Transgenic Maize Plants Expressing the Totivirus Antifungal Protein, KP4, Are Highly Resistant to Corn Smut

Plant Biotechnology Journal (2011) 9, pp. 857–864 doi: 10.1111/j.1467-7652.2011.00590.x

Transgenic maize plants expressing the Totivirus antifungal protein, KP4, are highly resistant to corn smut

Aron Allen1,†,EmirIslamovic2,†,‡, Jagdeep Kaur1,ScottGold2, Dilip Shah1 and Thomas J. Smith1,*

1Donald Danforth Plant Science Center, Saint Louis, MO, USA 2Department of Plant Pathology, University of Georgia, Athens, GA, USA

Received 8 November 2010; Summary revised 21 December 2010; The corn smut fungus, Ustilago maydis, is a global pathogen responsible for extensive agricul- accepted 22 December 2010. tural losses. Control of corn smut using traditional breeding has met with limited success *Correspondence (Tel (314) 587 1451; because natural resistance to U. maydis is organ speciﬁc and involves numerous maize genes. fax (314) 587 1551; Here, we present a transgenic approach by constitutively expressing the Totivirus antifungal email [email protected]) protein KP4, in maize. Transgenic maize plants expressed high levels of KP4 with no apparent † To be considered co-ﬁrst authors. negative impact on plant development and displayed robust resistance to U. maydis chal- ‡Present address: USDA-ARS Small Grains lenges to both the stem and ear tissues in the greenhouse. More broadly, these results dem- and Potato Germplasm Research Unit, onstrate that a high level of organ independent fungal resistance can be afforded by Aberdeen, ID 83210, USA. transgenic expression of this family of antifungal proteins. Keywords: KP4, Ustilago maydis, transgenic.

Introduction Our study focused on an ‘interstrain inhibition’ system found in U. maydis (Hankin and Puhalla, 1971; Day and Anagnostakis, The smut fungi are important agricultural pathogens responsible 1973; Koltin and Day, 1975; Koltin, 1988). Interstrain inhibition for significant crop yield losses. Corn smut, caused by a bio- in U. maydis is caused by antifungal proteins (killer toxins) trophic fungus Ustilago maydis, is economically important in all secreted by double-stranded RNA Totiviruses (Hankin and Puhal- countries where maize is grown. Yield loss because of corn la, 1971). It is estimated that 1% of U. maydis found in nat- smut is generally kept below 2% with available partially resis- ure secretes these killer toxins (Day, 1981). None of the three tant field varieties of maize. Sweet maize in particular is more known killer strains of U. maydis are resistant to any toxin other susceptible to this disease where yield losses can be as high as than their own, and the three corresponding resistance genes 20%. Hot and dry weather conditions are favourable for are recessive and independent. Therefore, it has been suggested U. maydis that can attack maize during its early stage of devel- that transgenic crops expressing two or more different U. may- opment. However, corn smut occurs more frequently on maize dis killer toxins would be protected against all by a fraction of a ears, tassels and nodes than on leaves, internodes and aerial percent of U. maydis strains (Kinal et al., 1995). Similar killer roots. If one considers that maize is the most economically toxins have been identified in eight genera of yeast (Young, important crop in the USA, generating $48.7 billion in 2009 1987). Specifically, we focused on the secreted KP4 protein of with approximately 35 million hectares planted (2010 World of the interstrain inhibition system (Gu et al., 1994, 1995). Corn, National Corn Growers Association, http://www.ncga.com) KP4 is a single polypeptide of 105 amino acids produced by even a 2% loss is nearly $1.0 billion annually. In addition to the UMV4 virus that infects the P4 strain of U. maydis (Park domestic consumption, maize is a major profitable US export et al., 1994). It is the only U. maydis toxin not processed by propelling USA as the largest maize exporter in the world for Kex2p, and there is no sequence similarity to other toxins 2009. With the current increasing emphasis on biofuels, the (Ganesa et al., 1991; Park et al., 1994). Although most of the role of maize in the USA agriculture is likely to increase to even yeast toxins are acidic (Bussey, 1972) and the Ustilago antifun- greater importance. gal proteins, KP6 and KP1, have neutral pI values (Levine et al., To control corn smut disease, several methods have been rec- 1979), KP4 is extremely basic, with a pI 9.0 (Ganesa et al., ommended including crop rotation, sanitation, seed treatments, 1989). KP4 is an a ⁄ b sandwich protein with a relatively com- application of foliar fungicides, modification of fertility and bio- pact structure (Gu et al., 1995). From a tenuous structural simi- logical controls (Pataky and Snetselaar, 2006). In spite of these larity to the scorpion toxin AaHII from Androctonus australius,it frequently mentioned control tactics, host resistance is the only was suggested (Gu et al., 1995) and then subsequently shown practical method of managing common smut in areas where (Gage et al., 2001) that KP4 inhibits calcium uptake in fungal U. maydis is prevalent. Currently, there is no maize line avail- cells. Our previous studies have shown that the KP4 protein able that is immune to infection by U. maydis. A recent study inhibits calcium channels (Gage et al., 2001, 2002; Allen et al., suggested that U. maydis resistance in maize is a polygenic 2008). This is a reasonable mode of action as calcium and cal- trait, where multiple quantitative trait loci contribute to plant cium-dependent signalling is essential for normal growth as well resistance to corn smut (Baumgarten et al., 2007). We explored as pathogenicity of various fungal plant pathogens (Rispail an alternative approach by introducing a component of a natu- et al., 2009). Transforming economically important crops with rally occurring antifungal system into transgenic maize. the native U. maydis KP4 gene has been successfully applied in

