DOCSLIB.ORG

Programming Languages

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Programming Languages Introduction to Programming Languages Introduction to Programming Languages Anthony A. Aaby © 1996 by Anthony A. Aaby HTML Style Guide | To Do | Miscellenous (possible content) | Figures | Definitions Short Table of Contents Preface 1. Introduction 2. Syntax 3. Semantics 4. Translation 5. Pragmatics 6. Abstraction and Generalization 7. Data and Data Structuring 8. Logic Programming 9. Functional Programming 10. Imperative Programming 11. Concurrent Programming 12. Object-Oriented Programming 13. Evaluation Appendix Stack machine Unified Grammar Logic Bibliography Definitions Index Supplementary Material http://cs.wwc.edu/~aabyan/221_2/PLBOOK/ (1 de 6) [18/12/2001 10:33:41] Introduction to Programming Languages Code Answers Long Table of Contents HTML Style Guide | To Do Preface Syntax, translation, semantics and pragmatics 1 Introduction 1.1 Data 1.2 Models of Computation 1.3 Syntax and Semantics 1.4 Pragmatics 1.5 Language Design Principles 1.6 Historical Perspectives and Further Reading 1.7 Exercises 2 Syntax 2.1 Context-free Grammars 2.1.1 Alphabets and Languages 2.1.2 Grammars and Languages 2.1.3 Abstract Syntax 2.1.4 Parsing 2.1.5 Table-driven and recursive descent parsing 2.2 Nondeterministic Pushdown Automata 2.2.1 Equivalence of pda and cfgs 2.3 Regular Expressions 2.4 Deterministic and Non-deterministic Finite State Machines 2.4.1 Equivalence of deterministic and non-deterministic fsa 2.4.2 Equivalence of fsa and regular expressions 2.4.3 Graphical Representation 2.4.4 Tabular Representation 2.4.5 Implementation of FSAs 2.5 Historical Perspectives and Further Reading 2.5.1 Backus-Naur Form 2.5.2 EBNF (extended BNF) 2.5.3 Language Descriptions 2.5.4 Parser (Compiler) Construction Tools 2.5.5 Formal Languages and Automata 2.6 Exercises 3 Semantics http://cs.wwc.edu/~aabyan/221_2/PLBOOK/ (2 de 6) [18/12/2001 10:33:41] Introduction to Programming Languages 3.1 Algebraic 3.2 Axiomatic 3.3 Denotational 3.4 Operational 3.5 Translation 3.6 Historical Perspectives and Further Reading 3.7 Exercises 4 Pragmatics 4.1 Syntax 4.2 Semantics 4.3 Bindings and Binding Times 4.4 Procedures and Functions 4.4.1 Parameters and Arguments 4.4.1.1 Eager vs Lazy Evaluation 4.4.1.2 Parameter Passing Mechanisms 4.5 Scope and Blocks 4.5.-- more to come 4.6 Safety 4.7 Historical Perspectives and Further Reading 4.8 Exercises Models of Computation 5 Abstraction and Generalization 5.1 Abstraction 5.1.1 Binding 5.1.2 Encapsulation 5.2 Generalization 5.2.1 Substitution 5.3 Block Structure 5.3.1 Activation Records 5.4 Scope Rules 5.4.1 Dynamic Scope Rules 5.4.2 Static Scope Rules 5.5 Partitions 5.6 Environment 5.7 Modules 5.8 ADTs 5.9 Historical Perspectives and Further Reading 5.10 Exercises 6 Domains and Types http://cs.wwc.edu/~aabyan/221_2/PLBOOK/ (3 de 6) [18/12/2001 10:33:41] Introduction to Programming Languages 6.1 Elements of Domain Theory 6.1.1 Product Domain 6.1.2 Sum Domain 6.1.3 Function Domain 6.1.4 Power Domain 6.1.5 Recursively Defined Domain 6.2 Type Systems 6.2.1 Type Checking 6.2.2 Type Equivalence 6.2.2.1 Name Equivalence 6.2.2.2 Structural Equivalence 6.2.2 Type Inference 6.2.3 Type Declarations 6.2.4 Polymorphism 6.3 Type Completeness 6.4 Historical Perspectives and Further Reading 6.5 Exercises 7 Logic Programming Database query languages