Asian Herpetological Research 2019, 10(2): 105–128 ORIGINAL ARTICLE DOI: 10.16373/j.cnki.ahr.180091

On the Generic Taxonomy of Opisthotropis balteata (Cope, 1895) (Squamata: Colubridae: Natricinae): Taxonomic Revision of Two Natricine Genera

Jinlong REN1,2,3, Kai WANG4, Peng GUO5, Yingyong WANG6, Tao Thien NGUYEN7,8 and Jiatang LI1,2,9*

1 CAS Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization and Ecological Restoration and Biodiversity Conservation Key Laboratory of Sichuan Province, Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, Sichuan 610041, China 2 Center for Excellence in Animal Evolution and Genetics, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 3 University of Chinese Academy of Sciences, Beijing 100049, China 4 Sam Noble Oklahoma Museum of Natural History and Department of Biology, University of Oklahoma, Norman, Oklahoma 73019, USA 5 College of Life Sciences and Food Engineering, Yibin University, Yibin, Sichuan 644007, China 6 State Key Laboratory of Biocontrol / The Museum of Biology, School of Life Sciences, Sun Yat-sen University, Guangzhou, Guangdong 510275, China 7 Vietnam National Museum of Nature, Vietnam Academy of Science and Technology, 18 Hoang Quoc Viet Road, Hanoi, Vietnam 8 Graduate University of Science and Technology, Vietnam Academy of Science and Technology, 18 Hoang Quoc Viet, Cau Giay, Hanoi, Vietnam 9 Southeast Asia Biodiversity Research Institute, Chinese Academy of Sciences, Yezin, Nay Pyi Taw 05282, Myanmar

Abstract The single prefrontal configuration has historically been used as an important diagnostic character for many natricine taxa. For example, the genus Trimerodytes Cope, 1895 was long been regarded as a junior synonym of Opisthotropis Günther, 1872 for their similar prefrontal configurations and the type species, T. balteatus Cope, 1895, has been assigned to the genus Opisthotropis. However, as the number and arrangement of prefrontal vary frequently both at species and generic level, it is questionable whether the synonymization of Trimerodytes reflects their evolutionary relationships. On the basis of recently collected specimens of O. balteata, the generic status of the species was assessed using both molecular and morphological data. Opisthotropis was recovered as polyphyletic with reference to O. balteata, because O. balteata is nested within the genus Sinonatrix Rossman and Eberle, 1977 and is the sister species of the type species of Sinonatrix. Consequently, we herein resurrect the long-overlooked synonym Trimerodytes from Opisthotropis and synonymize the junior generic nomen Sinonatrix with Trimerodytes. In addition, based on morphological similarities between the monotypic genus Paratapinophis Angel, 1929 and Trimerodytes, we doubt about the validity of Paratapinophis. Following taxonomic changes in this work, the taxonomic account of the genus Trimerodytes, updated descriptions of its type species, and diagnostic key to Trimerodytes species are provided. Keywords Paratapinophis, prefrontal scales, Sinonatrix, taxonomic revision, Trimerodytes

1. Introduction recognized to date (Figueroa et al., 2016). This family represents the most morphologically diverse and widely The family Colubridae includes more than half of the distributed group among all squamates (Uetz et al., 2018; known snake species of the world, with eight subfamilies Zhao et al., 1998). Within the family, numbers of cephalic * Corresponding author: Dr. Jiatang LI, from Museum of Herpetology, scales and their arrangements represent one of the most Chengdu Institute of Biology, Chinese Academy of Sciences, with his research focusing on taxonomy, phylogenetics, biogeography, genomics important diagnostic characters (Boulenger, 1893; and evolution of amphibians and reptiles. Smith, 1943; Zhao, 2006). Regarding these head scales, E-mail: [email protected] Received: 18 December 2018 Accepted: 25 April 2019 most colubrid snakes have nine enlarged dorsal side of 106 Asian Herpetological Research Vol. 10 head scales, including paired internasals, prefrontals, specimens of O. balteata, in this study we assessed the supraoculars, parietal scales, and a single frontal scale. taxonomic validity of Trimerodytes and the phylogenetic Such set of head scales and their configurations are position of O. balteata. Furthermore, we examined known as the typical colubrid configuration or “colubrid- the usefulness of the prefrontal configuration as the elapid dorsal nine-scute arrangement” (David et al., 2015; generic diagnosis among natricine genera. Our results O’shea et al., 2018). indicate that the genus Opisthotropis is polyphyletic with Despite the fact that such typical configuration of respect to O. balteata, which is nested within the genus head scales is common, a great variation exits among the Sinonatrix Rossman and Eberle, 1977 and is sister to keelback snakes of the subfamily Natricinae, particularly Sinonatrix annularis (Hallowell, 1856), the type species for the prefrontal scales (Bourret, 1934; David et al., of the latter genus (Rossman and Eberle, 1977). As a 2015; Smith, 1943; Zhao and Jiang, 1981). Since the consequence, we resurrect the long-overlooked synonym presence of paired prefrontals is considered to be the Trimerodytes from Opisthotropis and synonymized the typical configuration, any variation from this condition, junior name Sinonatrix with Trimerodytes. In addition, we such as a single prefrontal, is regarded as an important comment on the similarities in morphological characters diagnostic character in taxonomic delimitations, between the monotypic genus Paratapinophis and particularly at the generic level (Angel, 1929; Bourret, Trimerodytes. Lastly, we provide a taxonomic account of 1934; David et al., 2015; Taylor and Elbel, 1958). Trimerodytes, the updated description of its type species, The single prefrontal configuration is found in many and a diagnostic key to this genus. natricine groups, including Opisthotropis Günther, 1872, Paratapinophis Angel, 1929, Isanophis David, Pauwels, 2. Materials and Methods Nguyen and Vogel, 2015, Hebius Thompson, 1913, Trachischium Günther, 1858, and Rhabdops Boulenger, 2.1. Sampling Specimens were collected during field 1893 (Angel, 1929; Bourret, 1934; Kizirian et al., 2018; surveys from June 2015 to September 2018. After being Smith, 1943; Taylor and Elbel, 1958; David et al., 2015). euthanized, fresh liver tissues were taken and preserved Furthermore, the morphology-based taxonomy that in 95% ethanol, and then stored at –20°C for DNA relies on the single prefrontal has resulted in taxonomic extraction. Specimens were preserved in 10% formalin confusions, in which species were incorrectly assigned to in the field and transferred to 75% ethanol for permanent a genus based on their similar prefrontal configurations storage after fieldwork. All of these recently collected (Brown and Leviton, 1961; Pope, 1935; Smith, 1943; specimens were deposited in major collections in China, Taylor and Elbel, 1958). including the Museum of Herpetology, Chengdu Institute Erected as a monotypic genus, with Trimerodytes of Biology, Chinese Academy of Sciences, Chengdu, balteatus Cope, 1895 as the sole included species, China (CIB); the Museum of Biology, Sun Yat-sen the genus Trimerodytes was later synonymized with University, Guangzhou, China (SYS); and College of Life Opisthotropis on the basis of morphological similarities, Sciences and Food Engineering, Yibin University, Yibin, including the presence of a single prefrontal scale (Pope, China (YBU). In addition, specimens were examined 1935). Most later authors followed Pope (1935) and in the following collections: Institute of Ecology and considered Trimerodytes to be a junior synonym of Biological Resources, Vietnam Academy of Science Opisthotropis and its type species, T. balteatus, has been and Technology, Hanoi, Vietnam (IEBR); Museum of Kunming Institute of Zoology, Chinese Academy of assigned to Opisthotropis (Brown and Leviton, 1961; Sciences, Kunming, China (KIZ); Vietnam National Nguyen et al., 2009; Smith, 1943; Zhao, 2006; Zhao Museum of Nature, Vietnam Academy of Science and et al., 1998; Zheng, 1992). Although there have been Technology, Hanoi, Vietnam (VNMN); and Zoological recent phylogenetic studies on Opisthotropis, none of Museum, Vietnam National University, Hanoi, Vietnam them included O. balteata in their analyses (Ren et al., (VNUH). The topographic map was created from MAP 2017; Wang et al., 2017b; Ziegler et al., 2017; 2018). WORLD, http://www.tianditu.com. Therefore, the generic assignment of O. balteata has not been confirmed by molecular data. Consequently, both the 2.2. Molecular analyses Genomic DNA was extracted validity of Trimerodytes and the phylogenetic placement from macerated liver tissue samples using an Ezup of its type species have remained unknown (Cope, 1895; Column Animal Genomic DNA Purification Kit David et al., 2011). (Sangon Biotech, China), according to the protocols On the basis of newly collected genetic tissues and of the manufacturer. A total of 1 060 bp of the No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 107 mitochondrial gene cytochrome b (cyt b) was targeted et al., 2017b), PCR protocols as described by Ren et al. and amplified via the polymerase chain reaction (2017). The PCR products were purified and sequenced (PCR), using the following primer pairs: L14919 (5'– in both directions using an ABI 3730xL sequencer by AACCACCGTTGTTATTCAACT–3')/L14910 (5'– Sangon Biotech Co., Ltd (Chengdu, China). All newly GACCTGTGATMTGAAAACCAYCGTTGT–3'), and generated sequences of this work were deposited in H16064 (5'–CTTTGGTTTACAAGAACAATGCT GenBank, and additional sequences of natricine species TTA–3') (Burbrink et al., 2000; Guo et al., 2012; Wang were also obtained from GenBank (Table 1). Outgroup

Table 1 Information of samples, voucher numbers, sequences GenBank accession numbers and collection localities used in molecular analysis. Voucher abbreviations: SYS=Museum of Biology, Sun Yat-sen University, Guangzhou, China; CIB=Chengdu Institute of Biology, Chengdu, China; YBU=Yibin University, Yibin, China; IEBR=Institute of Ecology and Biological Resources, Hanoi, Vietnam; ZFMK=Zoologisches Forschungsmuseum Alexander Koenig, Bonn, Germany; VNMN=Vietnam National Museum of Nature, Hanoi, Vietnam; GP=Dr. Guo Peng’s personal catalogue numbers; CAS=California Academy of Science, San Francisco, USA; MTD T=Museum of Zoology, Senckenberg Dresden (Tissue Collection), Dresden, Germany; SCUM=Sichuan University Museum, Chengdu, China.