ª 2011 The Authors Plant Biotechnology Journal ª 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd 857 858 Aron Allen et al.

the wheat defence against stinking smut (Clausen et al., 2000). As we used a plant defensin secretory signal peptide In this study, we show that transgenic maize lines expressing sequence, we determined whether KP4 was indeed secreted in the monocot codon-optimized chimeric KP4 gene containing a the transgenic lines (Terras et al., 1995). The imbibed germi- plant secretory signal sequence are highly resistant to corn smut nating seeds from transgenic lines 851 and 1040 and the

disease caused by U. maydis. non-transgenic H99 ⁄ B73 BC1F4 control line were tested for their ability to secrete biologically active KP4 in a plate diffu- Results sion assay. The intact germinating seeds were used to determine if biologically active KP4 was secreted from this tissue. Expression of extracellular KP4 in transgenic maize Some of the seeds were cut to enhance the contact area To express KP4 in the extracellular space of transgenic maize, a between the seed and the agar. This may cause some tissue monocot codon-optimized gene containing the secretory signal damage that could release some KP4 from within the cell. peptide sequence of a plant defensin MsDef1 was placed However, it was thought that the larger contact surface might under the control of a constitutive maize Ubi1 promoter enhance the observed killing zone and that there was a lim- (Figure 1) and introduced into maize inbred H99 (Sidorov et al., ited amount of KP4 released from the damage. As shown in

2005). Forty-ﬁve R0 transgenic lines were generated. Nineteen Figure 2b, the intact germinating seed from the line 1040 of these lines contained the chimeric KP4 gene and expressed yielded a marked zone of inhibition indicating that antifungal high levels of protein as determined by sandwich ELISA. These KP4 protein was efﬁciently secreted. As expected, clear zone lines were backcrossed to maize inbred B73 once and subse- of inhibition was also observed around the cut germinating

quently selfed twice to generate BC0F3 plants. Ten transgenic seed of this line, but not around the wild-type BC1F4 seed. lines containing a single insert were selected for further analy- The germinating seed of line 851 produced less pronounced sis. Of the lines tested (Table 1), only line 826 did not express zone of inhibition than that of line 1040. As shown in KP4 protein as determined by ELISA. KP4 expression in homo- Table 1, this correlated well with the fact that line 1040 was zygous transgenic lines 1040, 851 and 746 was determined to slightly more resistant to U. maydis challenge than line 851. be 5.6, 6.6 and 5.8 ppm (fresh weight), respectively. As KP4 Perhaps transgenic maize line 1040 secretes KP4 better than contains ﬁve disulﬁde bonds, we next addressed the issue of line 851 even though the total KP4 expression level is essen- whether the protein was properly folded during export from tially the same for these two lines. This is rather speculative as the plant cells and biologically active. To that end, total leaf the killing zone assay is only a qualitative measure of KP4’s protein extracts of four transgenic lines 851, 746, 759 and 947 antifungal activity. were tested for antifungal activity against U. maydis in a plate Corn smut resistance analysis of transgenic maize lines diffusion assay. From the data presented in Figure 2, it was clear that these transgenic lines expressed high amounts of As transgenic maize lines secreted bioactive KP4 protein, the biologically active KP4. ability of this protein to protect transgenic lines from the corn

(a)

(b)

Figure 1 (a) For expression in transgenic maize, a chimeric KP4 gene was designed where the nucleotide sequence encoding the 105-amino acid KP4 was fused to the carboxyl terminus of the 27-amino acid signal peptide sequence of a plant defensin, MsDef1. (b) The monocot codon-optimized chimeric KP4 gene was synthesized (GenScript Corporation, Piscataway, NJ), placed under the control of the maize Ubi1 promoter ⁄ intron ⁄ tobacco etch virus mRNA leader sequence, and cloned into the plant expression vector pZP212 (Hajdukiewicz et al., 1994). The resulting construct was introduced into Agrobacterium tumefaciens strain EHA101 for maize transformation.

