Mutations in VPS13D Lead to a New Recessive Ataxia with Spasticity And

Page 1of76 between this versionandtheVersionofrecord. Pleasecitethis articleasdoi:10.1002/ana.25220. through thecopyediting, typesetting, paginationandproofreadingprocess, whichmayleadtodifferences This istheauthormanuscript acceptedforpublicationandhasundergone full peerreviewbuthasnotbeen Arbor, MIArbor, 48109,USA Bart P.van deBart Warrenburg Trinh Vikram Shakkottai Vikram Jun Z.Li Jun 48109, USA. 48109, 10 9 8 7 6 5 4 3 2 1 Affiliations Seong Eunju in Mutations Salem, North Salem, USA.Carolina, USA. paraplegia in ataxia/spastic VPS13D TITLE: RUNNING Department ofClinical Department Erasmus Genetics, MC, NetherlandsRotterdam, the ofPediatrics, Department Section on Medical Forest Genetics, School Medicine, Wake of Winston ofComputational Department Medicine Bioinformatics,&University Michigan,Arbor, Ann of MI 48109, ofHuman Department University Genetics, Michigan, of Arbor,Ann MI 48109,USA. ofNeurology, Department Lübeck,University of Germany ofHuman Department Radboud Genetics, University MedicalNijmegen, Netherlands Centre, The ofNeurogenetics, Institute University ofLübeck, Germany ofMolecular, Department Cellular,Developmentaland Biology, University Michigan,Arbor, Ann of MI MolecularBehavioral&Neuroscience Institute,Michigan, AnnUniversityMI Arbor, 48109,USA. of Departments ofNeurology Departments ofMolecularand and Integrative Physiology,University Michigan, of Ann 3 , PhD, Norbert,PhD, Brüggemann 6,7 , PhD, Tamison, Jewett 1 , PhD, Ryan,PhD, Insolera lead to a new recessive ataxia with spasticity and mitochondrial defects defects mitochondrial and withspasticity ataxia new a to recessive lead VPS13D

Author Manuscript10 , MD PhD, ChristineMDPhD, Klein, 11 *, MD*, BurmeisterMargit PhD, This article isprotected by copyright. All rights reserved. 8 5 , MD,Kievit J.A.Anneke , 2 , MD, SandfordErin, ,PhD, Marija Dulovic Annals ofNeurology

3 , MD, CatherineMD, Collins , 1 , PhD, Sheng,PhD, Li 3 , PhD, ErikJanPhD, Kamsteeg, 1,6,7,12 9 , MD Münchau, AlexanderPhD, *, PhD *, 2

, PhD, Katja LohmannKatja PhD, , 13 , Ayse, PhD, Bilge Ozel

4 ,PhD, Joanne 3 , MD, , 3* , PhD, , 6 , PhD, , *Correspondingauthors: 13 12 11 MedicalNijmegen,Center, Netherlands The Present Address: BioXAddress: ShanghaiCenter,Present Jiao University,Tong China. ofPsychiatry, UniversityDepartment Michigan,Arbor, Ann MIof 48109, USA. ofNeurology, DondersDepartment CognitionInstitute and Brain, for Behaviour, RadboudUniversity

Ann ArborMIAnn 481092200 +31243613396 Nijmegen,HB, 6500 NetherlandsThe Box 9101,P.O. RadboudUniversity MedicalCenter Donders Brain,InstituteCognition and for Behaviour, DepartmentofNeurology 935 van de Bart Warrenburg [email protected] 647+1734 2186 BSRB,1095061 ZinaPitcherPlace MichiganUniversity of MolecularBehavioral& Neuroscience Institute BurmeisterMargit [email protected]luebeck.de 451 82093101+49 Lübeck,23562 Germany MariaGoeppertStraße 1 LübeckUniversity of NeurogeneticsInstitute for LohmannKatja

Page 2of76 Page 3of76 movementdisordersalong theataxiaspasticity spectrum, making downremoval or of function (nonsenseorsplice onmutationsite) one a and missense otheron mutation allele.the Knock includedprogressiveand ofindependentloss ambulation 5.inAll but two lossof patients carrieda patients.5in Diseasepresent onsetranged infancy from years,to39 and weresymptoms slowly patientswas12 Althoughbroad. most presented ataxia,additionalwith or spasticitypredominant was chromosome to was1p36 in found LODthis scoreoffamilya with 3.1. phenotypicThe spectrumin our ataxiaintrusionssaccadicwith ( allin1p36seven families. includedThislarge a with affected siblings5 family with spinocerebellar Exome Results: sequencingidentified compound heterozygous inmutations fibroblastcultures. evaluateda withfamilies recessiveataxia spastic paraplegia. and/or evaluateTo therole of internationalMethods:Inan wecollaboration, independently performedexomesequencing sevenin intrusions,spasticataxiasspastic andparaplegia. identify Objective: To novel of recessive causes spinocerebellarincludingataxias, ataxia with saccadic Abstract: Interpretation: studyOur demonstrates compoundthat heterozygous mutations in and functionalityreducedincludingenergy production. inimpairment mitochondrialalongdistribution Patient axons. fibroblastsshowed morphology altered involvedneurologicalin disorders.

Author ManuscriptDrosophila

Vps13D

Drosophila SCASI ), or), spinocerebellarataxia, recessive, type4, neuronsledtochanges in mitochondrialandmorphology Annals ofNeurology John Wiley&Sons VPS13D the the fourthVPS13 paralog VPS13D VPS13D VPS13D SCAR4. on chromosomeon mutations,we cause Linkage intrusion ( intrusion well striking saccadic as initially intrusions,hence spinocerebellarreferredto as ataxia with saccadic this familydemonstrated earlycerebellaradultonsetataxia with neuropathy aspyramidaland signs, ataxia/spasticityonimpactgene mitochondrial structure and function. families, comprising families, patients5 (Figurehas1), previously indescribed been detail. developmentalanddelay, nonambulatory ishypotonia, 1).(Tablephenotype ofThe onein these 2 yearsoldpatients > have spasticity, ataxia and/or onewhile yearold 2 the patientshows identified, ofidiopathic (~20%) orsuspected recessiveataxiaacases can mutation ain ataxiaknownbe gene clinicallyataxia are geneticallyheterogeneousand thandominantmore ataxias. minorOnlyain fraction Drosophila Here, we reportpatientsHere, 12 7 from heterozygouswithfamilies compound inmutations molecular overlapmolecular with, example,for thespasticparaplegias. heterogeneity, to isthere pleiotropy,alsoas spectrumofataxias the includesalso clinical and >80 recessively, >80 dominantly,or Xlinked inherited geneticallyconditions.defined Ataxiaofsymptomovera is syndromic 400 neurologicalor conditions can thesymptomsolebe of Introduction 4 SCASI), suggestingof that much the heterogeneitygenetic still discovered.remainstobe Inaddition knockout modelpatientderivedand fibroblastssuggests that innewmutations this

Annals ofNeurology John Wiley&Sons 5

SCAR4) . Analysis a. of 13 6, 7 Recessiveof forms Briefly,patientsin VPS13D .All Page 4of76 Page 5of76 140), followedby parametric fully recessivepenetrant analysismodel Merlin.in unaffected usingsiblings theInfiniumHumanLinkage24 Beadchip kit (6000markers, Illumina, WG32 LUB1NextSeq500), to mediumcoverageof46X and(UM1), ~75X NIJ, (alland LUB1, WF1). followednextgeneration by sequencing on Illumina arrays(UM1 paired LUB1:HiSeq2000; andend 50MbCA, USA)(Agilent, V5 KitCopenhagen, atBGI and atGeneDx (Gaithersburg,WF1 MD, USA)] CA,Diego,Sanat USA) (Rostock,Centogene Germany);allNIJ SureSelectXTcases: Human All Exon v3.0USA)kit (Roche,CA, at UM NexteraRapidcore facility;LUB1: Exome Capture (Illumina, kit Inc., NationalAtaxiaby andFoundation “GeneMatcher”. andFormation(NIJ ofthis collaboration was WF1). by publicationfacilitated of funded grants bythe and Rotterdam)local(NIJ orcommercial (WF1, GeneDx,MD)Gaithersburg, clinical exomesequencing respectivelocalIRBs (IRBMED Michigan,UniversityUniversity of Lübeck ethicsof review or to panel,

gave written informedwrittengave consentparticipate to diagnosticin or studieswereresearchthat approved by the ataxia/spasticitygenes) didnot revealmolecular diagnosisa in theseAllcases. patients and relatives USA,Carolina,(North Diagnostic testing (includingWF1). panelanalysisgene of known and Nijmegen Rotterdam (TheNetherlands,NIJ14), Lübeck (Germany, LUB1) and WinstonSalem Reserve Western UniversityUSand (Ohio, geneticallyArboranalyzedinAnn UM1]),[Michigan,USA, In all whole In sequencingfamilies, exome was byperformed exomecapture [UM1:SeqCap ExomeEZ In Family In analysis linkage UM1, wasDNAperformedwithaffecteds,all 5 from the mother7and studies: LinkageGenetic analysis exomeandsequencing For UM1, wereFor two cases sequenced variantand analysis towasthe~10 Mb restricted linkage Patients were identifiedPatients indifferent centers afive with on movementlocatedfocus indisorders Case Patients: Methods:

ATCATTTCCAGGTGTGCTAC)and therespective wasproduct inspected its forsize Sanger and Exons22 and 21(VPS13Dex21F: complementaryDNA (cDNA)by of use reverse transcriptase(RT). PCRwas performedwith primers in cDNASynthesis(ThermoFisher, Kit Waltham,MA, USA) servedas primers tosynthesize the Kit Extraction (QIAGEN, MD,Germantown, USA).OligodTNucleotides ofMaxima the Strand First notshown)(dataPatient andLUB1.1. ForPatient LUB1.1, RNA was extractedusing theQIAmpRNA culturea fibroblast tostudy expressionnonsensemediated levels and mRNA decay Familyin UM1 NIJ: ClinicalNIJ: and exomevariantsequencing described. as calling compound heterozygous, compound a wholedeletion ingene detect hard wholeinto exomeanalyses, they hence can’tbeSince out. ruled allpatients were cases. variants changing under recessiveaVPS13D model. emergedvariants as thestrongestcandidate allin pipeline.Detectedvariantswere rarefiltered for (Europeanpopulation <0.01)frequencyand protein heterozygositywas verified. samples were partsamples 734sample ofa pooledLUB1:call; Variant wascalling described; performedas base(v1.74),Picard recalibration, realignmentandvariant calling wereusing done (v3.3); GATK these wasAlignment usingdone against BWA Human 1K Genome duplicatesreference, were removed using variants(nohits)damaging wasVariantswere performed. called as UM1.1 UM1.4: and follows: ForLUB1, region. and parentsNIJ4, wereWF1 sequencedalsoinitially, and trioanalysisa for All Since expression: Analysisof Nonsense-mediated decay predictionsitesplice and

Copy number variantCopy analysisnumber performedwas allsamples.not on Sincesingle exonic deletionsare VPS13D VPS13D variants were Sanger variantswere confirmed andin segregation the familywithconsistent compound

Authorexpressionhigher is skinin (fibroblasts)blood,thanin we mRNAused extracted from Manuscript This article isprotected by copyright. All rights reserved. TGATTCCTTAGTCCACATCAAC, VPS13Dex22 TGATTCCTTAGTCCACATCAAC, Annals ofNeurology John Wiley&Sons VPS13D can becan ruled out. 11 WF1: GeneDxclinicalwhole WF1: exome R: R: de novode 10

Page 6of76 Page 7of76 VPS13paralogassociateddisease, we restrictedanalysiscases whichin to bothmutations are known. frequencieshumans.in assesstheTocommon typeslossmutation (e.g. of function, inmissense) each availableanimalmodels literature andthe in databases,inand examined of estimates mutation sequencingofcDNA. nonsensemediatedconfirm mRNAdecay (NMD)Effectcause. as ofcycloheximide wasevaluated by withLUB1.1 8cycloheximide hours at 100g/ml for concentration final to stabilizetranscriptand the sequencingindicatedand instabilityallele of the thenonsensewith mutation,we treated offibroblasts wereperformedwith SYBRon Green the LightCycler systemnotshown).(data480 Sinceboth qPCR on splicing:Humanon SplicingFinder (HSF, wemutations.Instead used twoonline prediction slice site to estimate tools theofimpact thesevariants adults only,purposes to our we per nothavedoIRB, cultures fibroblast children from the with splice (c.941+3A>G,c.22371G>C, c.9998+4A>C). Sincewelimited toare perform biopsyskin research for two controls twocontrols (UM1.17,a affected, daughterofan UMCtrl1,and a unaffected marriedinspouse). From withvariationoutput as theinterpretation of CV <10%indicatingdisruptiona of the spliceSSP site. to mammals (SSP, expression of Further, sequenced. VPS13Dthe expression inof and LUB1.1 a controlwas compared tothe falsepositiveofrate <5%.higher thescore, The theprobabilityhigher the isthe splice that site active. scorea generates betweenand with0 score1 a 0.5 of recognizingabout of actual 90% sitesthe and a In addition In tononsense missenseand mutations,wevariantsthree detected at splice sites From theUM1From establishedwefamily, fibroblastcell twopatientslines from (UM1.2UM1.4)and and studiesFunctional inpatient-derived fibroblasts Toassesstheimpact ofoftheloss functionofeach Comparisonofmutation frequencies in

Author Manuscriptß-Actin http://www.fruitfly.org/seq_tools/splice.html and

HPRT This article isprotected by copyright. All rights reserved. , and , YAZ http://www.umd.be/HSF3/ that servedthat reference as genes. These quantitativePCRs Annals ofNeurology John Wiley&Sons VPS13D paralogs VPS13paralogs,we compared phenotypesof ). HSFprovides). consensusa value (CV) ) 12 and SplicePrediction, Site set containing412cells,defined form asfactor [P MitoTrackerofintensity) projectedZstacka imageintensity). (averageFor projectedeach image VolocityElmer) (Perkin toselect mitochondrial objectsstandard (1 deviation above the mean mitochondrialnetworkintegrity wasa selectionperformedby using algorithmin the softwareprogram cellswithsuchobjects >2 thein perinuclear region.Form analysis a factor of as measurement the selected objectssuch per cell was eachincalculatedcell line. also computedthepercentage We of selectedremaining areas correspond tobrightand spherical mitochondria.averagenumber ofThe µm^2circularitylesswith0.18 and than were removed Fiji’sAnalyze using Particles function. The extract thetoppixels.1%brightest quantifysphericalTo mitochondria, any areassmaller than 1.5 wastousedalso generateintensityhistograms.For each 2Dimage, the algorithm was Otsu applied to analyzed. entireimage the For each field. individual, images fromtwo 1117 independentexperiments were ofa mitochondrion,area wasall calculatedselected mitochondria andfor themeanwas obtained for Cambridge,MA) combinationin withZenon the the immunolabelling (Invitrogen, kit Carlsbad, CA) mitochondrialnetworkin fibroblastswaswith antiGRP75stained an antibody1000, Abcam, (1: and LUBCtrl2,L2134,and aka were used. and (LUB1.3 LUB1.4). Inaddition, fibroblasts controlfrom two unrelated LUBCtrl1, lines, aka L2132, linesLUB1,were establishedfibroblast LUB1.1, from theindex andpatient, her heterozygous parents Images wereImages usingzprojectionflattened at maximumintensityusing the softwareopen Fiji, ofimagesstacks were obtained pervisual producetofield images ofin cells~per127totalline. 72 12 for minutes. Through (1.42PLAPON60X Oil)on lens FV1000 Olympus confocal microscope, 68z wasculturedonapplied coverslipsto fibroblasts 40 minutesbefore for 4%infixingparaformaldehyde In In fibroblastsofFamily thewas form asdeterminedLUB1, factor previously described. For For mitochondrialimagingin fibroblast from theMitoTrackerUM1Red CMXRosfamily, (Invitrogen)

Author Manuscript This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons m 2 ]/[4πA m ] with P ] m being theperimeterA and 14 In brief, In the m 13 being the which Page 8of76 Page 9of76 dissection and immunostaininganddissection procedures were larval tissueused analysis.for All 1:1000). secondary antibodieswere Invitrogen (Alexaconjugatedfrom 21:1000,RT). hrs, Standard 1:1000),Horse 11122, Radish Peroxidase (HRP) 123605021,1:1000), (Jackson DLG(DSHB 4f3, (#7596), as(#7596), well as mitochondrial fluorescent (UASmitoGFP,marker #42727). RNAimotoneuronspecific(#38320), driver (D42Gal4,a#8816), Gal4 deficiency lineDf(3L)Exel6117 twoalleles,mutantinallelesand overthedeficiency awhichline, defined oflacks region the homozygous observedof Vps13Dalleles mutant compoundinwere confirmed heterozygous of the flies select select mitochondrialinnetworks the cellRNAibodies expressingof based motoneurons on threshold of temperature.Formroom analysis factor ofnervelarval ventral cordswas performedusingVolocity to exceptstaining, antiATP5A stainingfor whichin was tissue with fixed Bouin’s7 Fixative minutes for at immunostaining, tissues werewith fixed 4% formaldehyde 20 minutes for temperatureat room prior to used theused primaryfollowing ATP5Aantibodies:(Abcam chromosomecontainingentire Vps13D the and locus someneighboringgenetic Forstaining, wegenes. amount ofproteinamountwas determined usingBCA the proteinAssay Kit (Pierce). System), Detection and ATP as calculated (µMoles)generated per minuteper mgofprotein. The Diagnostics), manufacture’sfollowinginstruction. is inmeasuredATP luminometer a (Berthold, MeasurementATPoftheofrate cultured synthesisfibroblastsin individual. andmeasured thewas Mean form calculated. factor was form averagedfactor cellsover 20 per according to manufacturer'sprotocol. onBased singlecell images, mitochondriaareaoutlineand were Vps13Dmutantlines [#56282 (Vps13D ATP was ATP in quantified, usingtriplicate, theATPBioluminiscence Assay Kit (Roche CLSII All fly linesAllconstructsand fly related were purchasedtheBloomington from Center, includingStock Functional studiesFunctional in Author Manuscript

ab14748),1:1000 GFP (Life Technologies A 15 16 All phenotypes For larval For Drosophila

