On the Generic Taxonomy of Opisthotropis Balteata (Cope, 1895) (Squamata: Colubridae: Natricinae): Taxonomic Revision of Two Natricine Genera
Total Page：16
File Type：pdf, Size：1020Kb
Asian Herpetological Research 2019, 10(2): 105–128 ORIGINAL ARTICLE DOI: 10.16373/j.cnki.ahr.180091 On the Generic Taxonomy of Opisthotropis balteata (Cope, 1895) (Squamata: Colubridae: Natricinae): Taxonomic Revision of Two Natricine Genera Jinlong REN1,2,3, Kai WANG4, Peng GUO5, Yingyong WANG6, Tao Thien NGUYEN7,8 and Jiatang LI1,2,9* 1 CAS Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization and Ecological Restoration and Biodiversity Conservation Key Laboratory of Sichuan Province, Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, Sichuan 610041, China 2 Center for Excellence in Animal Evolution and Genetics, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 3 University of Chinese Academy of Sciences, Beijing 100049, China 4 Sam Noble Oklahoma Museum of Natural History and Department of Biology, University of Oklahoma, Norman, Oklahoma 73019, USA 5 College of Life Sciences and Food Engineering, Yibin University, Yibin, Sichuan 644007, China 6 State Key Laboratory of Biocontrol / The Museum of Biology, School of Life Sciences, Sun Yat-sen University, Guangzhou, Guangdong 510275, China 7 Vietnam National Museum of Nature, Vietnam Academy of Science and Technology, 18 Hoang Quoc Viet Road, Hanoi, Vietnam 8 Graduate University of Science and Technology, Vietnam Academy of Science and Technology, 18 Hoang Quoc Viet, Cau Giay, Hanoi, Vietnam 9 Southeast Asia Biodiversity Research Institute, Chinese Academy of Sciences, Yezin, Nay Pyi Taw 05282, Myanmar Abstract The single prefrontal configuration has historically been used as an important diagnostic character for many natricine taxa. For example, the genus Trimerodytes Cope, 1895 was long been regarded as a junior synonym of Opisthotropis Günther, 1872 for their similar prefrontal configurations and the type species, T. balteatus Cope, 1895, has been assigned to the genus Opisthotropis. However, as the number and arrangement of prefrontal vary frequently both at species and generic level, it is questionable whether the synonymization of Trimerodytes reflects their evolutionary relationships. On the basis of recently collected specimens of O. balteata, the generic status of the species was assessed using both molecular and morphological data. Opisthotropis was recovered as polyphyletic with reference to O. balteata, because O. balteata is nested within the genus Sinonatrix Rossman and Eberle, 1977 and is the sister species of the type species of Sinonatrix. Consequently, we herein resurrect the long-overlooked synonym Trimerodytes from Opisthotropis and synonymize the junior generic nomen Sinonatrix with Trimerodytes. In addition, based on morphological similarities between the monotypic genus Paratapinophis Angel, 1929 and Trimerodytes, we doubt about the validity of Paratapinophis. Following taxonomic changes in this work, the taxonomic account of the genus Trimerodytes, updated descriptions of its type species, and diagnostic key to Trimerodytes species are provided. Keywords Paratapinophis, prefrontal scales, Sinonatrix, taxonomic revision, Trimerodytes 1. Introduction recognized to date (Figueroa et al., 2016). This family represents the most morphologically diverse and widely The family Colubridae includes more than half of the distributed group among all squamates (Uetz et al., 2018; known snake species of the world, with eight subfamilies Zhao et al., 1998). Within the family, numbers of cephalic * Corresponding author: Dr. Jiatang LI, from Museum of Herpetology, scales and their arrangements represent one of the most Chengdu Institute of Biology, Chinese Academy of Sciences, with his research focusing on taxonomy, phylogenetics, biogeography, genomics important diagnostic characters (Boulenger, 1893; and evolution of amphibians and reptiles. Smith, 1943; Zhao, 2006). Regarding these head scales, E-mail: [email protected] Received: 18 December 2018 Accepted: 25 April 2019 most colubrid snakes have nine enlarged dorsal side of 106 Asian Herpetological Research Vol. 10 head scales, including paired internasals, prefrontals, specimens of O. balteata, in this study we assessed the supraoculars, parietal scales, and a single frontal scale. taxonomic validity of Trimerodytes and the phylogenetic Such set of head scales and their configurations are position of O. balteata. Furthermore, we examined known as the typical colubrid configuration or “colubrid- the usefulness of the prefrontal configuration as the elapid dorsal nine-scute arrangement” (David et al., 2015; generic diagnosis among natricine genera. Our results O’shea et al., 2018). indicate that the genus Opisthotropis is polyphyletic with Despite the fact that such typical