ª 2011 The Authors Plant Biotechnology Journal ª 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd, Plant Biotechnology Journal, 9, 857–864 Fungal resistant transgenic maize 859

Table 1 Disease symptoms caused by Ustilago maydis infection on KP4 transgenic maize

Disease score

Events (maize lines) # Plants total 012345Disease index

947* 53 49 4 0 0 0 0 0.08b 1040* 59 54 5 0 0 0 0 0.08b 972† 40 34 6 0 0 0 0 0.15b 885† 40 32 8 0 0 0 0 0.20b 851* 60 47 12 1 0 0 0 0.23b 810† 40 13 16 7 4 0 0 1.05ab 923† 40 15 12 8 5 0 0 1.08ab 746* 60 18 24 12 6 0 0 1.10ab 759† 58 9 20 19 7 3 0 1.57ab 826 40 2 5 3 12 17 1 3.00a a BC1F4 (wt) 60 2 11 10 22 13 2 2.65 Non-infected 947 18 15 3 0 0 0 0 0.17b Non-infected wt 20 18 2 0 0 0 0 0.10b

Results from three pathogenicity experiments using stem inoculations. The disease scores are as follows: 0 = no symptoms; 1 = anthocyanin and ⁄ or chlorosis; 2 = small leaf galls; 3 = small stem galls; 4 = basal stem galls; 5 = plant death. 851, 746, 759, 947, 1040, 810, 826, 885, 923, and 972 are 10 independently generated KP4 transgenic maize lines. BC1F4 (wt) is the wild-type (wt) maize line from which KP4 transgenic plants were generated. Symptoms were scored 10 dpi. Values with different superscripts in the disease index column are signiﬁcantly different (P £ 0.05) in Duncan’s multiple range test. The number of plants used differed because not all seeds germinated or (in the case of uninfected plants) so many replicates were not needed. *Lines that were homozygous at the time of testing. †Lines that were hemizygous at the time of testing.

(a) (b) (c)

Figure 2 (a) KP4 transgenic maize leaf material strongly inhibited growth of Ustilago maydis. KP4 killing activity is denoted by the clearing zone around the wells. Purified KP4 served as a positive control. As a negative control, the antifungal activity of a leaf extract from wild-type, BC1F4 is also shown. (b) KP4 killing activity of two representative lines of transgenic maize seeds. Here, the tops of the seeds were dissected and the flat face was placed on top of the agar. For controls, wild-type maize seeds BC1F4, purified KP4 and water are also shown. (c) KP4 killing activity of intact seeds from two representative lines of transgenic maize. Here, the tip caps of germinating seeds were place into the agar. smut disease was then determined (Figure 3). Ten transgenic delayed U. maydis infection, transgenic plants were scored for maize lines were tested against U. maydis infection in the disease symptoms at 21 dpi. Disease symptoms were absent at greenhouse. In general, all transgenic maize lines expressing 21 dpi in several transgenic maize lines, while the wild-type line

KP4 developed normally when compared to the nontransgenic BC1F4 exhibited plant death (Figure 3d). Five KP4 transgenic control line BC1F4 (Figure 3e,f). Seven-day-old seedlings were lines, 851, 947, 1040, 885 and 972, demonstrated strong resis- inoculated with a mixture of the wild-type U. maydis KP4-sensi- tance to U. maydis infection (Table 1). Four KP4 transgenic lines, tive strains 1 ⁄ 2 and 2 ⁄ 9 (Gold et al., 1997). These strains are 746, 759, 810, and 923, showed moderate resistance to this commonly used wild-type laboratory strains of U. maydis fungus. One KP4 transgenic line, 826, did not confer resistance (Brefort et al., 2009). Both strains, 1 ⁄ 2 (same as strain 521) to U. maydis infection. Transgenic maize plants were then trans- (Kronstad and Leong, 1989) and the near-isogenic strain 2 ⁄ 9 planted into large pots and compared with the wild-type plants (Gold et al., 1997) generated galls in nontransgenic maize plants. for any developmental defects. Three-month-old transgenic Disease symptoms were observed and scored at 10 days post- maize plants developed normally when compared with wild-type inoculation (dpi). To determine whether plants resisted or simply plants (Figure 3e,f). Secondary inoculation with 1 ⁄ 2 and 2 ⁄ 9

(a) (b) (c)

(d) (e) (f)

(g) (h) (i) (j)

Figure 3 KP4 transgenic plants resist Ustilago maydis infection. Wild-type maize plants (BC1F4) at 10 dpi show disease symptoms of (a) anthocyanin and chlorosis, (b) leaf galls and (c) basal galls. (d) Wild-type maize seedlings 21 days poststem inoculation results in death (white arrow 1), while the KP4 transgenic plants remain symptomless (line 947; white arrow 2). (e, f) Three-month-old transgenic maize plants (line 947) expressing KP4

protein have no observable developmental differences in comparison with the wild-type (BC1F4). (g, h) Maize ears prior to Ustilago maydis inoculation. (i) Galls appear 14 days postinoculation in the wild type (arrow 3), while the KP4 transgenic maize remain free of disease for the duration of the experiment (j).

strains directly into maize ears was done upon the appearance line 826 had a very low level of KP4 mRNA, while the more of silks (Figure 3g,h). Two weeks later, plant tumours or galls resistant lines 1040, 851 and 947 had high levels of transcript.