Relations and the Relational Algebra Datalog Quantifiers Appliation Areas Inference and Unification Syntax Facts, Predicates and Atoms Queries Semantics Operational Semantics A Simple Interpreter for Pure Prolog Declarative Semantics Denotational Semantics Pragmatics Logic Programming and Software Engineering The Logical Variable Incomplete Data Structures Arithmetic Iteration vs Recursion Backtracking Exceptions http://cs.wwc.edu/~aabyan/221_2/PLBOOK/ (4 de 6) [18/12/2001 10:33:41] Introduction to Programming Languages Logic Programming vs Functional Programming Prolog and Logic The Logic of Prolog The Illogic of Prolog Incompleteness Unfairness Unsoundness Negation Control Information Extralogical Features Multidirectionality Rule Order Historical Perspectives and Further Reading Exercises 8 Functional Programming 8.1 The Lambda Calculus 8.1.1 Operational Semantics 8.1.2 Denotational Semantics 8.1.3 Translation Semantics and Combinators 8.2 Scheme 8.3 ML 8.4 Haskell 8.5 Historical Perspectives and Further Reading 8.6 Exercises 9 Imperative Programming 9. Historal Perspectives and Further Reading 9. Exercises Pragmatics 10 Concurrent Programming 10.1 The Concurrent Nature of Systems 10.2 The Nature of Concurrent Systems 10.3 Concurrency in Programming Languages 10.4 The Engineering of Concurrent Programs 10.5 Historical Perspectives and Further Reading 10.6 Exercises 11 Object-Oriented Programming 11.1 Subtypes (subranges) 11.2 Objects http://cs.wwc.edu/~aabyan/221_2/PLBOOK/ (5 de 6) [18/12/2001 10:33:41] Introduction to Programming Languages 11.3 Classes 11.4 Inheritance 11.5 Types and Classes 11.6 Examples 11.7 Historical Perspectives and Further Reading 11.8 Exercises 12 Translation 12.1 Attribute Grammars and Static Semantics 12.2 Parsing 12.3 Scanning 12.4 Symbol Table 12.5 Virtual Computers 12.6 Optimization 12.7 Code Generation 12.8 Peephole Optimization 12.9 Historical Perspectives and Further Reading 12.10 Exercises 13 Evaluation 13. Historical Perspectives and Further Reading 13. Exercises Appendix Logic Bibliography Definitions Index Supplementary Material Code Answers Permission to make digital/hard copy of part or all of this work for personal or classroom use is granted without fee provided that the copies are not made or distributed for profit or commercial advantage, the copyright notice, the title of the publication, and its date appear, and notice is given that copying is by permission of Anthony A. Aaby. To copy otherwise, to republish, to post on servers, or to redistribute to lists, requires prior specific permission and/or fee. © 1998 Anthony A. Aaby. Last Modified - . Send comments to [email protected] http://cs.wwc.edu/~aabyan/221_2/PLBOOK/ (6 de 6) [18/12/2001 10:33:41] Disclamer and Copyright Disclamer and Copyright This information is provided in good faith but no warranty can be made for its accuracy. Opinions expressed are entirely those of myself and cannot be taken to represent views of past, present or future employers. Feel free to quote, but reproduction of this material in any form of storage, paper, etc is forbidden without the express written permission of the author. Intellectual property rights in this material are held by the author. All rights reserved. If you have questions or comments feel free to send mail to me. Anthony A. Aaby http://cs.wwc.edu/~aabyan/221_2/PLBOOK/Notices.html [18/12/2001 10:33:43] Anthony