Species Voucher No. GenBank No. Locality Opisthotropis andersonii SYS r001020 KY594732 Mt. Wutong, Shenzhen City, Guangdong Province, China Opisthotropis andersonii SYS r001382 KY594734 Mt. Maofeng, Guangzhou City, Guangdong Province, China Opisthotropis andersonii SYS r001423 KY594730 Tai Tam, HK Island, Hong Kong, China Opisthotropis balteata CIB 109017 MN017774 Guangxi Zhuang Autonomous Region, China Opisthotropis balteata CIB 109018 MN017775 Dinghu District, Zhaoqing City, Guangdong Province, China Opisthotropis balteata YBU 16109 MN017773 Dinghu District, Zhaoqing City, Guangdong Province, China Opisthotropis cheni YBU 071040 GQ281779 Guangdong Province, China Opisthotropis cheni SYS r001422 KY594741 Shimentai Nature Reserve, Yingde City, Guangdong Province, China Opisthotropis guangxiensis GP 746 GQ281776 Guangxi Zhuang Autonomous Region, China Opisthotropis jacobi IEBR 4329 MG545601 Tam Dao National Park, Vinh Phuc Province, Vietnam Opisthotropis jacobi ZFMK 100818 MG545602 Tam Dao National Park, Vinh Phuc Province, Vietnam Opisthotropis kuatunensis SYS r000998 KY594745 Qixiling Nature Reserve, Yongxin County, Jiangxi Province, China Opisthotropis kuatunensis SYS r001008 KY594746 Wulong Village, Shanghang County, Fujian Province, China Opisthotropis lateralis GP 646 GQ281782 Guangxi Zhuang Autonomous Region, China Opisthotropis lateralis SYS r000951 KY594743 Heishiding Nature Reserve, Fengkai County, Guangdong Province, China Opisthotropis latouchii GP 647 GQ281783 Fujian Province, China Opisthotropis latouchii SYS r000670 KY594742 Guadun Village, Wuyishan City, Fujian Province, China Opisthotropis laui SYS r001161 KY594738 Shangchuan Island, Taishan County, Guangdong Province, China Opisthotropis laui SYS r001170 KY594739 Shangchuan Island, Taishan County, Guangdong Province, China Opisthotropis maculosa SYS r000946 KY594748 Heishiding Nature Reserve, Fengkai County, Guangdong Province, China Opisthotropis maxwelli SYS r000841 KY594736 Nan’ao Island, Nan’ao County, Guangdong Province, China Opisthotropis maxwelli SYS r001053 KY594737 Huboliao Nature Reserve, Nanjing County, Fujian Province, China Opisthotropis shenzhenensis SYS r001018 KY594727 Mt. Wutong, Shenzhen City, Guangdong Province, China Opisthotropis shenzhenensis SYS r001021 KY594728 Sanzhoutian, Shenzhen City, Guangdong Province, China Opisthotropis tamdaoensis IEBR A.2016.33 MF477901 Tam Dao National Park, Vinh Phuc Province, Vietnam Opisthotropis voquyi IEBR 4327 MG451046 Tay Yen Tu Nature Reserve, Bac Giang Province, Vietnam Opisthotropis voquyi VNMN 06315 MG451047 Tay Yen Tu Nature Reserve, Bac Giang Province, Vietnam Opisthotropis zhaoermii CIB 109998 MG012799 Guzhang County, Hunan Province, China Opisthotropis zhaoermii CIB 109999 MG012800 Guzhang County, Hunan Province, China Sinonatrix aequifasciata GP 357 JQ687430 China Sinonatrix aequifasciata S-116 KF913325 - Sinonatrix aequifasciata CIB 109019 MN017776 Mt. Wuyi, Wuyishan City, Fujian Province, China Sinonatrix annularis GP 889 JQ687431 China Sinonatrix annularis S-51 KF913290 - Sinonatrix annularis CIB 109020 MN017777 Guangxi Zhuang Autonomous Region, China Sinonatrix annularis CIB 109021 MN017778 Guangxi Zhuang Autonomous Region, China Sinonatrix percarinata GP 324 GQ281784 Sichuan Province, China Sinonatrix percarinata GP 956 JQ687433 China Sinonatrix percarinata CIB 109022 MN017779 Mt. Wuyi, Wuyishan City, Fujian Province, China Sinonatrix percarinata CIB 109023 MN017780 Mt. Wuyi, Wuyishan City, Fujian Province, China Sinonatrix yunnanensis CAS 224485 KR814685 Putao District, Kachin State, Myanmar Hebius johannis GP 897 KJ685708 Yunnan Province, China Natrix natrix MTD T 9269 HF680010 S Borup, Zealand, Denmark Rhabdophis leonardi SCUM 090009 KF800933 Panzhihua City, Sichuan Province, China 108 Asian Herpetological Research Vol. 10 taxa were selected based on previous phylogenetic comparisons, the following ratios were also obtained from studies (Figueroa et al., 2016; Pyron et al., 2013), which raw measurements, including TaL/TL, HL/HW, SL/SW, include Hebius johannis (Boulenger, 1908), Natrix natrix IOD/HW, EW/SoL, LoL/LoD, and ToL/ToD. (Linnaeus, 1758), and Rhabdophis leonardi (Wall, 1923). Definitions of pholidosis characters and their counting The DNA sequences of cyt b dataset were aligned using methods followed Zhao (2006) and Ren et al. (2018), the FasParser software package (Sun, 2017) and checked which include internasal counts (IN), prefrontal counts visually for minor manual justifications. Phylogenetic (PrF), frontal counts (F), parietal counts (P), loreal relationships were estimated using two methods, counts (L), preocular counts (PrO), postocular counts Bayesian inference (BI) and maximum likelihood (ML), (PtO), supraocular counts (SpO), subocular counts both with partitions based on codon position, which were (SbO), supralabial counts (SpL), infralabial counts (IfL), selected in PartitionFinder 2 (Lanfear et al., 2017). The temporal counts (TEM), chin shield counts (CS), dorsal most optimum substitution model of sequence evolution scale row counts (DSR), ventral counts (VEN), and (GTR+Γ for all codon positions) was selected under subcaudal counts (SC). Dorsal scale rows were taken at the Akaike Information Criterion (AIC). BI analyses one head length behind head, at midbody, and at one head were implemented by MrBayes v3.1.2 (Ronquist length before cloaca, respectively. and Huelsenbeck, 2003), two runs were performed In addition to the scale counts, the following characters simultaneously with four Markov chains and the dataset were also used, including: SpL-orbit: supralabial enter was conducted with 10 000 000 replicates. Starting trees orbit; aTEM: anterior temporal format; pTEM: posterior were random and the first 25% trees were discarded as temporal format; HdN: distinction between head and “burn-in”, sampling one tree per 100 replications for each neck; DoN: direction of nostrils; MT: maxillary teeth run. Bayesian posterior probability (BPP) was determined counts; and the numbers of annulated markings present to test the confidence of tree topology, nodes in the trees along both trunk and tail were formulated as trunk+tail were considered to be significantly supported when BPP (eg. 42+13). Symmetric characters were given as left/ ≥ 0.95. Tracer 1.6 (Rambaut et al., 2013) was performed right, and averages were used in the comparisons, except to investigated the convergence of sampled trees. for maxillary teeth and the number of annulated markings The partitioned ML analyses were conducted using the along lateral body, which were only counted on the left most complex model GTR+Γ by through 100 different side. runs in RAxML 8.2.10 (Stamatakis, 2014), bootstrap Morphological and ecological data of related taxa were proportions (BSP) were assessed to test the node support, based on specimens examined (Appendix 1) and from the using the rapid-bootstrapping algorithm with 1000 non- literature (Brown and Leviton, 1961; Chuaynkern et al., parametric bootstrap replicates, where nodes in the trees 2014; David et al., 2011; Günther, 1872; Huang et al., were considered to be strongly supported when BSP ≥ 70. 1990; Iskandar and Kamsi, 2009; Le et al., 2015; Murphy In addition to the phylogenetic analyses, uncorrected et al., 2008; Noonloy et al., 2018; Okada and Takara, pairwise distances (p-distances) of the cyt b dataset 1958; Orlov et al., 1998; Ota, 2004; Pauwels et al., 2009; among species of Sinonatrix and Opisthotropis were Pope, 1935; Rao and Yang, 1998; Rasmussen, 1982; Ren calculated using MEGA 6 (Tamura et al., 2013). et al., 2017; Rossman and Eberle, 1977; Smith, 1943; 2.3. Morphological data Measurements were taken with Stuart and Heatwole, 2008; Teynié et al., 2014; Toyama, a digital slide-caliper to the nearest 0.1 mm, except the 1983; Vogel et al., 2004; Wang et al., 2017a, 2017b; Wu total length, snout-vent length, and tail length, which were et al., 1985; Yang et al., 2011, 2013; Zhao, 2006; Zhao et measured using a measuring tape to the nearest 1 mm. al., 1998; Zheng, 1992; Ziegler et al., 2017, 2018). Measurement methods and their definitions followed Zhao (2006) and Ren et al. (2018), and included: total length 3. Results (TL), snout-vent length (SVL), tail length (TaL), head length (HL), and head width (HW), rostral length (RL), 3.1. Molecular results A total of 1 060 base pairs were rostral width (RW), interorbital distance (IOD), eye width aligned for the dataset of 44 sequences, which represented (EW), distance between the lower margins of eye and of all available 15 Opisthotropis species and four currently lip (SoL), maximum loreal length (LoL), maximum loreal recognized Sinonatrix species, as well as three outgroup depth (LoD), maximum anterior temporal length (ToL), taxa. The BI and ML analyses of dataset yielded identical and maximum anterior temporal depth (ToD). In addition, topologies, where the genera Opisthotropis and Sinonatrix to remove covariance of raw measurements for better were recovered as polyphyletic and paraphyletic groups No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 109 with regard to O. balteata, respectively (Figure 1). With with previous descriptions (Fan, 1931; Peracca, 1904; the exclusion of O. balteata, all remaining species of Steindachner, 1906; Zhao, 2006; Zhao et al., 1998), Opisthotropis formed a monophyletic clade (clade A, except that the slightly lower number of maxillary teeth BPP=0.99, BSP=41), whereas all species of the genus (16–17 vs. 17–18, 25 by Fan, 1931) and slightly fewer Sinonatrix and O. balteata formed another well-supported ventral scales (187–196 vs. 194–205) (Table 3). clade, clade B (BPP=1.00, BSP=100). Within clade B, the Opisthotropis balteata possesses a suite of previously unassigned species S. yunnanensis Rao and morphological characters that differentiate itself from Yang, 1998 was strongly supported as the sister taxon to remaining congeners of the genus Opisthotropis, S. aequifasciata (Barbour, 1908) (BPP=0.90, BSP=79). including having (1) a relatively larger body size, TL 604– Opisthotropis balteata was nested within the genus 1 021 mm (vs. TL mostly lower than 600 mm); (2) a head Sinonatrix and sister to the type species of the genus moderately distinct from the neck (vs. barely distinct); Sinonatrix, S. annularis, with strong statistical support (3) dorsolaterally directed nostrils (vs. dorsally); (4) a (clade B, BPP=1.00, BSP=99). relatively larger eye size (vs. overwhelming small); (5) The infraspecific uncorrected genetic p-distances of large maxillary teeth, which are enlarged posteriorly (vs. O. balteata ranged from 0–0.2% (Table 2). The small and subequal); (6) a higher number of postocular p-distances varied from 8.8% to 12.4% between [3 (rarely 2, 4, 5) vs. 1–2 (3 occur in O. kuatunensis and O. balteata and all analyzed Sinonatrix species [minimum O. laui only)]; (7) the presence of annulated markings (vs. distance to S. annularis, which was recovered as sister color uniform, with longitudinal lines, crossbars or spots); group of O. balteata (Figure 1); maximum distance to (8) the presence of ventral black bands (vs. uniform S. aequifasciata (Table 2)] and from 14.7% to 18.6% color). Although O. balteata has a single prefrontal between O. balteata and all other sampled species of similar to all species of Opisthotropis, the prefrontal of Opisthotropis (minimum to O. jacobi; maximum to O. balteata differs in shape (prefrontal spindle-shaped vs. O. tamdaoensis). tricuspid or subrectangular) (Table 4; Figures 2–3). 3.2. Morphological results Morphological characters of With the exclusion of O. balteata, members of the our newly collected specimens of O. balteata matched the genus Opisthotropis differs from Sinonatrix in the original description by Cope (1895) and largely agreed following distinct morphological characters, including