were observed in the ears of the wild-type line (BC1F4) and trans- Interestingly, homozygous line 746 showed the weakest resis- genic line 826 (Figure 3i), while the ears of the KP4 transgenic tance to fungal challenge and had 20-fold lower KP4 tran- lines 851, 746, 759, 947, 1040, 810, 885, 923 and 972 script level than the other three lines. remained healthy and disease free (Figure 3j). The protein expression levels of a number of individual transgenic maize plants was determined using ELISA assays and Correlation between expression levels and resistance compared with their respective disease scores. As shown in Corn smut resistance observed in various transgenic lines corre- Figure 5, there is excellent correlation between KP4 expression lated well with the expression of KP4. As shown in Table 1, and resistance to U. maydis infection. Importantly, these results lines 759, 810 and 923 that showed partial resistance to demonstrated that constitutively expressed KP4, throughout the U. maydis were hemizygous. In contrast, line 826 was com- maize plant, was capable of preventing infection in all organs pletely susceptible to infection. To ascertain whether this is while recent results suggest that naturally occurring immunity because of differences in the mRNA levels, quantitative RT-PCR to this disease is encoded by a number of genes in an organ- was performed on line 826 and homozygous lines 746, 1040, dependent manner (Baumgarten et al., 2007; Skibbe et al., 851 and 947 (Figure 4). From these studies, it is clear that the 2010).

759, 810 and 923 showed partial resistance to U. maydis infection with observed leaf, stem and basal galls. At 21 dpi, chlorosis and ⁄ or anthocyanin symptoms were reduced or completely absent in KP4 transgenic maize plants, while the wild-type

maize line (BC1F4) exhibited plant death. This suggests that plants resisted U. maydis infection and not simply delayed infection. ELISA and in vitro antifungal assays of the disease- susceptible line 826 showed absence of the KP4 protein. Surviv- ing KP4 transgenic maize plants were transplanted into large pots, and in the next 3 months, they developed normal ears and tassels similar in appearance to the wild-type plants. This suggests that initial inoculation of transgenic KP4 lines at the early life stage (7-day-old plantlets) did not affect development into mature plants. Upon the appearance of silks, mature KP4 transgenic plants were inoculated with the fungus directly into maize ears. Two weeks later, plant tumours or galls were Figure 4 Relative expression of the KP4 gene in homozygous transgenic observed in the ears of the wild-type maize line BC F and in maize lines (746, 1040, 851, 947) and wild-type BC F using real-time 1 4 1 4 826, while the ears of the remaining KP4 transgenic maize lines RT-PCR. The signal relative to the wild-type plants is shown as on a log (851, 746, 759, 947, 1040, 810, 885, 923, 972) were healthy scale along the Y-axis. Data presented are means from two experiments and largely disease free. This suggests that transgenic mature using the same biological sample with standard deviation shown as error bars. plants continued KP4 production, which enabled them to resist U. maydis infection. Interestingly, partially resistant KP4 lines did not develop ear galls, suggesting that KP4 production in this tissue was sufficient to protect transgenic plants from U. maydis infection. However, a few ears of the KP4 transgenic maize lines did show ear rot (data not shown), which may be caused by other invading pathogens. With regard to commercial application of this technology, there is growing evidence that these proteins are safe for human and animal consumption. As the KP4 protein inhibits U. maydis growth and also blocks L-type voltage-gated calcium channels (Gu et al., 1995), a major concern has been whether KP4 transgenic maize is safe for use by humans and animals, and whether it is safe for the environment. It has been shown that KP4 protein degrades in <60 s in artificial stomach fluid, and its amino acid sequence is not similar to any known aller- gens (Schlaich et al., 2006). In the same study, it was also shown that KP4 does not affect viability or subcellular structures of human, plant, insect and hamster cell lines. Various bacterial Figure 5 Correlation between KP4 expression levels and disease scores and fungal strains have been tested in vitro and none appeared from stem inoculated plants. Tissue samples from representative plants from the various lines were collected after disease scoring, and KP4 pro- to be susceptible to KP4 except for the specific genera of the tein levels were estimated using ELISA assays from leaf tissue collected order Ustilaginales causing smut and bunt (Schlaich et al., from 17-day-old seedlings, 10 days postinoculation. As shown here, 2006, 2007). Furthermore, KP4 transgenic wheat was shown to there is an excellent correlation between KP4 expression and disease not affect fungal soil communities, wheat-infesting insects, such resistance (correlation coefficient of 0.94 with a P test <0.0001). as aphids, and ‘standard’ soil arthropod Folsomia candida (Wid- mer, 2007). It can therefore be assumed that KP4 transgenic maize will not have any deleterious effects on humans, plants, Discussion insects, bacterial and fungal soil communities. Currently, we are considering several gene containment strategies. For example, In this work, we generated several transgenic maize lines as maize silk is the major route of U. maydis infection (Christen- expressing extracellular KP4. High level expression of KP4 was sen, 1963; Snetselaar et al., 2001), we propose to use a silk- obtained using the monocot codon-optimized mature KP4 pro- specific promoter, such as SLG promoter (Liu et al., 2008), to tein coding sequence. The chimeric KP4 gene also utilized a drive KP4 expression, thus addressing the food safety issue and secretory signal peptide sequence of a plant defensin gene for gene flow of transgenic plants. Another alternative would be to efficient secretion of the protein to the extracellular space. The generate maize plants expressing KP4 in the chloroplasts of resistance of 10 independent maize lines expressing KP4 was transgenic plants, which is a promising approach for transgene compared with that of the parental maize inbred line H99 ⁄ B73 containment.