Zstack image.projected cellForbody,each averagean form factorofall mitochondriawas calculated. mitoGFP standardfluorescence(2.5 deviations above mean the fluorescence intensity) froma BonferroniDunnposthoc correction. Differences wereDifferences analyzed statisticallyunpaired ttests,oranalysisusing variance of (ANOVA)with a analyses Statistical

Annals ofNeurology John Wiley&Sons Page 10of76 Page 11of76 individualsrevealedheterozygous compound mutationsin and rs7538691 rs761162 (LOD3.1, data= notshown). exome sequencingin Whole twoaffected identifiedlocusonly single witha 0,which LOD > wasMbcM/ 20chromosome~10 on 1p36 by flanked ataxiaknown mutations, genomewideanalysis linkage recessive, a penetrance under modelfull shown).pGly1190Asp introducesan extra negativeappears chargeand notaffectprotein to stability wasproductmRNA less abundant,suggestingit underwentthat nonsensemediated decay (data not PCRproducts from fibroblastcelllines oftwo demonstrated patients thestopgainthatallelecontaining sequencingverified segregationamong all 12with siblings available DNASequencingsamples. of RT andp.Gly1190Asp) a maternallystopgaininherited mutation (c.3316C>T, p.Gln1106Ter).Sanger linked withinthe region. variantscomprisedThe paternally a missenseinheritedchange (c.3569G>A, heterozygous unique amongall VPS13unique proteinsincluding yeast. LUB1,families NIJ2andare close NIJ3 toorwithinthe Cdomain 1D), (Fig which conservedandis were locatedNIJ1 thein oftheprotein.center Cterminal three The mutations detectedmissense in AmongGnomAD. the fivemissense mutations, Gly1190AspMet1307Ileinand families found UM1and variantswere absentor extremelyheterozygous(<13rare carriers)in the ~120,000individuals inlisted onespliceandsites) presumably changeormilder nonessential(missense splice site mutation).. All carriedafamilies combinationlossoffunction ofone nonsense,mutation (LOF: frameshift,oressential onemissense, frameshift,one essential twoandnonessential splicesite mutations 2). (Table All adultonset spinocerebellaradultonset ataxia eyesaccadicwith 1A, (Fig intrusion Overview Findings Genetic Results UM1 ataxia familyUM1(SCAR4)ataxia : differentIn fourlocations theinUSand Europe,we independently compounddetected Author ManuscriptVPS13D

We have previously reported a familyWe withsiblings, 14of whom five with Annals ofNeurology John Wiley&Sons VPS13D as the onlycause likely genetic SCAR4 6, 7 ). After exclusion After ). of site change. site developmentalglobal delay. has a combination nonsensea of nonessential andWF1 mutation splice clinicalwere perform, ataxia difficult tests to due tohercurrentand age disease as wellfeatures as hypotonia,balanceand coordinatingdifficulties,aswell developmentalglobal delay; as more formal wasWF1, identifiedby clinical exomesequencing(GeneDx, Gaithersburg, MD). displayed WF1 mother carried mother thesame hasvariantand isolated atrophy. optic excludedsequencingwithby exome sufficient coverage ofentire the andcodingregion splice sites. Her mutation inmutation a and missense change also2).(Table NIJ4 atrophyhas carries optic and heterozygous a frameshift andnonessentialframeshift a splice site mutation,and NIJ4carriesan essential splicesite mutation NIJ1and1). (Table NIJ2carrycombination a ofa nonsense and mutation missensechange,a NIJ3 a different ethnicities different with heterozygous compound andNijmegen, the geneticmovementclinic Rotterdam,in Netherlands, the unrelatedfourcases of in Patient LUB1.1 Patient in shown).(data not allele1C).indeedunderwent NMD NMDdecreased (Fig ain expressionresulted level about 5060% of withTreatment cycloheximidestabilized mutatedallele confirmedthe and nonsensemutated that the index cDNA of the patient allelerevealed nonsensethe with the less tobe mutation abundant. paternala and missensechange (Ala4210Val,rs746736545). SimilarFamily to sequencingUM1, of compound heterozygous compound mutations in (data notshown).(data At theForest At SchoolMedicine, Wake of North USA,Carolina,WinstonSalem, additionalone case, Additionalcasessporadic

Family LUB1Family : OPA1

In sistersIn two affected ofa German withataxia familyspastic 1B), (Fig we detected

Author[c.1156_1157del(p.Leu386Glufs*2)]. A second (biallelic) inmutation Manuscript : AtRadboudumc : expertthe centre for genetic movementdisordersin This article isprotected by copyright. All rights reserved. VPS13D Annals ofNeurology John Wiley&Sons including aincludingnonsense maternal mutation (Tyr1803Ter) VPS13D mutations were independently identified OPA1 was Page 12of76 Page 13of76 features, neuropathy,features, and myoclonusbut no intellectualdisability distinct eye phenotypedistinct areavailable onlinesupplement ofthat the in reference NIJ4 and NIJ4 were severely withageWF1 affected an onsetat in year oflife.the first In addition toataxia severe debilitating (wheelchairboundyrs).by17 age phenotypichis originatesdifferenceWhether from more phenotype.oculomotor By NIJ1ahadcontrast, earliermuch 5 onset(< yrs) and weresymptoms more familyLUB1were theirinonsetand clinicalUM1,phenotypessimilar exceptto different a for demonstrated primarilydemonstrated ataxiaadultonset with distinct macrosaccadic intrusions Onset ranged Onset infancy earlyfrom adulthood.to UM1The assignedpreviouslyfamily, she carriesshe additionalan inmutation neuropathy,and NIJ4suffers developmental from delay,andseizures, opticatrophy. Coincidentally, (see (see methods details).for Confirmatorytranscripts. analysisintronic spliceof variants region couldnotbe performedat this time arehencemutations not completeconsidered LOFallelesthey as allowmay correctly some spliced 0.890.21, from suggestingto reductionpredictedin ability.splicing twospliceThese nonessential site HSFalgorithm the wouldand against anargue effect on splicing.However, theSSPscoredropped onimpact of recognition splice Forsite. this c.941+3A>Gintronin9, theCVvariation wasby 0.83% belowHSF’s cutoff. 10 SSP’sscoredroppedprediction 0.93 0.62 from to suggesting ifa any, mild, invariantspliceconsensus For sites. c.9998+4>Cintron49,inCVvariation was 10.57%,thus just washence classifiedLOF. splicevariants Theregion inand NIJ3 however, arenotwithin WF1, on splicingeffect oftheinvariant splice acceptor of intron 18 site NIJ4,in 2),c.22371G>C(Fig which predictionsplice site programs. As expected, HSFbothprograms, SSP,and strongly predictedan All cases exceptAll whichcases for young,washad eithertoo WF1, ataxia orspasticitycore a as symptom. To estimateTo theofimpactsplice site changes the thetranscript,on we twouseddifferent Clinical Clinical findings VPS13D

Authormutations environmentalorother or genetic unknownisfactors Similarly,this time. at Manuscript This article isprotected by copyright. All rights reserved. OPA1(Optic 1/MitochondrialAtrophy LikeDynamin GTPase) Annals ofNeurology John Wiley&Sons 6 . Videos of the clinical Videos of the andexams . the 7 . The two. The sisters from 7 , with pyramidal, SCAR4 , in-silico (animal phenotypes(animal for both animals,while both inmutations much is much about known MGI2444207, andMGI2444207, MGI2448530]Mutations 3). (Table in homologs inhomologs the twomodel organismsand database fly mouseCG2093[fly LOF/LOF LOF/LOF mutationsin in 41/45 casesby 41/45 in LOF/LOF inmutations data. a isScore) genebased intolerance scorederived allele infrom wholefrequency exomesequence expected. Forexpected. most sensitiveas toLOFmutations,with theoflowest ratio theofnumber variantsobservedover affectedby spasticparaplegia without ataxia, with earlyin onset adulthood. whichexplains optic butnotatrophy theadditional the seizuresthedevelopmentaland delay. NIJ2 was LOF in eachin paralogLOF in theExAC Aggregation(Exome Consortium) browser. Again, VPS13D VPS13A/C,paralogs– B, D and chorea acanthocytosis chorea isin caused 29/31cases by inmutationsLOF/LOF duplicatedtheinvertebrate evolution into mitochondrialintegrity. other subjects.other aand changeLOF mutation,contrastin to thecombination ofa missense LOF a andin mutation the be might severelymore affected due totwo severe mutations a including nonessential splice site A similar A wastrend observedhuman3):in populations(Table RVIS (Residual IntoleranceVariation Yeast Yeast Among 22 Amongthe paralogs, vps13 is among among isthe most mutationintolerantofhuman also genes. thecompared frequency of We VPS13paralogs, is implicatedis manyincellular functionsincluding sporulation, organization,Golgiand AuthorVPS13D Manuscript

VPS13D

VPS13C , , theprobabilityLOF of intolerance,pLI isscore, 1,virtually Indeed, certain. 18 VPS13B During evolution,metazoan twoduplication events rise gaveto three VPS13D VPS13D This article isprotected by copyright. All rights reserved. specific specific function, we phenotypesreported compared of VPS13 . . cases. Drosophila are unavailable). are VPS13Aand C is the intolerantmost to mutations has RVISthelowest scoreof percentile, 4.23, 0.14 suggesting 29, 30 VPS13B, VPS13A In summary, In Vps13 (CG2093)ortholog an is of Annals ofNeurology John Wiley&Sons appear tolerablemore earlyduring development and 2428 and Parkinson’s3/4diseaseinandcases by VPS13C Vps13D VPS13D (updated reference from / VPS13D is intolerantis tocompleteLOFof both embryoniccause lethality in VPS13A,

PatientsNIJ3and WF1 20 , mouse: MGI2444304, VPS13A/C, 23 VPS13D Cohensyndrome 19 which further ). Sincenot). emerges 21 Page 14of76 , , Page 15of76 Vps13D ofcoding region larvaelethalitystage. was This withconfirmed two independentlines containinglarge insertions in the mitochondrialin function neurons. observationssuggesta roleVps13Din regulating for mitochondrialmorphology potentiallyand also complexity of themitochondria of network withcoinciding enlarged,isolated mitochondria. These Vps13DinRNAi significantresulted a reduction in formquantified (Fig consistent2C),factor withloss a mitochondriaspherical2B). (Fig Compareda RNAito linecontrol targeting luciferase, knockdownby hypothesizedofloss that markers of markers organellesother ER,(Golgi, lysosomes nucleus;and data the shown). not tissuesothertheseinyoung larvaeshown). (not differencesByno werecontrast, detected cellular for objects.enlarged abnormalThis mitochondrialappearancewas present theinlarval2A) (Figand brain ofInstead forming mitochondrialfine innetworks individual mitochondriaappearcells, as singular, Consistent with Consistent lethality,we deletionobservedofthat missense/LOFornonessential splice/LOFmutations. mitoGFP targetedmitoGFPspecifically mitochondriaof to theRNAi neurons,depleted enablescharacterization further Vps13D’s autonomous of functionneurons.in By coexpression of motoneurons. This allowsmotoneurons.survival This larvaefor to3 of the alleles, being likelyalleles, being incompatiblewith life, withconsistent ourofonly finding heterozygous compound Since the only Sincethe vps13yeast proteinhas previouslyimplicated been in mitochondrial function, KnownCG32113 as alsoin Vps13D showsflies, fly 33%proteinidentity human to the (Tablegene 3). The abnormalThe mitochondrialnetworkneuronalin cell hypothesizebodiesled us to loss ofVps13D that Vps13D We thenused We RNAimediated knockdown allele,hence rulingoutsecondary mutations of as lethality.cause the disruptionin Vps13d Author ManuscriptVps13D

lethality disruptedmice,in flies for , including compound, heterozygous containinganimals one each copy of Drosophila Drosophila This article isprotected by copyright. All rights reserved. Vps13D altermaymitochondria. Inearly 2 isand lethal mitochondrialcauses defects Vps13D Annals ofNeurology 31 John Wiley&Sons to inhibitexpression to of led toseverealterations mitochondrialin morphology. rd instarstage atpupal(deathstage), which Vps13D do not surviveinstar2nd beyond Vps13D 15 specifically in we observedenlarged nd instar larvae beforeinstar

29 we mitochondriaVPS13Ddeficientin fibroblasts. affected fibroblastscompared controls 4J).to (Fig observationsThese suggeststructural defects in analysis form factor also revealedsignificant a reductionin degree of the mitochondrialbranching in the but 91%and but 67%ofofaffected cellsfibroblasts subjects’ 4I).Consistent(Fig with the 4H).cellsperinuclear(Fig In region,the such objects were identified clustersin (≥3) of~10%normalin ofsuchnumber abnormal mitochondrial objects6fold~higherwas thein affected controlcompared to each pixelsimage and from selectedbased circular onobjects computed circularity score. average The ofabundancethebright sphericaland eachinmitochondria cell weline, extracted thetop 1%brightest clustersinmostly atand magnificationhigher appearedbe donutshapedto 4G).(Fig To quantifythe containedoften unusually and significantlybright sphericalmore mitochondrial whichobjects, were was branches observed bothincontroland patientcells, the perinuclear of onlyregions affectedcells mitochondriabrighter 4). (Fig the typicalnetwork mitochondrial objectsof elongatedandWhile inaccumulates mitochondriaain membranepotentialdependent manner, revealedsignificantly Stainingfibroblasts. fibroblastsaffected from the of subjects familyUM1MitoTracker,with which defects mutationsfor in mitochondrialmachinery. fission/fusion theinlocationsCNS (Fig 3). distribute failureThis to mitochondriaresembles previously described mitochondriawas progressively concomitantwith reduced distance increased thecell body from segmentalnerves(Fig 3A,B)neuromuscular and junction (NMJ)synapses3C,(FigD). density The of led motoneurons tostrong impairment theindistribution ofmitochondria axonsperipheralin in woulddeleteriouslydistribution the impact oftomitochondriadistal regionsofneurons. neurodegenerativeneuropathies.anddiseases

Given these fly data,Given these fly we investigatedalso mitochondrial and morphologyfunction humanin Patient-derivedshowfibroblastsaltered mitochondrialmorphology Previoushave studies linked deficiencies in mitochondrialtraffickingto distal neuritesin

Drosophila data, Page 16of76 Page 17of76 OPA1 NIJ4’s presentationNIJ4’s may complicatedbeby additional an inmutation bemayThis severe more thanthecombination of missense/LOFinother found addition,cases.the In additionalandmutations, as NIJ3 carry splicenonessentialregion variantsinWF1 additiontoan LOF. motorincludingdelay, and yetambulatory.was not patients threeThese havealso differentortypes patient, youngest of 2age atthe last evaluation, presentedWF1 with hypotonia,developmental delay, includedlatter The withtwoadditional cases an developmental delay phenotypeNIJ4).and(NIJ3 The ataxia,predominant spasticataxia, tospasticparaplegia without ataxia, and ataxia phenotypes.plus is mutations characterizedby movementdisorders theofataxiaspasticity spectrum, ranging from that about5%that ofpatients carry twoindependent Mendelian diseases. of effect the twomutations linkedto mitochondrialdysfunction. Interestingly,datahaverecent shown chromosomeincluding1p36 the LUB1.1 comparedLUB1.1 tocontrol fibroblasts(Fig 5E). structuralThese mitochondrialwerechanges accompanied by aproduction reduced ATP ofrate mitochondrialprobandbranching of fibroblastscompared totwo unrelated healthy 5D).controls (Fig analysisForm factor immunostainingof GRP75 revealedsimilar a reduction theindegree of fibroblastsexpressed reducedlevels of proteinmitochondrialGRP75 controlscompared 5AC).to (Fig deficits. Our deficits. includedalsostudy largea ataxia familywith ( andtwelve linkpatients VPS13D/Vps13Ddefects patientin fibroblastsand in to mitochondrialflies can’t be ascertainedbe can’t based onsingle case. this note, Of homozygousor compoundheterozygous In this study, weIn this have identifiedseven differentcompound heterozygous inmutations Discussion The corephenotypeThe of theelevenabove patients of2agethe with compoundheterozygous Independentanalysis of fibroblastsofproband the of familyLUB1affectedthatdemonstrated the is inimplicatedalso mitochondrial conceivablefunction. is It therethatan bemay interactive