Aaby's Homepage Anthony Aaby Office: 328 Kretchmar Hall Phone: 1-(509)-527-2067 FAX: 1-(509)-527-2253 email: [email protected] Professor of Computer Science BA Mathematics Loma Linda University MA Mathematics The Pennsylvania State University Ph.D. Computer Science The Pennsylvania State University Course Syllabi CPTR 235 System Software and Programming CPTR 352 Operating Systems CPTR 415 Introduction to Databases CPTR 425 Introduction to Networking CPTR 435 Software Engineering CPTR nn Software Project Management CPTR 460 Parallel and Distributed Programming CPTR 464 Compiler Design CPTR 496,7,8 Seminar INFO 150 Software Application INFO 250 System Software Instructions for students Research Interests Parallel and Distributed Computing Programming Languages Natural Language Processing Theory of Programming Automated Reasoning Systems Research Group http://cs.wwc.edu/~aabyan/ (1 de 3) [18/12/2001 10:33:53] Anthony Aaby's Homepage Work in Progress C Family of Languages Essays on Ethics Computing Curricula 2001 1991 CS Labs Hardware Logic Programming -- tiger Logic resources The Logic of Fact, Fiction, Fantasy, & Physics Programming Languages ● Compiler Construction using Flex and Bison (Lecture Notes) ● Multiparadigm Programming Language ● Textbook Introduction Programming Languages ● Tutorials [ Pascal | Prolog | Gödel | Scheme | SML | Haskell | PCN ] Software Engineering ● Introduction to Software Engineering (Lecture Notes) ● Programming Patterns ● Design ● Temporal logic for specification Colloquia Index Stand alone Prolog and AI lectures OOP VR & Limits of Computation Old Syllabi INFO 105 Personal Computing CPTR 141 Introduction to Programming CPTR 215 Assembly Language Programming CPTR 221-222 Programming Languages CPTR 350 Computer Architecture CPTR 351 Memory and I/O Systems Local Computing at WWC Software Engineering at WWC BS, BA, AS - CS BS-SE; BS-SE alt BSE-SE vs BS-SE Last Modified - . Send comments to [email protected] http://cs.wwc.edu/~aabyan/ (2 de 3) [18/12/2001 10:33:53] Anthony Aaby's Homepage http://cs.wwc.edu/~aabyan/ (3 de 3) [18/12/2001 10:33:53] http://cs.wwc.edu/~aabyan/Long_Haired_Aaby.jpg http://cs.wwc.edu/~aabyan/Long_Haired_Aaby.jpg [18/12/2001 10:33:58] CPTR235 System Software & Programming CPTR235 System Software & Programming - 4 CAUTION: subject to change Description: Introduction to Unix, system adminstration, system software including database managment systems and web severs, and system programming. Prerequisites: CPTR 141 or CIS 130. This course has a significant project componenent that follows a project-based organization rather than the traditional lecture-lab organization. All class members are expected to spend 120 hours (12 hours/week) on this course. Goals: Upon completion of the course students will have a variety of skills in the following areas: ● Unix operating system ● Standard Unix C libraries ● Development tools ● Documentation ● Data management (database) ● Scripting languages (e.g., shell, Tcl, Perl) ● Concurrency and distributed applications ● GUI programming (e.g., Tk, GTK+, Qt) ● Web programming Consistent with peer review practice in academia, the source code for software developed for this course must be available to all class members and if desired may be protected by one of the approved open source licenses unless prior arrangement is made for a more restricted copyright protected by an NDA.