(BC1F4). Pathogenicity assays showed strong resistance to In summary, our study shows that transformation of maize U. maydis infection in nine KP4 transgenic lines, but not in line with KP4 can generate constitutive antifungal activity against 826. Transgenic lines 851, 947, 1040, 885 and 972 showed corn smut in the whole plant. In theory, the eventual combina- robust resistance to this fungus (Table 1) with no observed galls tion of KP4 with the other Totivirus-encoded antifungal and little chlorosis and ⁄ or anthocyanin on the leaves. Lines 746, proteins, KP1 and KP6, should inhibit all strains of Ustilago.

In addition, KP4 also exhibits some antifungal activity against plants were grown under the standard greenhouse growth con- other maize fungi, Fusarium graminearum (Spelbrink et al., ditions used for maize. 2004), Fusarium verticillioides and Fusarium proliferatum ELISA assays (unpublished data). To this end, greenhouse and field trials are underway to determine the level of protection against these KP4 expression levels were determined using the sandwich pathogenic fungi in transgenic maize expressing KP4. This work ELISA method. Antibodies were raised against purified KP4 is aided by the fact that the atomic structure of KP4 is known, using the services at Sigma Genosys (The Woodlands, TX). The and the active site has been partially defined via mutagenesis antibodies were purified from antiserum using Protein G affinity (Gage et al., 2001). Therefore, this transgenic approach has chromatography, and this purified material was used for both great potential to improve maize resistance to a broad spectrum primary and secondary antibodies. The enzyme-linked secondary of fungal pathogens. As American farmers intend to plant 88.8 antibodies were prepared by conjugating horseradish peroxidase million acres of maize in 2010 [Prospective Plantings, Released (HRP) using the SureLINK HRP Conjugation kit (KPL Corporation, March 31, 2010, by the National Agricultural Statistics Service Gaithersburg, MD, catalogue #84-00-01). For the antigen cap- (NASS), Agricultural Statistics Board, United States Department ture layer, 100 lLofa10lg ⁄ mL solution of primary polyclonal of Agriculture (USDA)], the need for maximizing maize antibodies purified from KP4 rabbit antiserum was added to production increases owing to demand for more food, feed and each well and incubated for 2 h at room temperature or over- biofuels. Applying our novel control method could significantly night at 4 C. The plate was washed with phosphate-buffered reduce annual farm yield losses caused by corn smut and saline (PBS) containing 0.05% Tween 20 and blocked with 5%

potentially other fungi. milk prepared in 15 mM Na2CO3, NaHCO3, pH 9.6 for >2 h. Leaf extracts were made by homogenizing 50 mg of frozen tis- Experimental procedures sue in 1 mL 50 mM Tris ⁄ HCl, 150 mM NaCl, 1 mM EDTA, 1 mM phenylmethanesulfonyl fluoride (PMSF), 0.05% Tween-20, and Construction of KP4 expression vector 0.1% BSA, pH 7.4. Extracts were diluted 1 : 50 in the same buffer and loaded on the assay plate. A standard curve using As U. maydis is a biotrophic pathogen, it was thought necessary purified KP4 was added in triplicate. A 1 : 1000 dilution of sec- to target the expression of KP4 to the apoplast in transgenic ondary antibody of KP4 polyclonal antibodies conjugated to maize. To this end, the KP4 signal peptide sequence was HRP was used (SureLINK HRP Conjugation kit 84-00-01). The replaced with the 27-amino acid secretory signal peptide HRP substrate, 3,3¢,5,5¢-tetramethylbenzidine, was added, 1 N sequence of a plant defensin, MsDef1 (Figure 1a). This signal HCl used to stop the reaction and the plate was read on a peptide was previously shown to facilitate transport of proteins spectrophotometer (SpectraMax M2e; Molecular Devices Inc., to the apoplast in transgenic plants (Gao et al., 2000). To Sunnyvale, CA) at OD . obtain a high level expression of KP4 in all organs of transgenic 450 The ELISA was validated to ensure accuracy of expression maize, the 407-bp full-length chimeric KP4 gene was chemically level quantitation. Extraction efficiency was optimized by synthesized using the monocot-preferred codons and cloned as homogenizing leaf tissue by varying the tissue : buffer ratios a Nco I-Xba I fragment between the tobacco etch virus (TEV) and by testing different buffers and additives. Matrix effects mRNA leader sequence and CaMV 35S polyadenylation signal were accounted for by adding purified KP4 to control tissue in pRTL2 (a gift from Dr Tom Clemente, University of Nebraska). extract (non-transformed) and using these samples for the stan- The 5¢TEV mRNA leader ⁄ KP4 ⁄ cauliflower mosaic virus 35S dard curve. A spike and recovery experiment was performed polyA3¢ cassette was removed from pRTL2 on a 667-bp Xho I- where unhomogenized control tissue and buffer were spiked Pst I fragment. This restriction fragment and 1.9-kb Hind III-Sal I with purified protein, subjected to normal extraction rigours fragment containing the maize Ubi1 promoter were cloned into and analysed for protein recovery. the unique Hind III and Pst I sites of the vector pZP212 (Ha- jdukiewicz et al., 1994). Thus, the full-length chimeric KP4 cod- KP4 antifungal activity assay ing sequence was placed under the control of the maize Ubi1 Plant material was prepared for antifungal activity by grinding promoter ⁄ intron ⁄ TEV mRNA leader sequence and terminated 50 mg of fresh leaf material in 1 mL of PBS. As a positive con- by the cauliflower mosaic virus 35S 3¢ UTR (Figure 1b). The trol, a 20 lg ⁄ mL solution of purified KP4 was used. For the pZP212 vector containing this chimeric gene was transferred to agar-based killing zone assay, KP4-sensitive P2 cells were grown Agrobacterium tumefaciens strain EHA101 for transformation overnight in complete U. maydis media. P2 cells (1 mL culture of maize. per 100 mL agar) were added to warm complete U. maydis Maize transformation media containing 2% bacto agar and poured into 100 · 20 mm culture dishes. Once the agar solidified, wells Maize inbred line H99 was transformed using a previously were cut into the agar, and 20 lL of the test solutions was described protocol (Sidorov et al., 2005) except immature added to each well. The plates were then incubated at 30 C embryos were used as starting material in this case instead of for <36 h. KP4 activity presents a clear zone of growth inhibi- mature seeds. The primary transgenic maize plants containing tion around the point of application. the KP4 gene (R ) were identified by PCR and out-crossed to 0 As the well-documented defensin export signal (Terras et al., non-transgenic public inbred B73 to generate BC F seeds. 0 1 1995) was placed at the N-terminus of KP4, it was assumed Based on the Mendelian segregation of 1 : 1 indicative of a sin- that this antifungal protein was targeted to the apoplasm. To gle insert, the BC F plants were self-pollinated twice to gener- 0 1 test for this, germinating seeds were placed onto the P2 ate BC F lines. Homozygous lines were identified using the 0 3 containing agar plates as described earlier to detect secretion Invader Reagent kit (Third Wave Technologies, Madison, WI) of active KP4. For these experiments, maize kernels from and used subsequently for corn smut resistance evaluations. All