Figure 1 Bayesian inference (BI) phylogenetic tree estimated from partial mtDNA cyt b sequences, depicting phylogenetic relationships of two sister genera, Opisthotropis and Sinonatrix, of the subfamily Natricinae. Numbers above branches are bayesian posterior probability and bootstrap proportions (BPP/BSP), respectively. Branches in red showing the nominal taxa of Opisthotropis. Exemplar dorsal side of head drawings showing variation in the number of prefrontals, which are the two conditions that species classified by, i.e. (1) single prefrontal (solid black) and (2) paired prefrontals (outlined in black). Photographs and line drawings by Jinlong REN. 110 Asian Herpetological Research Vol. 10 12 13 14 15 16 17 18 19 20 21 11 0.0% 0.2% 0.2% 8.8% 8.8% 8.8% 11.7% 11.7% 11.6% 10.7% 9.3% 16.8% 16.8% 16.9% 17.4% 16.0% 17.8% 18.1% 10.1% 10.1% 9.9% 10.3% 12.2% 12.2% 12.4% 11.1% 10.7% 8.5% 17.4% 17.4% 17.6% 16.9% 16.1% 16.0% 16.9% 15.8% 14.7% 14.7% 14.8% 15.6% 15.0% 13.7% 16.4% 15.0% 14.0% 12.4% 17.9% 17.9% 17.8% 16.4% 16.1% 15.6% 16.8% 16.4% 12.4% 15.8% 14.3% 17.8% 17.8% 17.9% 19.1% 16.8% 16.4% 16.8% 12.7% 15.5% 16.0% 16.3% 14.7% 17.1% 17.1% 17.3% 15.6% 15.5% 16.0% 15.5% 15.8% 5.2% 14.0% 14.2% 12.4% 15.6% 17.1% 17.1% 17.3% 16.4% 15.8% 17.1% 18.2% 11.2% 14.0% 15.5% 13.4% 16.0% 12.9% 15.3% 17.1% 17.1% 16.9% 15.1% 15.0% 15.0% 16.1% 15.5% 16.9% 13.5% 12.4% 14.5% 16.4% 16.1% 15.3% 17.4% 17.4% 17.6% 18.1% 17.4% 17.8% 18.2% 11.1% 16.1% 14.5% 14.7% 17.3% 13.0% 15.8% 13.0% 15.1% 11.1% 17.9% 17.9% 17.8% 18.2% 16.9% 17.6% 18.7% 11.1% 15.3% 15.3% 14.7% 15.3% 13.2% 15.0% 11.1% 14.8% 18.4% 18.4% 18.6% 17.9% 17.3% 16.9% 18.1% 13.0% 15.5% 16.3% 16.3% 15.3% 5.9% 15.3% 12.5% 15.5% 14.0% 13.2% 16.1% 16.1% 16.0% 15.6% 15.0% 15.5% 16.6% 14.7% 13.2% 12.2% 8.5% 13.5% 14.2% 13.5% 12.1% 12.7% 14.0% 13.7% 14.3% 16.9% 16.9% 17.1% 16.9% 15.8% 15.6% 16.1% 15.0% 5.2% 13.7% 13.0% 13.7% 15.1% 5.9% 15.0% 15.5% 14.0% 15.6% 15.1% 13.4% CIB CIB CIB CIB CIB CIB SYS SYS SYS SYS SYS SYS SYS SYS CAS 4329 4327 YBU YBU IEBR IEBR IEBR 16109 GP 746GP 16.4% 16.4% 16.6% 17.4% 15.6% 16.8% 16.4% 14.0% 14.2% 109022 109019 071040 109017 109018 109020 224485 109999 r001161 r001020 r001008 r000951 r000670 r000946 r001018 r001053 A.2016.33 laui cheni jacobi voquyi balteata balteata balteata lateralis latouchii maxwelli annularis maculosa zhaoermii Sinonatrix Sinonatrix Sinonatrix Sinonatrix andersonii percarinata kuatunensis yunnanensis tamdaoensis guangxiensis aequifasciata Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis Opisthotropis shenzhenensis Clade Species Voucher 1 2 3 4 5 6 7 8 9 10 A 8 A 9 A 1 B 2 B 3 B 4 B 5 B 7 B 6 B 10 A 11 12 A 13 A sequences of clade A and clade B as shown in phylogenetic tree (see Figure 2). A cyt b sequences of clade among 1 060 bp fragments of mtDNA 2 Uncorrected pairwise sequence divergence Table 14 A 15 A 16 A 18 A 19 A 17 A 20 A 21 A No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 111

Table 3 Morphological and pholidosis characters of Trimerodytes balteatus obtained from the literature and this work.

Cope (1895) Peracca (1904) Steindachner (1906) Fan (1931) Zhao et al. (1998) this work Total sample size 1 1 3 16 10 6 37 TL 377 717 280–642 604–1021 620–1000 624–902 604–1021 TaL 80 104+ 55–147 148–177 130–172 120–140 120–177 SVL 297 613 225–495 462–773 542–850 504–761 462–850 Tal/TL 0.21 0.14+ 0.19–0.22 0.15–0.24 0.15–0.21 0.19–0.21 0.15–0.24 HL - - - - - 12.23–16.84 12.23–16.84 HW - - - - - 8.42–15.20 8.42–15.20 HL/HW - - - - - 1.08–1.45 1.08–1.45 SL - - - - - 4.33–7.64 4.33–7.64 SW - - - - - 6.50–11.31 6.50–11.31 SL/SW - - - - - 0.64–0.70 0.64–0.70 IOD/HW - - - - - 0.51–0.62 0.51–0.62 EW/SoL - - - - - 0.86–1.38 0.86–1.38 LoL/LoD - - - - - 1.05–1.34 1.05–1.34 ToL/ToD - - - - - 1.66–2.94 1.66–2.94 IN 2 2 2 2 2 2 2 PrF 1 1 1 1 1 1 1 F 1 1 1 1 1 1 1 P 2 2 2 2 2 2 2 PrO 1 1 1 1 (2) 1–2 1 1 (2) PtO 3 2–3 2 (3) 3 (2, 4, 5) 3 (2, 4) 3 (2) 3 (2, 4, 5) SpL 9 9 9 9–10 (8) 9–10 9 (8) 9–10 (8) SpL-orbit - 5 5 - 5 (4, 4–5) 5 (4) 5 (4, 4–5) IfL 9 - 9 10 9–10 9–10 (8) 9–10 (8) CS 2 - 2 2 2 2 2 aTEM 1 1 1 2 (3) 1 (2) 1 1–2 (3) pTEM 2 2 3 2 (3) 2–3 3 (0) 2–3 MT - 18 17–18 25 - 16–19 16–19 (25) DSR 19 19 19 21-19-17 19 (21)-19-17 19-19-17 19-19-17 VEN 202 196 199–204 194–204 194–205 187–196 187–205 SC 84 55+ 76–89 69–102 65–99 74–84 65–102 dorsal color - - 46–49+20–27 32–47+19–28 41–54+17–26 42–44+13–17 32–54+13–28 having (1) a relatively smaller body size, slenderly Furthermore, the ecology of O. balteata also matches built (vs. larger, strongly built and robust); (2) a barely the members of the genus Sinonatrix and differs from distinct head from the neck (vs. moderately or clearly congeners of Opisthotropis, including diet preference distinct); (3) dorsally directed nostrils (vs. dorsolaterally); (mainly fishes for O. balteata and Sinonatrix species (4) a relatively smaller eye size (large or moderate); vs. worms, small shrimps, crabs, or tadpoles for (5) maxillary teeth small, subequal (vs. large, enlarged Opisthotropis species) and activity patterns (often posteriorly); (6) prefrontal single (vs. paired) (Tables 4–5; diurnal for O. balteata and Sinonatrix species vs. strictly Figures 2–3). nocturnal for most Opisthotropis) (Karsen et al., 1986; In contrast, O. balteata possesses a combination of Karsen et al., 1998; Le et al., 2015; Noonloy et al., 2018; Ota, 2004; Pauwels et al., 2009; Pope, 1935; Zhao, 2006; morphological characters shared with the members of Zhao et al., 1998). the genus Sinonatrix, including the head moderately or clearly distinct from the neck, large or moderate 4. Discussion eyes, dorsolaterally directed nostrils, enlarged posterior maxillary teeth, and annulated color patterns (Table 4.1. Taxonomic assignment of O. balteata Despite the 4; Figures 2–3). Additionally, O. balteata is similar to long assignment of O. balteata to the genus Opisthotropis Sinonatrix by having 19-19-17 dorsal scale rows, which (Nguyen et al., 2009; Smith, 1943; Zhao, 2006; Zhao is a morphological character shared among all the four et al., 1998; Zheng, 1992), one study has previously species of Sinonatrix (Le et al., 2015; Rao and Yang, suggested that this generic assignment might be 1998), whereas it is unknown in any Opisthotropis species questionable. While recording O. balteata from Luoxiang, (Table 4). Guangxi Zhuang Autonomous Region, China (considered 112 Asian Herpetological Research Vol. 10

Figure 2 Comparisons of head in dorsal view among species of Trimerodytes (upper row) and Opisthotropis (lower row). (A) Trimerodytes balteatus (CIB 109017; adult female; Guangxi, China); (B) T. annularis (CIB 11461; adult male; Wuyishan, Fujian, China); (C) T. aequifasciatus (CIB 11436; subadult female; Yizhang, Hunan, China); (D) T. percarinatus (CIB 109023; adult female; Wuyishan, Fujian, China); (E) O. cheni (CIB 78149; adult male; Yizhang, Hunan, China); (F) O. shenzhenensis (SYS r001018; holotype; adult male; Shenzhen, Guangdong, China); (G) O. guangxiensis (SYS r001739; adult male; Nanning, Guangxi, China); (H) O. cucae (IEBR A.0924; holotype; adult female; Sa Thay, Kon Tum, Vietnam). Scale bar 5 mm. Line drawings by Jinlong REN. to be O. multicinctata at the time, later synonymized However, with the inclusion of O. balteata, the generic to O. balteata), Fan (1931) suggested that the species name of the lineage (clade B) that is currently represented was “rather isolated” from other congeners of the genus by Sinonatrix needs further justification. Clade B Opisthotropis in terms of external morphology. includes both the type species (i.e. Sinonatrix annularis) Our morphological and molecular evidences agree with and other members of the genus currently known as those of Fan (1931) and show that the genus Opisthotropis Sinonatrix, plus “Opisthotropis” balteata. This latter is polyphyletic with respect to O. balteata and species of species, “Opisthotropis” balteata is the type species by Sinonatrix, and the continuous recognition of O. balteata monotypy of Trimerodytes, which is currently considered in the genus Opisthotropis will preclude the monophyly to be a junior synonym of the genus Opisthotropis. As a of both genera Opisthotropis and Sinonatrix (Figure 1). consequence, Trimerodytes Cope, 1895 is distinct from In combining evidence from external morphology and Opisthotropis, and Sinonatrix Rossman and Eberle, 1977 ecology between O. balteata and members of Sinonatrix, is a junior synonym of Trimerodytes, a generic nomen therefore, and in order to stabilize the generic taxonomy which has hence priority. and best reflect the evolutionary relationships of these Could Trimerodytes be considered to be a nomen snakes, O. balteata should be removed from Opisthotropis oblitum? The possibility of a “reversal of precedence” and placed into the genus currently represented by is addressed by the International Code of Zoological Sinonatrix (clade B). Nomenclature (ICZN, 1999), Art. 23.9. Although the No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 113 , 2014 , 2011 , 2017a , 2017b , 2017b , 2017b et al. , 2018 et al. , 2018 et al. , 2017 ang et al. Iskandar and Kamsi, 2009 uniform Murphy et al. , 2008 annulated Zhao, 2006 annulated, V-shaped annulated, annulated, V-shaped annulated, . Abbreviations are listed in Material and Abbreviations are listed in Material and . and Opisthotropis Isanophis , Paratapinophis , PrF DSR PrO PtO VEN SC Dorsal color pattern VEN color Resouce max TL DTDT DL DL EP EP moderate 870 large 1420 2 2 19-19-17 1 19-19-17 1 (2) 3 3 (4) 136–160 142–164 39–78 61–78 annulated, untouched annulated, X-shaped annulated annulated Pope, 1935; Zhao, 2006 Huang et al. , 1990 DT DLDT EP DL large EP moderate 1300 980 2 1 19-19-17 19-19-17 1 1 3–5 131–160 2–3 44–87 145–155 58–67 DT OUP EP large 990 1 19-19-17 1 (2) 2–4 136–140 60 uniform, with darker areas annulated David et al. , 2015 BD UP ? small 564 2 19-17-15 1 1–2 170–174 76–84 purplish-brown and brown uniform BD UP SE small 462 1 17-17-17 1–2 2 149–157 54–62 longitudinal stripes/spotted uniform et al. Wang BD UP SE small 520 1 15-15-15 1 1–2 166–182 67–97 each scale spotted uniform et al. Yang BDBD UP UP SE SE moderate 461 small 463 1 17-17-17 1 2 17-17-17 0 (1) 2 2 (1) 154–173 155–161 42–57 57–63 with lateral stripes longitudinal stripes uniform uniform Ren et al. , 2017 Zhao, 2006 BD UP SE small 497 1 23-23-21 2 (1) 2 (3) 152–176 53–61 with yellow crossbars uniform et al. Wang BDBD UP UP ? SE small small 506 678 1 1 ?-15-? 19-19-19 2 (1, 3) 2–3 (4) 2 151–177 63–66 2 with lateral stripes 180–183 69–73 uniform with orange spots Zhao, 2006 uniform 1983 Toyama, BD UP SE small 549 1 15-15-15 1 1 159–182 67–92 uniform, greyish-brown uniform Ziegler BD UP SE small 535 1 17-15-15 1 2 166–174 51–58 with orange crossbars uniform Zhao, 2006 BD UP SE small 538 1 19~21-17-17 1 2 177–181 88–90 uniform, bronze-brown uniform et al. , 2014 Teynié BD UP SE small 578 1 17-17-17 1 2 189–194 39–47 uniform, gray-olive uniform Orlov et al. , 1998 BD UP SE small 464+ 1 23-19-19 1 2 191 44+ uniform, greyish-brown uniform David et al. , 2011 BD UP SE small 565 1 17-17-17 0 2 146–162 47–64 with yellow crossbars uniform Ren et al. , 2017 BD UP EQ small 337 1 ?-17-? 1 2 170 65 uniform, brownish black uniform 1872 Günther, BD UP SE small 586 1 17-17-17 0 2 147–152 54–62 with longitudinal stripes uniform Ren et al. , 2017 BD UP SE small 462 1 17-17-17 0–2 (3) 2 (1) 141–174 43–59 with longitudinal stripes uniform et al. Wang BDBD UP UP ? SE small small 609 561 1–2 1 21-19-17 15-15-15 2 1 1–2 2 (1) 176–184 165–182 82–95 74–86 uniform, olive brown uniform, greyish-brown uniform uniform Iskandar and Kamsi, 2009 Ziegler BD UP SE small 532 2 21-19-17 2 2 195 53 uniform, dark brown uniform Brown and Leviton, 1961 BDBD UP UP ? SE small small 600 555 1 1 17-17-17 19-17-17 1 1–2 2 2 162–176 178–185 48–51 33–49 uniform, olive brown with lateral stripes uniform uniform Chuaynkern et al. Ziegler BD UP SE small 412 1 19-19-19 1 2 162–179 53–60 uniform, olive-green uniform W MD DL EP moderate 1021 1 19-19-17 1 3 (4) 187–205 65–102 annulated, transverse bands annulated this work MD DL EP moderate 1100 2 19-19-17 1 3–4 156–165 61–77 annulated, X-shaped annulated 1998 Yang, Rao and O. rugosa O. maxwelli O. maculosa O. lateralis O. latouchii O. laui O. kikuzatoi O. kuatunensis O. jacobi O. guangxiensis O. durandi O. daovantieni O. cucae O. cheni T. balteatus T. T. yunnanensis T. O. atra O. zhaoermii T. annularis T. aequifasciatus T. T. percarinatus T. P. praemaxillaris P. I. boonsongi O. andersonii O. typica O. voquyi O. alcalai O. spenceri O. tamdaoensis Species HdN DoN MT Eye size* O. shenzhenensis Table 4 Morphological comparisons among all known species of the natricine genera Trimerodytes Table Methods except for DT: distinct; MD: moderately distinct; BD: barely distinct; DL: dorsolateral; OUP: obliquely upward; UP: upward; EP: enlarged posteriorly; SE: subequal; EQ: equal; “*” after OUP: BD: barely distinct; DL: dorsolateral; obliquely upward; UP: EP: enlarged distinct; distinct; MD: moderately Methods except for DT: standardizing by EW/SoL; “?” indicates missing data; values given in brackets indicate infrequent condition. 114 Asian Herpetological Research Vol. 10

