Regulatory Architecture of Gene Expression Variation in the 2 Threespine Stickleback, Gasterosteus Aculeatus
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Correct Setup of the Substantia Nigra Requires Reelin-Mediated Fast, Laterally- Directed Migration of Dopaminergic Neurons
RESEARCH ARTICLE Correct setup of the substantia nigra requires Reelin-mediated fast, laterally- directed migration of dopaminergic neurons Ankita Ravi Vaswani1, Beatrice Weykopf2†, Cathleen Hagemann1, Hans-Ulrich Fried3, Oliver Bru¨ stle2, Sandra Blaess1* 1Neurodevelopmental Genetics, Institute of Reconstructive Neurobiology, University of Bonn School of Medicine & University Hospital Bonn, Bonn, Germany; 2Institute of Reconstructive Neurobiology, University of Bonn School of Medicine & University Hospital Bonn, Bonn, Germany; 3Light Microscope Facility, German Center for Neurodegenerative Diseases, Bonn, Germany Abstract Midbrain dopaminergic (mDA) neurons migrate to form the laterally-located substantia nigra pars compacta (SN) and medially-located ventral tegmental area (VTA), but little is known about the underlying cellular and molecular processes. Here we visualize the dynamic cell morphologies of tangentially migrating SN-mDA neurons in 3D and identify two distinct migration modes. Slow migration is the default mode in SN-mDA neurons, while fast, laterally-directed *For correspondence: migration occurs infrequently and is strongly associated with bipolar cell morphology. Tangential [email protected] migration of SN-mDA neurons is altered in absence of Reelin signaling, but it is unclear whether Reelin acts directly on migrating SN-mDA neurons and how it affects their cell morphology and † Present address: Precision migratory behavior. By specifically inactivating Reelin signaling in mDA neurons we demonstrate its Neurology Program & Advanced direct role in SN-mDA tangential migration. Reelin promotes laterally-biased movements in mDA Center for Parkinson’s Disease neurons during their slow migration mode, stabilizes leading process morphology and increases the Research, Harvard Medical School and Brigham & Women’s probability of fast, laterally-directed migration. -
Watsonjn2018.Pdf (1.780Mb)
UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Methamphetamine Induces Alterations in the Long Non-Coding Rnas Expression Profile in the Nucleus Accumbens of the Mouse
Zhu et al. BMC Neuroscience (2015) 16:18 DOI 10.1186/s12868-015-0157-3 RESEARCH ARTICLE Open Access Methamphetamine induces alterations in the long non-coding RNAs expression profile in the nucleus accumbens of the mouse Li Zhu1,2†,JieZhu1,2†,YufengLiu3, Yanjiong Chen4, Yanlin Li1,2,LirenHuang3,SisiChen3,TaoLi1,2,YonghuiDang1,2 andTengChen1,2* Abstract Background: Repeated exposure to addictive drugs elicits long-lasting cellular and molecular changes. It has been reported that the aberrant expression of long non-coding RNAs (lncRNAs) is involved in cocaine and heroin addiction, yet the expression profile of lncRNAs and their potential effects on methamphetamine (METH)-induced locomotor sensitization are largely unknown. Results: Using high-throughput strand-specific complementary DNA sequencing technology (ssRNA-seq), here we examined the alterations in the lncRNAs expression profile in the nucleus accumbens (NAc) of METH-sensitized mice. We found that the expression levels of 6246 known lncRNAs (6215 down-regulated, 31 up-regulated) and 8442 novel lncRNA candidates (8408 down-regulated, 34 up-regulated) were significantly altered in the METH-sensitized mice. Based on characterizations of the genomic contexts of the lncRNAs, we further showed that there were 5139 differentially expressed lncRNAs acted via cis mechanisms, including sense intronic (4295 down-regulated and one up-regulated), overlapping (25 down-regulated and one up-regulated), natural antisense transcripts (NATs, 148 down-regulated and eight up-regulated), long intergenic non-coding RNAs (lincRNAs, 582 down-regulated and five up-regulated), and bidirectional (72 down-regulated and two up-regulated). Moreover, using the program RNAplex, we identified 3994 differentially expressed lncRNAs acted via trans mechanisms. -
Bone Morphogenetic Protein-4 Affects Both Trophoblast and Non-Trophoblast Lineage-Associated Gene Expression in Human Embryonic Stem Cells
