Genetic Diversity and Habitat Fragmentation in the Montane Marsh Widowbird (Euplectes Psammocromius)

Home , Marsh widowbird

Genetic diversity and habitat fragmentation in the Montane marsh widowbird (Euplectes psammocromius)

Image here, aligned right

John Rolander

Degree project for Master of Science in Biology

Animal Ecology, 45 hec, ht 2013

Department of Biological and Environmental Sciences

University of Gothenburg

Supervisor: Staffan Andersson

Examiner: Lotta Kvarnemo

Abstract Habitat fragmentation is one of the major reasons for biodiversity loss today, and species with already restricted distribution ranges might be particularly sensitive. This study investigated signs of genetic effects of habitat fragmentation and population change in a highly range- and habitat-restricted species, the Montane marsh widowbird Euplectes psammocromius. It inhabits montane grasslands in southern Tanzania and northern Malawi, a habitat that suffers greatly from conversion to farmland and forest plantations. Based on mitochondrial control region sequences, fragmentation was investigated at large scale (Malawi vs. Tanzania) and small scale (in a highland plateau in Tanzania), using neighbour- joining analysis of geographic structuring, analysis of molecular variance (AMOVA) for genetic structuring, and genetic diversity indices. The results show zero or limited gene flow between the Malawi and Tanzania populations, while no such differentiation was detected between the nearby sampling localities in Tanzania. Genetic diversity indices showed no signs of depletion and even indicated a recent population expansion in Tanzania, despite the more rapid habitat loss in this area. It might be that habitat fragmentation is too recent to (yet) have affected genetic diversity, but more likely it relates to nomadic and flexible dispersal to adjust to spatial and temporal variation in breeding conditions (e.g. food or nesting grass), thus mitigating any negative effects of habitat fragmentation on the short term. Nevertheless, to ensure the long-term survival of the Montane marsh widowbird and its rapidly diminishing habitat, additional areas, apart from the Kitulo and Nyika national parks, must be protected.

Table of contents Introduction ...... 1 Methods ...... 3 Samples ...... 3 DNA extraction and amplification ...... 3 Alignment and analysis ...... 4 Results ...... 5 Genetic variation and population expansion ...... 8 Discussion ...... 10 Conclusion ...... 13 Acknowledgements ...... 14 References ...... 15

Introduction Rare or endemic species with restricted distribution ranges are more vulnerable to habitat loss then their more common counterparts. One of the most common factors of extinction risk in rare bird species is loss of habitat (Owens and Bennett, 2000), primarily due to transformation of natural habitat into farmland (Peterjohn, 2003). Habitat fragmentation is the process in which a continuous habitat becomes subdivided into several smaller fragments. The main cause of habitat fragmentation is due to anthropogenic activities in form of expansion and intensification of land use (Andrén, 1994). Habitat fragmentation affects a population in three major ways: 1) by loss of total habitat area, 2) reduced size of habitat fragments and 3) increasing isolation of habitat fragments from each other. The genetic consequences of habitat fragmentation depend primarily on the potential for gene flow between fragments. Frequencies of alleles fluctuate in a population due to random drift, and species that are rare or have restricted distribution ranges are more affected by these fluctuations. The effects of genetic drift have greater impact in smaller populations where it may lead to loss of genetic diversity and associated inbreeding depression. However, recent studies show that this is not always the case. Highly mobile species seem to cope better with habitat fragmentation and retain genetic diversity in contrast to more sedentary species (Lindsay et al, 2008). For example, Canales- Delgadillo et al. (2012) investigated genetic effects of anthropogenic habitat fragmentation in a rare endemic bird inhabiting grassland-desert habitat. They found no genetic degradation even though the natural habitat had declined by more than 30 percent (Canales-Delgadillo et. al, 2012). In this study I investigated if these patterns could be found in another range- restricted grassland bird, the Montane marsh widowbird, Euplectes psammocromius (Aves; Ploceidae), limited to afromontane grasslands in the southern highlands of Tanzania, and the Nyika plateau in northern Malawi. They inhabit short, dense montane grasslands preferably in close vicinity of streams at 1800 – 2000 meters above sea level (Fry and Keith, 2004). Very little is known about the ecology and behaviour of the Montane marsh widowbird (Fry and Keith, 2004). Although no comprehensive census has been done, it is considered to have a viable population status based on the range criterion, trend criterion and population criterion specified by BirdLife International, and is therefore listed as least concern by the International Union for Nature Conservation (BirdLife International, 2012). Since the East African afromontane grasslands are rapidly declining, primarily due to commercial forestry and agriculture (Stuart et al. 1990, WWF 2008, 2012), the Montane marsh widowbird may serve as a valuable ’umbrella species’ for this unique and biodiverse habitat. In particular, the genetic diversity and structure of this species may provide important insights into the viability, degree of fragmentation, and conservation status of this bird and its habitat. The afromontane grassland habitat consists of mosaics of grassland and forests at high altitudes (>2000 m). Restricted to a few isolated mountain ranges and high plateaus, the habitat is naturally fragmented, but is recently also subject to