Figure 3 Lateral head (column 1), dorsal side of head (column 2), ventral head (column 3), dorsal color pattern (column 4), and ventral color pattern (column 5) comparisons of species of Trimerodytes and Opisthotropis. (A) T. percarinatus (CIB 109023); (B) T. aequifasciatus (CIB 11436); (C) T. annularis (CIB 109020; adult male; Guangxi, China); (D) T. balteatus (CIB 109017); (E) O. cheni (CIB 78148; adult male; Yizhang, Hunan, China); (F) O. tamdaoensis (VNMN 06217; adult female; Tamdao, Vinh Phuc, Vietnam); (G) O. jacobi (VNMN 06220; adult female; Tamdao, Vinh Phuc, Vietnam); (H) O. cf. maculosa (SYS r001525; adult female; Zhaoqing, Guangdong, China). Photographs by Jinlong REN. taxon Trimerodytes satisfies Art. 23.9.1.2, the necessary Trimerodytes. condition included in Art. 23.9.1.1 is not met in the Taxonomic account present case since Trimerodytes was used as a valid Trimerodytes Cope, 1895 (Figures 4–5) generic name by Mell (1931: 206) and Schmidt (1927: Liparophis M. G. Peracca, 1904, Rev. Suisse Zool., 438), so after 1899. As a consequence, the reversal of Geneva, 12: 664. Type species: Liparophis bedoti M. G. precedence cannot be applied here. Hence, we resurrect Peracca, 1904. Trimerodytes Cope, 1895 from Opisthotropis Günther, Sinonatrix D. A. Rossman and W. G. Eberle, 1977, 1872 as a valid genus, and place Sinonatrix Rossman and Herpetologica, Lawrence, 33: 42. Type species: Eberle, 1977 in its junior synonymy. Tropidonotus annularis E. Hallowell, 1857. Following systematic implications as presented Type species Trimerodytes balteatus Cope, 1895 above, we present a new classification scheme of genus Diagnosis (1) body size relatively large; (2) head No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 115

Table 5 Differences between the genus Trimerodytes and Opisthotropis.

Characters Trimerodytes Opisthotropis Relative body size maximum TL 870–1420 maximum TL <700 Head/neck distinct or moderately distinct barely distinct Position of nostrils dorsalateral dorsal Direction of nostrils dorsalateral upward Eye relative size large or moderate overwhelming small Maxillary teeth enlarged posteriorly equal or subequal DSR 19-19-17 variable, but never in 19-19-17 PtO 3–5 mostly 1–2 Dorsal color pattern with annulated, X-shaped or V-shaped markings uniform, striped, spotted or with crossbars Ventral color pattern black bands present black bands absent Diet fishes, frogs, tadpoles mostly earthworms, crabs Activity often diurnal mostly nocturnal Temper mostly petulant mild, inoffensive Defense behavior bite, autotomy, odor releasing odor releasing

Figure 4 Adult female specimen of Trimerodytes balteatus (CIB 109017; Guangxi, China) in preservative. (A) Dorsal view; (B) Ventral view; (C) Dorsal side of head view; (D) Ventral head view; (E) Lateral head view, left side; (F) Ventral cloacal region and ventral tail view. Scale bar 5 mm. Photographs by Jinlong REN. 116 Asian Herpetological Research Vol. 10

Figure 5 General view comparisons of Trimerodytes species in life, showing diagnostic character of annulated color patterns of this genus. (A) T. balteatus (CIB 109017; adult female; Guangxi, China); (B) T. balteatus (CIB 109017), showing coloration before shedding; (C) T. percarinatus (adult male; K Bang, Gia Lai, Vietnam); (D) T. annularis (CIB 109020; subadult male; Guangxi, China); (E) T. aequifasciatus (IEBR 3630; adult female; Bac Giang, Vietnam; from Le et al., 2015); (F) T. yunnanensis (IEBR A.2015.12; adult male; Dien Bien, Vietnam; from Le et al., 2015). Photographs A, B, C, D by Jinlong REN; E and F from Le et al. (2015), respectively. moderately distinct from neck; (3) nostrils situated and hemipenis bilobed, spinous, sulcus spermaticus not directed dorsolaterally; (4) eye size relatively large or forked; (10) body with annulated, V-shaped, or X-shaped moderate; (5) maxillary teeth large, enlarged posteriorly; markings, become darker or vaguer with age; (11) ventral (6) dorsal scale rows 19-19-17, keeled at least in the surface with black bands or uniformly colored. posterior part of body; (7) prefrontal single or paired; Etymology The generic nomen of Trimerodytes is a (8) a higher number of postoculars, usually 3–5; (9) noun made of three parts: (1) the Ancient Greek τρία No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 117

“tría”, meaning “three”; (2) the Ancient Greek μέρος Trimerodytes balteatus E. D. Cope, 1895, Proc. Acad. “méros”, meaning part, component, or region; and (3) Nat. Sci. Philadelphia, 46: 426. Type locality: Nodoa the Greek “dytēs”, meaning diver or swimmer. The (=Nada), Hainan Island, Hainan Prov., China. generic nomen refers to the three-parted (black-yellow- Opisthotropis balteata: C. H. Pope, 1935, Rept. China, black) annulated markings and the aquatic life of the type New York: 167. species T. balteatus (Figures 3D, 4, 5A–B). The gender Liparophis bedoti M. G. Peracca, 1904, Rev. Suisse of this generic name is masculine. We suggest “Annulate Zool., Geneva, 12: 664. Type locality: China. Keelback” as its English common name, and Huan You Opisthotropis multicinctata T.-H. Fan, 1931, Bull. She Shu ( 环游蛇属 ) as its Chinese common name. Dept. Biol. Coil. Sci. Sun Yat-sen Univ., Canton, 11: Content Five species are currently included (listed below 82. Type locality: Loshiang (=Luoxiang), Kwangsi in order of: scientific name; English common name; and (=Guangxi Zhuang Autonomous Region), China. Chinese common name): Diagnosis Trimerodytes balteatus can be diagnosed from Trimerodytes aequifasciatus (Barbour, 1908) comb. other morphologically similar species by a combination nov.; Asiatic Annulate Keelback; “Huan Wen Hua You of the following characters: (1) body cylindrical, TL She” ( 环纹华游蛇 ) 604–1 021 mm; (2) tail relatively moderate, TaL/TL Trimerodytes annularis (Hallowell, 1856) comb. nov.; 0.15–0.24; (3) head moderately distinct from neck; (4) Red-bellied Annulate Keelback; “Chi Lian Hua You She” nostrils directed dorsolaterally; (5) eyes moderate, EW/ ( 赤链华游蛇 ) SoL 0.86–1.38; (6) maxillary teeth mostly 16–19, slightly Trimerodytes balteatus Cope, 1895; Banded Annulate enlarged posteriorly, without diastema; (7) dorsal scale Keelback; “Heng Wen Huan You She” ( 横纹环游蛇 ) rows 19-19-17; (8) prefrontal single, spindle-shaped; (9) Trimerodytes percarinatus (Boulenger, 1899) comb. supralabials 9–10, usually 4th or 5th entering orbit; (10) nov.; Olive Annulate Keelback; “Wu Hua You She” ( 乌 ventrals 187–205; (11) dorsal scales smooth anteriorly, 华游蛇 ) smooth or feebly keeled at midbody, tending to be Trimerodytes yunnanensis (Rao and Yang, 1998) moderately keeled rear body and on tail, outer most comb. nov.; Yunnan Annulate Keelback; “Yun Nan Hua three or four dorsal scale rows along both sides of body You She” ( 云南华游蛇 ) smooth entirely before cloaca; (12) body brownish-red Distribution Members of the genus distribute across or brownish-yellow, encircled by 32–54 black bands southern and eastern China (including Taiwan and with yellow centers, 13–28 present on tail; (13) venter Hainan) and northern Southeast Asia (Vietnam, Laos, yellowish-beige, with annulated or alternating black Thailand, Myanmar, and northeast India). bands (Figures 2A, 3D, 4, 5A–B; Tables 3–4). Key to species of Trimerodytes (after Rao and Yang, Description Body cylindrical and elongate, slenderly 1998 and Zhao, 2006) built, size relative large, TL 604–1 021 mm; tail relatively 1 Prefrontal single; ventrals 187–205...... T. balteatus moderate, TaL/TL 0.15–0.24; head moderately distinct - Prefrontal paired; ventrals fewer than 170...... 2 from neck, not dorsally depressed; snout broad and short; 2 Dorsal transverse lines thick, crossed, X-shaped, less eye moderate, EW/SoL 0.86–1.38; pupil round; nostril than 29 markings on trunk...... 3 large, elliptic or round, piercing in the middle of the nasal, - Dorsal transverse lines thin, not crossed, shape not as directed dorsolaterally. Maxillary teeth mostly 16–19, such, more than 30 markings on trunk...... 4 count for 25 in Luoxiang population, Guangxi, China 3 Ventrals 156–165; maxillary teeth 31–35...... (Fan, 1931), progressively increasing in size, without ...... T. yunnanensis diastema. - Ventrals 142–154; maxillary teeth 22–28...... Dorsal scale rows 19-19-17, relatively enlarged, about ...... T. aequifasciatus equal in size, without apical pits; smooth anteriorly, 4 Dorsal transverse bands in contact, V-shaped; ventral smooth or weekly keeled at midbody, tending to be background color grayish white; labial sutures pale, moderately keeled posteriorly, outer most three or four indistinct...... T. percarinatus dorsal scale rows smooth entirely before cloaca. - Dorsal transverse bands not in contact, bar-like; ventral Dorsal scale row reductions: 3+4 →− 3 (VEN 100 113) background color redish orange; labial sutures black, 19 17 distinct...... T. annularis 15+16→− 15 (VEN 101 114) 4+5 →− 4 (VEN 108 117) Trimerodytes balteatus Cope, 1895 (Figures 2A, 3D, 4, 19 17 5A–B) or 15+16→− 15 (VEN 110 123) 118 Asian Herpetological Research Vol. 10