Author Manuscript This article isprotected by copyright. All rights reserved. VPS13D gene. Annals ofNeurology John Wiley&Sons ) and linkageSCAR4and 10Mb) toa region on OPA1 34 inheritance However, digenic . protein. Theencoded by VPS13D VPS13D in OPA1

mitochondrialdisease. Although it is Althoughit currently uncertainwhether thisis extrapyramidaland signsas such myoclonusand Infertilitydystonia.in wascases.twomale noted Frequentlyobservedneurological comorbidities in ourseriesincluded peripheral axonal neuropathy analyses as (conducted described) paralogs, paralogs, outknocking diseaseassociated these mutations areLOF/LOF (see3). IncontrastTable other to VPS13the residualVPS13D humansin criticalfunction survival.bemay addition, ExACIn for the pLIserver’s embryonic leadsto lethality,notaand single LOF/LOF wasmutation identified, suggesting that some splice sites, no secondspliceno sites, inmutation the addition, thereaddition, was ofourvariabilityonsetinpatients, whichage in notalsounusualis ataxias. for perturb proteinhomeostasis perturb thein fly. rare casesrareof Parkinson’sdiseasegenetic with mitochondrialdysregulation mitophagy.and seizures, and otherandseizures, complex phenotypescommonly earlyaccompany onset recessiveataxias. Behrsyndrome. as known causemutations an extendedmultisystem phenotype includesthatataxia spastic andparaplegia, disorders: as there arethereother as examples of genes (e.g., asalternativesyndrome an incase diagnosis likely. this not is mutationpromoteris that notpenetrant,as does the notfather have optic atrophy, we believe Behr movementdisorder, myopathy,epilepticseizures, cognitive declinebehavioral and changes, ataxia or spasticparaplegiaataxia or or a mixedto phenotype spastic ataxia, of The overlapThe betweenofataxias genetic forms hereditaryand spastic paraplegiaswell is recognized, VPS13D encodes a largea encodes protein(4388 amino whoseacids), paralogscause neurological other AuthorVPS13A Manuscript mutations causemutations choreaacanthocytosis, characterized byseverehyperkinetic a 38

VPS13D’s

Hence, although Hence, weexclude cannot intrundetectedan 20 OPA1

VPS13B Annals ofNeurology SPG7 John Wiley&Sons wasgene bydetected exomenor by copynumber Drosophila VPS13D is involvedis Coheninsyndrome ) when) canthat mutated to either pure rise give related, infertility related, ofa is known feature (our results)(our and mouse(MGI:2448530) 36, 37 36, OPA1 developmental delay, and coding andregions 40, 41 and VPS13C 29 onic oronic Most of 23, 39 2 In and and in Page 18of76 Page 19of76 or compoundheterozygous or missense mutationsobserved werenot here. As with manymissensewithvariants inreported databaseshomozygosity,including predict difficult to pathogenicity any novelof variants. biallelic missense Although our Althoughconvincinglystudy establishes missense/LOF inmutations missense/LOFmutation carriers, theclinical variedpresentation ourin Inseries.addition, homozygous problems. includingwere symptomatic, one whoparent 90slived withoutinto their apparent neurological haploinsufficiency, to as ofeachparent one of thecasesreported herewas haploinsufficient, butnone Clinically,predicting the phenotypenew in from mutations paraplegiaataxia/spastic and mitochondrialpathology, manyquestions addressed.remaintobe function in function Mitochondrialfibroblasts. dysfunction associatedis with severalataxias other spasticand abnormal mitochondrial morphologybothinpatient cell and lines,and flies reducedmitochondrial workis further warranted While pindown to the precise mitochondrialdefect,we have shown affects mitochondrial function. mother.subject’s The dominantexistent broaderand/or severespectrummore Lastly,ofphenotypes. theother severeNIJ4,case, hadco a splicenonessential site/LOF mutations,other mutation typecombinations associatedbemay with a ataxiaspasticity.and/or as suggestedSecond, by more severeNIJ3the whoandcases, carry WF1 ourcurrentFirst, data collectively to missense/LOFpointmutations tending tocause relatively pure Our dataallowgenetic some yetcautiousfirst,for speculations on genotypephenotypecorrelations. i.e.probabilityscore, the a thatbemay gene intoleranttohaploinsufficiency, for contrast contrast toallother

Author ManuscriptOPA1 VPS13 3). (Table genes

OPA1

Annals ofNeurology John Wiley&Sons 42 We did not, however,didnot, observepredicted We the intolerance VPS13D willEven difficult. be for 43 whichwas observedalsoin the 42 VPS13D it will it evenbe more VPS13D VPS13D is a largea is gene as causing as is 1,inis OPA1 also

in ataxia.in implementedalsoand VPS13D aautophagy,in process we that have recently tobereported involved ubiquitinbindingprotein affectingand mitochondrial and fission fusion, While wasthis manuscript underreview, etal.published Anding findings showingVPS13D tobe a paraplegias. target mitochondrialdysfunctionand could that becommonto other formsofataxiaspastic and biologydiseaseprogression.and methods These willtestingpotential allowalso of for therapies that inexperiments the geneticmodel out helpmayfly us parse the cellularrole ofVPS13D mitochondrialin patient fibroblastsand neuronsdifferentiated induces pluripotentfrom stem cellswith additionallycan disrupt mitochondrial distributionCombiningneurons.in the mutationsVarious in mitochondriallead toproductionthegenes of reactiveoxygen species, and/or fusion assess mitochondrialAlterationsmorphology. of mitochondrialdynamics as transport,such fission, underpinningsofthisarestill defect investigation, under including electron microscopy studiesto lackingVps13D neurons patientand fibroblastscontaining inmutations unexplainedataxias. asparaplegias Friedreich’ssuch ataxia, Neurology, RadboudNeurology, university Netherlands)centre,medicalNijmegen, the and M. Jongen,MD, PhD discussiononuseful VPS13 evolution; Post,Bart MD, JolandaPhDSchieving,and MD of(Department (Dermatology,University ofMichigan) biopsies,fibroblastfor SoochinCho (CreightonUniversity) for Kubisiak, Thomas and FraukeHinrichs excellentfor assistance;technical Johann Gudjonsson,MD Philipp Dr. Capetian clinicalfor Family evaluationof referring LUB1andto the study. LindaGates, We thankpatients We the theirwillingnessfor participate patienceto and during ourresearch. thank We Acknowledgment 51

Author Manuscriptallpotentiallycan aberrantinmanifest distributionof mitochondriathroughout thecell.

SCA28, Annals ofNeurology John Wiley&Sons 45

POLG , 46 and SPG7 50 , VPS13D 47 consistent withconsistent our findings, as well as somein as cellularvitroin model of , theprecise biological, in vivoin Drosophila 49 which

Page 20of76 Page 21of76 Lillyand (CK).Foundation Schilling HospitalSchleswigHolstein (“GutesAM), andcareer Tun!”, a development award theHermann from university(BvdW) BioblastcentremedicalPharma and (BvdW),Foundation the oftheUniversity underBvdW)the ERare3 frame of the network HersenstichtingPREPARE, the (BvdW),Radboud innovationresearch programunder theaction ERANET N° Cofund 643578, ZonMW (9003037604; F32NS098611and(CC), (RI),theNational Ataxia Foundation European(MB), Union’s Horizon 2020 (Neurology,CaseReserve) providing importantclinicalfor Western data. ofNeurology,(Department MC,Erasmus Rotterdam, theNetherlands) andAasefMDShaikh, Author Contributions: Author This workwas This supported USby the National ofHealthInstitutes NS056780grantsNS069844(MB), Noneof theauthors reportCOI relevanttothereported Seework. disclosuresdetailed other for COI ConflictsPotential ofInterests: MD,RI, ESe, EJK,CK, KL,MBBvdW,CC, tocontributeddrafting thetextpreparing and the figures MD,RI, ESe, EJK,JT,SL, ABO,ESa, NB, TJ, AJAKcontributedacquisition to analysisanddata of AM, VS,CC,JZL, CK, KL,MB BvdW, contributed totheconception designof and thestudy

Annals ofNeurology John Wiley&Sons disorders. Eurdisorders.J Hum Genet. 2016 Oct;24(10):14606. ataxiaspasticandparaplegia uncovers novel associationsgenedisease and unanticipated rare vanBP,de MI,deSchouten Warrenburg BotClinicalST, et al. exomesequencing cerebellarfor 11. 2819 samplesfrom reflecting 1000 families.Eur Hum Genet.2017 J Feb;25(2):17682. BertoliAvella TrujillanoD, AM, KandaswamyKumar etal. ClinicalK, sequencing: exome results 10. using maps sparse Natgene trees. flow Genet. 2002Jan;30(1):97101. Cherny AbecasisGR, SS, Cookson CardonMerlinrapid LR. analysis WO, ofdense genetic 9. withinvestigatorsinterest an theinsame Hum Mutat. gene. 2015 Oct;36(10):92830. N,Schiettecatte Sobreira F,ValleHamosh A. D, GeneMatcher:a matchingtool connecting for 8. intrusions.saccadic Ann 2003 Neurol. Dec;54(6):8248. Bespalova Swartz S, Lietal. BE, Pathogenesis I, clinical of insigns recessivewithataxia 7. NAnnmyoclonus. AcadY2002 Sci. Apr;956:4414. ataxiacerebellar saccadicwith intrusions,increased saccadic speed,sensory neuropathy, and Swartz Burmeister M,BE, JT,RottachSomers BespalovaLeighKG, IN, RJ.ofinheritedA form 6. phenotypes,and genes, Movpathways.Mar;32(3):33245.2017 Disord. M, Synofzik SchuleR. Overcomingthedivide between ataxiasspasticandparaplegias: Shared 5. ataxia.familialcerebellar JAMA 2014 Neurol. Oct;71(10):123746. BL,Lee Fogel H,Deignan JL,etal. Exomesequencingin theclinical diagnosisof sporadic or 4. 2017 Disord. May;32(5):7245. Recommendationsof theInternational ParkinsonMovement Disorderand Society force.task Mov Lang Marras C, A,van BP,de et al. Warrenburg Nomenclatureof genetic movementdisorders: 3. proposal anda for classification. Cerebellum 2017;4:3.Ataxias. BeaudinM,Rouleau KleinDupre GA, CJ, N. Systematic autosomalreview recessive of ataxias 2. 2014;5(3):586603. E,Burmeister Sandford andM. Genes hereditarytestingin genetic ataxias. Genes(Basel). 1. LiteratureCited

Author Manuscript This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons Page 22of76 Page 23of76 8. FrenchinCanadianmutation with choreaacanthocytosis.families Neurogenetics. Sep;6(3):1512005 C,VelayosBaeza DobsonStone Jansen A,A, et Identification al. VPS13Aofa founder 23. PredictsVariation Gene DosageSensitivity. Sep;11(9):e1005492.PLoSGenet.2015 PetrovskiS, Gussow etal. Q, AB, ofIntoleranceRegulatoryThe Wang Sequenceto Genetic 22. Neurochem.acanthocytosis. J Feb;92(4):75966.2005 Y, TomemoriIchiba M, A,Kusumotoetal. A genetargetedmousechorea model for 21. Brain.PLoS the 2017;12(1):e0170106.One. YeshawJJ, Vonk F,etPintoal. Drosophila RequiredIsWM, Vps13 ProteinforHomeostasis in 20. VPS13gene Genomics.Sep;84(3):53649.family.2004 VelayosBaezaVettoriCopley A, A, DobsonStone RR, C,Monaco Analysis AP. human the of 19. Feb;216(2):299301.Biol.2017 MyersPayneMD, Vps13 GS. Cdc31/centrin: and partnersinPuzzling membraneCelltraffic. J 18. mutations.Brain.Jan;138(Pt2015 1):e321. CarelliSabatelli V, M, Carrozzoet al. syndrome' 'BehrR, with OPA1 compoundheterozygote 17. 31;33(31):1276478.Jul2013 MAPKKK the synapticstructure, axonalregulate Wnd/DLK transport,injuryand signaling.J Neurosci. KlinedinstHaenfler S, X, X, Xiong JM,Wang CA.Collins Independentpathways ofdownstream 16. transportfast ofmitochondria Drosophilain axons.Mol motor Biol Cell.Apr;17(4):205768.2006 AD, Pilling HoriuchiD, Lively Kinesin1Saxton CM, Dynein and aretheprimary WM. motors for 15. morphologyhumanin PLoSfibroblasts. 2010One.27;5(9):e12962. Sep Voges Grunewald A, L, et al. MutantRakovicA, impairsParkinmitochondrial and function 14. analysis.image NatMethods. 2012 Jun 28;9(7):67682. SchindelinArgandaCarreras et FriseJ, Fiji:I, E, an al. platformopensource biological for 13. an onlineFinder: bioinformatics predicttool to splicing Nucleic signals. Acids Res.May;37(9):e67.2009 HamrounFO, Desmet D,Lalande M, Claustres CollodBeroud G, M,Human Beroud Splicing C. 12.

Author Manuscript This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons Am JHum Am Genet. 2016 Mar3;98(3):50013. byexomesequencingin cohort large ofa genetic disorders. Med.Genet 2017 Jun;19(6):66775. R,Del Rosario Pfundt M, VissersDetection L,et al. ofclinically variantsrelevant copynumber 35. Variation.GenomicEnglN J Med. Jan 2017 5;376(1):2131. HarelLiu Poseyet al. JE, T, ResolutionP, ofDisease Phenotypes Resulting Multilocus from 34. SciRep.mitochondria. 2016 08;6:18981. Jan Lee HC,Y, Yu ChenKC, et al. Inner membrane fusionmediatesspatial distribution ofaxonal 33. Feb;14(1):128. BalohMitochondrialRH. dynamicsperipheraland neuropathy. Neuroscientist. 2008 32. inactivationgene Drosophila.in 2007Nature. Jul 12;448(7150):1516. ChenD,Schnorrer Dietzl F,etal. G, A genomewidetransgenicRNAi libraryconditional for 31. 2017Clin 01.SepGenet. Parkinson'sdiseaseconfirmsVPS13C as acause rareofautosomalrecessive disease. Parkinson's B, SchormairKemlinkD, Mollenhaueret DiagnosticB, al. exome sequencingearlyonsetin 30. Parkinsonism CausesParkinsonism Mitochondrial Dysfunction IncreasesandPINK1/ParkinDependent Mitophagy. S, LesageDrouetV, Majounie et al. LossE, of VPS13C inAutosomalRecessiveFunction 29. Coheninheterogeneity syndrome. Med J Genet. May;43(5):e22.2006 HolderEspinasse Seifert M, SprangerS, etW, al. Mutational spectrumof and COH1 clinical 28. syndrome,tissueexpression,and oftranscriptCOH1.variants Hum2009Mutat. Feb;30(2):E40420. HolderEspinasse Seifert M, KuhnischetJ,al. W, Expandedspectrumin mutational Cohen 27. largescale genotypephenotypeAmJscreen. Hum Jul;75(1):1227.2004Genet. KolehmainenLehesjokiJ, R, etal. AE, Wilkinson DelineationCohensyndrome of a following 26. by Cohenaffected Humsyndrome. J Genet.2007;52(12):10117. E,Pescucci Katzaki Uliana C, et al. ClinicalV, molecularand characterization ofItalian patients 25. variabilityAmJ HumCohenin syndrome. Jul;75(1):13845.Genet. 2004 HenniesA,RauchSeifertHC, et al. Allelic heterogeneityW, theinCOH1 explainsgene clinical 24.

Author Manuscript This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons Page 24of76 Page 25of76 2009 Jul;36(4):40928.2009 AtaxiasJ. Finsterer with autosomal, Xchromosomalormaternal inheritance.Can Neurol J Sci. 46. 2011 Genet. Oct;7(10):e1002325. ainmutations spasticataxianeuropathy linkedsyndrome to proteases.mitochondrial mAAA PLoS PiersonBonn Adams D, TM, F,et al. sequencing identifies Wholeexome homozygousAFG3L2 45. MitochondrialImpairs Biogenesis Cells,inMice HumHumans.Mol and AprGenet.201721. JasoliyaMJ,McMackin PerlmanMZ,SL, CK, CortopassiHenderson GA. FrataxinDeficiency 44. ofmanifestations theopticatrophy Curr1 mutation. Opin Ophthalmol.2016 Nov;27(6):47580. Rizzo ChunBY, 3rd. optic atrophy: Dominant JF, on theupdates pathophysiology clinicaland 43. from: ExomeConsortiumAggregation (ExAC).Cambridge, MA2015 2015/01/16/];[updated Available 42. 2009 Hum Aug;17(8):10769.Genet. inmutation two brothers Cohensyndrome,with cutisverticis and gyrata sensorineuraldeafness. EurJ MegarbaneA,SlimR, Nurnberg Ebermann G, P, I,Bolz A Nurnberg HJ. novelVPS13B 41. Cohen of syndrome.HumMutat. 2009 Sep;30(9):E84554. BalikovaLehesjokiI, AE,Ravel et de DeletionsTJ, al. theinVPS13B (COH1) as a causegene 40. Neuropsychiatr2011 Jul;156B(5):62031.Genet. VPS13Avariations the in patientsin withgene choreaacanthocytosis.Med Am J B Genet Nakamura Tomiyasu A, al.M,M, NovelIchiba et pathogenic and mutations copynumber 39. 2017Clin Feb;91(2):199207.Genet. LA, DemainConway NewmanGS, Genetics of mitochondrialdysfunctionWG. infertility.and 38. paraplegia spastic type7:a ainstudyDutch large cohort.Brain. 2012 10):29943004. Oct;135(Pt KL,van van derGassen deCD,Heijden Bot ST, al. Genotypephenotypeet correlationsin 37. causesgeneticof spasticataxias. Neurology. 02;79(14):150714.2012 Oct ST, Bot de MA, Vermeer S,Kremer Willemsen HP, van de BP. Reviewing theWarrenburg 36.

Author http://exac.broadinstitute.org. Manuscript This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons developmentalwith delay.2016 26;5.Elife. Jan M, Kim SandfordE,Gatica MutationD,et al. inATG5 reducesautophagy leadstoataxiaand 51. RegulationRequired the for ofMitochondrial Clearance.Size and CurrBiol.2017 30.Dec AL, Anding C, Chang Vps13DWang et al. TK, EncodesUbiquitinBinding a Proteinthat Is 50. Med.A):107.Nov;88(Pt2015 Cortopassi Hayashi G. inG, Oxidative inherited stress mitochondrialFreeRadic diseases. Biol 49. ataxia.CerebellumAtaxias.2015;2:16. D,Shanmugarajah Bargiela P,Lo MitochondrialC,et al. pathology progressivein cerebellar 48. ComponentoftheMitochondrial Permeability TransitionMolPore. 01;60(1):4762. Oct Cell.2015 ShanmughapriyaRajan HoffmanS, S, etal. NE, anIs EssentialSPG7 and Conserved 47.