1 additional fragmentation caused by human activities. It is a highly biodiverse habitat with many endemic species, such as 18 endemic to near-endemic bird species, and has been categorized by BirdLife International as an Endemic Bird Area (EBA). EBA’s are areas which BirdLife International has defined as particularly important to preserve for habitat-based conservation purposes. EBA’s are often located on islands or mountain ranges, with primary focus on forest habitats, ranging from a few square kilometres to about 100,000 km2. About 2,500 of the world’s bird species have home ranges less than 50,000 km2 and are thereby endemics. Important regions where two or more endemic species have an overlapping distribution range form an EBA. The afromontane grasslands in this study belongs to the Tanzania and Malawi mountains EBA, which consists of a chain of isolated mountain ranges that extends for 1,900 km from southeast Kenya, over the southern highlands of Tanzania to Malawi mountains, and northeast Zambia. Most of the restricted range species in the EBA are associated with the forest habitats, but five species are connected to forest-edge or non-forest habitats, including four that have distribution ranges centered on parts of the Udzungwa Mountains, the southern highlands of Tanzania and Nyika plateau in Malawi. The EBA has not been sufficiently explored ornithologically, which means that the distribution ranges for many of the range restricted bird species are not well documented. The main threats to this EBA are loss of forest and grasslands as well as the degradation of the habitat caused by expanding agriculture. Additional threats are replacement of natural forest and grasslands by plantations of three species such as exotic pines and eucalyptus. Previous research on widowbirds in the genus Euplectes has primarily concerned behavioural ecology and sexual selection, and one study of molecular systematics (Prager et al, 2008), but no work on population or conservation genetics. One exception is a pilot study on the genetic variation of the Montane marsh widowbird (Pálsdóttir, 2010). Population genetic studies which elucidate the genetic impact of habitat fragmentation on the Montane marsh widowbird have not been analysed before. This study will approach the following study objectives: 1) Estimate the genetic diversity of the Montane marsh widowbird in Tanzania and Malawi 2) Genetic analyses of large-scale and small-scale habitat fragmentation effects and 3) Genetic signatures of recent changes (or stability) in population size.

Methods

Samples Blood samples stored in acetone from 105 individuals of E. psammocromius were collected from two separate localities in Tanzania; Mtitu valley (08°12´S 35° 48É) represented by 38 samples, and Mtanga farm (08°08´S 35°50É) represented by 14 samples, between November 2010 to January 2011 by the author, and student Jesper Nilsson in collaboration with the Bird Atlas Tanzania project. Moreover, 30 additional samples from Mtitu were collected 2009 – 2010 by Jenny Olsson and David Krantz. Finally, 23 samples were collected by Staffan Andersson in 2004 from the Nyika plateau (10°37´S 33°47É), Malawi.

DNA extraction and amplification A small amount of the blood pellet was taken from each sample, transferred to a microcentrifuge tube, evaporated briefly in RT, and washed with 500µl Phosphate buffered saline (PBS). The mixture was centrifuged for 30 seconds, PBS removed, whereafter any remains of acetone were evaporated in a thermo mixer for one hour. DNA was extracted using Qiagen DNeasy® blood and tissue kit following the manufacturer protocol. 25 µl PCRs were prepared with 0.25 µl 5U/µl taq polymerase, 0.5 µl 10 µM dNTP, 2.5 µl 10x PCR Rxn buffer, 1.75 µl 25 mM MgCl2, 1.25 µl DMSO, 1.25 µl of each primer (10 µM) and 14.25 µl ddH2O. Primers used were LCON2 and PlocCR-R1 (Table 1), targeting the mitochondrial control region, domain III. PCR amplification was performed, using an Eppendorf Mastercycler gradient. The amplification program for the control region was 94 °C for 5 min, followed by 30 cycles at 94 °C for 40 s and 54.5 °C for 40 s and an extension step at 72 °C for 1 min and a final extension step at 72 °C for 8 min. The PCR products were examined in 1% agarose gels with Biotium Gel Red™ staining. Purification and sequencing in both directions of ca 600 bp long fragments of the mtDNA control region was outsourced to Macrogen Inc.

