dynamic code loading. -
Revenues 1010 1020 1030 1040 1045 1060 1090 82,958 139,250
FCC Paper Report 43-01 ARMIS Annual Summary Report COMPANY Northern New England Telephone Telephone Operallons LLC ST UDY AREA. New Hempsh1 re PERIOD From: Jan 201 1 To Dec 2011 COSA FPNH A ACCOUNT LEVEL REPORTING (Dollars on thousands) ROW CLASSIFICATION T otal Nonreg AdJu stments Subject To Slate Interstate (a) (b) (C) (d) Separations (g) (h) (f) Revenues 1010 Besoc Local Servoces 82,958 N/A 0 82,958 82,958 0 1020 Network Access Services 139,250 N/A 0 139,250 9,443 129,807 1030 Toil Network Servoces 13,911 N/A 0 13,911 13,881 31 1040 Mosceltaneous 33,250 N/A 0 33,250 22,165 11,084 1045 Nonregutated 7,540 7,540 N/A N/A N/A N/A 1060 Uncoltecllbles 3,597 101 0 3,497 1,615 1,882 1090 Total Operalong Revenues 273,312 7,439 0 265,872 126,832 139,040 Imputation or Dtrectory Revenue 23,300 Total Assessed Revenue 296,612 Assessment 942,999 403,229 Assessment Factor $0.00318 $ 0.0031 8 The revenue data above os avaolable on the FCC ARMIS websote at http)/fjallrossJcc.gov/eafs7/adhoc/table year tal Profile and Historic Information! AT&T Labs! AT&T Page 1 of 5 Personal Business About AT&T ·~ ~ at&t Backgrounder In today's rapidly changing business environment, many of the most exciting innovations are being spearheaded by AT&T Labs, the long-respected research and development arm of AT&T. History The year was 1901...the beginning of a new century. -
Advanced Development of Certified OS Kernels Prof
Advanced Development of Certified OS Kernels Zhong Shao (PI) and Bryan Ford (Co-PI) Department of Computer Science Yale University P.O.Box 208285 New Haven, CT 06520-8285, USA {zhong.shao,bryan.ford}yale.edu July 15, 2010 1 Innovative Claims Operating System (OS) kernels form the bedrock of all system software—they can have the greatest impact on the resilience, extensibility, and security of today’s computing hosts. A single kernel bug can easily wreck the entire system’s integrity and protection. We propose to apply new advances in certified software [86] to the development of a novel OS kernel. Our certified kernel will offer safe and application-specific extensibility [8], provable security properties with information flow control, and accountability and recovery from hardware or application failures. Our certified kernel builds on proof-carrying code concepts [74], where a binary executable includes a rigorous machine-checkable proof that the software is free of bugs with respect to spe- cific requirements. Unlike traditional verification systems, our certified software approach uses an expressive general-purpose meta-logic and machine-checkable proofs to support modular reason- ing about sophisticated invariants. The rich meta-logic enables us to verify all kinds of low-level assembly and C code [10,28,31,44,68,77,98] and to establish dependability claims ranging from simple safety properties to advanced security, correctness, and liveness properties. We advocate a modular certification framework for kernel components, which mirrors and enhances the modularity of the kernel itself. Using this framework, we aim to create not just a “one-off” lump of verified kernel code, but a statically and dynamically extensible kernel that can be incrementally built and extended with individual certified modules, each of which will provably preserve the kernel’s overall safety and security properties. -
Sam Quick Reference Card
Sam______________________ quick reference card ___________________________Addresses _Sam_______________________________________________________________________ idioms n,m line n to line m X/.*/,x/<cr>/d strip <cr> from all files ’ address mark, see k below x/ˆ/ .,/0d strip C comments from selection . correct selection/position -/ˆ/+#10 goto the 10th colum in the current line 0 start of file -0+,+0- round dot down to whole lines only ˆ start of line ,x/ +/ v/ˆ/ c/ / compress runs of spaces, leaving indentation $ end of line/file s/"([ˆ"]*)"/‘‘1’’/ replace "hello" with ‘‘hello’’ in selection , equivalent to 0,$ f <nl> set current file-name to null < echo "" insert ascii code xxx at current pos ______________________________Regular Expressions , > wc -l count lines in file . any character /text/+-p highlight the lines containing <pat> -/text/ search for text backwards * 0 or more of previous $-/text/ search for the last occurrence of text in file + 1 or more of previous [ˆn] any char but n ,x/<text>/+-p grep for text [nm] n or m .x/<pat>/ c/<rep>/ search for <pat> and replace with <rep> [a-z] class a thru z B < echo *.c add all the C files in current dir to file list B < grep -l <pat> * add all the files containing <pat> to file list (re) tag pattern # substitute #’th tagged pattern X/’/w write all modified files Y/.c/D remove all non C files from file list _Text________________________________________ commands fmt pipe selection through the text formatter > mail <user> send selection as Email