Author Manuscript This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons Page 26of76 Page 27of76 protein protein ( stabilizedexpressionshowed andlevels similar treatment. upon cycloheximide.tracesThe are representative 2 of sequencingruns. nonsensemutated The allele got ofcDNAsequences the c.5409C>A beforemutation and panel) (topafter (lowertreatmentpanel) with PedigreeofFamily LUB1with in mutations the twoaffectedsisters,shown by blacksymbols. filled A. domain. domain. appearmissense mutations cluster to twoinoneregions, in the middleand neartheotherC the domainbinding (aa32763558), C:VPS13 Cterminal 39834129).domain (aa different five The (Ubiquitinassociated)like26272679),domain (aa VPS13SHR:SHORT transcriptionROOT factor VPS131stNterminal N1: 2115),domain N2: (aa VPS13 2nd Nterminal (aa137356),domain U: UBA 1. Figure Legends: Figure and/or fruitfly. Met1307Leuorthologs, and Ala4210Valconserved are mammalsinchickenand butnotzebrafishin variousacross species. While Gly1190Asp,Asn4107Ile,and conservedGly4149Ser are allin VPS13D diamond. Mutational diamond. status is givenbelow individualeach with together therespective laboratory ID. individualsbymarked symbols.are unfilled nine unaffectedaresiblingsThe shown open anin Pedigree ofFamily Pedigree UM1.siblings Affected arebyindicated black filled symbolswhile unaffected http://www.ebi.ac.uk/interpro/protein/Q5THJ4with the) identified missense mutations marked: E

Multiplexataxia compound families heterozygouswith in mutations

Author ManuscriptAmino acid. sequencealignments of theregions surroundingeach missense mutation This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons D. Predicted domain mapsofVPS13D VPS13D

Vps13D neuronal cellneuronalbodies. Scale 50µmBars:and (bottom) (top) 5µm Zplanesconfocal ofareas indicatedby dashed boxes,highlightingthe mitochondrial morphologyin Figure 2.Disruption Figure of mitoGFP (green)mitoGFP along control(leftwithand panel) motoneurons (viaD42Gal4)with simultaneous expression of fluorescent mitochondrialmarker mitochondrialmorphology cellbodies.motoneuronin High magnification singleconfocalof Zplanes indicatedbyareas dashed boxes,highlightingthe A morphology. error.standard p<0.001indicates*** (Students Ttest). Vps13D mitochondrialnetwork(basedon mitoGFP)neuronalin cellsbodiesexpressing controlRNAi (white)vs. . Ventral nerve cord nervecord (VNC),stained Ventral . mitochondrialfor markerofATP5A, control ( mutant( RNAi n=50(grey).neurons per condition 5(from differentanimals). barsError represent

Author ManuscriptVps13D

Vps13D 11101/11101 This article isprotected by copyright. All rights reserved. in in the , leftpanel) , Drosophila Annals ofNeurology John Wiley&Sons Drosophila Vps13D central nervous systemaffects mitochondrial C. larvae.HighBottom:magnification single Quantification ofQuantification formanalysis factor of the (right panel) RNAiexpression.Bottom: B .Representative ofimages w 1118 , , right panel) right

and Page 28of76 Page 29of76 the VNC the (proximal, top) distantandVNC from the bottom)(distal, areshown. Scale10µm. Bar: marker mitoGFP controlRNAi(green) andof Vps13D RNAi knockdownNerves animals. (RNAi) near A mitochondriatodistal axons. Figure 3:Knockdown Figure of represent standard represent error.indicates **** p<0.0001 (Students Ttest). RNAiControl Proximalcondition. Region n≥10 individual5 differentnervesanimals. Error from bars motoneurons expressing motoneurons controlRNAi (white)vs. synapses/animal).Error bars represent standardindicates **** error.p<0.0001 (Students Ttest). RNAin=5(eachanimalsncondition. representsavg. the mitochondrialcontent ofNMJ≥6 2.5µm (right).2.5µm panels)shown highlight (right to mitochondriaoccupying the synaptic region.ScaleBar: 20µm (left) and region.postsynapticHigh magnification images ofsynaptic the region by(indicated dashed box)the are Vps13DRNAi animals.knockdownHRP (red) labels neuronal membrane, while(blue)labels DLG NMJ axonsmotoneuron expressing mitochondrialfluorescent markermitoGFP ofcontroland(green) regions ofregions motoneurons controlexpressing RNAi vs.(white) ofQuantification the mitochondrialperareacontent withinnerves segmental proximalin and distal . Segmental nerves (HRP,containingSegmental red) . motoneuronaxons expressing mitochondrialfluorescent D Author Manuscript . ofQuantification the mitochondrialinNMJcontent the synapse perarea of

in Drosophila Annals ofNeurology John Wiley&Sons Vps13D motoneuronsdisrupts thedistribution of RNAi (grey). Data is normalizedRNAiis Data (grey). Control to Vps13D C RNAi Data(grey).normalizedis to .Larval NMJ synapses from B . . * perinuclear circularperinuclearMT objects control than and(6 9foldincrease). circularperinuclearMT objects. patient cultureshavefibroblastThe higher ofcellsnumberwith UMCtrl1: wildUMCtrl1: typefor increase in brightinMitoTrackerstainedincrease objects. logscale).inplot Note bothpatientsthat havepixels many withmore intensity,higher indicative the of numbers ofthe pixels areplottedYaxison the plotsblacknaturalin (the andscalenumber the gray wasindividuallytoreveal optimized thestructural not isand details comparable. whileinterconnected the patient mitochondria (G,are often UM1.2) donutshaped. Here, brightness magnificationlens, zoom). (60X Control4X mitochondria UMCtrl1)(F, are elongated, andtubular, mitochondrialnetworkstained by MitoTracker. perinuclear region.perinuclear cellsareloaded patient particularlywith circular mitochondrialbright, objects mostly localized in majoritywhile the of the mitochondriatheincontrol elongated cellsare and intensity,ofsimilar the missense mutation;andUM1.2C D, UM1.4:and heterozygousVPS13D compound patients. Note that

Comparison ofComparison mitochondria4in linesofFamily fibroblast UM1 withstained A,MitoTracker: A-D 4.Patient Figure fibroblastscontainabnormal spherical mitochondria D much abundantmuch more in theaffectedcell lines (~6fold increase). circularprocessing.Suchobjects are present in controlthecelllines atlow butbecome frequencies ** indicatep<10** ) and 2and µmand ) (F G). : 4

Authorp<10 , Manuscript E : : IntensityofMitoTrackerhistogram images. The theXaxisintensity, represents

VPS13D

Average number ofcircular mitochondria (MT) identified objects by image

; B,UM1.17: asymptomatic; heterozygous ofcarrier the Gly1190Asp 6 respectively Ttest).(Student’s Annals ofNeurology John Wiley&Sons In H to to errorIn J,Hbars represent standard error. F and G : Perinuclear : mitochondriaathigher

Percentage ofcellsleastwith at 3 I : orm factor analysisorm factor ofthe J.

F ScaleBars:µm 20 (A *, **, **, *, and Page 30of76 Page 31of76 independentexperiments. ofproteinmilligram (n=3 independentexperiments).andIn B E, theerror indicate bars SEM n≥3 of basedwas ondetermined luminescence. ATPconcentration (µmoles) was percalculated minuteper actin as loadingactin control. patient’s parents(LUB1.1), and (LUB1.3 LUB1.4),healthy and control fibroblasts (LUBCtrl2)with β mean values,and mean thestandard deviations ofthe individuals investigated shown. are andLUBCrtl2)patient lineone (LUB1.1) (n=20). dotrepresentsEach inmeasurement singleacell. The interconnectivityimmunostaining) (GRP75 was calculated two for control fibroblastlines (LUBCtrl1, immunostainedwith ScaleantiGRP75. 20Bar: µm. mitochondrialnetworkwas investigated underbasal byconditions confocal inmicroscopycells fixed A. Figure 5. Altered5. Figure mitochondrialmorphology ATPdecreasedand in Western blot analysis shows mitochondrialWestern proteinlevels GRP75 the in Author Manuscript

ofQuantificationtheabove GRP75blot using ImageJ.Western This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons D. Form factor asForm a factor measure mitochondrial for VPS13D VPS13D mutant fibroblasts. mutant fibroblasts mutant E. ATPproduction C. The Arbor, MI 48109, Arbor, USA Salem, Carolina, Salem, North USA. USA. Trinh 10 9 8 7 6 5 4 3 2 1 Affiliations Seong Eunju in Mutations Vikram Vikram Shakkottai paraplegia TITLE:ataxia/spastic VPS13D in RUNNING Jun Z. Li JunZ. Bart de P. Bart van Warrenburg 48109, 48109, USA. Department of Clinical Genetics, Department MC, Erasmus Rotterdam, the Netherlands of Pediatrics, Department onMedicalSection Genetics, School ofForest Medicine, Wake Winston of MedicineComputational Department Bioinformatics, University& of Michigan, MI 48109,AnnArbor, of Human Genetics, Department UniversityMichigan, of Ann MI 48109, Arbor, USA. of Neurology, Department UniversityLübeck, of Germany of Human Genetics, Department Radboud Medical University Centre, Nijmegen,The Netherlands of Neurogenetics, Institute UniversityLübeck, of Germany of Molecular, Department Cellular,and Developmental Biology,Michigan, of University MI Ann Arbor, Molecular Behavioral Institute,& Neuroscience of Michigan, University MI 48109,AnnArbor, USA. Departments of MolecularDepartments Neurology andof and Integrative ofPhysiology,UniversityMichigan, Ann 3 ,Norbert PhD, Brüggemann 6,7 , PhD, , JewettTamison 1 ,Ryan PhD, Insolera VPS13D 10 , MDPhD, , KleinChristine

Author Manuscript defects spasticityandmitochondrial with ataxia new recessive a to lead 11 *, MD MargitPhD, Burmeister *,

8 5 , MD,J.A. , Anneke Kievit 2 , MD, Erin SandfordErin MD, , ,MarijaPhD, Dulovic This article isprotected by copyright. All rights reserved. 3 , MD, , Collins Catherine 1 ,Sheng PhD, Li 3 , PhD, PhD, , KamsteegErikJan Annals ofNeurology 1,6,7,12 9 , MD , MünchauAlexander PhD, John Wiley&Sons *, *, PhD 2

, PhD, , Lohmann Katja 13 , , PhD, Ozel Bilge Ayse

4 ,Joanne PhD, 3 , MD,, 3* , PhD, , 6 , , PhD, Page 32of76 Page 33of76 *Correspondingauthors: 13 12 11 Medical Center, Nijmegen, TheNetherlands Present Address: Center, ShanghaiPresent BioX Address: Jiao University, Tong China. of Psychiatry, Department UniversityMichigan, of MI 48109, Arbor, Ann USA. of Neurology, Department Donders Institute Brain, and Cognition for Behaviour, Radboud University Ann Arbor MI 481092200 MI Ann Arbor +31243613396 Nijmegen,HB, 6500 Netherlands The Box9101, P.O. UniversityRadboud MedicalCenter InstituteDonders Brain, and Cognition for Behaviour, NeurologyDepartmentof 935 de Bart van Warrenburg [email protected] +17346472186 109BSRB, 5061 Pitcher Zina Place Michiganof University & Molecular Behavioral Neuroscience Institute Margit Burmeister [email protected]

[email protected]luebeck.de 451 +49 8209 3101 Lübeck, 23562 Germany MariaGoeppertStraße1 Lübeckof University Institute for Neurogenetics Lohmann Katja Manuscript This article isprotected by copyright. All rights reserved.

Annals ofNeurology John Wiley&Sons Interpretation: Our study Interpretation: demonstrates Our thatcompound heterozygousmutations in andfunctionality reducedincludingenergy production. distributionmitochondrial impairment alongin axons. showed Patient fibroblasts altered morphology movement disordersmovementalong the ataxiaspasticity spectrum, making or down removalof orfunction (nonsensesplice onmutationsite) onemissense anda mutation other on allele.the Knock progressiveand includedof loss ambulation independent in but two5. All a patients lossofcarried inpatients. 5 presentDisease onset ranged from 39years,infancy to and symptomsslowly were patients was 12 broad. mostAlthough ataxia, additionalpresented with or predominant spasticity was chromosome to was 1p36 in with scorefound LODthisfamily ofa 3.1. phenotypic spectrumThe our in saccadicwith ataxia intrusions ( all seven in 1p36 families. includedaThis large5with affected siblingsfamily spinocerebellarwith Results: Exomesequencing compoundidentified mutations heterozygous in cultures. fibroblast a evaluated withfamiliesrecessive and/orataxiaspastic paraplegia. evaluate ofTo the role Incollaboration,Methods: an internationalwe independentlyperformed exome sequencingin seven spastic ataxiasintrusions, andspastic paraplegia. identifyObjective: novel To causes of recessiveataxias,spinocerebellarincluding saccadicwith ataxia Abstract: neurological involved in disorders.

Drosophila Vps13D

Author Manuscriptknockoutmodel and mitochondrial investigated patientderived in function in

Drosophila SCASI ), or spinocerebellar), ataxia, recessive, type 4, This article isprotected by copyright. All rights reserved. neurons led to changes neuronsled to mitochondrial in morphologyand Annals ofNeurology John Wiley&Sons VPS13D the fourth VPS13 paralog VPS13D VPS13D VPS13D SCAR4. on chromosome mutations, we cause Linkage Page 34of76 Page 35of76 Drosophila comprising patientsfamilies, 5 has (Figure1), previously described been in detail. be gene identified, (~20%) of or idiopathic fraction recessive suspected ataxia onataxia/spasticity gene structuremitochondrial impact andfunction. molecular overlap with,molecular for example, the spastic paraplegias. heterogeneity, addition to pleiotropy,also is thethere spectrumataxiasas of alsoclinical includes and developmental delay, anddevelopmental hypotonia, nonambulatory is 2 years oldpatients > have ataxiaspasticity, and/or yearthe onewhile 2 old patient shows >80 recessively, or>80 Xlinked dominantly, inherited definedgenetically conditions. Here, wepatients report Here, 12 7 from compoundwith families mutations heterozygous in intrusion ( intrusion striking as well intrusions,saccadic hence initiallyspinocerebellarreferred to ataxiaas with saccadic demonstrated this family adultonset early cerebellarneuropathywith ataxia andpyramidal as signs, ataxia areand clinically ataxia genetically heterogeneous more thanataxiasdominant Ataxia is aAtaxia is symptom 400 over of syndromic orneurologicalconditions symptomsole canbe ofthe Introduction SCASI) knockout andmodel patientderived suggestsfibroblaststhat new in mutations this

, 6 4 , suggesting thatmuch the genetic heterogeneityof still discovered.remains tobe In

Author Manuscript spinocerebellarrenamed later ataxia,recessive( 4

. The phenotypeone.The of in these can a mutationcana a known in ataxia S CAR4) ., and ., . Analysis of a Analysis . 13 6, 7 6, Recessive forms Recessive of Briefly, patients in

Oo VPS13D nly in a nlyin minor . All . All Western Reserve UniversityReserveWestern and(Ohio, US genetically inanalyzed Ann Arbor [Michigan,UM1 USA, 140), followed by 140), parametric followed recessive penetrant fully modelanalysis in Merlin. siblings using unaffected the Infinium kitBeadchip HumanLinkage24 markers,(6000Illumina, WG32 WF1). WF1). LUB1 NextSeq500),HiSeq2000; to mediumcoverage 46Xof (UM1), and ~75X LUB1,NIJ, and (all by generationnext USA)] sequencingfollowed onarrays(UM1 andLUB1:Illumina paired end 50Mb (Agilent,CA,Exon Kit atV5 USA) andCopenhagen, at BGI GeneDx(Gaithersburg, MD,WF1 SanInc., USA)CA, Diego, at(Rostock, Centogene NIJGermany); all cases: SureSelectXT HumanAll ataxia/spasticitygenes) a not revealmolecular did diagnosis in cases.these patients andrelatives All (North USA, Carolina, Diagnostic testing (includingpanelgeneWF1). analysis known of and Nijmegen(TheRotterdam Netherlands, NIJ14),Lübeck (Germany,LUB1) and WinstonSalem v3.0 kit atv3.0 (Roche,USA)CA,core LUB1: facility;UM gave written participatewritten gave consentinformed diagnostic to orin were studiesbyresearchapproved that the National National Ataxia by “GeneMatcher”.Foundation and andof(NIJ Formationthiscollaboration was ofby facilitated publicationgrants WF1). funded bythe and(NIJ local or commercial (WF1,Rotterdam) GeneDx, MD)exomeGaithersburg, clinical sequencing local respective (IRBMED IRBs UniversityMichigan, ofLübeck of reviewUniversity panel,ethics or to Patientswere differentinidentified centers a five with on focus movement located disorders Case in Patients: Methods: InFamily analysisUM1, was linkage performed with motheraffecteds,all from 5 DNA the and7 Geneticstudies: Linkage exomeanalysis sequencingand In allwhole Inexome families, performedwassequencing by exome capture [UM1: SeqCapEZ Exome

with NexteraRapid NexteraRapid Exomekit (Illumina, Capture Annals ofNeurology John Wiley&Sons 9