Table 1. Primers used for PCR and sequencing of mitochondrial DNA Control region III in Montane marsh widowbird, Euplectes psammocromius

Primer Target Region Sequence (5’- 3’) Reference LCON2 Control Region III CTTCCTCTTGACATGTCCAT (Zink, Weller and (forward) mtDNA Blackwell, 1998) PlocCR-R1 Control Region III CTTGACATCTTCA GTGTCATGCTT (Andersson (reverse) mtDNA S & Pálsdóttir, 2010)

Alignment and analysis Sequence data from 2009 and 2010 from Tanzania samples together with previously obtained sequences from the Malawi samples (Pálsdóttir, 2010), were imported, trimmed and aligned in Geneious Pro v 5.04 (Drummond et al., 2010). Sequences with poor quality endings were trimmed and sequences with poor quality overall were excluded from the analysis. Since the reverse primer did not function adequately on 2010 years data, only single reads were included from these samples. The results were controlled and manually adjusted when needed. The sequences were aligned with default settings in Geneious Pro, and consensus files compiled for Tanzania and Malawi, respectively. In total, 105 sequences were analysed; 82 from Tanzania and 23 from Malawi. Phylogenetic relationships among haplotypes were analysed using Neighbour-joining (Saitou and Nei, 1987) with the p-distance method, in which gaps are replaced with an A as a fifth character state. The Neighbour-joining tree was constructed using MEGA version 5 (Tamura et al., 2011). Genetic diversity and structure were explored by analysis of molecular variance (AMOVA), using Arlequin v.3.1 (Excoffier, Laval and Schneider, 2005). The null distribution to test the significance of the variance components and the F- statistics (φST) were constructed from 10.000 permutations of the data. Genetic diversity was estimated by haplotype diversity (h), nucleotide diversity (π), number of polymorphic sites (s) and number of pairwise differences (k), all calculated using Arlequin (Excoffier, Laval and Schneider, 2005) (Table 4). In order to test deviations from neutral selection in the control region, Tajima’s D (Tajima, 1989) was estimated for Malawi and Tanzania and Mtitu and Mtanga respectively using the neutrality test implemented in Arlequin (Excoffier, Laval and Schneider, 2005).

Results In the alignment of 105 sequences with a 500 bp long fragment of Montane marsh widowbird mtDNA control region sequence, 15 sites (3%) were polymorphic, of which 14 (2,8%) were phylogenetically informative. Fourteen of the sites had substitutions whilst one site had deletions (Table 2). Two haplotypes were clearly dominant of which haplotype 1 (n=41) was found both in the Tanzania and Malawi populations. The second most common haplotype 2 (n=29) was only found in the Tanzania population. In addition to the 14 haplotypes found previously (Pálsdóttir, 2010), two new haplotypes were identified in the extended Tanzania sample, number 14 and 15 (Table 2), one from Mtanga and the other from Mtitu (Figure 1).

Table 2. Variable nucleotide position sites for the 16 different haplotypes of the Montane marsh

widowbird (Euplectes psammocromius). Positions are read from top to bottom, total size of the investigated fragment is 500 base pairs long. [X] denotes a missing base and [.] is the same as haplotype 1. Nucleotide positions:

5 8 9 1 1 2 3 3 3 3 3 3 4 4 4 7 9 6 6 9 8 1 1 5 6 8 9 7 8 9 4 2 3 2 4 9 3 1 4 0 4 3 n = 1 T A T G A G A T T A C C C T T 41 2 ...... X . . . 29 3 . G ...... 11 4 ...... G . . . . . 4 5 . . . A ...... 3 6 . . . . . A ...... 3 7 . G ...... X . . . 2 8 ...... A . . . . 2 9 ...... G ...... 2 10 . . . . G . . C ...... 2 11 ...... T . . 1 12 ...... C 1 13 ...... C . 1 14 G ...... X . . . 1 15 ...... C ...... 1 16 . . C ...... 1

The distribution of haplotype frequencies for the localities is showed in Figure 1. Haplotype 1 is the most common (n=41) and is also the only one shared between Malawi and Tanzania. The figure shows that haplotype 1 and 2 is clearly dominant while the majority have overall low frequencies. Haplotypes 3, 7 and 16 is unique to Malawi where haplotype 3 is the most common type.