Vol.2, No.4, 163-175 (2012) Stem Cell Discovery http://dx.doi.org/10.4236/scd.2012.24021 Bone morphogenetic protein-4 affects both trophoblast and non-trophoblast lineage-associated gene expression in human embryonic stem cells Margaret L. Shirley1,2*, Alison Venable1*, Raj R. Rao3, Nolan L. Boyd4, Steven L. Stice1,5,6, David Puett1#, Prema Narayan7# 1Department of Biochemistry and Molecular Biology, University of Georgia, Athens, USA; #Corresponding Author: [email protected] 2Department of Psychiatry, University of California, San Francisco, USA 3Department of Chemical and Life Science Engineering, School of Engineering, Virginia Commonwealth University, Richmond, USA 4Cardiovascular Innovation Institute, University of Louisville, Louisville, USA 5Regenerative Bioscience Center, University of Georgia, Athens, USA 6Department of Animal and Dairy Sciences, University of Georgia, Athens, USA 7Department of Physiology, Southern Illinois University School of Medicine, Carbondale, USA; #Corresponding Author: [email protected] Received 5 May 2012; revised 4 June 2012; accepted 1 July 2012 ABSTRACT cells were obtained. Gene expression by EB was characterized by an up-regulation of a num- Human embryonic stem cells (hESC) can be in- ber of genes associated with trophoblast, ecto- duced to differentiate to trophoblast by bone derm, endoderm, and mesoderm, and the pro- morphogenetic proteins (BMPs) and by aggre- duction of hCG and progesterone confirmed that gation to form embryoid bodies (EB), but there trophoblast-like cells were formed. These re- are many differences and controversies regard- sults suggest that, in the presence of FGF-2, ing the nature of the differentiated cells. Our BG02 cells respond to BMP4 to yield tropho- goals herein were to determine if BG02 cells form trophoblast-like cells (a) in the presence of blast-like cells, which are also obtained upon EB BMP4-plus-basic fibroblast growth factor (FGF-2) formation. -
Claire Hastie Thesis
Hastie, Claire E. (2011) Discovering common genetic variants for hypertension using an extreme case-control strategy. PhD thesis. http://theses.gla.ac.uk/2423/ Copyright and moral rights for this thesis are retained by the author A copy can be downloaded for personal non-commercial research or study, without prior permission or charge This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the Author The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the Author When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given. Glasgow Theses Service http://theses.gla.ac.uk/ [email protected] Discovering Common Genetic Variants for Hypertension Using an Extreme Case-control Strategy Claire E. Hastie, M.Sc. This being a thesis submitted for the degree of Doctor of Philosophy (Ph.D.) in the Faculty of Medicine, University of Glasgow October 2010 BHF Glasgow Cardiovascular Research Centre Institute of Cardiovascular and Medical Sciences College of Medical, Veterinary, and Life Sciences University of Glasgow © C.E. Hastie 2010 Declaration I declare that this thesis has been written entirely by myself and is a record of research performed by myself with the exception of discovery cohort genotyping (Dr Wai K. Lee, Dr Anna Maria Di Blasio, Stewart Laing, and Dr Davide Gentilini), genotyping and association analysis of replication cohorts (undertaken by investigators from each cohort, respectively), and analysis of data from the BRIGHT (Dr Sandosh Padmanabhan), GRECO and HERCULES clinical functional cohorts (undertaken by investigators from each cohort, respectively). -
Identification of Key Pathways and Genes in Dementia Via Integrated Bioinformatics Analysis
bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Identification of Key Pathways and Genes in Dementia via Integrated Bioinformatics Analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karnataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract To provide a better understanding of dementia at the molecular level, this study aimed to identify the genes and key pathways associated with dementia by using integrated bioinformatics analysis. Based on the expression profiling by high throughput sequencing dataset GSE153960 derived from the Gene Expression Omnibus (GEO), the differentially expressed genes (DEGs) between patients with dementia and healthy controls were identified. With DEGs, we performed a series of functional enrichment analyses. Then, a protein–protein interaction (PPI) network, modules, miRNA-hub gene regulatory network and TF-hub gene regulatory network was constructed, analyzed and visualized, with which the hub genes miRNAs and TFs nodes were screened out. Finally, validation of hub genes was performed by using receiver operating characteristic curve (ROC) analysis. -
An OTX2-PAX3 Signaling Axis Regulates Group 3 Medulloblastoma Cell Fate