)] ), Page 36of76 Page 37of76 http://www.umd.be/HSF3/ ) prediction totools site estimate thethese impact of on splicing: variants HumanSplicing (HSF, Finder not allow biopsy skin do to tochildren) get samplesskin patients, usedthese from wetwoonline slicing c.22371G>C, (c.941+3A>G, c.9998+4A>C). not waspossible it Since ethical (including reasonsthat decay heterozygous,compoundadeletion gene whole in detectwhole to exomehard in hencethey analyses, can’t be out. Since ruled all patients were heterozygosity washeterozygosityverified. samples werepart734sample samples a LUB1:of pooled call;was Variant calling described; as performed (v1.74), base Picard recalibration, realignment and callingdonewerevariant using (v3.3); GATK these donewas Alignment using againstBWA 1K Genome duplicatesHuman reference,were using removed variantshits)(no damaging performed.wascalled wereVariants as and follows: UM1.1 UM1.4: cases. cases. changing under recessivea variants model. VPS13D emerged as variants thecandidate strongest inall pipeline.Detectedwere variants for(European rare filtered population frequency and<0.01) protein region. For LUB1, and region. For parents NIJ4, sequencedalso were andWF1 trioanalysis initially, a for NIJ: ClinicalandNIJ: exome sequencing described.variant calling as All In addition In tononsense mutations,andmissense d we Analysisexpression: of Copynumber variant analysiswas not alperformed on For were twocases UM1, sequenced andvariant was analysis ~10linkageto restricted the Mb

VPS13D and splice site and prediction

Author ManuscriptwereSanger variants confirmed andsegregation in the consistent family compoundwith 12 Splice site Splice prediction,

and Splice Site andSplice toPrediction, mammals set(SSP, This article isprotected by copyright. All rights reserved. VPS13D quantitative RT-PCRquantitative etected three splicevariantsat sites l samples. l Since exonicsingle aredeletions Annals ofNeurology John Wiley&Sons canbe ruled out. 11 WF1: exomeGeneDxclinical whole WF1: , , andNn onsense-mediated denovo 10

VPS13Dex22 the ofthe expression andSanger sequenced. Further, VPS13Dexpression of the LUB1.1 andwasa in control to compared PCRs were performedwerePCRs SYBRwith Green LightCycler 480system onthe evaluated by evaluated sequencing of cDNA andconfirm transcript nonsensemediated mRNA (NMD) cause.decay Effectcycloheximideas of was withoffibroblastsLUB1.1 8at 100g/mlhours concentration cycloheximide for to final stabilizethe qPCR and sequencing indicated the of instability nonsenseallele thewith we mutation, treated with performed wasExons primers21in and22 (VPS13Dex21F: primerstosynthesizeas complementary the DNAby(cDNA) useof reverse transcriptase (RT). PCR MaximaFirstNucleotides cDNAofthe Strand Synthesis (ThermoFisher, Kit Waltham,MA, served USA) RNAwas extracted theQIAmpusing RNA Extraction (QIAGEN, MD, Germantown, Kit OligodT USA). acacgagattgtccagggtt. VPS13Dex21R, wereproducts RTPCR Sangersequenced. exon in mutations 20 were placed intothe exons: adjacent VPS13Dex19F, agctacactgaacgaccgatand SuperSriptIII(Invitrogen 18080044). Primersto amplifya cDNA fragment bothcontaining familial column Zymogen (DNA column using digested in andthe DNase), reversetranscribed using UM1 Family a extracted fibroblast from culture study toexpression levels and nonsensemediated mRNA in decay <5%. of Thehigher the score,the higher the splicethe probability site that active. is and01 between awith of score 0.5 90% recognizing aboutactual of sites the anda ratefalsepositive thewith interpretationof CV<10% a indicating disruption of site.thesplice generatesSSP a score http://www.fruitfly.org/seq_tools/splice.html). provides HSF consensus a (CV) value asvariation output In addition In tononsense mutations,andmissense detected we three splicevariantsat sites Since VPS13D (data not shown) (data R: R: ATCATTTCCAGGTGTGCTAC) productand respective inspectedthe wasits size for

expression ß-Actin

Authorand Manuscript is higher is

HPRT andPatientLUB1.1.

) .

, , and expressed This article isprotected by copyright. All rights reserved. YAZ thatserved as reference genes. quantitative These in skin (fibroblasts) in skin in than wemRNA used blood, For UM1, RNA For Family ausing extracted was Annals ofNeurology John Wiley&Sons TGATTCCTTAGTCCACATCAAC, TGATTCCTTAGTCCACATCAAC, (data notshown)(data For Patient For LUB1.1, Patient

. . both Since Page 38of76 Page 39of76 VPS13 inhumans. frequencies To assess the common types mutation loss (e.g. missense) of infunction, each models available animal the in and literaturein databases, and of mutationexamined estimates <5%. of Thehigher the score,probabilitythe higher the splicethe site that active. is and01 between awith of score 0.5 90% recognizing aboutactual of sites the anda ratefalsepositive thewith interpretationof CV<10% a indicating disruption of site.thesplice generatesSSP a score http://www.fruitfly.org/seq_tools/splice.html). provides HSF consensus a as (CV) value variation output http://www.umd.be/HSF3/ (HSF, ) siteprediction slicing tools estimate to the impact of on these splicing: variants HumanSplicingFinder donot allow skin thatchildren) to samplesbiopsyskinto getfrom patients, usedthese weonline two thecultures from patientssplice mutations with mutations in ourweonly, purposes adults not haveper IRB, docultures childrenfibroblast the from splicewith c.22371G>C, (c.941+3A>G, c.9998+4A>C). and LUBCtrl2,akaL2134, andwere used. and (LUB1.3 InLUB1.4). addition,fibroblasts unrelated controltwo from lines,akaLUBCtrl1, L2132, establishedLUB1, were lines fibroblast LUB1.1, from patient,the index and her heterozygous parents controls atwo (UM1.17, affected, ofdaughter an andUMCtrl1, marriedin a unaffected spouse). From Functionalstudies in humancells including patient-derived fibroblasts Fromthe UM1 we established fibroblastfamily, lines cell twopatients from andUM1.4) (UM1.2 and Comparison mutation frequenciesof in Toassess the ofimpactloss of the each function of paralogassociated disease, restrictedanalysiswe caseswhich to in mutationsboth are known. Since Author Manuscriptourconsentare designed skinforms to biopsy limit

12 and Splice set to Site Prediction, mammals (SSP, This article isprotected by copyright. All rights reserved. VPS13D Since we arewe perform Since limited to biopsyskin rese for . Instead. paralogs VPS13 it was notwas possible(including it ethical reasons Annals ofNeurology John Wiley&Sons paralogs, we comparedphenotypesof to adults, to dohavewe notfibroblast

arch arch Formatted: Indent: First line: 0" Firstline:Indent: stacks of imagesstacks were obtainedper produceimagesvisual ofto field in per12772 cellstotal ~ line. 12 minutes. for 60XThroughPLAPON onOil)lens (1.42 FV1000 confocalOlympus microscope,68 z fibroblasts applied was to culturedon 40 coverslips minutesbefore for fixing 4% paraformaldehyde in individual. individual. andthe measured calculated.was factor Mean form was factor form 20overperaveraged cells manufacturer'sto according onBasedprotocol. cellmitochondria single images, outlinearea and were withCambridge,in MA) combinationthe immunolabellingkit the (Invitrogen,Zenon Carlsbad, CA) networkmitochondrialin fibroblasts stainedwas withantiGRP75 an antibody 1000, Abcam,(1: containing 412 cells,defined412 containing form asfactor [P ofprojectedMitoTracker intensity) a Zstack (average projectedimage Foreach intensity). image Volocity(Perkin Elmer) tomitochondrial select objects deviationstandard (1 mean above the networkmitochondrialintegrity performedwasselection aby using algorithm in the programsoftware with>2 objects cells suchin the perinuclear region. analysisas a ofForm measurement factor the selectedobjects such per cellwas cell line.also calculated each in computed the percentage ofWe selectedareas remaining correspondbright mitochondria.toand spherical averagenumber of The circularitylesswith µm^2 0.18than and were using removed Fiji’s AnalyzeParticles function.The the top1%pixels.brightestextract quantify spherical To mitochondria, anyareas smaller1.5 than tousedalsowas generate intensityhistograms. each 2Dimage, wasFor algorithmthe Otsu applied to analyzed. analyzed. entire image the each field. individual,For images 1117 two independent from experimentswere ofa mitochondrion,area calculatedwasmitochondria for all andselected obtainedwas the mean for Images were Images using zprojection flattenedat maximum intensityusing the software open Fiji, Formitochondrial imagingin fibroblast theMitoTrackerfrom UM1 family, CMXRos Red (Invitrogen) Inoffibroblasts LUB1, the form Family determinedwas asfactor previously described.

Author Manuscript This article isprotected by copyright. All rights reserved. m 2 ]/[4πA m ] with ] P Annals ofNeurology John Wiley&Sons m being andthe perimeter A 14 In brief, In the m 13 being the which which Page 40of76 Page 41of76 amount ofprotein amountdeterminedwas using the protein BCA Kit (Pierce). Assay andSystem), Detection as generatedcalculated ATP (µMoles) per minute per mgof protein. The manufacture’sDiagnostics), following measuredinstruction. isinATP a luminometer(Berthold, ATPtherateMeasurementof ofculturedsynthesis in fibroblasts used the primaryused following antibodies:ATP5A (Abcam entirecontainingchromosome the andVps13Dsome genetic locus neighboring staining,genes. Forwe two alleles, and mutanttwo alleles in theoverdeficiency which line, a lacks of defined theregion ofhomozygous observed mutantallelesVps13D confirmed were in compound heterozygous of flies the Zstackimage.projected cellbody, each an For average of factorall form calculated.mitochondriawas standard mitoGFP fluorescencedeviations(2.5 above the mean fluorescenceintensity) from a networksmitochondrial select the cellbodies in RNAi expressingof motoneuronsbased on ofthreshold temperature. analysisroom Form of factor nervelarval performed cordsventral was using Volocityto exceptantiATP5A staining, for staining in whichwas tissue with Bouin’s minutesfixed Fixative 7 at for immunostaining,tissues were 4%with formaldehyde fixed 20 minutesat temperaturefor priorroom to (#7596), asaswell (#7596),mitochondrial fluorescent marker(UASmitoGFP, #42727). (#38320), RNAi motoneuronspecific (D42Gal4,#8816),adriver Gal4 deficiency lineDf(3L)Exel6117 dissection andimmunostaining dissection procedures were larval used analysis. tissuefor secondary1:1000). All were antibodies Invitrogen from 1:1000,(Alexaconjugated2 RT).hrs, Standard 1:1000), 11122, Horse Radish Peroxidase 123605021,1:1000),(HRP) (Jackson DLG4f3, (DSHB Vps13D mutant Vps13D [#56282 lines (Vps13D ATP was ATP usingquantified, triplicate, in ATP theBioluminiscenceAssay Kit CLS (Roche II All and lines constructs purchasedfly were related the from Bloomington Center, Stock including Functionalstudies in Drosophila

ab14748), 1: ab14748), GFP 1000 Technologies(Life A Annals ofNeurology John Wiley&Sons 15 16 All phenotypes All For larval Forlarval Drosophila

BonferroniDunncorrection.posthoc

Differenceswere analyzed statisticallyunpaired or using analysis ttests, of with(ANOVA)variance a analysesStatistical

Author Manuscript

This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons Page 42of76 Page 43of76 heterozygous missense, oneframeshift, missense, one andessentialtwo nonessential splice sitemutations ( nonsensemediated decay notnonsensemediated introducesshown).(data pGly1190Asp an negativecharge extra and stopgain the allelecontainingmRNAproduct was abundant, less suggesting it underwent that samples. of products RTPCR Sequencing from of fibroblast demonstrated cell lines two patients that sequencingp.Gln1106Ter). Sanger segregationamong availableall verified 12 siblingswith DNA p.Gly1190Asp)and(c.3569G>A, maternally a stopgain inherited allamong unique VPS13 proteins yeast.including absentvariants were or heterozygous(<13 rare extremely carriers) theindividuals ~120,000 in in listed carrieda familiescombination of onelossoffunction mutation nonsense,(LOF: frameshift, or essential within the linked the linked within region. The adultonset spinocerebellar adultonset withataxia eyesaccadic 1A,(Figintrusion individuals revealed individuals compoundmutationsheterozygous in andrs761162 rs7538691 (LOD3.1, = notdata shown). exome sequencing twoaffected in Whole a onlyidentified locus0, single which LOD with > 20was ~10 cM/Mb on chromosome 1p36 by flanked mutations,ataxia known genomewideunder analysisa linkage recessive, penetrance model full families LUB1,NIJ2families areand closeNIJ3 withinto the orCdomain (Fig werelocated in NIJ1 the thecenter protein. of three The Cterminalmutations missense detectedin GnomAD. Among mutations,the fivemissense and Gly1190Asp Met1307Ile in found families UM1 and onesites) splice and presumably milderor changenonessential (missense sitesplice mutation) UM1 ataxia UM1 family (SCAR4) Overview Genetic Findings Results :In fourdifferent theand inwelocations US Europe, detectedindependentlycompound VPS13D

Author Manuscript 7 mutations in Themutationalfamilies. spectrum fiveincludednonsense, five

changes variants :

We have previouslyhave reported a 14with siblings,familywhom fiveof We with This article isprotected by copyright. All rights reserved. comprisedpaternallya inheritedmissense change Annals ofNeurology VPS13D John Wiley&Sons variant mutation variant as the genetic likely causeonly .

SCAR4 1D2 ), whichconserved ), is and

6, 7 6, ). After exclusion ). After of (c.3316C>T, FigTable. 2). All .

. . All allele indeedallele underwent (Fig NMD cycloheximidewith Treatment stabilized the mutated andconfirmed allele that nonsensemutated the of patientthe cDNA index allele nonsensewithrevealedthe themutation be abundant.less to paternalamissense and change (Ala4210Val,rs746736545). to sequencingFamily UM1, Similar of and a missensea and change( (Table 1).and NIJ1 (Table carry NIJ2 combinationmutation of a a and nonsense compound heterozygouscompoundmutations in different ethnicities with different heterozygous compound andthe geneticNijmegen, clinic movement Rotterdam, the Netherlands,in casesfourunrelated of sites. Her mother sites. the andsame Her carried variant isolatedhas atrophy.optic byexcludedwas exome sequencingsufficientwith coverage the entire of andcoding regionsplice site change. site developmental global delay. hasa combinationnonsense a mutationnonessential of and splice WF1 ataxia were tests clinical perform, difficult to due hercurrentagetoand disease as aswell features mutation frameshift in nonessentialanda frameshift sitemutation, spliceandNIJ4 carries an spliceessential sitemutation LUB1.1 in 60% Patient not shown).(data not affect appears to protein stability not shown).(data hypotonia, balance andhypotonia, ascoordinatingdifficulties, aswell global was WF1, byidentified clinical exome Gaithersburg,sequencing (GeneDx, MD). displayed WF1 Additionalcasessporadic At the of Forest Medicine, School Wake North additional USA,Carolina, WinstonSalem, one case, FamilyLUB1

In two affected sisters In two a of German spasticwith ataxia family 1B),(Fig we detected OPA1

Author Figure Table Manuscript : At the At : the expertRadboudumc geneticcentre for movement disorders in [c.1156_1157del(p.Leu386Glufs*2)]. A mutationsecond (biallelic) in

. 1C).NMD resultedin decreased a expression o level VPS13D 2). atrophyalso NIJ4 has optic carries andhetero a This article isprotected by copyright. All rights reserved. including aincluding nonsensematernal mutation (Tyr1803Ter) VPS13D mutations were independently identified Annals ofNeurology John Wiley&Sons developmental a missensechange, a NIJ3 delay; more formal f about 50 f zygous OPA1

Page 44of76 Page 45of76 this ( this time transcripts. arehencemutations not considered alleles completeas they LOF allow some may correctlyspliced 0.89 0.21, to from inreduction ability.predictedsuggesting splicing These two splicenonessential site andthe algorithm againstHSF anwould argue effect splicing.However, on theSSPdropped score onrecognition impactofsite. thissplice Forc.941+3A>G 9, intron CVwasin the0.83%variation by she carries additionalshe an inmutation neuropathy,and suffersdevelopmental NIJ4 from seizures, delay, andoptic atrophy.Coincidentally, demonstrated primarily adultonsetprimarilydemonstrated ataxiadistinctwithmacrosaccadic intrusions Onset ranged Onset adulthood.early infancyfrom to previouslyTheUM1 assignedfamily, distinct eyephenotype distinct online arein available the that supplement of reference features, neuropathy,features, andmyoclonus but no intellectual disability severe severe debilitating by(wheelchairbound17 yrs). hisage phenotypic difference originates more from Whether phenotype. oculomotor Bya NIJ1 contrast, much5 had earlieryrs)(< onset andsymptoms more were were LUB1 family onsettheir in andclinical phenotypes UM1, similar to except differentfor a below HSF’s below cutoff.10 SSP’s prediction droppedscore0.93 from 0.62 suggesting to spliceconsensus invariant sites. For c.9998+4>C49,in was intron justthusCV10.57%, variation was hence LOF. classified region The splice and NIJ3 in however,variants are not within WF1, on acceptorinvarianteffect splicing of the splice siteof 18 in2),intron c.22371G>C NIJ4, (Fig which siteprediction splice programs. As expected, programs, both andHSF strongly SSP, anpredicted NIJ4 andwere NIJ4 affectedseverelywith agean WF1 at onset the additionof yearfirst in life.In to ataxia Allcases wasexcept which fortoo young, hadeither spasticityataxia or WF1, core as a symptom. Clinicalfindings Totheestimate impactspliceof sitechanges the theused transcript, on wetwodifferent VPS13D referseeto the Confirmatory analysis intronic of mutations otheror environmental or genetic factors is atunknown thistime. Similarly,