60%

50%

40%

30% Mtitu

20% Mtanga Nyika 10%

Figure 1. Frequency distribution (%) of mtDNA control haplotypes at each of the three localities, Mtitu and Mtanga (Tanzania) and Nyika (Malawi).

The neighbour-joining haplotype phylogeny (Fig.2), using the closely related E. progne as outgroup, does not suggest much geographic structure, except that haplotypes 3 and 7 seems to have diverged in Malawi, and that the shared haplotype 1 likely was part of a founding population that colonized the Nyika plateau from the southern Highlands of Tanzania.

Haplotype Mtitu Mtanga Nyika

8 X 9 X X 1 X X X 16 X 4 X 5 X 3 X

7 X

2 X

14 X

15 X

6 X

11 X

12 X

13 X

10 X

E.progne

Figure 2. Evolutionary relationships of haplotypes, inferred using Neighbour-Joining analysis (Saitou and Nei, 1987) conducted in MEGA5 (Tamura et al, 2011). The optimal tree with the sum of branch length = 0.06690525 is shown. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the p-distance method (Nei, 2000) and are in the units of the number of base differences per site. The analysis involved 17 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 500 positions in the final dataset.

The results of the AMOVA analysis showed that most variation is among individuals both in Malawi-Tanzania (64%) and Mtitu-Mtanga (102%) while the lower amount in Mtitu-Mtanga (-1.8%) and Malawi-Tanzania (36%) is due to differences between sampling localities. The negative values can occur since the AMOVA analysis is based on covariance components, which may occasionally give negative values when the true value is actually zero. Since all percentages must sum up to 100, values above 100 can be a consequence, when negative percentage values are present (Solomon, 2007, p.46). The results further indicated a significant genetic differentiation between the Malawi and Tanzania populations while no such differentiation could be found between the two sampling localities in Tanzania. This difference is also supported with fixation indexes (Table 3).

Table 3. Analysis of molecular variance (AMOVA) of mitochondrial DNA haplotype variation of the Montane marsh widowbird.

Source of variation Fixation Variance % of d.f P index components variation (φST) Malawi and Tanzania Among countries 1 0.16 35.84 <0.0001 0.36 Within countries 103 0.28 64.16 <0.0001

Mtitu and Mtanga

Among localities 1 0.00 -1.83 NS -0.02 Within localities 80 0.28 101.83 <0,05

Genetic variation and population expansion The haplotype diversity over all loci spans from 0.64 in Malawi to 0.73 in Mtitu while the nucleotide diversity spans from 0.0009 in Mtanga to 0.0012 in Malawi (Table 4). In order to test for recent population change Tajima’s D test for neutral selection was calculated. The result showed a significant negative deviation from zero (i.e. neutrality) in the Tanzania population (and at both localities), while no such deviation was indicated for the Malawi population.

Table 4. Measures of genetic variation (±SD) of the Montane marsh widowbird. Test of neutral selection estimated from Tajima’s D test.

Localities (n) Polymorphic Pairwise Haplotype Nucleotide Tajima's Tajima's sites (s) differences diversity diversity (π) D D p – (k) (h) values Malawi 23 2 0.60±0.50 0.64±0.06 0.0012±0.0011 0.24251 NS Tanzania 82 12 0.55±0.46 0.72±0.03 0.0011±0.0010 -2.10737 <0.0001 Mtitu 68 11 0.58±0.47 0.73±0.04 0.0012±0.0011 -2.06838 <0.01 Mtanga 14 14 0.43±0.41 0.70±0.10 0.0009±0.0009 -1.67053 <0,05

The Montane marsh widowbird has relatively high haplotype diversity compared to sedentary rainforest dwelling species that have been subject to habitat fragmentation (Table 5). In relation to another open habitat resident, which also has a restricted distribution range, the haplotype diversity is essentially the same. It should be noted that in the study by Canales-Delgadillo et al. (2012) a different genetic marker was used compared to this study.