Load more

  1495
Copy Link
Recommended publications
  • Administering Unidata on UNIX Platforms
    C:\Program Files\Adobe\FrameMaker8\UniData 7.2\7.2rebranded\ADMINUNIX\ADMINUNIXTITLE.fm March 5, 2010 1:34 pm Beta Beta Beta Beta Beta Beta Beta Beta Beta Beta Beta Beta Beta Beta Beta Beta UniData Administering UniData on UNIX Platforms UDT-720-ADMU-1 C:\Program Files\Adobe\FrameMaker8\UniData 7.2\7.2rebranded\ADMINUNIX\ADMINUNIXTITLE.fm March 5, 2010 1:34 pm Beta Beta Beta Beta Beta Beta Beta Beta Beta Beta Beta Beta Beta Notices Edition Publication date: July, 2008 Book number: UDT-720-ADMU-1 Product version: UniData 7.2 Copyright © Rocket Software, Inc. 1988-2010. All Rights Reserved. Trademarks The following trademarks appear in this publication: Trademark Trademark Owner Rocket Software™ Rocket Software, Inc. Dynamic Connect® Rocket Software, Inc. RedBack® Rocket Software, Inc. SystemBuilder™ Rocket Software, Inc. UniData® Rocket Software, Inc. UniVerse™ Rocket Software, Inc. U2™ Rocket Software, Inc. U2.NET™ Rocket Software, Inc. U2 Web Development Environment™ Rocket Software, Inc. wIntegrate® Rocket Software, Inc. Microsoft® .NET Microsoft Corporation Microsoft® Office Excel®, Outlook®, Word Microsoft Corporation Windows® Microsoft Corporation Windows® 7 Microsoft Corporation Windows Vista® Microsoft Corporation Java™ and all Java-based trademarks and logos Sun Microsystems, Inc. UNIX® X/Open Company Limited ii SB/XA Getting Started The above trademarks are property of the specified companies in the United States, other countries, or both. All other products or services mentioned in this document may be covered by the trademarks, service marks, or product names as designated by the companies who own or market them. License agreement This software and the associated documentation are proprietary and confidential to Rocket Software, Inc., are furnished under license, and may be used and copied only in accordance with the terms of such license and with the inclusion of the copyright notice.
    [Show full text]
  • Types and Programming Languages by Benjamin C
    < Free Open Study > . .Types and Programming Languages by Benjamin C. Pierce ISBN:0262162091 The MIT Press © 2002 (623 pages) This thorough type-systems reference examines theory, pragmatics, implementation, and more Table of Contents Types and Programming Languages Preface Chapter 1 - Introduction Chapter 2 - Mathematical Preliminaries Part I - Untyped Systems Chapter 3 - Untyped Arithmetic Expressions Chapter 4 - An ML Implementation of Arithmetic Expressions Chapter 5 - The Untyped Lambda-Calculus Chapter 6 - Nameless Representation of Terms Chapter 7 - An ML Implementation of the Lambda-Calculus Part II - Simple Types Chapter 8 - Typed Arithmetic Expressions Chapter 9 - Simply Typed Lambda-Calculus Chapter 10 - An ML Implementation of Simple Types Chapter 11 - Simple Extensions Chapter 12 - Normalization Chapter 13 - References Chapter 14 - Exceptions Part III - Subtyping Chapter 15 - Subtyping Chapter 16 - Metatheory of Subtyping Chapter 17 - An ML Implementation of Subtyping Chapter 18 - Case Study: Imperative Objects Chapter 19 - Case Study: Featherweight Java Part IV - Recursive Types Chapter 20 - Recursive Types Chapter 21 - Metatheory of Recursive Types Part V - Polymorphism Chapter 22 - Type Reconstruction Chapter 23 - Universal Types Chapter 24 - Existential Types Chapter 25 - An ML Implementation of System F Chapter 26 - Bounded Quantification Chapter 27 - Case Study: Imperative Objects, Redux Chapter 28 - Metatheory of Bounded Quantification Part VI - Higher-Order Systems Chapter 29 - Type Operators and Kinding Chapter 30 - Higher-Order Polymorphism Chapter 31 - Higher-Order Subtyping Chapter 32 - Case Study: Purely Functional Objects Part VII - Appendices Appendix A - Solutions to Selected Exercises Appendix B - Notational Conventions References Index List of Figures < Free Open Study > < Free Open Study > Back Cover A type system is a syntactic method for automatically checking the absence of certain erroneous behaviors by classifying program phrases according to the kinds of values they compute.