Author ManuscriptmM ethods details). ethods for

Annals ofNeurology John Wiley&Sons variants could not be performednot variants could at 6 . the Videos clinical . of exams andthe 7 . The two sisters . The two from 7 ,pyramidalwith SCAR4 an a mild, an any,a if in-silico , ,

VPS13D data. isgenebased a Score) intolerance derived score allele from exome frequency whole in sequence animals, mutationswhileboth in paralogs– affectedby withoutspastic ataxia,paraplegia early adulthood. onset with in explains opticwhich theadditionaltheatrophy but not and seizuresthe developmental delay. was NIJ2 duplicated in duplicated the vertebrate evolution into chorea acanthocytosis chorea caused in casesis 29/31 mutationsby LOF/LOF in MGI2444207, andMGI2444207,MGI2448530] (Table in 41/45cases bymutations in LOF/LOF in LOF/LOF mutations LOF/LOF in (animal phenotypes (animal for LOF paralogeach in LOF in theExAC (ExomeAggregation Consortium)browser. Again, mitochondrial integrity mitochondrial expected. For expected. most toas sensitive mutations, LOF thewith lowest ofratio the number of variantsobserved over other subjects. other and mutation,change LOF a the contrastto incombination of a missense inmutation LOF and a the bemoreseverely might affectedduetwomutations includingsevere to splicenonessentiala site much is known aboutis much known homologs in model in homologs organismsthe two mouse databasefly and [fly CG2093 A A similar observedwas trend human populationsin (Table Among Yeast 22 the paralogs, Among vps13 is among mutationintolerant is most the of also human thegenes. compared frequency of We VPS13A/C,B, andD VPS13 implicated is inmany cellular includingfunctions sporulation, organization,and Golgi VPS13D paralogs, VPS13D . . VPS13C , theprobability, LOF of intolerance, pLI score, is 1, virtuallycertain. Indeed, 18 VPS13B . Author ManuscriptDuringevolution, metazoan g twoduplication events VPS13D VPS13D specificfunction, phenotypeswe compared VPS13reported of

. . cases. Drosophila are unavailable). VPS13Aand C

themost is intolerant to mutations hasthe RVIS ofpercentile, lowest score 4.23, 0.14 suggesting 29, 30 29, This article isprotected by copyright. All rights reserved. 23 VPS13B, VPS13A ). Mutations ). in In summary, (CG2093)an orthologVps13 of is appear more tolerableduring developmentearly and 2428 and Parkinson’sdiseasein byand3/4 cases VPS13C VPS13D V Annals ofNeurology ps13D John Wiley&Sons 23 ): ): (Residual RVIS IntoleranceVariation (updated reference from intolerant completeis to of LOF both / VPS13D VPS13A, cause embryonic in lethality

Patients andNIJ3 WF1 20 , mouse: MGI2444304, VPS13A/C, averiseto three 23 VPS13D Cohen syndrome 19 which further ).not Since emerges 21 , , Page 46of76 Page 47of76 each each also mitochondrial also neurons.function in observations These suggesta role for Vps13Din mitochondrial regulating morphology and potentially complexityofloss thea mitochondrianetwork of coinciding enlarged,with isolated mitochondria. byresulted significantVps13D RNAi ain in reduction quantified (Fig factor form markers cellular of organelles other (Golgi, lysosomesER, nucleus;data and the not shown). othertissues andin young these larvae (notshown). contrast, differences By were no detected for codingthe of in region stage.larvae instar lethalityThis was withconfirmed twoindependent lines containing insertions large ornonessentialmissense/LOF splice/LOFmutations. being alleles, likely incompatiblelife,with with consistent our finding 23 hypothesizedthatof loss motoneurons. This allows for survivalallows motoneurons. of This larvae3 for to the mitoGFP targetedspecifically mitoGFP mitochondriaof to depleted theRNAi neurons, characterization enables further of autonomousVps13D’s neurons. in coexpressionfunction By of spherical mitochondriaspherical (Fig lethality, we lethality, deletionobserved of that enlargedobjects.abnormal This mitochondrial appearancewas present in brain the larval (Fig of Instead mitochondrial forming networks fine mitochondriain cells, individual appear as singular, Since only Since the yeast protein hasvps13 previously beenimplicatedmitochondrial in function, Knownasalso CG32113 in flies, Vps13D shows protein33%fly humanidentity (Tableto gene the Theabnormal networkmitochondrial neuronalin cell We We usedthen RNAimediated knockdown Vps13D ).with Consistent Vps13D disruptionin allele, henceallele, ruling out secondary as mutations thecause of lethality. V ps13d Vps13D Drosophila Author ManuscriptDrosophila lethalitymice, in disruptedflies for 3B2B

, compoundincluding , heterozygousanimalscontaining one of copy

). ). Compared to control RNAia line targeting lucifer Vps13D may mitochondria.alterVps13D earlyIn 2 is and lethal causes mitochondrial defects Vps13D This article isprotected by copyright. All rights reserved. 31 to inhibittoexpression of tosevere ledalterationsmitochondrial in morphology. s rd bodies ledhypothesize us to thatofloss instarstage atstage), pupal(deathwhich Annals ofNeurology John Wiley&Sons Vps13D of Vps13D onlycompoundheterozygous do not survive beyond 2nd 15 specifically inspecifically we observedweenlarged nd 3C2C instarlarvae before

ase, knockdownase, ), consistent ), with 29 3A2A we ) suggest defectssuggest structural in mitochondria in fibroblasts. VPS13Ddeficient Drosophila butand 67%91% normal of fibroblastsaffected of subjects’ (Fig cells (Fig cells ofsuch numbermitochondrial abnormal objects ~higherwas6fold inthe control affected compared to each from pixels image andselected circular objectsbased on computed circularity score. Theaverage of abundance the bright mitochondriaandspherical each in cell weline, extracted thetop 1% brightest in clustersand mostly at higher appearedmagnification be donutshapedto (Fig unusuallycontained often and significantly bright objects,mitochondrialspherical more which were wasobserved branches andin controlboth patient perinuclearcells, ofthe only regions affected cells defects described mutations mitochondrialinfor machinery. fission/fusion inlocations body(Figthe CNS of mitochondria density progressivelywas reduced withconcomitant distanceincreased from the cell diseasesneurodegenerative andneuropathies. would deleteriously Vps13D impact distribution ofmitochondriathe distal to of neurons. regions brighter mitochondriabrighter(Fig mitochondria accumulatesin inmembrane dependenta potential manner, significantly revealed fibroblasts. Staining fibroblaststhe from affected withsubjectsof familyMitoTracker, UM1 which mitochondrial branchingmitochondrial in the affected fibroblasts compared controls (Fig to segmental nerves (Figsegmental strongmotoneuronsled to the impairmentdistribution in of mitochondria axonsperipheral in in

Previous studiesPrevioushavelinked mitochondrial deficiencies toin neurites trafficking distal in Given these data, fly we investigatedalso mitochondrial andmorphology functionhuman in Patient-derived altered fibroblastsshow mitochondrial morphology 5H4H data, form analysisalso factor revealed significant a reduction thedegree inof ). In the perinuclearIn thesuch). region, objects iden were 4A3A

Author Manuscript54 ,andneuromuscular B) junction synapses (NMJ) (Fig

). ). the typical networkmitochondrial of elonga While 43

). This failure to distributeThis to). mitochondria failure resembles This article isprotected by copyright. All rights reserved. 32, 32, 33 We observed ofthatreduction Vps13D in We Annals ofNeurology John Wiley&Sons tified tified 3) in ~10%clusters(≥ inof 5I4I 32 ). Consistent withConsistent ). the

5J4J tedobjectsand 5G4G ). ). observations These 4C3C previously ).To quantify the , D).The , Page 48of76 Page 49of76 chromosome 1p36 1p36 chromosome including the deficits. Our also deficits.study includeda large ataxia with ( family patients andlink twelve VPS13D/Vps13D defects in patient fibroblasts mitochondrialandin to flies protein encodedbyprotein youngest patient,youngest WF1 included cases Thelatter anwith additionaltwo delaydevelopmental phenotype and (NIJ3 NIJ4). The predominantataxia, spasticataxia, to withoutspasticataxia, paraplegia and phenotypes.plus ataxia is mutations characterizeddisordersby movement ofthe ataxiaspasticity spectrum, ranging from fibroblasts expressed fibroblasts reduced of levels mitochondrial GRP75 protein comparedcontrols to (Fig severe phenotype severe in patient dueto NIJ4 digenic but wecertaincannot inheritance,be baseda on just be In addition,NIJ4’scases. presentationmay be complicatedby anmutationadditional in an addition LOF. to mayThis thanbesevere more the combination missense/LOF of in found theother additional or mutations,types as and carry NIJ3 nonessential regionsplice WF1 anddelay, motor hypotonia with presented comparedtoLUB1.1 control fibroblasts (Fig mitochondrialstructural These changeswere accompanied productionreducedby a rateof ATP branchingmitochondrial proband of comparedfibroblaststotwounrelated healthy controls (Fig analysis C). Form factor of GRP75 immunostainingarevealed similar reduction the degree in of The core phenotypeThecore of elevenpatients above the of 2 theage compound with heterozygous Inwehave thisstudy, differentsevenidentified compound heterozygous in mutations Discussion Independentanalysisof of fibroblasts proband the LUB1of family demonstrated affected that the aninteractive of effect the twomutations linked to

severe gaitdifficulties, OPA1 of age2the lastat evaluation,, too young to be f

Author is implicated also mitochondrial in It is conceivable function. thatthere Manuscript andw

VPS13D asere presented and hypotonia with not This article isprotected by copyright. All rights reserved. gene. yet 6E5E ambulatory ). ). mitochondrial dysfunction. mitochondrial Annals ofNeurology SCAR4 yet John Wiley&Sons .These three differentpatients have also ) and )and linkage to10Mb a region on developmentaldelay ormally diagnosed withormally diagnosed ataxia, may This in result the mutationsvariants VPS13D OPA1 , , including . The VPS13D 6D5D 6 5 6 in in ismay A in in ).

disorders: disorders: ataxia or spastic paraplegiaor aorspasticataxia mixed spasticphenotype ataxia,to of phenotype that phenotypeand that ataxia spastic includes paraplegia, as syndrome Behr known mitochondrial disease.mitochondrial as there are otherthere as examples genes of (e.g., movement disorder, myopathy,disorder, movement epilepticseizures, decline cognitive and behavioral changes, these diseaseassociated these mutations are LOF/LOF (see Table ofcasesgeneticrare Parkinson’s disease mitochondrialwith dysregulation andmitophagy protein homeostasis perturb inthe fly. is uncertainit Althoughcurrently whether thisis extrapyramidalsignsandas such myoclonus and Infertilitydystonia. noted was two male in cases. observedFrequentlyneurological comorbidities ourseriesincludedin axonal peripheral neuropathy therewas ageaddition, in onsetour patients,variability of in which notalso unusual is ataxias. for and likely.. atrophy,optichave exclude an undetectedcannot promoter intronic or that mutation not is as does penetrant, the not father ofcoverage complete the homozygous note, Of or compound heterozygous diseases Mendelian case single was detected byexomedetectedwas analyses nor by numbercopy as(conducted described VPS13D Theoverlap betweengenetic ataxiasof forms andhereditary spasticwell paraplegias recognized, is seizures

encodes a proteinlarge(4388 whoseamino acids), paralogscause neurological other VPS13A . Interestingly,recent shownhavedata about 5% that , and other andother phenotypescomplex commonly accompany ear we believeBehr syndrome we as mutationscause chorea acanthocytosis, characterized severeby hyperkinetica . 34 38 .

However, digenic However, inheritancecan’t ascertained babe

Author ManuscriptOPA1

coding regionsandsplice no sites, secondin mutation the 20

This article isprotected by copyright. All rights reserved. VPS13B SPG7 VPS13D is involved is Cohen syndromein an ) that when ) mutatedcanrise togivethat either pure OPA1 alternative diagnosisalternative mutations anextendedcause multisystem related,infertility a ofis known feature Annals ofNeurology John Wiley&Sons 23 ).Inthe othercontrastto VPS13 of patients carry twoindependent 36,37 ly onset recessive onset ataxias.ly and of in ofin sedon thissingle case. developmentaldelay, this case is )

35 40, 41 40, . . ) 17 .

Hence, . While there was While and VPS13C . . ruled outnotruled OPA1 although we 29

. 23, 39 23, Most Most of and gene in 2 In Page 50of76 Page 51of76 contrast allothercontrast to score, the probabilityscore, genei.e. a may intolerant haploinsufficiency,that beto for residual functionVPS13D in humansmay addition, critical forsurvival. be In server’spLI the ExAC embryonic to and leads lethality,not a LOF/LOFsingle wasmutation identified, suggesting thatsome affects mitochondrial affects function. mother.subject’s The existentdominant and/ormore broader severe spectrum phenotypes.Lastly, of the other severe case, co hada NIJ4, splice nonessential mutations,site/LOF mutation other combinationstype with mayassociated a be and/or ataxia spasticity.as suggested Second, by severe themore and NIJ3 who cases, carry WF1 our current First, collectivelydata missense/LOF to point tendingmutations cause torelatively pure geneticOur someallow data for yet first, cautiousspeculations genotypephenotype on correlations. neurologicalapparent problems. haploinsufficient,but none symptomatic, were oneparent including livedwho 90sintowithouttheir haploinsufficiency,intolerance to as oneparent ofof each the cases wasreported here outknocking paralogs, Although our Although study convincingly establishes missense/LOF mutations in Clinically, predicting Clinically, the phenotypemutationsnew from in paraplegiaataxia/spastic andpathology,mitochondrial many addressed. questions to be remain or compound heterozygouscompound or mutationsmissense here.notobserved were As mutation missense/LOFthecarriers, clinical presentation ourvaried Inin addition,homozygous series. predict difficult pathogenicityof to anynovel biallelicmissense variants. with manywith variantsreported missense databases homozygosity,in including

OPA1 VPS13 OPA1 VPS13D’s Author Manuscriptandmutation opticcorresponding atrophy, genes(Table mutation maymutation epistaticallycontribute phenotype to the since

homologs homologs in This article isprotected by copyright. All rights reserved. 23 ) . . 42 Drosophila . We did not,however, We observethe predicted (our results)(our and (MGI:2448530)mouse Annals ofNeurology VPS13D John Wiley&Sons will bewill difficult. Even for 43 which observedalsowas in the 42 VPS13D it willbe moreit even VPS13D VPS13D a gene is large as causing is 1,is in OPA1 also Thomas andThomas Kubisiak, Frauke forHinrichs excellent assistance;technical Johann Gudjonsson,MD Capetian Dr. evaluationPhilipp for clinical of and FamilyLUB1 study.to referring Lindathe Gates, ataxia in alsoandimplementedVPS13D autophagy, in a thatweprocess have recently reported to be involved ubiquitinbindingprotein andaffectingmitochondrial and fission fusion thismanuscript underWhile was review, et al. publishedAnding findings showing betoVPS13D a paraplegias. dysfunctionmitochondrial target and that could betocommon other of ataxiaforms andspastic anddisease progression. biology alsomethods These testingallow will forpotential of that therapies genetic experimentsin model the may fly out us helpthe cellularparse role VPS13Dmitochondrialof in fibroblasts patient andneurons differentiated pluripotentfrom stem induces with cells additionallycan disrupt distributionmitochondrial neurons. in Combiningthe mutationsinVarious mitochondrial genes toleadof theproduction reactiveoxygen species, and/or fusion mitochondrial assess morphology. ofareunderpinnings stillunder thisdefect investigation neurons lacking Vps13Dpatient andcontaining fibroblasts mutations in ataxias. unexplained asparaplegias such Friedreich’s ataxia, function Mitochondrialin fibroblasts. associateddysfunction iswith severalataxias other and spastic mitochondrial abnormal inboth cellmorphologylines, patient and flies andreduced mitochondrial work further is warrantedpin down to While the mitochondrial precise defect, we have shown We patientsWe thank the willingnesstheir for participate andto patience during our research. thank We Acknowledgment . . 51 .