Table 5. The mitochondrial DNA and microsatellite genetic diversity in a number of passerine species. n, sample size; Hd, haplotype diversity; π, nucleotide diversity.

Localities n Marker Hd π Hab.pref References

Euplectes Montane 3 105 CR 0.70 0.0011 This study psammocromius grassland Henicorhina 1 34 CR 0.32 0.0017 Rain forest Brown et al. 2004 leucosticte Gymnopithys 1 8 CR 0.00 0.0000 Rain forest Brown et al. 2004 leucaspis Eucometis 1 17 CR 0.57 0.0027 Rain forest Brown et al. 2004 penicillata Grassland – Canales-Delgadillo Spizella wortheni 7 100 MICROSAT 0.65 - desert et al. 2012

Discussion Despite alarming signs of habitat loss due to commercial forestry and cultivation of afromontane grasslands, there were no signs of depleted genetic variation in Montane marsh widowbirds in either of the two populations in southern Tanzania and northern Malawi, respectively. Neither was there any evidence of fragmentation at the smaller scale (i.e. between nearby localities in Tanzania), but as suspected there is no or minimal gene flow between the two isolated mountain ranges. Only one haplotype, the most frequent one, is shared between the Malawi and Tanzania populations and thus seems likely to have been one of the founding haplotypes when the Nyika plateau in Malawi was colonized. According to Mindell (1997), the oldest haplotype is also the most widely distributed (Mindell, 1997, p.68). Furthermore, the larger number and diversity in Tanzania (Figure 1, Table 4), also support Tanzania as the phylogeographic origin. It should be noted however, that the sample size from Tanzania is larger than from Malawi (82 vs. 24) which might explain the higher diversity of haplotypes in Tanzania. The Neighbour joining analysis did not suggest any geographic structuring except that the Malawi haplotypes are fewer and partly group together. It also confirmed that Euplectes progne is a distinct (reciprocally monophyletic) species from the Montane marsh widowbird, as previously suggested (based on much fewer individuals) by Prager et al. (2008). Furthermore it seems that that two of the haplotypes (Haplotypes 3 and 7), that are unique to Malawi have recently diverged from the others, indicating that the two populations have not been separated for long. The result from the AMOVA analysis further confirmed that there is limited or no gene flow between the Malawi and Tanzania populations. No such separation could be found between the two sampling localities in Tanzania, indicating that they are fully interbreeding. The divergence between the subpopulations could be explained by the old, natural fragmentation of the habitat, and also the additional subdivision of the fragments caused by expansion of agriculture and commercial forestry. The genetic diversity was comparatively high in relation to similar studies on passerine bird species (Table 5). There is, however, a slight difference in haplotype diversity between Malawi and Tanzania with Tanzania displaying the highest diversity (Table 4). The results further revealed a notable difference between haplotype diversity and nucleotide diversity both in the Malawi and Tanzania populations, where the nucleotide diversity were generally lower compared to other studies (Table 4 and 5). This result indicates a possible population expansion in Tanzania since rapid demographic expansion results in many low frequency haplotypes (Figure 1) while the nucleotide diversity is overall low (Grant and Bowen, 1998). As mentioned earlier, the sample size from Tanzania is considerably larger, which might explain the higher haplotype diversity. This result should thus be interpreted with caution. The result from the Tajima’s D test revealed a significant deviation from neutrality (i.e drift and/or constant population size) in the Tanzania population but not in Malawi. Since the non-coding mtDNA control region is unlikely to be under