Ventrals 187–205; precloacal not divided; cloacal plate but a pair of elliptic orangish spots are symmetrically divided, subcaudals 65–102, paired, with single terminal present on inner sides of corresponding scales, just rigid tip. separated by parietal sutures; similar paired spots are also Rostral broad, width approximately twice as long as observed on internasals in some specimens. The color high, visible from above; nasals subrectangular, semi- pattern of lateral parts of head is simpler and paler, only divided; furrow from lower edge of nostrils to lower parts of dark blotches extend onto the supralabials, black edge of nasals, in contact with supralabials 1–2 or 1–3 and blurry labial sutures present on both supralabials ventrally; internasals paired, subtriangular, in broad and infralabials (Figure 5A). Ventral surfaces of head are contact, truncated anteriorly, curved outwards, not in uniformly yellowish-beige, while the black infralabial contact with loreal; prefrontal single in all specimens, sutures are clear and striking. The first small scale that is spindle-shaped, much broader than long, penetrate into located just after the first chin shield is black, connecting internasals anteriorly, both sides curved backwards; sometimes with a thick cross band posteriorly. If frontal pentagonal or bell-shaped, longer than wide, connected, such band forms a distinct black arrowhead or shorter than snout length, length approximately equal large triangular pattern on ventral head. to parietal sutures, penetrate into parietals posteriorly; The ground color of lateral body is brownish-red parietals paired, subhexagonal, width equal to parietal dorsally and orangish-yellow ventrally, color transitional sutures; supraoculars 1/1, narrowed anteriorly, nearly zones are observed on dorsal scales of row 2–3 of both twice as long as wide. Loreal 1/1, slightly longer sides without clear boundaries. Body is encircled by than depth, LoL/LoD 1.03–1.34, not entering orbit; 32–54 annulated markings, each marking is a broad black preocular 1/1 (2/2 in No. 2583 only, by Fan, 1931), much transverse band with yellow center, which covers one higher than long; postoculars usually 3, variable and third to one and a half the length of dorsal scale. The asymmetric, 2, 4, 5 occasionally occur on single side of yellow center of transverse band expands on the lowest head, the lowest ones situated at infero-posterior corner two or three dorsal scale rows and sometimes to the outer of eye; subocular absent, in some cases the lower most margins of ventrals. Each yellow center is bordered by postoculars encompass forwards more than three fourths two thick black streaks along each edge of the center, and length of lower margins of eye, nearly in contact with these black streaks are thicker than the yellow center and preocular, which defined as postoculars only rather than occupy one to two the length of dorsal scale. Together, subocular or postsubocular. Supralabials 9–10 (rarely 8 the yellow centers and the black streaks form a strong by Fan, 1931), usually 4th or 5th entering orbit (rarely contrast color pattern along the whole body. Sometimes both 4th and 5th entering orbit); infralabials 9–10 (8 the two halves of annulated markings are not evenly on single side of YBU 16060 and SYS r001677 only), connected along the vertebral column, thus the broad first five in contact with anterior chin shields; anterior bands along both sides of body could be in the stagger temporals 1–2 (rarely 3), longer than depth, ToL/ToD arrangement. Dorsal markings are darker and more 1.66–2.94; posterior temporals 2–3 (absent on right side indistinct in larger specimens. Coloration on tail is similar of CIB 9971), usually asymmetric; chin shields two pairs, to trunk, with 13–28 annulated markings. These lateral anterior chin shield distinctly shorter than posterior ones, markings decreasing in width towards the ventral scales, posterior chin shields separated from each other by 1+2 until the midline of venter, which only about one or two or 1+3 scales; minute granular tubercles absent. ventral scale width, forming annulated or alternating Coloration in life In life, the background color of dorsal black bands on yellowish-beige ventral surface (Figure side of the head is yellowish-beige, and dorsal side of 5A). head scales are densely covered by large and irregular The coloration of individuals turns to a dull purplish- black blotches. These large clusters of blotches may silver hue before shedding, especially for the posterior fuse together, forming several transverse belts across body (Figure 5B). In juveniles, the black annulated the dorsal side of the head. The intervals of these black markings are thicker with clear boundaries, in strong belts are orangish-yellow to brownish-red, especially on contrast to the background color; the yellow centers of anterior dorsal side of head, composing continuous or marking are absent or small spots only present near the discontinuous narrow pale streaks. The pale streaks just vertebral column. after the posterior margins of parietals are always present Coloration in preservative The pattern of the recently and continuous, which also extend to lateral and ventral preserved specimens resembles the coloration of live surface of head. Parietals are almost covered with black, animals, but the light coloration on the dorsal side of head No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 119 fades to an yellowish hue, dorsal ornamentation becomes Trachischium by having a different dorsal scale formula darker (Figures 3D, 4). (19-19-17 vs. 13 or 15 throughout), a different maxillary Comparison Trimerodytes balteatus can be readily condition (maxillary teeth enlarged posteriorly vs. distinguished from other species of Trimerodytes by subequal), and head moderately distinct from neck (vs. having a single prefrontal (vs. paired prefrontals), and indistinct); from Hebius annamensis (Bourret, 1934) by a higher number of ventral scale count (187–205 vs. having 19 rows of dorsal scales at the midbody (vs. 15 or less than 170). In addition, T. balteatus differs from T. 17), a lower number of subcaudals (65–102 vs. 116–146), yunnanensis by having a lower number of maxillary and a higher number of ventrals (187–205 vs. 158–172); teeth [16–19 (25?) vs. 31–35] and a different dorsal from Rhabdops bicolor by having paired internasals (vs. color pattern (body annulated by transverse markings vs. single), and a higher number of supralabials (9–10 vs. 5) crossed by X-shaped markings); from T. aequifasciatus (Table 6). by having a moderately distinct head (vs. distinct) and a Hemipenis Material not available in this work. Pope higher number of trunk markings (32–54 vs. 22–28); from (1935) provided hemipenial descriptions based on single T. percarinatus by having moderately keeled dorsal scales topotypic specimens as follows: The hemipenis extends at midbody (vs. strongly keeled throughout) and the to the ninth subcaudal plate and is spinous, the proximal presence of labial sutures (vs. absent). Lastly, T. balteatus spines being the largest. There are three much enlarged differs from its sister species, T. annularis, in having basal spines or hooks set in a compact, longitudinal row, a different head color pattern (black streaks present on the distal hook larger than the other two. The lips of the dorsal surface vs. absent) and a different background sulcus are spinous and are most conspicuous proximally. color of ventral surface (uniformly yellowish vs. red or Distribution Trimerodytes balteatus is currently known reddish-orange). from southern China [including Hainan (Danzhou), From other natricine taxa that have single prefrontal, Guangxi (Huanjiang, Jinxiu, Longsheng, Wuzhou, and T. balteatus differs from the genus Isanophis by its Yishan), Guangdong (Luoding, Gaoyao, Zhaoqing, and head moderately distinct from neck (vs. well distinct), Zhuhai), and Hong Kong), and Vietnam (Hai Phong eye size moderate (vs. large), and moderately keeled (Cat Ba Island), and Bac Giang (Tay Yen Tu Nature posterior dorsal scales (vs. strongly keeled throughout); Reserve)] (Figure 6). The previously reported record from from the genus Opisthotropis see above; from the genus Cambodia is rejected here (see discussion below).

Figure 6 Distribution records of Trimerodytes balteatus based on the records from literature, museum collections, and this study. Star represents the type locality (Nodoa, now Nada, Danzhou, Hainan, China). 120 Asian Herpetological Research Vol. 10