    [Show full text]
  • UNIX Workshop Series: Quick-Start Objectives
    Part I UNIX Workshop Series: Quick-Start Objectives Overview – Connecting with ssh Command Window Anatomy Command Structure Command Examples Getting Help Files and Directories Wildcards, Redirection and Pipe Create and edit files Overview Connecting with ssh Open a Terminal program Mac: Applications > Utilities > Terminal ssh –Y [email protected] Linux: In local shell ssh –Y [email protected] Windows: Start Xming and PuTTY Create a saved session for the remote host name centos.css.udel.edu using username Connecting with ssh First time you connect Unix Basics Multi-user Case-sensitive Bash shell, command-line Commands Command Window Anatomy Title bar Click in the title bar to bring the window to the front and make it active. Command Window Anatomy Login banner Appears as the first line of a login shell. Command Window Anatomy Prompts Appears at the beginning of a line and usually ends in $. Command Window Anatomy Command input Place to type commands, which may have options and/or arguments. Command Window Anatomy Command output Place for command response, which may be many lines long. Command Window Anatomy Input cursor Typed text will appear at the cursor location. Command Window Anatomy Scroll Bar Will appear as needed when there are more lines than fit in the window. Command Window Anatomy Resize Handle Use the mouse to change the window size from the default 80x24. Command Structure command [arguments] Commands are made up of the actual command and its arguments. command -options [arguments] The arguments are further broken down into the command options which are single letters prefixed by a “-” and other arguments that identify data for the command.
    [Show full text]
  • Useful Applications – Last Updated 8 Th March 2014
    A List of Useful Applications – Last updated 8 th March 2014 In the descriptions of the software the text in black is my comments. Text in dark blue preceded by 'What they say :-' is a quote from the website providing the software. Rating :- This is my own biased and arbitrary opinion of the quality and usefulness of the software. The rating is out of 5. Unrated = - Poor = Average = Good = Very Good = Essential = Open Office http://www.openoffice.org/ Very Good = Word processor, Spreadsheet, Drawing Package, Presentation Package etc, etc. Free and open source complete office suite, equivalent to Microsoft Office. Since the takeover of this project by Oracle development seems to have ground to a halt with the departure of many of the developers. Libre Office http://www.libreoffice.org/ Essential = Word processor, Spreadsheet, Drawing Package, Presentation Package etc, etc. Free and open source complete office suite, equivalent to Microsoft Office. This package is essentially the same as Open Office however it satisfies the open source purists because it is under the control of an open source group rather than the Oracle Corporation. Since the takeover of the Open Office project by Oracle many of the developers left and a lot of them ended up on the Libre Office project. Development on the Libre Office project is now ahead of Open Office and so Libre Office would be my preferred office suite. AbiWord http://www.abisource.com/ Good = If you don't really need a full office suite but just want a simple word processor then AbiWord might be just what you are looking for.
    [Show full text]
  • System Log Commands
    System Log Commands • system set-log , on page 2 • show system logging-level, on page 3 • show log, on page 4 System Log Commands 1 System Log Commands system set-log system set-log To set the log level and log type of messages, use the system set-log command in privileged EXEC mode. system set-log level {debug | info | warning | error | critical} logtype {configuration | operational | all} Syntax Description level Specifies the log level. debug Logs all messages. info Logs all messages that have info and higher severity level. warning Logs all messages that have warning and higher severity level. error Logs all messages that have error and higher severity level. critical Logs all messages that have critical severity level. logtype Specifies the log type. configuration Configuration log messages are recorded. operational Operational log messages are recorded. all All types of log messages are recorded. Command Default For the configuration log, info is the default level. For the operational log, warning is the default level. Command Modes Privileged EXEC (#) Command History Release Modification 3.5.1 This command was introduced. Usage Guidelines After a system reboot, the modified logging configuration is reset to the default level, that is, info for the configuration log and warning for the operational log. Example The following example shows how to configure a log level: nfvis# system set-log level error logtype all System Log Commands 2 System Log Commands show system logging-level show system logging-level To view the log level and log type settings, use the show system logging-level command in privileged EXEC mode.