10 selection, this result suggests a recent population expansion in Tanzania while no change in population size has occurred in Malawi. This potential population expansion in Tanzania might be explained by an initial positive effect of utilization of crops as a food source. The samples collected in Malawi were gathered from the Nyika plateau which is a national park and thereby protected from land usage. This means that the extra food source that the crops might entail is lacking in the area, this could be the explanation to why there is no detectable population change of the Montane marsh widowbird in this area. However, since the transformation to farmland also is at the expense of the natural grasslands it is likely that the long- term effect is negative due to loss of breeding habitat. The retained (or even increasing) genetic diversity, despite habitat fragmentation may thus be explained by an initially positive effect of agriculture. There may, however, be an alternative or additional explanation related to the dispersal behaviour. In a study of man-made habitat fragmentation effects on the rare endemic Worthen’s sparrow Spizella wortheni, Canales-Delgadillo et al. (2012) found that even though the natural habitat had decreased with more than 30% and that travel distance between the habitat patches exceed 5 km, there was no detectable degradation of the genetic diversity. The authors argue that the results might have to do with the nomadic behaviour of the study species. This would suggest that nomadic species are more resilient to fragmentation than non-nomadic counterparts. Nomadic behaviour is associated with the ability to move to where the food resources are most abundant (Andersson, 1980). Since the Montane marsh widowbird is a granivore, dependent on a strongly fluctuating and spatially and temporally unpredictable food resource (ripe grass seeds), this species also exhibits a nomadic lifestyle. According to Craig (1980) the cultivation of crops has been beneficial for most of the species in the genus, especially the southern red bishop Euplectes orix, which is now considered a crop pest in many areas. For species with more restricted habitat requirements, human activities may have direct negative effects (Craig, 1980). Even though no decline in genetic diversity was detected, there is still a risk that the Montane marsh widowbird has lost some genetic diversity through the recent population decline over the whole distribution range, as a consequence of habitat loss. The status of the Montane marsh widowbird is considered stable even though its habitat is under rapid decline due to commercial forestry and cultivation. Surveys have found that the Montane marsh widowbird is ‘locally common’ in the southern highlands of Tanzania (Olsson, 2010) which might be due to the initial positive effect of cultivation as mentioned earlier, though in the long term it will lead to further encroachment of the natural habitat, and further distance between habitat patches. This will affect the reproduction negatively since the afromontane grasslands constitute the breeding ground for the Montane marsh widowbird. It is not only cultivation of crops that threatens the natural habitat, also plantations of invasive trees like pines and eucalyptus further reduce the already hard-pressed habitat. This commercial forestry poses a problem since it is a source of income and yields more revenue than crops (Almqvist, 2012). This implies a strong incitement to focus on commercial forestry plantation instead of cultivation of crops. A transition from farmland to tree plantation means that the favourable

11 effect of the crop cultivation will disappear and a decrease in population size of the Montane marsh widowbird would be expected. In order to halt further degradation of the afromontane grasslands in the southern highlands of Tanzania it is important to educate local residents on the unique wildlife in the area and in what way it is affected by different land use regimes. The southern highlands of Tanzania have very limited official protection (except for the Kitulo plateau national park). In order to preserve this rare habitat it is of vital importance that more natural reserves are established, and that transformation of native grassland into farmland and tree plantation is better controlled. By protecting the Montane marsh widowbird many other species that are dependent upon the afromontane grasslands will have protection, the Montane marsh widowbird may have an important role as an umbrella species, together with its close relative the long-tailed widowbird Euplectes progne, also restricted to afromontane grasslands in Kenya and South Africa.

Conclusion I could not detect any negative effects of habitat fragmentation on the Montane marsh widowbird. The genetic diversity seems to be maintained despite rapid habitat loss. This is probably due to the dispersal capacity of the species since it has the ability to move between habitat patches. This nomadic lifestyle is an adaptation to an environment in which resources varies throughout the year, both temporal and spatial. It is a possibility that the nomadic lifestyle of the Montane marsh widowbird might mitigate the negative effects of man-made habitat fragmentation. I found signs of recent population expansion in Tanzania, presumably due to initial positive effects of crops as a food source. However this temporary positive effect will gradually diminish since the afromontane grasslands are poorly protected and are in rapid decline. Conservation measures like land use control and establishment of natural reserves must be completed, since the threshold of when the negative effects of habitat fragmentation become irreversible on the Montane marsh widowbird and its habitat is unknown.

Acknowledgements I would like to thank my supervisor Staffan Andersson for the opportunity to go to Tanzania and do this field study and for help and guidance during the study. Furthermore, I would like to thank Jesper Nilsson and Calum Ninnes for good cooperation in the field. A special thanks to my friends in Tanzania, Leons, Maneno and David for your help and for teaching me about caching birds and identifying them. To David Krantz, Jenny Olsson and Ylfa Pálsdóttir for letting me use your data and to Svante Martinsson for valuable help. Finally, special recognition goes out to my friends and to Johanna for supporting and believing in me.

References Almqvist, J., 2012. Fjärranalys av utbredning och exploatering av Afromontana gräsmarker i södra Tanzania. Bachelor Thesis. University of Gothenburg.