Natural history Trimerodytes balteatus is an aquatic As for the distribution records of T. balteatus within species that inhabits torrents and mountain streams at China, Ye and Deng (1997) reported the new provincial low to moderate elevations. This diurnal species often records of this species from central and southern Hunan hides under rocks in the water (Karsen et al., 1998; Province (Mt. Mangshan, Yizhang County and Nanyue Pope, 1935). Individuals were seen foraging in streams District, Hengyang City). These record are also erroneous or drainage ditches near villages during fieldworks at as their specimens distinctly differ from T. balteatus by a daytime, and two adults were encountered competing combination of morphological characters: a smaller body for a single loach, where each snake bit on one end of size (320–490 mm vs. 604–1 021 mm), a lower number the fish. Individuals are not aggressive, and no striking of ventrals (156–163 vs. 187–205), subcaudals (56–63 attempts were observed, but instead all snakes released vs. 65–102), and dorsal scale rows at midbody (17 vs. a strong musk when captured. In addition, tail autotomy 19), which probably represent Opisthotropis cheni Zhao, was also observed (see discussion below). 1999. Shen et al. (2014) also recorded the species in Etymology The specific epithet, balteatus, is a Latin “southern Hunan Province”, likely from the area near the adjective that means girded or belted. The term may be boundaries between Hunan Province and Guangxi Zhuang used to describe the distinctive annulated markings of this Autonomous Region (Figure 6). However, no detailed species. description or vouchered specimen was associated with this geographic distribution within Hunan Province. This 4.2. Variation, distribution, and behavior of record, if true, would represent the most northern range Trimerodytes balteatus Variation of the maxillary teeth of the species. Further confirmations are needed to better count are evident in T. balteatus. Fan (1931) firstly understand the distribution and ecology of this species. recorded 25 maxillary teeth for the population from Trimerodytes balteatus was recorded to display tail Luoxiang, Guangxi, China, which was distinctly higher autotomy, which is rare in snakes (Hoogmoed and Avila- than the maxillary teeth counts provided by later authors Pires, 2011). Fan (1931) firstly wrote that individuals (vs. 16–21) (Peracca, 1904; Pope, 1935; Steindachner, of T. balteatus would “throw down its tail and escape 1906; this work, Table 3). Additionally, Pope (1935) like gekkoes”. Similarly, such tail autotomy behavior recorded the maxillary teeth count as 20–21 based on was also observed in other Trimerodytes species. During topotypic specimens from Hainan Island, China, thus our fieldwork in May, 2016, two individuals of T. the maxillary teeth counts of Luoxiang Population percarinatus (a juvenile and an adult female) autotomized provided by Fan (1931) is questionable pending further their tails without being touched, and the autotomized part confirmation. Nevertheless, considering all published of the tails wiggled actively on the ground. Segmented data to date, maxillary teeth of T. balteatus vary from myomeres were observed, and no signs of bleeding were 16–25 among populations (Fan, 1931; Peracca, 1904; found from the autotomized tail. Interestingly, such tail Steindachner, 1906). Future studies are needed to gain a autotomy was only observed for certain populations of T. better understanding on the population variation of this percarinatus in southern Guangxi Zhuang Autonomous species. Region, China, and such behavior has not been observed Regarding the distribution of T. balteatus, an isolated by authors or documented in other populations from record from Cambodia is likely erroneous. Steindachner Fujian, Hainan or Yunnan Provinces of China or Vietnam. (1906) first reported a country record of T. balteatus Future studies are needed to understand the evolutionary from Cambodia based on three specimens purchased by mechanisms behind such physiological variation. Herrn Fruhstorfer. Such record was accepted by most later publications (Nguyen et al., 2009; Zhao, 2006; Zhao 4.3. The validity of Paratapinophis The monotypic and Adler, 1993; Zhao et al., 1998). However, Saint- genus Paratapinophis was established by Angel Girons (1972) indicated that all specimens alleged to (1929) based on two neonate specimens of the type be from Cambodia were actually collected in Vietnam. species, P. praemaxillaris Angel, 1929, collected in In addition, despite continuous fieldworks in Southeast northern Laos. The genus was diagnosed by having Asia for decades, specimens of T. balteatus were only a short, external process that extends anteriorly the collected from southern China and northern Vietnam, premaxillary bone. Later, Pope (1935) recognized and no other specimens were collected from any of the that the previously proposed diagnostic character of regions/countries that border Cambodia to date, including Paratapinophis was actually egg tooth of neonates, and southern Vietnam, Thailand, and Laos. Therefore, we he considered Paratapinophis to be a junior synonym reject the Cambodian record of the species. of Opisthotropis. However, Pope (1935) also presented No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 121 posteriorly posteriorly posteriorly posteriorly throughout throughout DSR keeling strongly keeled strongly keeled obtusely keeled obtusely keeled keeled posteriorly smooth anteriorly, smooth anteriorly, moderately keeled strongly posteriorly smooth; tuberculate keeled, more strongly smooth or moderately moderately anteriorly, 19 23 19 15–17 DSR at midbody enlarged enlarged enlarged enlarged subequal 17 smooth throughout subequal 13 subequal 13 subequal 15–23 last 3 distinctly last 2 distinctly last 2 moderately last 3 or 4 slightly large small small small , , 2015 and this work). “*” after standardizing by EW/SoL; “?” indicates lateral upward Direction of nostrils Eye size* Maxillary teeth nostrils Position of dorsolateral dorsolateral moderate posteriorly enlarged 19 feebly keeled dorsolateral dorsolateral moderate posteriorly enlarged 19 dorsolateral dorsolateral moderate or small distinct distinct distinct moderately moderately moderately paired indistinct dorsolateral dorsolateral paired barely distinct dorsal paired indistinct dorsolateral dorsolateral bicuspid posteriorly tricuspid or subrectangular 2–4 subrectangular 2–3 3–4 subrectangular paired clearly distinct lateral single spindle-shaped paired single tricuspid paired clearly distinct dorsolateral obliquely upward large single tricuspid paired distinct dorsolateral dorsolateral moderate single (3) tricuspid single barely distinct dorsolateral slightly upward small Prefrontal Prefrontal shape Internasal Head/neck mostly single usually single usually single ? single or paired subrectangular paired Atretium Atretium yunnanensis Rhabdops bicolor Pseudagkistrodon Pseudagkistrodon rudis multiprefrontalis Trimerodytes Trimerodytes balteatus Trachischium guentheri Isanophis Hebius annamensis Opisthotropis Paratapinophis Trachischium fuscum Taxa et al. et David (after prefrontals untypical with species and genera natricine among comparisons Morphological 6 Table missing data; values given in brackets indicate infrequent condition. 122 Asian Herpetological Research Vol. 10 distinct morphological differences that differentiate P. recognize the two pairs of posterior chin shields, whereas praemaxillaris from Opisthotropis, including having in Trimerodytes species, the posterior chin shields usually well-developed posterior chin shields, smooth scales, and separated from each other by two scales only (Figure 3). the large body size (Pope, 1935: 164). Nevertheless, this Thus the “inner posterior pair” chin shields described synonymization of Paratapinophis was accepted by later by Murphy et al. (2008) are likely the smaller scales authors and has not been re-evaluated for a long time between posterior chin shields, as a universal condition in (Brown and Leviton, 1961; Cai et al., 2015; Chan-Ard colubrids rather than “two pairs of posterior chin shields”. et al., 2015; Mo et al., 1984; Rasmussen, 1982; Smith, Therefore, given the high level of similarities between 1943; Zhao, 2006; Zhao et al., 1998). Paratapinophis and Trimerodytes, and the questionable Recently, Murphy et al. (2008) resurrected the genus morphological diagnosis of the former genus in recent Paratapinophis from Opisthotropis as a valid monotypic literature, Paratapinophis is most likely a junior synonym genus on the basis of morphological characters from of Trimerodytes, and its type species, P. praemaxillaris, newly collected specimens. Murphy et al. (2008) is likely a member of Trimerodytes with single prefrontal, stated that Paratapinophis differs from Opisthotropis which is similar to T. balteatus. We recommend future in possessing a distinct head from neck, with keeled phylogenetic studies on Paratapinophis to confirm its tubercles in the middle of dorsal scales, sexually taxonomic status and resolve its relationship with respect dimorphic scale ornamentation and coloration, a large and to Trimerodytes. robust body, a lower number of maxillary teeth, and two 4.4. Prefrontal variations of natricine snakes pairs of posterior chin shields. Later David et al. (2015) Variations of prefrontal scales historically play an accepted this revalidation, regarding Paratapinophis as important role in natricine snake taxonomy, particularly a valid, monotypic genus. However, David et al. (2015) at generic level (Angel, 1929; Bourret, 1934; David et al., only compared the resurrected Paratapinophis with 2015). However, different genera often share the same natricine taxa that have a single prefrontal. untypical prefrontal configuration (e.g. single prefrontal Based on our survey of reported morphological in Opisthotropis, Trimerodytes, Paratapinophis, and characters, we found that Paratapinophis shows a Isanophis) (David et al., 2015; this work). Furthermore, high level of similarities with respect to Trimerodytes variations from the standard configuration are also (Table 4). The previously proposed generic diagnoses common among congeners (e.g. genus Trimerodytes, of Paratapinophis and Trimerodytes are identical in Hebius, and Trachischium), and even among having: (1) head distinct from neck, (2) dorsolaterally populations or individuals (e.g. Pseudagkistrodon rudis directed nostrils, (3) large or moderate relative eye multiprefrontalis and Hebius annamensis) (David et al., size (after standardizing by EW/SoL, see method), 2015; Kizirian et al., 2018; Smith, 1943; Zhao and Jiang, (4) posteriorly enlarged maxillary teeth, (5) large and 1981; Zhao et al., 1998) (Figures 1, 7; Table 6). robust body, (6) same number of dorsal scale rows As results, the historical overemphasis on the (19-19-17), (7) same numbers of pre- and postoculars diagnostic value of prefrontal scales has resulted (mostly 1 and 3, respectively; the lowest postocular was in misleading taxonomic hypotheses, including the construed to be subocular by Murphy et al., 2008), (8) mis-assignment of Trimerodytes balteatus and the overlapping ventral and subcaudal scale counts, and establishment of synonym such as Parahelicops (Kizirian (9) similar V-shaped markings of dorsal color patterns et al., 2018; Ren et al., 2018). Given the high level and (Table 4). high frequency of variation in number and configuration In addition, the remaining diagnostic characters of of prefrontal scales in the subfamily Natricinae (Figures Paratapinophis provided by Murphy et al. (2008) were 1, 7; Table 6), we argue that their diagnostic importance believed to be not characteristic in Paratapinophis. should not be overemphasized, and we call for future Firstly, the “small tubercles in the middle of the scale” studies on the scale evolution among snakes to better were in fact a specialized keel, which were also shared in understand the evolutionary and taxonomic significance other genus (i.e. Opisthotropis andersonii; unpublished of different groups of scales. data). Secondly, the mention of “two pairs of posterior chin shields” is doubtful, because such character was Acknowledgements We thank Chung Van HOANG, Hoa never mentioned by any of the previous authors, including Thi NINH, Hieu Minh TRAN, Devon P. HUMPHREYS the original description and its illustration (Angel, 1929: for their help in the field; Yuezhao WANG, Ke LV, Shuo 77, figure B). In addition, Pope (1935: 164) also failed to LIU, Truong Quang NGUYEN and Zhiyong YUAN No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 123

Figure 7 Comparisons of head in dorsal view among species of subfamily Natricinae, showing the variations in the number of prefrontals among different groups. (A) Opisthotropis latouchii (from Wu et al., 1985); (B) Paratapinophis praemaxillaris (neonate; from Angel, 1929); (C) Trimerodytes balteatus (from Zhao et al., 1998); (D) Hebius annamensis (from Bourret, 1936); (E) Trachischium guentheri (from Boulenger, 1893); (F) Rhabdops bicolor (from Smith, 1943); (G) Atretium yunnanensis (from Zhao et al., 1998); (H) Pseudagkistrodon rudis muiltiprefrontalis (from Zhao and Jiang, 1981). for giving us access to examine specimens under their References care; Ke JIANG, Yulin XIE, Ping WANG, Xinhong XIE, Shaobing HOU, Jian WANG, Zhitong LYU and Angel F. 1929. Liste des Reptiles et Batraciens du Haut-Laos recueillis par M. Delacour. Description d’un genre, de deux Honghui CHEN for their kind help in morphological espèces et d’une variété d’Ophidiens. Bull Mus Natl Hist Nat, 2: data collection. This study was supported by the National 75–81 (In French) Key Research and Development Program of China Boulenger G. 1906. Descriptions of new reptiles from Yunnan. Ann (2017YFC0505202); Strategic Priority Research Program Mag Nat Hist 17(102): 567–568 Boulenger G. A. 1893. Catalogue of the Snakes in the British of Chinese Academy of Sciences (XDB31000000); Museum (Natural History). Vol. I. containing the families the National Natural Science Foundation of China Typhlopidae, Glauconiidae, Boidae, Ilysiidae, Uropeltidae, (31722049, 31772434); Key Research Program of Xenopeltidae, and Colubridae Aglyphae, part. London: British Frontier Sciences, CAS (QYZDB-SSW-SMC058); Museum of Natural History, 448 pp Bourret R. 1934. Notes herpétologiques sur l’Indochine française. the Southeast Asia Biodiversity Research Institute, III. Ophidiens d’Annam et du Moyen Laos. Bulletin général de Chinese Academy of Science (Y4ZK111B01); the Youth l’instruction Publique, 13e Année (9, Mai): 167–176 (In French) Innovation Promotion Association of CAS; the CAS Brown W. C., Leviton A. E. 1961. Discovery of the Snake Genus “Light of West China” Program (2018XBZG_JCTD_001) Opisthotropis in the Philippine Islands: With Description of a New Species. Occasional Papers of the Natural History Museum and Talent Program from Organization Department of of Stanford University, 8: 1–5 Sichuan Provincial Committee, and partially supported by Burbrink F. T., Lawson R., Slowinski J. B. 2000. Mitochondrial project BSTMV.08/16-19 to NTT. DNA phylogeography of the polytypic North American rat 124 Asian Herpetological Research Vol. 10