representative transgenic lines 851, 1040 and wild-type (BC1F3) measurement), and melting curve programme (60–95 C with were surface sterilized with 70% (v ⁄ v) ethanol for 1 min, fol- fluorescence read every 0.3 C). The threshold cycle (Ct) was lowed by washing in a sixfold diluted commercial hypochlorite calculated by the StepOne Plus software to indicate significant solution containing 0.1% (w ⁄ v) sodium dodecyl sulfate (SDS) for fluorescence signals rising above background during the early 10 min, and washed with autoclaved distilled water five times cycle of the exponential amplification phase of the PCR amplifi- for 5 min each. These kernels were dried before starting the cation process. The resulting data were analysed using relative experiment. Maize kernels were soaked in autoclaved distilled quantitation based on the DDCt (delta-delta-Ct) method. water overnight at RT. The next day, some of the kernels from each genotype were incised at the top using a sterile blade Acknowledgments (keeping the embryo intact) and other set was plated without incision. While the incision likely damaged some of the tissue, it This work was supported by the Monsanto Fund to T.J.S. and was hoped that it might improve the contact between the seeds D.S., start-up funding from the Danforth Plant Science Center and the agar. The plates were incubated in the dark at RT for to T.J.S, and by the USDA NRI grant 20033531913361 to 2 days before photographing. S.E.G. Plant infections and pathogenicity assays References Ustilago maydis KP4 sensitive wild-type strains 1 ⁄ 2 (mating type a1b1) and 2 ⁄ 9 (mating type a2b2, near isogenic to 1 ⁄ 2) were Allen, A., Snyder, A.K., Preuss, M., Nielsen, E.E., Shah, D.M. and Smith, T.J. 7 grown in potato dextrose broth to an OD600 of 1.0 (1 · 10 (2008) Plant defensins and virally encoded fungal toxin kp4 inhibit plant cells ⁄ mL). Cells were centrifuged and resuspended in water to root growth. Planta 227, 331–339. 1 · 106 cells ⁄ mL. These strains were mixed in equal amounts Baumgarten, A.M., Suresh, J., May, G. and Phillips, R.L. (2007) Mapping qtls immediately prior to inoculation. Maize plants were established contributing to Ustilago maydis resistance in specific plant tissues of maize. in a fine grade composted pine bark mixed with vermiculite in a Theor. Appl. Genet. 114, 1229–1238. Brefort, T., Doehlemann, G., Mendoza-Mendoza, A., Reissmann, S., Djamei, 3 : 1 ratio in 9-cm plastic pots under 16 h light at 28 C and A. and Kahmann, R. (2009) Ustilago maydis as a pathogen. Annu. Rev. 8 h dark at 20 C in a Conviron growth chamber. Using a Phytopathol. 47, 423–445. hypodermic needle and syringe, 3.0 mL of the cell suspension Bussey, H. (1972) Effects of yeast killer factor on sensitive cells. Nat. New was injected into the stems of 7-day-old maize plants. Initial dis- Biol. 235, 73–75. ease symptoms were observed 7–10 days postinoculation (dpi). Christensen, J.J. (1963) Corn Smut Caused by Ustilago maydis. St Paul, MN: Disease symptoms were recorded at 7, 10, 14 and 21 dpi using The American Phytopathological Society. the method of Gold et al., (Gold et al., 1997). Maize plants Clausen, M., Krauter, R., Schachermayr, G., Potrykus, I. and Sautter, C. were grown in 24-cm plastic pots and grown under the same (2000) Antifungal activity of a virally encoded gene in transgenic wheat. conditions as mentioned earlier for 80–90 days. Upon the Nat. Biotechnol. 