configuration of respect to O. balteata, which is nested within the genus head scales is common, a great variation exits among the Sinonatrix Rossman and Eberle, 1977 and is sister to keelback snakes of the subfamily Natricinae, particularly Sinonatrix annularis (Hallowell, 1856), the type species for the prefrontal scales (Bourret, 1934; David et al., of the latter genus (Rossman and Eberle, 1977). As a 2015; Smith, 1943; Zhao and Jiang, 1981). Since the consequence, we resurrect the long-overlooked synonym presence of paired prefrontals is considered to be the Trimerodytes from Opisthotropis and synonymized the typical configuration, any variation from this condition, junior name Sinonatrix with Trimerodytes. In addition, we such as a single prefrontal, is regarded as an important comment on the similarities in morphological characters diagnostic character in taxonomic delimitations, between the monotypic genus Paratapinophis and particularly at the generic level (Angel, 1929; Bourret, Trimerodytes. Lastly, we provide a taxonomic account of 1934; David et al., 2015; Taylor and Elbel, 1958). Trimerodytes, the updated description of its type species, The single prefrontal configuration is found in many and a diagnostic key to this genus. natricine groups, including Opisthotropis Günther, 1872, Paratapinophis Angel, 1929, Isanophis David, Pauwels, 2. Materials and Methods Nguyen and Vogel, 2015, Hebius Thompson, 1913, Trachischium Günther, 1858, and Rhabdops Boulenger, 2.1. Sampling Specimens were collected during field 1893 (Angel, 1929; Bourret, 1934; Kizirian et al., 2018; surveys from June 2015 to September 2018. After being Smith, 1943; Taylor and Elbel, 1958; David et al., 2015). euthanized, fresh liver tissues were taken and preserved Furthermore, the morphology-based taxonomy that in 95% ethanol, and then stored at –20°C for DNA relies on the single prefrontal has resulted in taxonomic extraction. Specimens were preserved in 10% formalin confusions, in which species were incorrectly assigned to in the field and transferred to 75% ethanol for permanent a genus based on their similar prefrontal configurations storage after fieldwork. All of these recently collected (Brown and Leviton, 1961; Pope, 1935; Smith, 1943; specimens were deposited in major collections in China, Taylor and Elbel, 1958). including the Museum of Herpetology, Chengdu Institute Erected as a monotypic genus, with Trimerodytes of Biology, Chinese Academy of Sciences, Chengdu, balteatus Cope, 1895 as the sole included species, China (CIB); the Museum of Biology, Sun Yat-sen the genus Trimerodytes was later synonymized with University, Guangzhou, China (SYS); and College of Life Opisthotropis on the basis of morphological similarities, Sciences and Food Engineering, Yibin University, Yibin, including the presence of a single prefrontal scale (Pope, China (YBU). In addition, specimens were examined 1935). Most later authors followed Pope (1935) and in the following collections: Institute of Ecology and considered Trimerodytes to be a junior synonym of Biological Resources, Vietnam Academy of Science Opisthotropis and its type species, T. balteatus, has been and Technology, Hanoi, Vietnam (IEBR); Museum of Kunming Institute of Zoology, Chinese Academy of assigned to Opisthotropis (Brown and Leviton, 1961; Sciences, Kunming, China (KIZ); Vietnam National Nguyen et al., 2009; Smith, 1943; Zhao, 2006; Zhao Museum of Nature, Vietnam Academy of Science and et al., 1998; Zheng, 1992). Although there have been Technology, Hanoi, Vietnam (VNMN); and Zoological recent phylogenetic studies on Opisthotropis, none of Museum, Vietnam National University, Hanoi, Vietnam them included O. balteata in their analyses (Ren et al., (VNUH). The topographic map was created from MAP 2017; Wang et al., 2017b; Ziegler et al., 2017; 2018). WORLD, http://www.tianditu.com. Therefore, the generic assignment of O. balteata has not been confirmed by molecular data. Consequently, both the 2.2. Molecular analyses Genomic DNA was extracted validity of Trimerodytes and the phylogenetic placement from macerated liver tissue samples using an Ezup of its type species have remained unknown (Cope, 1895; Column Animal Genomic DNA Purification Kit David et al., 2011). (Sangon Biotech, China), according to the protocols On the basis of newly collected genetic tissues and of the manufacturer. A total of 1 060 bp of the No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 107 mitochondrial gene cytochrome b (cyt b) was targeted et al., 2017b), PCR protocols as described by Ren et al. and amplified via the polymerase chain reaction (2017). The PCR products were purified and sequenced (PCR), using the following primer pairs: L14919 (5'– in both directions using an ABI 3730xL sequencer by AACCACCGTTGTTATTCAACT–3')/L14910 (5'– Sangon Biotech Co., Ltd (Chengdu,