    [Show full text]
  • Acme: a User Interface for Programmers Rob Pike [email protected]−Labs.Com
    Acme: A User Interface for Programmers Rob Pike [email protected]−labs.com ABSTRACT A hybrid of window system, shell, and editor, Acme gives text-oriented applications a clean, expressive, and consistent style of interaction. Tradi­ tional window systems support interactive client programs and offer libraries of pre-defined operations such as pop-up menus and buttons to promote a consistent user interface among the clients. Acme instead pro­ vides its clients with a fixed user interface and simple conventions to encourage its uniform use. Clients access the facilities of Acme through a file system interface; Acme is in part a file server that exports device-like files that may be manipulated to access and control the contents of its win­ dows. Written in a concurrent programming language, Acme is structured as a set of communicating processes that neatly subdivide the various aspects of its tasks: display management, input, file server, and so on. Acme attaches distinct functions to the three mouse buttons: the left selects text; the middle executes textual commands; and the right com­ bines context search and file opening functions to integrate the various applications and files in the system. Acme works well enough to have developed a community that uses it exclusively. Although Acme discourages the traditional style of interaction based on typescript windowsߞteletypesߞits users find Acmeߣs other ser­ vices render typescripts obsolete. History and motivation The usual typescript style of interaction with Unix and its relatives is an old one. The typescriptߞan intermingling of textual commands and their outputߞoriginates with the scrolls of paper on teletypes.
    [Show full text]
  • Dell EMC Powerstore CLI Guide
    Dell EMC PowerStore CLI Guide May 2020 Rev. A01 Notes, cautions, and warnings NOTE: A NOTE indicates important information that helps you make better use of your product. CAUTION: A CAUTION indicates either potential damage to hardware or loss of data and tells you how to avoid the problem. WARNING: A WARNING indicates a potential for property damage, personal injury, or death. © 2020 Dell Inc. or its subsidiaries. All rights reserved. Dell, EMC, and other trademarks are trademarks of Dell Inc. or its subsidiaries. Other trademarks may be trademarks of their respective owners. Contents Additional Resources.......................................................................................................................4 Chapter 1: Introduction................................................................................................................... 5 Overview.................................................................................................................................................................................5 Use PowerStore CLI in scripts.......................................................................................................................................5 Set up the PowerStore CLI client........................................................................................................................................5 Install the PowerStore CLI client..................................................................................................................................
    [Show full text]
  • Epmp Command Line Interface User Guide
    USER GUIDE ePMP Command Line Interface ePMP Command Line Interface User Manual Table of Contents 1 Introduction ...................................................................................................................................... 3 1.1 Purpose ................................................................................................................................ 3 1.2 Command Line Access ........................................................................................................ 3 1.3 Command usage syntax ...................................................................................................... 3 1.4 Basic information ................................................................................................................. 3 1.4.1 Context sensitive help .......................................................................................................... 3 1.4.2 Auto-completion ................................................................................................................... 3 1.4.3 Movement keys .................................................................................................................... 3 1.4.4 Deletion keys ....................................................................................................................... 4 1.4.5 Escape sequences .............................................................................................................. 4 2 Command Line Interface Overview ..............................................................................................
    [Show full text]
  • Tiny Tools Gerard J
    Tiny Tools Gerard J. Holzmann Jet Propulsion Laboratory, California Institute of Technology Many programmers like the convenience of integrated development environments (IDEs) when developing code. The best examples are Microsoft’s Visual Studio for Windows and Eclipse for Unix-like systems, which have both been around for many years. You get all the features you need to build and debug software, and lots of other things that you will probably never realize are also there. You can use all these features without having to know very much about what goes on behind the screen. And there’s the rub. If you’re like me, you want to know precisely what goes on behind the screen, and you want to be able to control every bit of it. The IDEs can sometimes feel as if they are taking over every last corner of your computer, leaving you wondering how much bigger your machine would have to be to make things run a little more smoothly. So what follows is for those of us who don’t use IDEs. It’s for the bare metal programmers, who prefer to write code using their own screen editor, and who do everything else with command-line tools. There are no real conveniences that you need to give up to work this way, but what you gain is a better understanding your development environment, and the control to change, extend, or improve it whenever you find better ways to do things. Bare Metal Programming Many developers who write embedded software work in precisely this way.