snake (Elaphe obsoleta): a critique of the subspecies concept. Parahelicops, Pararhabdophis, Paraphyly: Phylogenetic Evolution, 54(6): 2107–2118 Relationships among Certain Southeast Asian Natricine Snakes Cai B., Wang Y. Z., Chen Y. Y., Li J. T. 2015. A revised taxonomy (Hebius). Am Mus Novit, (3906): 1–7 for Chinese reptiles. Biodiversity Science, 23(3): 365–382 (In Lanfear R., Frandsen P. B., Wright A. M., Senfeld T., Calcott Chinese) B. 2017. PartitionFinder 2: New methods for selecting Chan-Ard T., Nabhitabhata J., Parr J. W. 2015. A field guide to partitioned models of evolution for molecular and morphological the reptiles of Thailand. Oxford University Press, 314 pp phylogenetic analyses. Mol Biol Evol, 34(3): 772–773 Chuaynkern Y., Duangkae P., Pongcharoen C., Chuaynkern C., Le T. D., Pham V. A., Pham T. C., Nguyen L. H. S., Ziegler T., Horsin L. 2014. Opisthotropis spenceri Smith, 1918 (Serpentes: Nguyen Q. T. 2015. Review of the genus Sinonatrix in Vietnam Natricidae): the third and fourth specimens. J Wildlife Thailand, with a new country record of Sinonatrix yunnanensis Rao Et 21(1): 1–14 Yang, 1998. Russ J Herpetol, 22(2): 84–88 Cope E. 1895. On a collection of Batrachia and Reptilia from the Lidth de Jeude T. W. V. 1890. Reptilia from the Malay island of Hainan. Proc Acad Nat Sci Philadelphia [1894]: 423– Archipelago. II. Ophidia Zoologische Ergebnisse einer Reise in 428 Niederländisch Ost-Indien. E. J. Brill, Leiden. p 178–192. Cox M. J. 1995. Opisthotrophis boonsongi. Herpetol Rev, 26(3): Malnate E. V., Underwood G. 1988. Australasian natricine snakes 157 of the genus Tropidonophis. Proc Acad Nat Sci Phila, 140(1): David P., Nguyen Q. T., Ziegler T. 2011. A new species of the 59–201 genus Opisthotropis Günther, 1872 (Squamata: Natricidae) from Mell R. 1931. List of Chinese snakes. Lingnan Science Journal, 8 the highlands of Kon Tum Province, Vietnam. Zootaxa, 2758(1): [1929]: 199–219 43–56 Mo D., Chen H., Li F. 1984. Opisthotropis premaxillaris (sic) David P., Pauwels O. S. G., Nguyen Q. T., Vogel G. 2015. On (Angel), a record new to China. Acta Herpetol Sinica, 3(1): 28 the taxonomic status of the Thai endemic freshwater snake (In Chinese) Parahelicops boonsongi, with the erection of a new genus Mocquard F. 1890. Recherches sur la faune herpétologique des (Squamata: Natricidae). Zootaxa, 3948(2): 203–217 îles de Bornéo et de Palawan. Nouv Arch Mus Hist Nat, 3(2): Fan T.-H. 1931. Preliminary report of reptiles from Yaoshan, 115–168 (In French) Kwangsi, China. Bulletin of the Deptartment of Biology, Sun Murphy J. C., Chan-ard T., Mekchai S., Cota M., Voris H. K. Yat-sen University, 11: 1–154 2008. The Rediscovery of Angel’s Stream Snake, Paratapinophis Figueroa A., McKelvy A. D., Grismer L. L., Bell C. D., Lailvaux praemaxillaris Angel, 1929 (Reptilia: Serpentes: Natricidae). S. P. 2016. A species-level phylogeny of extant snakes with Nat Hist J Chulalongkorn Univ, 8(2): 169–183 description of a new colubrid subfamily and genus. PLoS ONE, Nguyen V. S., Ho T. C., Nguyen Q. T. 2009. Herpetofauna of 11(9): e0161070 Vietnam. Frankfurt am Main: Edition Chimaira, 768 pp Günther A. 1872. Seventh account of new species of snakes in Noonloy T., Kunya K., Chanhome L., Sumontha M., Chomngam the collection of the British Museum. Ann Mag Nat Hist, 9(4): N., Pauwels O. S. G. 2018. Crab-ripping: an unusual feeding 13–37 behavior newly recorded in freshwater snakes. Bull Chicago Guo P., Liu Q., Xu Y., Jiang K., Hou M., Ding L., Pyron R. A., Herpetol Soc, 53(3): 53–56 Burbrink F. T. 2012. Out of Asia: natricine snakes support the O’Shea M., Allison A., Kaiser H. 2018. The taxonomic history of Cenozoic Beringian Dispersal Hypothesis. Mol Phylogenet Evol, the enigmatic Papuan snake genus Toxicocalamus (Elapidae: 63(3): 825–833 Hydrophiinae), with the description of a new species from the Hoogmoed M. S., Avila-Pires T. C. S. 2011. A case of voluntary Managalas Plateau of Oro Province, Papua New Guinea, and a tail autotomy in the snake Dendrophidion dendrophis (Schlegel, revised dichotomous key. Amphibia-Reptilia, 39(4): 403–433 1837) (Reptilia: Squamata: Colubridae). Bol Mus Para Emílio Okada Y., Takara T. 1958. A new species of Liopeltis (Ophidia, Goeldi Cienc Nat, Belém, 6(2): 113–117 Colubridae) from Ryukyu Islands. Bull Biogeographical Soc Huang M., Cai C., Jin Y., Gu H., Zhang S., Guo H., Wei J. 1990. Japan, 20(3): 1–3 Fauna of Zhejiang, Amphibia, Reptilia. Hangzhou: Zhejiang Orlov N. L., Darevsky I. S., Murphy R. W. 1998. A new species Science and Technology Publishing House, 306 pp (In Chinese) of mountain stream snake, genus Opisthotropis Gunther, 1872 ICZN 1999. International Code of Zoological Nomenclature. (Serpentes: Colubridae: Natricinae), from the tropical rain Fourth Edition adopted by the International Union of forests of southern Vietnam. Russ J Herpetol, 5(1): 61–64 Biological Sciences. London: International Trust of Zoological Ota H. 2004. Field observations on a highly endangered snake, Nomenclature, 306 pp Opisthotropis kikuzatoi (Squamata: Colubridae), endemic to Iskandar D. T., Kamsi K. 2009. On the second specimen of Kumejima Island, Japan. Current herpetology, 23(2): 73–80 Opisthotropis rugosus (van Lidth de Jeude, 1890) (Colubridae, Pauwels O. S. G., Kunya K., David P., Sumontha M. 2009. First Natricinae). Hamadryad, 34(1): 108–111 record of the Yunnan Keelback Sinonatrix yunnanensis Rao and Karsen S. J., Lau M. W., Bogadek A. 1998. Hong Kong Yang, 1998 (Serpentes: Natricidae) from Thailand. Salamandra, amphibians and reptiles, 2nd ed. Hong Kong: Urban Council, 45(3): 165–169 186 pp Peracca M. 1904. Nouvelles espèces d’Ophidiens d’Asie et Karsen S. J., Lau M. W., Bogadek A. 1986. Hong Kong d’Amerique, faisant partie de la collection du Muséum d’Histoire amphibians and reptiles. Urban Council, 136 pp Naturelle de Genève. Rev Suisse Zool, 12(3): 663–668 (In Kizirian D., Truong N. Q., Ngo H. T., Le M. D. 2018. French) No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 125

Pope C. H. 1935. The reptiles of China. Turtles, crocodilians, natricine snakes (Serpentes: Colubridae), inferred from a snakes, lizards. New York: American Museum of Natural molecular phylogeny. Ecol Evol, in press. History, 604 pp Tamura K., Stecher G., Peterson D., Filipski A., Kumar S. 2013. Pyron R. A., Kandambi H. K., Hendry C. R., Pushpamal V., MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Burbrink F. T., Somaweera R. 2013. Genus-level phylogeny of Mol Biol Evol, 30(12): 2725–2729 snakes reveals the origins of species richness in Sri Lanka. Mol Taylor E. H. 1965. The serpents of Thailand and adjacent waters. Phylogenet Evol, 66(3): 969–978 Univ Kans Sci Bull, 45(9): 609–1096 Rambaut A., Suchard M., Xie D., Drummond A. 2013. Tracer, Taylor E. H., Elbel R. E. 1958. Contribution to the herpetology of version 1.6, MCMC trace analysis package. Retrieved from Thailand. Univ Kans Sci Bull, 38(2): 1033–1189 http://tree.bio.ed.ac.uk/software/tracer/ Accessed 7 March 2018 Teynié A., Lottier A., David P., Nguyen Q. T., Vogel G. 2014. Rao D.-Q., Yang D.-T. 1998. A new species of Sinonatrix A new species of the genus Opisthotropis Gunther, 1872 from (Serpentes: Colubridae) of China with preliminary survey on northern Laos (Squamata: Natricidae). Zootaxa, 3774(2): 165– Sinonatrix. Russ J Herpetol, 5(1): 70–73 182 Rasmussen J. B. 1982. A new record of the rare Opisthotropis Toyama M. 1983. Taxonomic reassignment of the colubrid praemaxillaris (Serpentes: Colubridae). Amphibia-Reptilia, 3(2): snake, Opheodrys kikuzatoi, from Kume-jima Island, Ryukyu 279–280 Archipelago. Jpn J Herpetol, 10(2): 33–38 Ren J.-L., Wang K., Jiang K., Guo P., Li J.-T. 2017. A new Uetz P., Freed P., Hošek J. 2018. The Reptile Database. Retrieved species of the Southeast Asian genus Opisthotropis (Serpentes: from http://www.reptile-database.org. Accessed 27 March 2018 Colubridae: Natricinae) from western Hunan, China. Zool Res, Vogel G., David P., Pauwels O. S. G., Brachtel N. 2004. On 38(5): 251–263 the occurrence of the watersnake Sinonatrix aequifasciata Ren J.-L., Wang K., Nguyen T. T., Hoang C. V., Zhong G.-H., (Barbour, 1908) (Serpentes, Colubridae, Natricinae) in Vietnam. Jiang K., Guo P., Li J.-T. 2018. Taxonomic re-evaluation of Hamadryad 29(1): 110–114 the monotypic genus Pararhabdophis Bourret, 1934 (Squamata: Wallach V., Williams K. L., Boundy J. 2014. Snakes of the world. Colubridae: Natricinae) with discovery of its type species, P. A catalogue of living and extinct species. Boca Raton: CRC chapaensis, from China. Zootaxa, 4486(1): 31–56 Press, 1209 pp Ronquist F., Huelsenbeck J. P. 2003. MrBayes 3: Bayesian Wang J., Lyu Z., Zeng Z., Liu Z., Wang Y. 2017a. Re-description phylogenetic inference under mixed models. Bioinformatics, of Opisthotropis laui Yang, Sung and Chan, 2013 (Squamata: 19(12): 1572–1574 Natricidae). Asian Herpetol Res, 8(1): 70–74 Rossman D. A., Eberle W. G. 1977. Partition of the genus Natrix, Wang Y. Y., Guo Q., Liu Z. Y., Lyu Z. T., Wang J., Luo L., Sun with preliminary observations on evolutionary trends in natricine Y. J., Zhang Y. W. 2017b. Revisions of two poorly known snakes. Herpetologica, 33(1): 34–43 species of Opisthotropis Günther, 1872 (Squamata: Colubridae: Saint-Girons H. 1972. Les serpents du Cambodge. Paris: Mémoires Natricinae) with description of a new species from China. du Muséum National d’Histoire Naturelle, 170 pp Zootaxa, 4247(4): 391–412 Schmidt K. P. 1927. The reptiles of Hainan. Bull Am Mus Nat Hist, Wu L., Li D. J., Liu J. S. 1985. Reptilian Fauna of Guizhou. 54(3): 395–465 Guiyang: Guizhou Peoples Press, 436 pp (In Chinese) Shen Y., Ye Y., Deng X. 2014. Fauna Hunan. Reptilia. Changsha: Yang J.-H., Sung Y.-H., Chan B. P.-L. 2013. A new species of Hunan Science and Technology Press, 220 pp the genus Opisthotropis Günther, 1872 (Squamata: Colubridae: Smith M. A. 1943. The fauna of British India, Ceylon and Burma, Natricinae) from Guangdong Province, China. Zootaxa, 3646(3): including the whole of the Indo-chinese subregion. Reptilia and 289–296 Amphibia. Vol. III. Serpentes. London: Taylor and Francis, 583 Ye Y., Deng X. 1997. Five New Records of Snake in Hunan pp Province. Chinese Journal of Zoology, 32(5): 46–47 (In Chinese) Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic Zhang F. J., Hu S. Q., Zhao E. M. 1984. Comparative studies analysis and post-analysis of large phylogenies. Bioinformatics, and phylogenetic discussions on hemipenial morphology of the 30(9): 1312–1313 Chinese Colubrinae (Colubridae). Acta Herpetol Sinica, 3(3): Steindachner F. 1906. Bemerkungen zu Liparophis Bedoti, Peracca 23–44 (In Chinese) und Lachesis monticola (Gthr.). Sitzungsber Akad Wiss Wien, Zhao E. M. 2006. Snakes of China. I. Hefei: Anhui Science and math-natur-wiss Kl, 115(1): 905–909 Technology Publishing House, 372 pp (In Chinese) Stuart B. L., Heatwole H. 2008. Country records of snakes from Zhao E. M., Adler K. 1993. Herpetology of China. Oxford: Society Laos. Hamadryad, 33(1): 97–106 for the Study of Amphibians and Reptiles: Contribution to Stuebing R. B., Inger R. F. 1998. Additional records on two rare Herpetology, 522 pp snakes from Borneo, with the confirmation of Trimeresurus Zhao E. M., Huang M. H., Zong Y. 1998. Fauna Sinica Reptilia, malcolmi Loveridge as a distinct species. Raffles Bull Zool, 46: Vol. 3: Squamata, Serpentes. Beijing: Science Press, 522 pp (In 325–328 Chinese) Sun Y.-B. 2017. FasParser: a package for manipulating sequence Zhao E. M., Jiang Y. M. 1981. A new species and subspecies of data. Zool Res, 38(2): 110–112 snakes from Sichuan. Acta Herpetol Sinica, 5(7): 53–58 (In Takeuchi H., Savitzky A. H., Ding L., de Silva A., Das I., Nguyen Chinese) T. T., Tsai T. S., Jono T., Zhu G. X., Mahaulpatha D. 2018. Zheng J. 1992. A note on the genus Opisthotropis in China. Wuyi Evolution of nuchal glands, unusual defensive organs of Asian Science Journal, 9: 369–372 (In Chinese) 126 Asian Herpetological Research Vol. 10