32 canall potentially inmanifest aberrantdistribution of mitochondria throughout the cell. 48 Author Manuscriptwe observed defect Although a in distributionmitochondrial bothin

SCA28 , 45

POLG , .eincluding lectron microscopy studiesto Annals ofNeurology , 46 John Wiley&Sons and SPG7 , , 50 , VPS13D 47 , ourwith consistent findings, assome aswell in in vitro in , the precise, biological cellular model of in vivo in ort, fission, Drosophila 49

which

Page 52of76 Page 53of76 Lilly andSchillingFoundation (CK). Hospital SchleswigHolstein(“Gutes and AM), career Tun!”, a development award the from Hermann medicalcentre university(BvdW) and Bioblast (BvdW),Pharma ofthe theFoundation University under theBvdW) of networkframe the ERare3 thePREPARE, Hersenstichting (BvdW), Radboud program innovation research under actionthe ERANET 643578, (9003037604;Cofund N° ZonMW andF32NS098611 (CC), (RI), the National Ataxia Foundation (MB),Union’s European 2020 Horizon (Neurology, Case Reserve) providing clinical for data.important Western (Departmentof Neurology,MC, Erasmus Rotterdam, the MDNetherlands) andAasef Shaikh, Neurology, medicalcentre, universityRadboud Nijmegen, the Netherlands)andM. Jongen, PhD MD, ondiscussion useful VPS13 evolution; Bart and MD, Post, JolandaPhD Schieving, MD(Department of (Dermatology, of University Michigan) biopsies,for fibroblast Soochin (Creighton Cho University) for AuthorContributions: of None the authors COI reportrelevantto the work.reported See disclosures fordetailed other COI PotentialofConflicts Interests: MD,ESe, RI, CC,CK,BvdW, MBEJK, contributed KL,to drafting thetext preparing and figures the MD,ESe, JT, RI, SL, ABO,ESa, NB, contributedEJK, TJ,AJAK acquisition to andanalysis of data JZL, VS,CC,CK,AM, MB KL,BvdW, contributed to designthe conceptionof and the study This work wasworkThis supported by the ofUS NationalInstitutes grants NS056780Health (MB), NS069844

Author Manuscript

This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons disorders. Eur J disorders. Genet.Hum 2016 Eur Oct;24(10):14606. andspastic paraplegiaataxia uncovers genedisease novel associations andunanticipatedrare vande MI,BP,de Schouten etexome Warrenburg al. ClinicalBot ST, sequencing for cerebellar 11. 2819reflectingsamples from 1000 families. HumEurJ Genet. 2017 Feb;25(2):17682. D, TrujillanoBertoliAvella AM, Kandaswamy al.Kumar et exome K, Clinical sequencing: results 10. sparseusinggene maps NatGenet. trees. flow 2002 Jan;30(1):97101. GR, AbecasisCherny SS, CardonanalysisLR.CooksonMerlinrapid of dense WO, genetic 9. investigatorsanwiththe sameinterest in gene. Hum2015 Mutat. Oct;36(10):92830. Sobreira N, Schiettecatte D, Valle Hamosh GeneMatcher: F, matching A. a toolfor connecting 8. intrusions.saccadic Neurol.Ann 2003 Dec;54(6):8248. SwartzBE,Li et I,S, al. Bespalova clinical Pathogenesis ataxiasigns recessive of with in 7. Ymyoclonus.2002 NAnn Acad Sci. Apr;956:4414. ataxia cerebellar saccadicwith intrusions, increased saccadic sensoryspeed, neuropathy, and SwartzBE,Burmeister M, JT, Rottach Somers LeighKG, Bespalova RJ.IN, A of form inherited 6. genes,and phenotypes, pathways. Disord.Mov 2017 Mar;32(3):33245. M, Synofzik Schule R. Overcomingtheand divide ataxias between spastic paraplegias: Shared 5. cerebellar ataxia.familial JAMA Neurol. 2014 Oct;71(10):123746. Lee Fogel DeignanBL, H,al. ExomeJL, et sequencing the clinical in diagnosis of orsporadic 4. 2017 Disord. May;32(5):7245. of Recommendations the International Parkinson Movement and SocietyDisorder task Mov force. Langde MarrasC, BP,A, et van al. Nomenclature geneticof Warrenburg movement disorders: 3. proposal aclassification.andfor 2017;4:3. Cerebellum Ataxias. BeaudinM, CJ, RouleauGA,Klein ofN. Systematicautosomal Dupre review recessive ataxias 2. 2014;5(3):586603. E, Sandford Burmeister Genesandgenetic M. hereditarytesting in ataxias. Genes (Basel). 1. LiteratureCited

Author Manuscript This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons Page 54of76 Page 55of76 8. in mutation French familieswith Canadian choreaacanthocytosis. Neurogenetics. 2005 Sep;6(3):151 DobsonStone C, JansenVelayosBaeza A, et A, Identification a al. of VPS13Afounder 23. Variation Dosage Sensitivity.Predicts Gene PLoS Genet.Sep;11(9):e1005492. 2015 PetrovskiGussow al.S, etAB, of Q, TheIntolerance RegulatorytoWang Sequence Genetic 22. acanthocytosis.Neurochem. J Feb;92(4):75966. 2005 Ichiba TomemoriM,Y, Kusumotoet genetargetedal. A, A model mouse chorea for 21. PLoS the Brain. 2017;12(1):e0170106. One. JJ,Yeshaw Vonk Pintoet al. F, Drosophila Vps13 Is forWM, Required Protein inHomeostasis 20. gene VPS13 family. Genomics. 2004 Sep;84(3):53649. VelayosBaeza Vettori A, A, CopleyDobsonStoneRR, Monaco C, human of AP. Analysis the 19. 2017 Biol. Feb;216(2):299301. MyersPayneMD, GS. and Vps13Cdc31/centrin: partnersPuzzling membrane traffic.in JCell 18. Brain. Jan;138(Ptmutations. 2015 1):e321. Sabatelli CarelliV, M, Carrozzo et al. with R,'Behr syndrome' OPA1 compound heterozygote 17. 31;33(31):1276478.Jul 2013 MAPKKKthe regulatesynaptic structure, axonal and transport,Wnd/DLK injury J signaling. Neurosci. Klinedinst X,X,S, Xiong Haenfler CollinsJM, Wang IndependentCA. pathways downstreamof 16. transportoffast mitochondria Mol motorin axons. Drosophila 2006Biol Apr;17(4):205768. Cell. PillingHoriuchiAD, Lively SaxtonCM, D, and Kinesin1 primaryDyneinare the motors for WM. 15. human morphologyin 2010fibroblasts. One. PLoS 27;5(9):e12962. Sep Grunewald L,A, al.Voges et Rakovic A, Mutant Parkin impairs mitochondrial functionand 14. analysis. image 2012Nat Methods. Jun28;9(7):67682. Schindelin etJ, ArgandaCarreras E,an Friseopensource platformI, al. Fiji: biological for 13. an online Finder: bioinformatics predict toolto splicing signals. Nucleic Acids May;37(9):e67. 2009 Res. DesmetHamroun FO, Lalande M, CollodBeroud D, G, M, Beroud Claustres C.Human Splicing 12.

Author Manuscript This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons Am J Genet. 2016 Am 3;98(3):50013.Hum Mar Parkinsonism Causes MitochondrialParkinsonism Dysfunction andIncreases PINK1/ParkinDependent Mitophagy. Lesage S,Majounie Drouet et V, al. E, of Loss FunctionVPS13C AutosomalRecessive in 29. heterogeneity Cohensyndrome.in Med J Genet.May;43(5):e22.2006 HolderEspinasse SeifertM, al. MutationalSpranger et spectrumW, S, of COH1 andclinical 28. tissuesyndrome,expression, andtranscript of variants COH1.Mutat.Hum 2009 Feb;30(2):E40420. HolderEspinasse SeifertM, etal.J, Kuhnisch W, mutational Expanded spectrum Cohen in 27. genotypephenotype largescale screen. AmJ Jul;75(1):1227.2004HumGenet. Kolehmainen Lehesjoki al.J, R, AE,et Delineation syndromeofWilkinson Cohen afollowing 26. by syndrome.affected J Cohen Genet. Hum 2007;52(12):10117. KatzakiE, C,Pescucci Uliana al. Clinicaland et V, molecular Italiancharacterization ofpatients 25. syndrome.in variability CohenJ Am Genet. Jul;75(1):13845. Hum 2004 HenniesHC, et Seifertal. Rauch A, heterogeneity Allelic intheW, COH1 explainsclinical gene 24. byin exome asequencing geneticcohort large of disorders. Med. Genet 2017 Jun;19(6):66775. Pfundt R, Del RosarioM, Vissersal. L, Detection et clinically of relevantcopynumber variants 35. JGenomic Med.N Variation. Engl Jan5;376(1):2131. 2017 Poseyet JE,Harel Liu al. P, T, of DiseaseResolution Phenotypes ResultingMultilocus from 34. 08;6:18981.2016Sci mitochondria.Rep. Jan YuY, LeeChen HC, al. membrane Inner et KC, mediates fusion spatial distribution ofaxonal 33. Feb;14(1):128. Baloh Mitochondrial RH. peripheral dynamicsneuropathy. and 2008Neuroscientist. 32. Drosophila.inactivation gene in2007 Nature.Jul 12;448(7150):1516. Dietzl al.G, D, Chen Schnorrer et genomewide F, A transgenic conditional libraryRNAi for 31. 2017 Genet. Clin Sep01. Parkinson'sdisease confirms asVPS13C ofa autosomalrecessivecause rare Parkinson'sdisease. SchormairB, KemlinkD, Mollenhauer et al. B, Diagnostic exome sequencing earlyonset in 30.

Author Manuscript This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons Page 56of76 Page 57of76 2009 Jul;36(4):40928. 2009 J. Finsterer with Xchromosomal Ataxias autosomal, or inheritance.maternal J Can Neurol Sci. 46. 2011 Genet. Oct;7(10):e1002325. a in spastic mutations ataxianeuropathy syndrome mitochondrial mAAA proteases.linked to PLoS PiersonAdams D,Bonn et TM, al. F, sequencing homozygousidentifies Wholeexome AFG3L2 45. Mitochondrial Impairs Biogenesis and in Mice MolCells, Humans. Genet. Hum 21. 2017 Apr JasoliyaMcMackinMJ, HendersonMZ, SL,PerlmanCK, GA. Cortopassi FrataxinDeficiency 44. of manifestations the optic mutation. atrophy 1 Opin Curr Ophthalmol.2016 Nov;27(6):47580. Chun JF,3rd. BY, Rizzo atrophy:opticon Dominant updates the pathophysiology andclinical 43. from: ExomeAggregation Consortium (ExAC). Cambridge,MA2015 [updated2015/01/16/]; Available 42. 2009 Genet. Hum Aug;17(8):10769. brothers in mutation two Cohenwith syndrome, cutis verticis gyrata andsensorineural deafness. EurJ Megarbane Slim A, R, G, Nurnberg Ebermann Nurnberg I, P, HJ.ABolz VPS13B novel 41. Cohen syndrome.of Hum 2009 Mutat. Sep;30(9):E84554. Balikova Lehesjoki I, TJ, AE,de et Ravel al. in Deletions the VPS13B(COH1) as gene a cause 40. 2011Neuropsychiatr Genet. Jul;156B(5):62031. in variations the VPS13A gene patientschoreaacanthocytosis. within Med J Genet Am B Tomiyasu A, IchibaNakamuraal.M,M,et Novel mutations pathogenic andcopy number 39. 2017 Genet. Clin Feb;91(2):199207. DemainLA,Conway Newman GS, Genetics dysfunctionmitochondrial of andinfertility. WG. 38. paraplegia 7:typespastic a study a Dutchin large cohort. 10):29943004. Oct;135(Pt 2012 Brain. vanGassen KL, der devan HeijdenCD, BotST, al. Genotypephenotype et correlations in 37. causes of genetic spasticataxias. 2012Neurology. Oct02;79(14):150714. MA, deBot ST, Vermeer Kremer Willemsen S, HP,vande theBP. Reviewing Warrenburg 36. http://exac.broadinstitute.org Author Manuscript

. This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons delay.developmental2016with Elife. Jan26;5. M, Kim Sandford Gatica MutationE, et al. D, ATG5 in reducesautophagy toandleads ataxia 51. Required the Regulation for of Mitochondrial Clearance.and 2017Size 30.Dec Biol. Curr Anding AL, C, al.ChangVps13D TK, et Wang a Encodes UbiquitinBindingProteinthat Is 50. Nov;88(Pt 2015 Med. A):107. HayashiG, Cortopassi G. Oxidative mitochondrialinheritedstress in diseases. Radic Free Biol 49. Cerebellum 2015;2:16. ataxia. Ataxias. BargielaD, Shanmugarajah Loal. pathologyC, Mitochondrial progressiveP, et cerebellar in 48. the ComponentMitochondrial of Permeability Mol Pore. 01;60(1):4762.2015Transition Cell. Oct ShanmughapriyaRajan S, S, etNE,Hoffman al. an Is SPG7 andConserved Essential 47.

Author Manuscript This article isprotected by copyright. All rights reserved. Annals ofNeurology John Wiley&Sons Page 58of76 Page 59of76 Ala4210Val areconservedAla4210Val mammals inand zebrafishchicken notbut in and/or fruitfly. symbols. symbols. ID. Gly1190Asp,Asn4107Ile, andGly4149Ser areconserved all orthologs,VPS13D in Met1307Leu and of thealignments regions surroundingmissense each acrossmutation species. various While the Cterminalthem domain (aa 39834129). domain Thedifferent missense mutationsfive cluster appear to tworegions, one in of VPS13 ROOT SHORT transcription factorbinding 32763558),domain (aa C:VPS13 Cterminal domain Nterminal (aa 137356), U: (Ubiquitinassociated)like UBA domain (aa 26272679), SHR: mutationsmissenseidentified marked: N1:VPS13 1st domain 2115),Nterminal 2nd(aa N2: VPS13 domain Predicted maps protein of VPS13D (http://www.ebi.ac.uk/interpro/protein/Q5THJ4)thewith allele nonsensemutated gotand stabilized showed similarexpressionupon treatment. levels withcycloheximide. treatment Mutationaldiamond. open statusgiven is below individualeach with together the respective laboratory individuals unaffected are marked by nineunfilled symbols. areunaffectedThe siblings an shown in 1. Figure Figure Legends: A. Pedigree of Pedigree

B. Pedigree of Pedigree mutationswithFamily LUB1 in the affectedtwo sisters, by blackshown filled

C. Multiplexataxia compound families with heterozygous mutationsin cDNA sequencescDNAof the c.5409C>A before panel)(top andmutationafter panel) (lower Family

Author ManuscriptUM1 family in the middle in and thenearthe other domain C

Thetraces ofare representative

numberof . C sequencingruns. E . sequenceacid Amino . mbols while mbols VPS13D

B The D .

Formatted: Highlight Ala4210Valare conserved and in mammals zebrafishandbut chicken not in and/or fruitfly. Met1307Leu orthologs, VPS13D all species.in conserved are Gly4149Ser and various Asn4107Ile, Gly1190Asp, While across mutation missense each surrounding regions the of alignments sequence different five The 39834129). mutationsdomain.oneregions,of cluster appearthe in Cterminal them to missense two (aa domain Cterminal VPS13 C: 32763558), (aa domain binding factor transcription ROOT SHORT VPS13 SHR: 26272679), (aa domain (Ubiquitinassociated)like UBA U: 137356), (aa domain Nterminal 2nd VPS13 N2: 2115), (aa domain Nterminal 1st N1:VPS13 marked: mutations missense identified the with (http://www.ebi.ac.uk/interpro/protein/Q5THJ4) Site (http://www.fruitfly.org/seq_tools/splice.html) Splice Prediction and (http://www.umd.be/HSF3/) Finder Splicing Human by scores prediction site splice and http://gnomad.broadinstitute.org/gene/ENSG00000048707), at consortium aggregation genome exome/genome(GnomAD: publicdatabases in frequency MutationTaster),score and (CADD prediction A. 2. Overview Figure of mutationsin VPS13D oriae o al eetd uain (RH7h1 bit N_138, respective NM_015378), built, (GRCH37/hg19 mutations detected all of Coordinates

Author Manuscript

John Wiley&Sons C . Amino acidAmino .

in-silico

Page 60of76 Page 61of76 mitochondrial morphologymitochondrial motoneuron cellbodies. in magnification High confocalsingle indicatedof Zplanes areasby highlightingthe dashed boxes, Vps13D mitoGFP)networkmitochondrial(based on neuronal inbodies cells expressing (white)control RNAi vs. A morphology. Figure p<0.001indicates error. standard *** (Students Ttest). mitoGFP (green) mitoGFP along andcontrolwith panel)(left motoneurons(viaD42Gal4) simultaneouswith expression of fluorescent markermitochondrial neuronalcellbodies. Scale 50µmBars: and5µm (top) (bottom) ofconfocalZplanes areas byindicated dashed boxes, highlighting the mitochondrial morphology in Vps13D . Ventral nerve cordnerve (VNC), Ventral stained . formarker mitochondrial ATP5A, of control ( 32 (grey). n=50RNAi neuronsper condition 5 (from animals). different bars Error represent mutant ( . Disruption . of Vps13D 11101/11101

Author ManuscriptV ps13D

, leftpanel) , the in This article isprotected by copyright. All rights reserved. Drosophila Drosophila Vps13D centralsystem nervous affects mitochondrial C. C. larvae. singlemagnificationBottom: High Quantification ofQuantification form analysisof factor the Annals ofNeurology (right panel) expression. RNAi Bottom: John Wiley&Sons B . . of Representative images w 1118 , , right panel)right

and 2.5"3" + 2" + + 1.5"1" + 0.5" + at Not stops: numbers,Tab betweenand text Asian Adjust space betweentext, Asian and Latin Widow/OrphanAdjust control, space Formatted: Line spacing: single, spacing: Line Vps13D knock Vps13D RNAi axons expressing motoneuron fluorescentmarker mitochondrial mitoGFP and of control (green) marker mitoGFP controlmarker (green) and RNAi of Vps13DRNAi knock represent standarderror. represent ****p<0.0001indicates (Students Ttest). ProximalControl condition. RNAi Region n≥10 individual nerves 5 from differentanimals. bars Error regions of motoneurons regions control expressing RNAi (white) vs. mitochondrialofQuantification the per area content withinnervessegmental proximal in anddistal motoneurons expressingmotoneurons control (white) vs. RNAi synapses/animal). Error represent bars error.standard **** p<0.0001indicates (Students Ttest). condition. RNAi n n=5animals (each represents mitochondrialtheavg. content of ≥6 NMJ (left) and(right).2.5µm (left) shown (rightare highlightbox) panels) to mitochondria occupying thesynapticregion. 20µmBar: Scale postsynaptic NMJ magnification region. images High the synaptic of (indicated dashedregion by the the near VNC top)anddistant (proximal, (distal,the from VNC bottom) are 10µm.Bar:shown. Scale A to mitochondria distal Figure . Segmental nerves (HRP,Segmental containingred) motoneuronaxons . expressing mitochondrial fluorescent 43 : : of Knockdown ed downanimals. (red) HRPneuronalmembrane, labels wh D regions of neuronsaxons Author Manuscript.Quantification the of contentmitochondrial theNMJ in synapseperof area V ps13D

in Drosophila This article isprotected by copyright. All rights reserved. Vps13D motoneurons thedisruptsdistribution of . . (grey). Data RNAi normalized tois Control Annals ofNeurology John Wiley&Sons Vps13D ed ed C normalized(grey). Data RNAi tois down(RNAi) animals. Nerves . Larval Larval synapses. NMJ from ile DLG (blue) DLG ile labels B . . Page 62of76 Page 63of76 much more abundant more much in theaffected(~6fold cell increase). lines processing.circular objectsSuch are present in thecontrol cell at lines low but become frequencies increase in bright MitoTrackerstainedbright in increase objects. in bothplot Note logscale). thatpatientsmany have pixels more higherwith of indicative theintensity, numbers pixels the of are onthe Yaxisplottedplots blacknatural(the andthenumber in scale gray was individuallywas to optimized reveal the structural and detailsnot comparable. is while interconnected mitochondriathe patient (G, donutshaped.areUM1.2) often brightness Here, (60Xmagnification 4X lens, Control mitochondria zoom). are(F, UMCtrl1) andelongated, tubular, D perinuclear region. perinuclear are cells patient loadedparticularlywith bright, circularmitochondrial mostly objects localized in the majorityof while the thecontrolareelongatedcellsmitochondriain and similar of theintensity, mutation; missense andD, UM1.2C andUM1.4: compoundVPS13D heterozygous patients.that Note * UMCtrl1: wild typewild UMCtrl1: for A-D Figure mitochondrial networkmitochondrialstained byMitoTracker.