    [Show full text]
  • Sequence Alignment/Map Format Specification
    Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345.
    [Show full text]
  • Revenues 1010 1020 1030 1040 1045 1060 1090 82,958 139,250
    FCC Paper Report 43-01 ARMIS Annual Summary Report COMPANY Northern New England Telephone Telephone Operallons LLC ST UDY AREA. New Hempsh1 re PERIOD From: Jan 201 1 To Dec 2011 COSA FPNH A ACCOUNT LEVEL REPORTING (Dollars on thousands) ROW CLASSIFICATION T otal Nonreg AdJu stments Subject To Slate Interstate (a) (b) (C) (d) Separations (g) (h) (f) Revenues 1010 Besoc Local Servoces 82,958 N/A 0 82,958 82,958 0 1020 Network Access Services 139,250 N/A 0 139,250 9,443 129,807 1030 Toil Network Servoces 13,911 N/A 0 13,911 13,881 31 1040 Mosceltaneous 33,250 N/A 0 33,250 22,165 11,084 1045 Nonregutated 7,540 7,540 N/A N/A N/A N/A 1060 Uncoltecllbles 3,597 101 0 3,497 1,615 1,882 1090 Total Operalong Revenues 273,312 7,439 0 265,872 126,832 139,040 Imputation or Dtrectory Revenue 23,300 Total Assessed Revenue 296,612 Assessment 942,999 403,229 Assessment Factor $0.00318 $ 0.0031 8 The revenue data above os avaolable on the FCC ARMIS websote at http)/fjallrossJcc.gov/eafs7/adhoc/table year tal Profile and Historic Information! AT&T Labs! AT&T Page 1 of 5 Personal Business About AT&T ·~ ~ at&t Backgrounder In today's rapidly changing business environment, many of the most exciting innovations are being spearheaded by AT&T Labs, the long-respected research and development arm of AT&T. History The year was 1901...the beginning of a new century.
    [Show full text]
  • Simple Groupware Manual Installation, Configuration, Customization, Maintenance and More! (September 2011)
    Simple Groupware Manual Installation, Configuration, Customization, Maintenance and more! (September 2011) Simple Groupware Manual Table of contents 1. About Simple Groupware 2. Why Open Source? 3. Features 4. Screenshots 5. Requirements 6. Installation 7. Installation SyncML Server 8. Update 9. Extension Manager 10. Content Management 11. WebDAV server 12. SyncML integration 13. Offline folder synchronization 14. Desktop Integration 15. Data Handlers / Data Import 16. Data Export and URL parameters 17. Using modules and keyboard shortcuts 18. Users / Groups 19. Backup / Restore 20. System tasks 21. System configuration 22. System monitoring 23. Folder templates 24. LDAP / Active Directory integration 25. SOAP Server 26. Customization 27. Customization FAQs 28. Extension Development 29. Translation / localization 30. Speedup techniques 31. Roadmap 32. sgsML Tutorial 33. sgsML Reference Guide 34. sgsML Extended Attributes 35. sgsML Frequently asked questions / FAQ 36. Frequently asked questions / FAQ 37. Support Links Download User Manual Forum (Google Groups) Contact Support Request 1 Feature Request Submit a patch Short URLs Here are some short URLs for the most important pages: Homepage: http://bit.ly/sgcms Homepage Changes: http://bit.ly/sgrss Forum: http://bit.ly/sgforum Changelog: http://bit.ly/sglog sgsML reference: http://bit.ly/sgsML Complete manual: http://bit.ly/sgmanual User manual: http://bit.ly/sguser Download installer: http://bit.ly/sginstall FAQs: http://bit.ly/sgfaqs Support request: http://bit.ly/sgticket Freshmeat: http://bit.ly/sgfmeat SourceForge.net: http://bit.ly/sgsfnet 2 About Simple Groupware Simple Groupware & Content Management System is a complete open source enterprise groupware offering email, calendaring, contacts, tasks, document management, synchronization with cell phones and Outlook, full-text search and many more.
    [Show full text]