18, 446–449. appearance of silks, maize ears were inoculated with 3.0 mL of Day, P.R. (1981) Fungal virus populations in corn smut from conneticut. Mycologia 73, 379–391. the fungal cell suspension. Ear symptoms were observed 14 dpi. Day, P.R. and Anagnostakis, S.L. (1973) The killer system in Ustilago maydis: All data were subjected to analysis of variance (ANOVA) and heterokaryon transfer and loss of determinants. Phytopathology 63, 1017– Duncan’s multiple range test via DSAASTAT statistical software, 1018. version 1.0192 (Onofri, 2006). Gage, M.J., Bruenn, J., Fischer, M., Sanders, D. and Smith, T.J. (2001) Kp4 RNA isolation and quantitative RT-PCR analysis fungal toxin inhibits growth in Ustilago maydis by blocking calcium uptake. Mol. Microbiol. 41, 775–785. Leaf tissue of 3-week-old homozygous transgenic maize lines Gage, M.J., Rane, S.G., Hockerman, G.H. and Smith, T.J. (2002) The virally encoded fungal toxin kp4 specifically blocks l-type voltage-gated calcium (746, 1040, 851 and 947) along with wild-type control BC1F4 was used for isolation of total RNA using Trizol reagent (Invitro- channels. Mol. Pharmacol. 61, 936–944. gen, Carlsbad, CA). RNA quantification was done using Nano- Ganesa, C., Chang, Y.-H., Flurkey, W.H. and Bozarth, R.F. (1989) Purification and molecular properties of the toxin coded by Ustilago maydis virus p4. drop 2000 spectrophotometer (Thermo Scientific, Waltham, Biochem. Biophys. Res. Commun. 162, 651–657. MA), and one microgram equivalent of total RNA was then Ganesa, C., Flurkey, W.H., Randhawa, Z.I. and Bozarth, R.F. (1991) Ustilago reverse transcribed using the Superscript III first-strand synthesis maydis virus p4 killer toxin: characterization, partial amino terminus system for RT-PCR (Invitrogen) following manufacturer’s instruc- sequence, and evidence for glycosylation. Arch. Biochem. Biophys. 286, tions. The resulting cDNA was diluted five times and amplified 195–200. using Promega GoTaq qPCR master mix (Promega Corpora- Gao, A., Hakimi, S.M., Mittanck, C.A., Wu, Y., Woerner, M.B., Stark, D.M., tion, Madison, WI) on the AB StepOne Plus-Real time PCR Shah, D.M., Liang, J. and Rommens, C.M.T. (2000) Fungal pathogen system (Applied Biosystems, Carlsbad, CA). Expression of maize protection in potato by expression of a plant defensin peptide. Nat. cytosolic glyceraldehyde-3-phosphate dehydrogenase 2 (GAPC2) Biotechnol. 18, 1307–1310. gene was used as an endogenous control for normalization of Gold, S.E., Brogdon, S.M., Mayroga, M.E. and Kronstad, J.W. (1997) The Ustilago maydis regulatory subunit of a camp-dependent protein kinase is the mRNA target. Primer pair sequences used for amplifying required for gall formation in maize. Plant Cell 9, 1585–1594. GAPC2 were forward, TCGGAATCAACGGTTTCGGAAGGA; Gu, F., Sullivan, T.S., Che, Z., Ganesa, C., Flurkey, W.H., Bozarth, R.F. and reverse, AGTTTGTGGTGCAGCTAGCATTGG and for KP4 for- Smith, T.J. (1994) The characterization and crystallization of a virally ward, TGCTTCCTGTTCCTCGTGCTCTT; reverse, TCAGCAGC encoded Ustilago maydis kp4 toxin. J. Mol. Biol. 243, 792–795. TGTTCACGTAGTTCAC. Real-time run protocol composed of ini- Gu, F., Khimani, A., Rane, S.G., Flurkey, W.H., Bozarth, R.F. and Smith, T.J. tial denaturation and polymerase activation (95 C for 5 min), (1995) Structure and function of a virally encoded fungal toxin from 40 cycles of amplification and quantification (95 C for 15 s, Ustilago maydis: a fungal and mammalian Ca2+ channel inhibitor. 60 C for 10 s, 72 C for 25 s with single fluorescence Structure 3, 805–814.