Ziegler T., David P., Vu N. T. 2008. A new natricine snake of sibling species from northern Vietnam. Zootaxa, 4374(4): 476– the genus Opisthotropis from Tam Dao, Vinh Phuc Province, 496 northern Vietnam (Squamata, Colubridae). Zoosystematics Evol, Ziegler T., Ziegler T. N., Peusquens J., David P., Vu N. T., Pham 84(2): 197–203 T. C., Nguyen Q. T., Le M. D. 2017. Expanded morphological Ziegler T., David P., Ziegler N. T., Pham T. C., Nguyen Q. T., definition and molecular phylogenetic position of the Tam Le D. M. 2018. Morphological and molecular review of Jacob’s Dao mountain stream keelback Opisthotropis tamdaoensis Mountain Stream Keelback Opisthotropis jacobi Angel and (Squamata: Natricidae) from Vietnam. Rev Suisse Zool, 124(2): Bourret, 1933 (Squamata: Natricidae) with description of a 377–389 No. 2 Jinlong REN et al. Generic taxonomy of Opisthotropis balteata 127

Appendix 1 Specimens examined.

Trimerodytes annularis (n=6) China. —Fujian Province. CIB 11460, CIB 11461, CIB 11466, Wuyishan City, Mt. Wuyi, Xing Village. —Zhejiang Province. CIB 78066. —Guangxi Zhuang Autonomous Region. CIB 109020, 109021. Trimerodytes aequifaciatus (n=3) China. —Hunan Province. CIB 11435, CIB 11436, Yizhang County, Mt. Mangshan. —Fujian Province. CIB 109019, Wuyishan City, Mt. Wuyi. Trimerodytes balteatus (n=6) China. —Guangxi Zhuang Autonomous Region. CIB 9971, Guigang City; YBU 16015, YBU 16060, Cangwu County; CIB 109017. —Guangdong Province. CIB 109018, Zhaoqing City, Mt. Dinghu; SYS r001677, Luoding City. Trimerodytes percarinatus (n=5) China. —Fujian Province. CIB 109022, CIB 109023, Wuyishan City, Mt. Wuyi. — Sichuan Province. CIB 102922–102924, Chengdu City. Opisthotropis andersonii (n=12) China. —Hong Kong. SYS r001423, HK Island, Tai Tam; SYS r001424, Tai Mo Shan. —Guangdong Province. SYS r000607, SYS r001017, SYS r001020, SYS r001082, SYS r001672, SYS r001673, Shenzhen City, Mt. Wutong; SYS r000803, Shenzhen City, Mt. Yangtai; SYS r000893, Shenzhen City, Dapeng Peninsula; SYS r001382, SYS r001383, Guangzhou City, Mt. Maofeng. Opisthotropis cheni (n=31) China. —Hunan Province. CIB 78146–78149, SYS r000369, Yizhang County, Mt. Mangshan; SYS r000300, Shuangpai County, Mt. Yangming. —Guangdong Province. CIB 98273, KIZ 04752, KIZ 04759, SYS r000007, SYS r000010, SYS r000040, SYS r000045, SYS r000050, SYS r001293–r001295, YBU 12110, YBU 071040, YBU 071042, YBU 071046–071050, Ruyuan County, Nanling National Nature Reserve; SYS r000764, SYS r001688, SYS r001743, SYS r001808, Yingde City, Shimentai Nature Reserve; SYS r000934, Lianzhou City, Mt. Dadong. —Guangxi Zhuang Autonomous Region. SYS r001804, Guanyang County, Qianjiadong Nature Reserve. Opisthotropis cucae (n=1) Vietnam. —Kon Tum Province. IEBR A.0924 (holotype), Sa Thay District, Chu Mom Ray National Park. Opisthotropis guangxiensis (n=19) China. —Guangxi Zhuang Autonomous Region. KIZ 01597, KIZ 01598, KIZ 027352, SYS r001477, Jinxiu County, Mt. Dayao; KIZ 027369, Xing’an City, Mt. Maoer; SYS r001736, SYS r001739, SYS r001740, Nanning City, Wuming District, Mt. Daming; SYS r001547–r001549, Longsheng County, Huaping National Nature Reserve. —Guangdong Province. KIZ 024824–024826, Luoding City, Fuhe Town; SYS r001446, SYS r001447, SYS r001686, SYS r001799, Xinyi County, Dawuling Nature Reserve. —Hunan Province. KIZ 08792, Jiangyong County. Opisthotropis jacobi (n=3) Vietnam. —Vinh Phuc Province. VNMN 06219–06221, Tamdao, Tamdao National Park. Opisthotropis kuatunensis (n=15) China. —Fujian Province. SYS r001008, Shanghang County, Gutian Town; SYS r001746, Dehua County, Mt. Daiyun. —Jiangxi Province. SYS r001851, Guixi City, Yangjifeng National Nature Reserve; SYS r000737, SYS r000745, Shangrao City, Guangfeng District, Tongboshan Nature Reserve; SYS r000998, Yongxin County, Qixiling Nature Reserve; SYS r000356, Jinggangshan City, Mt. Jinggang. —Guangdong Province. SYS r000606, SYS r000615, SYS r000623, SYS r001081, Shenzhen City, Mt. Wutong. —Hong Kong. KIZ 05770, KIZ 05776, Tsuen Wan District. —Unknown locality. SYS r000026, SYS r00576. Opisthotropis lateralis (n=38) China. —Guangxi Zhuang Autonomous Region. SYS r000262, Jingxi County, Xinling Village; SYS r000394, Shangsi County, Shiwandashan National Nature Reserve; YBU 14465, YBU 14477–14479, Fangchenggang City, Fangcheng District, Fulong; YBU 14516–14523, Guigang City, Mt. Pingtian; KIZ 79074, Beiliu City, Mt. Darong; YBU 091014. —Guangdong Province. SYS r000951, Fengkai County, Heishiding Nature Reserve; SYS r001149, Zhaoqing City, Mt. Dinghu; SYS r000608, SYS r000612, SYS r000616, SYS r001019, SYS r001080, SYS r001389, SYS r001671, Shenzhen City, Mt. Wutong.—Yunnan Province. CIB 103778, CIB 103779, Hekou County. —Hainan Province. SYS r000367, Haikou City, Dazhipo Town. —Hong Kong. KIZ 05768, KIZ 05774, Tsuen Wan District. Vietnam. —Cao Bang Province. VNMN A.2016.15. —Quang Ninh Province. VNMN A.2016.14, Bai Tu Long; IEBR A.2016.35, Dong Son Ky Thuong. —Bac Giang Province. IEBR A.2016.36, IEBR 3629, IEBR 3644, IEBR 3645, Tay Yen Tu. —Quang Nam Province. IEBR.83, Mt. Ngoc Linh. Opisthotropis latouchii (n=68) China. —Fujian Province (n=18). SYS r001289, Wuyishan City, Guadun Village; CIB 9983, CIB 9988, CIB 9990–9994, CIB 9998–10000, Wuyishan City, Tongmu Village; SYS r000671, Wuyishan City, San’gang Village; KIZ 01984, SYS r000670, SYS r000677, SYS r001723, Wuyishan City, Mt. Wuyi; SYS 128 Asian Herpetological Research Vol. 10

r001287, Shaowu City, Longhu Forestry Station; SYS r001724, Ninghua County, Mt. Yashu. —Jiangxi Province (n=24). SYS r000296, SYS r000309, SYS r000358, SYS r000359, SYS r000421–r000423, SYS r000991, SYSr000993, SYS r001253, SYS r001255, SYS r001298, SYS r001300, SYS r001303–r001306, Jinggangshan City, Mt. Jinggang; SYS r000776, Shangrao City, Guangfeng District, Tongboshan Nature Reserve; SYS r000961, Chongyi County, Qiyunshan Nature Reserve; SYS r000979, SYS r001470, Anfu County, Mt. Wugong; SYS r000987, Jing’an County, Jiulingshan Nature Reserve; SYS r001004, Anyuan County, Sanbaishan; SYS r001370, Xinfeng County, Mt. Jinpen. —Zhejiang Province (n=1). SYS r001771, Pan’an County, Mt. Dapan. —Guangxi Zhuang Autonomous Region (n=8). KIZ 07638, Gongcheng County; SYS r000843, Jinxiu County, Dayaoshan National Nature Reserve; SYS r000853, Lingui County, Huaping National Nature Reserve; SYS r001846, Fuchuan County, Yangxi Village; KIZ 024859, KIZ 024893, KIZ 027354, SYS r001530. —Guangdong Province (n=3). SYS r000753, SYS r001449, Renhua County, Huangshakeng Village; SYS r001628, Shixing County, Mt. Longdoufeng. —Hunan Province (n=13). SYS r001322, Hengshan County, Mt. Hengshan; SYS r001468, Hengdong County, Chuankou Town; SYS r001791, Liuyang City, Dawei National Forest Park; SYS r001793, SYS r001794, Zixing City, Dongjiang Lake; SYS r000368, SYS r000371, Yizhang County, Mt. Mangshan; SYS r000823–r000825, Yanling County, Taoyuandong National Nature Reserve; KIZ 04527, KIZ 04528, Taoyuan County; SYS r001646, Pingjiang County, Mt. Mubu. —Guizhou Province (n=1). KIZ 057014, Leishan County, Qilichong Village. Opisthotropis laui (n=6) China. —Guangdong Province. SYS r001161, SYS r001169–r001171, Taishan City, Shangchuan Island; SYS r001622, SYS r001623, Enping City, Qixingkeng Natural Reserve. Opisthotropis maculosa (n=8) China. —Guangxi Zhuang Autonomous Region. SYS r000393, SYS r000537, SYS r000538, Shangsi County, Shiwandashan National Nature Reserve. —Guangdong Province. SYS r000946, SYS r001350, SYS r001525, Fengkai County, Heishiding Nature Reserve; SYS r001515, Xinyi County, Dawuling Nature Reserve. Vietnam. —Quang Ninh Province. IEBR A.2016.34, Hai Ha District, Tai Chi Village. Opisthotropis maxwelli (n=7) China. —Fujian Province. SYS r001053, Nanjing County, Huboliao Nature Reserve; SYS r001273, Shanghang County, Wulong Village; KIZ 024861, Zherong County. —Guangdong Province. SYS r000841, Nan’ao County, Nan’ao Island; SYS r001454, SYS r001571, SYS r001572, Fengshun County, Mt. Tongguzhang. Opisthotropis shenzhenensis (n=6) China. —Guangdong Province. SYS r000635, SYS r000636, SYS r001018 (holotype), Shenzhen City, Mt. Wutong; SYS r001021, Shenzhen City, Sanzhoutian; SYS r001032, Shenzhen City, Mt. Tiantou; SYS r001145, Dongguan City, Mt. Yinping. Opisthotropis tamdaoensis (n=6) Vietnam. —Vinh Phuc Province. VNUH 010606 (holotype), IEBR A.2016.32, IEBR A.2016.33, VNMN 06216, VNMN 06217, VNMN 06222, Tam Dao. Opisthotropis zhaoermii (n=3) China. Hunan Province. CIB 109998–110000 (type series), Guzhang County, Zuolong Gorges.