ARTICLE https://doi.org/10.1038/s41467-020-17357-4 OPEN An OTX2-PAX3 signaling axis regulates Group 3 medulloblastoma cell fate Jamie Zagozewski1, Ghazaleh M. Shahriary 1, Ludivine Coudière Morrison1, Olivier Saulnier 2,3, Margaret Stromecki1, Agnes Fresnoza4, Gareth Palidwor5, Christopher J. Porter 5, Antoine Forget6,7, Olivier Ayrault 6,7, Cynthia Hawkins2,8,9, Jennifer A. Chan10, Maria C. Vladoiu2,3,9, Lakshmikirupa Sundaresan2,3, Janilyn Arsenio11,12, Michael D. Taylor 2,3,9,13, Vijay Ramaswamy 2,3,14,15 & ✉ Tamra E. Werbowetski-Ogilvie 1 1234567890():,; OTX2 is a potent oncogene that promotes tumor growth in Group 3 medulloblastoma. However, the mechanisms by which OTX2 represses neural differentiation are not well characterized. Here, we perform extensive multiomic analyses to identify an OTX2 regulatory network that controls Group 3 medulloblastoma cell fate. OTX2 silencing modulates the repressive chromatin landscape, decreases levels of PRC2 complex genes and increases the expression of neurodevelopmental transcription factors including PAX3 and PAX6. Expression of PAX3 and PAX6 is significantly lower in Group 3 medulloblastoma patients and is cor- related with reduced survival, yet only PAX3 inhibits self-renewal in vitro and increases survival in vivo. Single cell RNA sequencing of Group 3 medulloblastoma tumorspheres demonstrates expression of an undifferentiated progenitor program observed in primary tumors and characterized by translation/elongation factor genes. Identification of mTORC1 signaling as a downstream effector of OTX2-PAX3 reveals roles for protein synthesis pathways in regulating Group 3 medulloblastoma pathogenesis. 1 Regenerative Medicine Program, Department of Biochemistry and Medical Genetics, University of Manitoba, Winnipeg, MB, Canada. 2 The Arthur and Sonia Labatt Brain Tumour Research Center, The Hospital for Sick Children, Toronto, ON, Canada. -
Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in -
Supplementary Material Computational Prediction of SARS
Supplementary_Material Computational prediction of SARS-CoV-2 encoded miRNAs and their putative host targets Sheet_1 List of potential stem-loop structures in SARS-CoV-2 genome as predicted by VMir. Rank Name Start Apex Size Score Window Count (Absolute) Direct Orientation 1 MD13 2801 2864 125 243.8 61 2 MD62 11234 11286 101 211.4 49 4 MD136 27666 27721 104 205.6 119 5 MD108 21131 21184 110 204.7 210 9 MD132 26743 26801 119 188.9 252 19 MD56 9797 9858 128 179.1 59 26 MD139 28196 28233 72 170.4 133 28 MD16 2934 2974 76 169.9 71 43 MD103 20002 20042 80 159.3 403 46 MD6 1489 1531 86 156.7 171 51 MD17 2981 3047 131 152.8 38 87 MD4 651 692 75 140.3 46 95 MD7 1810 1872 121 137.4 58 116 MD140 28217 28252 72 133.8 62 122 MD55 9712 9758 96 132.5 49 135 MD70 13171 13219 93 130.2 131 164 MD95 18782 18820 79 124.7 184 173 MD121 24086 24135 99 123.1 45 176 MD96 19046 19086 75 123.1 179 196 MD19 3197 3236 76 120.4 49 200 MD86 17048 17083 73 119.8 428 223 MD75 14534 14600 137 117 51 228 MD50 8824 8870 94 115.8 79 234 MD129 25598 25642 89 115.6 354 Reverse Orientation 6 MR61 19088 19132 88 197.8 271 10 MR72 23563 23636 148 188.8 286 11 MR11 3775 3844 136 185.1 116 12 MR94 29532 29582 94 184.6 271 15 MR43 14973 15028 109 183.9 226 27 MR14 4160 4206 89 170 241 34 MR35 11734 11792 111 164.2 37 52 MR5 1603 1652 89 152.7 118 53 MR57 18089 18132 101 152.7 139 94 MR8 2804 2864 122 137.4 38 107 MR58 18474 18508 72 134.9 237 117 MR16 4506 4540 72 133.8 311 120 MR34 10010 10048 82 132.7 245 133 MR7 2534 2578 90 130.4 75 146 MR79 24766 24808 75 127.9 59 150 MR65 21528 21576 99 127.4 83 180 MR60 19016 19049 70 122.5 72 187 MR51 16450 16482 75 121 363 190 MR80 25687 25734 96 120.6 75 198 MR64 21507 21544 70 120.3 35 206 MR41 14500 14542 84 119.2 94 218 MR84 26840 26894 108 117.6 94 Sheet_2 List of stable stem-loop structures based on MFE. -
PDF Download
Review Xatzipsalti Maria et al. Congenital Hypopituitarism: Various Genes, … Horm Metab Res 2018; 00: 00–00 Congenital Hypopituitarism: Various Genes, Various Phenotypes Authors Maria Xatzipsalti1, 2, Antonis Voutetakis1, Lela Stamoyannou2, George P. Chrousos1, Christina Kanaka-Gantenbein1 Affiliations ABSTRacT 1 Division of Endocrinology, Diabetes and Metabolism, The ontogenesis and development of the pituitary gland is a First Department of Pediatrics, Medical School, National highly complex process that depends on a cascade of transcrip- and Kapodistrian University of Athens, “Aghia Sofia” tion factors and signaling molecules. Spontaneous mutations Children's Hospital, Athens, Greece and transgenic murine models have demonstrated a role for 2 First Department of Pediatrics, “Aglaia Kyriakou” many of these factors, including HESX1, PROP1, PIT1, LHX3, Children's Hospital, Athens, Greece LHX4, SOX2, SOX3, OTX2, PAX6, FGFR1, SHH, GLI2, and FGF8 in the etiology of congenital hypopituitarism. Genetic muta- Key words tions in any of these factors can lead to congenital hypopitui- pituitary, combined pituitary hormone deficiency, congenital tarism, which is characterized by the deficiency in one or more hypopituitarism, transcription factors, syndromic hypopitui- pituitary hormones. The phenotype can be highly variable, tarism, non-syndromic hypopituitarism consisting of isolated hypopituitarism or more complex disor- ders. The same phenotype can be attributed to different gene received 27.03.2018 mutations; while a given gene mutation can