Hajdukiewicz, P., Svab, Z. and Maliga, P. (1994) The small, versatile pzp Perez-Martin, J., Talbot, N.J., Wendland, J. and Di Pietro, A. (2009) family of Agrobacterium binary vectors for plant transformation. Plant Mol. Comparative genomics of map kinase and calcium–calcineurin signalling Biol. 25, 989–994. components in plant and human pathogenic fungi. Fungal Genet. Biol. 46, Hankin, L. and Puhalla, J.E. (1971) Nature of a factor causing interstrain 287–298. lethality in Ustilago maydis. Phytopathology 61, 50–53. Schlaich, T., Urbaniak, B., Malgrass, N., Ehler, E., Birrer, C., Meier, L. and Kinal, H., Park, C.-M., Berry, J.O., Koltin, Y. and Bruenn, J.A. (1995) Sautter, C. (2006) Field resistance to tilletia caries provided by a specific Processing and secretion of a virally encoded antifungal toxin in transgenic antifungal virus gene in genetically engineered wheat. Plant Biotechnol. tobacco plants: evidence for a kex2p pathway in plants. Plant Cell 7, 677– J. 4, 63–75. 688. Schlaich, T., Urbaniak, B., Plissonnier, M.L., Malgras, N. and Sautter, C. Koltin, Y. (1988) The killer system of Ustilago maydis: secreted polypeptides (2007) Exploration and swiss field-testing of a viral gene for specific encoded by viruses. Viruses of Fungi and Simple Eukaryotes. New York: quantitative resistance against smuts and bunts in wheat. Adv. Biochem. Marcel Dekker. Eng. Biotechnol. 107, 97–112. Koltin, Y. and Day, P.R. (1975) Specificity of Ustilago maydis killer proteins. Sidorov, V., Gilbertson, L., Addae, P. and Duncan, D. (2005) Agrobacterium- Appl. Microbiol. 30, 694–696. mediated transformation of seedling-derived maize callus. Plant Cell Rep. Kronstad, J.W. and Leong, S.A. (1989) Isolation of two alleles of the b locus 25, 320–328. of Ustilago maydis. Proc. Natl Acad. Sci. USA 86, 978–982. Skibbe, D.S., Doehlemann, G., Fernandes, J. and Walbot, V. (2010) Maize Levine, R., Koltin, Y. and Kandel, J. (1979) Nuclease activity associated with tumors caused by Ustilago maydis require organ-specific genes in host and the Ustilago maydis virus induced killer proteins. Nucleic Acids Res. 6, pathogen. Science 328, 89–92. 3717–3732. Snetselaar, K.M., Carfioli, M.A. and Cordisco, K.M. (2001) Pollination can Liu, Z., Zhou, C. and Wu, K. (2008) Creation and analysis of a novel chimeric protect maize ovaries from infection by Ustilago maydis, the corn smut promoter for the complete containment of pollen- and seed-mediated fungus. Can. J. Bot. 79, 1390–1399. gene flow. Plant Cell Rep. 27, 995–1004. Spelbrink, R.G., Dilmac, N., Allen, A., Smith, T.J., Shah, D.M. and Onofri, A. (2006) Enhancing excel capability to perform statistical analyses in Hockerman, G.H. (2004) Differential antifungal and calcium channel- agriculture applied research. Computational Statistics and Data Analysis. blocking activity among structurally related plant defensins. Plant Physiol. Statistical Software Newsletters. Vooburg, The Netherlands: International 135, 2055–2067. Association for Statistical Computing. Terras, F.R., Eggermont, K., Kovaleva, V., Raikhel, N.V., Osborn, R.W., Kester, Park, C.M., Bruenn, J.A., Ganesa, C., Flurkey, W.F., Bozarth, R.F. and Koltin, A., Rees, S.B., Torrekens, S., Van Leuven, F., Vanderleyden, J., Cammue, Y. (1994) Structure and heterologous expression of Ustilago maydis viral B.P.A., Broekart, W.F. (1995) Small cysteine-rich antifungal proteins from toxin kp4. Mol. Microbiol. 11, 155–164. radish: their role in host defense. Plant Cell 7, 573–588. Pataky, J.K. and Snetselaar, K.M. (2006) Common smut of corn. The Plant Widmer, F. (2007) Assessing effects of transgenic crops on soil microbial Health Instructor doi:10.1094/PHI-I-2006-0927-01. communities. Adv. Biochem. Eng. Biotechnol. 107, 207–234. Rispail, N., Soanes, D.M., Ant, C., Czajkowski, R., Gru¨ nler, A., Huguet, R., Young, T. (1987) Killer yeasts. In The Yeasts, Vol. 2 (Rose, A.H. and Harrison, Perez-Nadales, E., Poli, A., Sartorel, E., Valiante, V., Yang, M., Beffa, R., J.S., eds), pp. 131–164. Orlando, FL: Academic Press. Brakhage, A.A., Gow, N.A.R., Kahmann, R., Lebrun, M.H., Lenasi, H.,

ª 2011 The Authors Plant Biotechnology Journal ª 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd, Plant Biotechnology Journal, 9, 857–864