Andersson, M., 1980. Nomadism and Site Tenacity as Alternative Reproductive Tactics in Birds. Journal of Animal Ecology, 49(1), pp.175–184.

Andrén, H., 1994. Effects of Habitat Fragmentation on Birds and Mammals in Landscapes with Different Proportions of Suitable Habitat: A Review. Oikos, 71(3), p.355.

BirdLife International, 2012. Species factsheet: Euplectes psammocromius. [online] Available at: [Accessed 20 Nov. 2012].

Canales-Delgadillo, J.C., Scott-Morales, L. and Korb, J., 2012. The influence of habitat fragmentation on genetic diversity of a rare bird species that commonly faces environmental fluctuations. Journal of Avian Biology, 43(2), pp.168–176.

Craig, A.J.F.K., 1980. Behaviour and evolution in the genus Euplectes. Journal of Ornithology, 121(2), pp.144–161.

Drummond, A. et al., 2010. Geneious version 5.0.4. [online] Biomatters Ltd. Available at: .

Excoffier, L., Laval, G. and Schneider, S., 2005. Arlequin ver. 3.11: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1, pp.47–50.

Fry, C.H. and Keith, S. eds., 2004. The Birds of Africa, Volume VII. Princeton University Press.

Grant, W. a. S. and Bowen, B.W., 1998. Shallow population histories in deep evolutionary lineages of marine fishes: insights from sardines and anchovies and lessons for conservation. Journal of Heredity, 89(5), pp.415–426.

Lindsay, D.L. et al., 2008. Habitat fragmentation and genetic diversity of an endangered, migratory songbird, the golden-cheeked warbler (Dendroica chrysoparia). Molecular Ecology, 17(9), pp.2122–2133.

Mindell, D.P. ed., 1997. Avian Molecular Evolution and Systematics. 1st ed. San Diego: Academic Press.

Nei, M., 2000. Molecular evolution and phylogenetics. Oxford ; New York: Oxford University Press.

Olsson, J., 2010. Population status and habitat preference of the Mountain Marsh Widowbird (Euplectes psammocromius). Master Thesis. University of Gothenburg.

Owens, I.P.F. and Bennett, P.M., 2000. Ecological basis of extinction risk in birds: Habitat loss versus human persecution and introduced predators. Proceedings of the National Academy of Sciences, 97(22), pp.12144–12148.

Pálsdóttir, Y.E., 2010. Genetic variation in the mountain marsh widowbird Euplectes psammocromius. Master Thesis. University of Gothenburg.

Peterjohn, B.G., 2003. Agricultural landscapes: can they support healthy bird populations as well as farm products?. The Auk, 120(1), p.14.

Prager, M., Johansson, E.I.A. and Andersson, S., 2008. A molecular phylogeny of the African widowbirds and bishops, Euplectes spp. (Aves: Passeridae: Ploceinae). Molecular Phylogenetics and Evolution, 46(1), pp.290–302.

Saitou, N. and Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4(4), pp.406– 425.

Solomon, S.E., 2007. Biogeography and Evolution of Widespread Leafcutting Ants, Atta Spp. (Formicidae, Attini). ProQuest.

Stuart, S.N., Adams, R.J., Jenkins, M. and Biodiversity Conservation Strategy Programme, 1990. Biodiversity in sub-Saharan Africa and its islands : conservation, management, and sustainable use. Gland, Switzerland: IUCN.

Tajima, F., 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123(3), pp.585–595.

Tamura, K. et al., 2011. MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution, 28(10), pp.2731–2739.

World Wildlife Fund and Estes, L.D., 2012. Southern Africa: Southern Tanzania into Malawi | Ecoregions | WWF. [online] Available at: [Accessed 30 Oct. 2012].

World Wildlife Fund and McGinley, M., 2008. “Southern Rift montane forest- grassland mosaic”. In: Encyclopedia of Earth. Eds. Cutler J. Cleveland (Washington, D.C.: Environmental Information Coalition, National Council for Science and the Environment). [online] Available at: [Accessed 7 Nov. 2012].

Zink, R.M., Weller, S.J. and Blackwell, R.C., 1998. Molecular phylogenetics of the avian genus Pipilo and a biogeographic argument for taxonomic uncertainty. Molecular phylogenetics and evolution, 10(2), pp.191–201.