perinuclear circular MTobjectsperinuclear controlthan (69fold and increase). circular MTobjects.perinuclear patient cultures havefibroblast The higher withcells numberof ** indicate p<10 ** ) and2 ) andµm (F G). : Comparison of mitochondria Comparison of 4of : in fibroblast lines 54 . Patient . fibroblastsabnormalcontainspherical mit 4 , p<10 , E : Intensity histogram : of Intensity MitoTrackerimages. TheXaxis represents the intensity, VPS13D Average number circularAverage of mitochondria (MT) objectsbyidentified image

H 5 , andp<10 , Author Manuscript:

; B, ; asymptomaticUM1.17: heterozygousof carrier the Gly1190Asp

6 respectively (Student’s Ttest). This article isprotected by copyright. All rights reserved. In H J,H bars errorto In standard represent error. F and G : : mitochondriaPerinuclearat higher Family Family Annals ofNeurology John Wiley&Sons UM1 UM1

ochondria I Percentage of atwith cells least 3 : J. J. orm factor analysis ormthe of factor family

F stained with MitoTracker:stainedwith A, Scale Scale 20 Bars: µm (A *, **, and*, independent experiments.independent proteinof milligram (n=3 andInindependent experiments).the errorE, B ofindicatebars n≥3 SEM based ondetermined was luminescence. concentration ATP (µmoles) calculatedwas per minute per mean andmean the standard values, deviationsthe of investigatedindividuals are shown. andone patient LUBCrtl2) line(LUB1.1) dot(n=20).represents Each measurement single a cell. in The interconnectivity(GRP75immunostaining) calculatedwas twocontrol fibroblast for lines (LUBCtrl1, A. Figure actin as actin loading control. patient’sparents (LUB1.1), healthy(LUB1.3andLUB1.4), and control fibroblasts (LUBCtrl2) βwith immunostained with antiGRP75.with immunostained networkmitochondrialwas investigated under basal by conditions confocalmicroscopy cells fixed in Western blot analysisshows mitochondrialprotein GRP75 in levels theWestern 65 . Altered . mitochondrial morphologyATP and decreased B.

Author Manuscript ofQuantification the above GRP75 blotusing ImageJ. Western

Annals ofNeurology John Wiley&Sons in VPS13D VPS13D mutantfibroblasts. mutant fibroblasts E. ATP production ATP C. C. The Page 64of76 Page 65of76 Table 1. Clinical presentations of each ataxia case with VPS13D mutations identified mutations VPS13D ataxiacase with each of presentations Clinical 1. Table Tendon reflexes Tendon signs Extrapyramidal Seizures signs Pyramidal Cerebellar signs evaluation Age at last Sex Origin Slovenian German Dutch Javanese Dutch Dutch Javanese Dutch German symptom Presenting Slovenian Onset age Origin Mutation information Additional NCS/EMG MRIBrain exam Sensory state Cognitive atrophy Weakness/ Gait ataxia Oculomotor Mobility phenotype Core patient sexes and ages are given in id order (1-5 in UM1, 1-2 in LUB1), which are noted in parenthesis when phenotypes differ. when differ. phenotypes are parenthesis in noted LUB1), which 1-2UM1, in order (1-5 in id in given ages are andpatient sexes 3, 2 and potential. In columns evoked potential; sensory SEP: evoked magnetic MEP: electromyography; studies, NCS/EMG: conduction nerve disability; ID:jerks, intellectual wave square noSWJ: assessment, NA: absent, -:present, lower +: LL: limb, upper and UL: M: female, male, F: UL spasticity UL LL spasticityLL Spastic gait Dysarthria response ataxiaUL LL ataxia LL

Plantar

39; 36; 28; 23; 34 29; 20 <5 28 <3-4 <3-4 28 <5 29; 20 34 39; 23; 36; 28;

Normal Normal

- NA NA + + + + + M UM1.1 atrophy with dorsal with atrophydorsal - vermis involvement vermis - Myoclonus ankles decrease at Increase at knees, Extensor 37 29 ataxia Spastic ataxia Spastic Cerebellar ataxia 43 35; 29 47 54; 49; 52; 50;

p.Gly1190Asp p.Gly1190Asp p.Gln1106* axonal neuropathyaxonal sensorimotor to moderateMild cerebellarMild Independent (5) Independent Walker (2,4); Wheelchair (1,3); (1-4); None (5) (1-4); None atrophy calf Mild oscillations saccadic Horizontal position sense sense position Impaired joint + + + + difficulties difficulties (1-5)reading (1-4) Gait and

;

M; Author Manuscript

; -

M; 5

SEP: Reduced deep executive Mild - NA Extensor + + - + + + - (1); pu Saccadic + F LUB1.1 to pregnancies (2) to pregnancies Deterioration due (1); latencies increased cortical & MEP: latencies (2) (1); NANormal (2) (1); NANormal (2) LL (1); NA sensory functions (2) Normal (1); dysfunction (1);NA (2) UL/Increased LL saccades vertical hypermetric SWJ, p.Ala4210Val p.Ala4210Val p.Tyr1803* Wheelchair (2) Wheelchair (2) (1); Independent NA (2) NA (2) (1); Moderate LL difficulties difficulties speech (2) (1,2) and Gait This article isprotected by copyright. All rights reserved.

(1); (1); ;

(2) NA

LL prolonged NA +

(2) (2)

(2) (1) -

; rsuit,

- + - + M NIJ1 - NA - - + NA NA - + (stance) + + (stance) + - NA W - SWJ oml A NA Oligospermia Macrocephaly NA Normal tract corticospinal changes in Signal Extensor loss distal LL distal loss Normal Deep sensory Normal Normal LL UL/Increased p.Met1307Leu p.Gln662* Wheelchair Independent Wheelchair Independent Not walking Notwalking Independent Wheelchair Independent Wheelchair Severe LL Mild LL Severe LL Severe LL LL Mild Severe LL spastic gait spastic walking, Delayed

Annals ofNeurology

John Wiley&Sons

Cria ytna - dystonia Cervical - - - - F NIJ2 - extensor to Equivocal + + - + - paraplegia paraplegia Spastic p.Gly4149Ser p.Gln2572*

Normal Normal Normal Normal Increased LL difficulties difficulties Gait

Atrophy /hypoplasia Atrophy /hypoplasia Azoospermia Azoospermia Absentjerks, ankle + + + M NIJ3 - NA + - + + c.941+3A>G c.941+3A>G p.Val2987Glyfs*14 centrum semiovale centrum semiovale matter changes white inferior; subtle cerebellar vermis Flexor Equivocal Extensor Spastic ataxia ataxia Spastic saccades saccades hypermetric pursuit, Jerky slow rest increased rest increased LL distal Sensory loss abnormal gait gait abnormal Delayed walking,

Dutch Dutch 6 <1 <1 Ataxia andAtaxia Areflexia Increased UL/ Increased LL Areflexia Axonal Axonal Mild ID Speech delayed Speech delayed ID Mild + + - F NIJ4 + - - - - + p.Asn4107Ile p.Asn4107Ile c.2237-1G>C atrophy atrophy Cerebellar neuropathy neuropathy nystagmus nystagmus Gaze-evoked distal UL anddistal LL proximal/ Mild p.Leu386Glufs*2 c.1156_1157del, mutation:OPA1 atrophyOptic neuropathy neuropathy NA Normal Normal NA delay delay Developmental

- 2 <1 <1 NA NA + Scottish Lumbee/German/ F WF1 - NA - - - nation difficulties non NA head banging head banging flapping and frequent hand Poor eye None balance/coordi- secondary to c.9998+4A>C c.9998+4A>C p.Leu2277* Normal Normal Hypotonia Hypotonia NA NA motor skills motor skills Delayed gross

ambulatory ambulatory

contact; contact;

( ( Splicing Human Finder at calculated heterozygous Compound 2. Table http://gnomad.broadinstitute.org/gene/ENSG0000004870 CADD score and MutationTaster are MutationTasterare and score CADD DNA. genomic builtfor GRCH37/hg19 and forcDNA NM_015378 on based are mutations detected of all Coordinates been reported previously in public exome/genome databases (gnomAD: genome aggregation consortium at consortium aggregation genome (gnomAD: databases exome/genome in public previously reported been

http://www.fruitfly.org/seq_tools/splice.html) LUB1 UM1 UM1 WF1 NIJ4 NIJ3 NIJ2 NIJ1

Ala4210Val 12629C>T chr1:12520418C>T 34 Disease causing Disease 34 chr1:12520418C>T 12629C>T Ala4210Val Asn4107Ile 12320A>T chr1:12476867A>T 30 Disease causing Disease 30 chr1:12476867A>T 12320A>T Asn4107Ile Leu2277Ter (essential) Splicing causing Disease fsX14 51 Val2987Gly chr1:12382602C>T causing Disease 40 7714C>T Gln2572Ter chr1:12331062C>T causing Disease 1984C>T 33 Gln662Ter chr1:12343568C>A causing Disease 5409C>A 39 Tyr1803Ter chr1:12336961C>T 3316C>T Gln1106Ter Gly1190Asp Splicing 941+3A>G chr1:12317147A>G 17 NA Not reported Not 9998+4A>C NA Splicing 17 chr1:12317147A>G 941+3A>G causing Disease Splicing 35 chr1:12516165G>A 12445G>A Gly4149Ser Met1307Leu

Author Manuscript NP_056193 Protein Mutation

8960_8961 8960_8961 6829delC chr1:12371876delC 35 Disease causing Disease 35 chr1:12371876delC 6829delC causing Disease 19 chr1:12337564A>T 3919A>T causing Disease 25 chr1:12337214G>A 3569G>A 2237-1G>C 2237-1G>C NM_015378 cDNA Mutation delTG delTG This article isprotected by copyright. All rights reserved.

h11468AC . N 0.00003738 reported Not NA NA 9.6 chr1:12416585A>C 23 chr1:12335881G>C level Genomic Mutation chr1:12405505delTG mutations identified in each ataxia/spasticity family ataxia/spasticity each family in identified mutations VPS13D in-silico http://www.umd.be/HSF3/ . . prediction of deleteriousness of each mutation. 3 of the mutations have of mutations the 3 of each mutation. deleteriousness of prediction Annals ofNeurology John Wiley&Sons 7

). For splice mutations, splice site prediction scor site prediction splice ).splice mutations, For score CADD 35 Disease causing Disease 35 ) and Splice Site Prediction Prediction Site Splice and )

Mutation Taster Mutation

Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not Not reported Not reported Not 0.00004885 0.00004039 Frequency GnomAD GnomAD

Splicing Splicing -10.57% -31.07% Human Finder Finder -0.83%

es werees Splice Site Splice

0.93 0.99 Prediction 0.89 → → → 0.62 0.00 0.21

Page 66of76 Page 67of76 junction junction deletions/insertions included. #: MGI2444207. $: MGI2448530. *: This This study *: MGI2448530. $: MGI2444207. included. #: deletions/insertions mitochondria, of Integrity Sporulation, Vps13 Vps13 of Mutations 3. Table geographic/ethnic population. MIS: missense. LOF: LoF plus frameshift. LOF+: In addition to LOF, LOF, large additionto In LOF+: plusframeshift. LoF LOF: MIS:population. missense. geographic/ethnic particular in any frequency increased with no variants, 65 LoF gnomADlists VPS13D, For @: ExAC. on based arepLI and RVIS, O/E LoF extremelyintolerant). as LoF regarded >=0.9 (pLI Intolerance LoF of probability pLI: ofobserved/expected. variants O/E: number site mutations. splice essential and stop-gained function, of Loss LoF: release. onExAC (gnomAD) v2 constructed v4, RVIS %ExAC RVIS: v2 in paranthesis. given genes human inall ranked score intolerance with intolerant) more (more negative score intolerance variation residual RVIS: Organelle organization, Golgi implicated implicated functions functions Cellular Cellular Yeast 17

defects defects Mitochondrial lethal, Embryonic ration ration Neurodegene- span, life Reduced CG32113 CG32113 Vps13D/ available data No CG15523 Vps13B/ CG2093 Vps13/ phenotypes phenotypes paralogs paralogs

Author Manuscriptfly Fruit mutant mutant

19 paralogs in animals and humans and animals in VPS13Dparalogs

complete penetrance complete with placentation before lethal Embryonic VPS13D Neurologically normal Neurologically Viable, Viable, VPS13C 20 in 129/SvEvbackground in abnormal Neurologically Acanthocytosis, Viable, VPS13A No data available data No VPS13B This article isprotected by copyright. All rights reserved. Mouse null phenotypes null Mouse

Vertebral paralogs paralogs Vertebral Annals ofNeurology John Wiley&Sons $

( (17.5%) ( ( 12.08%) 0.14%) 2.03%) RVIS RVIS -0.61 -0.61 -4.23 -4.23 -1.85 -1.85 -0.81 -0.81 Mutation Intolerance Mutation

v2RVIS %ExAC in human in (0.11%) (2.69%) (1.20%) (0.51%)

-5.77 -2.13 -2.83 -3.75

127.8 141.1 119.0 156.2 28 LoF O/E O/E 65/ 83/ 30/

@ /

1.00 0.00 0.00 0.00 LoF pLI

Ataxia syndrome syndrome Cohen disorder Parkinson's cytosis acantho- Chorea Disorder * 23-27 22 Human disorder Human

28-29

41/45 LOF+ / / LOF+ LOF+ 41/45 MIS LOF+ / 1/45 3/45 MIS MIS / 3/45 29/31 LOF+ / / LOF+ LOF+ 29/31 MIS LOF+ / 1/31 1/31 MIS MIS / 1/31

2/7 Splice? / / LOF Splice? 2/7 5/7 MIS LOF / 5/7 3/4 LOF / LOF / LOF 3/4 MIS LOF / 1/4 mutation type mutation Disease Disease

Author Manuscriptfamilies Figureheterozygousin compound VPS13D1: Multiplexataxia mutations with This article isprotected by copyright. All rights reserved. 170x95mm (300170x95mm 300DPI) x Annals ofNeurology John Wiley&Sons

Page 68of76 Page 69of76

Author inFigure Drosophila the central affects 2: system Disruptionmitochondrial nervous Vps13D of morphology. Manuscript This article isprotected by copyright. All rights reserved. 80x225mm (30080x225mm 300DPI) x Annals ofNeurology John Wiley&Sons

Author ManuscriptFigureVps13D inof 3:Drosophila motoneuronsKnockdown disrupts distributionmitochondria the of to This article isprotected by copyright. All rights reserved. 170x135mm(300 300DPI) x Annals ofNeurology John Wiley&Sons distal axons distalaxons

Page 70of76 Page 71of76

Author Manuscript

Figure 4: Patient fibroblasts contain abnormal spherical Figurefibroblastsabnormal 4: Patient contain mitochondria This article isprotected by copyright. All rights reserved. 170x114mm(300 300DPI) x Annals ofNeurology John Wiley&Sons

Author Manuscriptin VPS13D fibroblastsFiguremutant 5: Altered ATP morphologydecreased mitochondrial and This article isprotected by copyright. All rights reserved. 170x93mm (300170x93mm 300DPI) x Annals ofNeurology John Wiley&Sons

Page 72of76 Page 73of76

Author ManuscriptFigure BW 1:families Multiplex inwith compoundVPS13D heterozygous ataxia mutations This article isprotected by copyright. All rights reserved. 170x97mm (300170x97mm 300DPI) x Annals ofNeurology John Wiley&Sons

AuthorFigure BW 2: Disruption Vps13D inof Drosophila the affects system mitochondrialcentral nervous Manuscript This article isprotected by copyright. All rights reserved. 80x225mm (30080x225mm 300DPI) x Annals ofNeurology John Wiley&Sons morphology

Page 74of76 Page 75of76

Author Manuscript BW Figure 4: Patient fibroblasts containspherical Figure fibroblasts abnormal BW 4: Patient mitochondria This article isprotected by copyright. All rights reserved. 170x114mm(300 300DPI) x Annals ofNeurology John Wiley&Sons

Author ManuscriptFigure BW 5: inAltered mutant mitochondrial VPS13D morphologyATP decreased fibroblasts and This article isprotected by copyright. All rights reserved. 170x97mm (300170x97mm 300DPI) x Annals ofNeurology John Wiley&Sons

Page 76of