DOCSLIB.ORG

Silencing Pinx1 Compromises Telomere Length Maintenance As Well As Tumorigenicity in Telomerase-Positive Human Cancer Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Silencing Pinx1 Compromises Telomere Length Maintenance As Well As Tumorigenicity in Telomerase-Positive Human Cancer Cells Research Article Silencing PinX1 Compromises Telomere Length Maintenance As Well As Tumorigenicity in Telomerase-Positive Human Cancer Cells Bin Zhang,1 Yun Xiu Bai,1 Hang Hang Ma,1 Feng Feng,2 Rui Jin,1 Zhi Long Wang,1 Jian Lin,1 Shi Peng Sun,1 Pingxun Yang,1 Xiao Xiong Wang,2 Pei Tang Huang,1 Cui Fen Huang,1 Ying Peng,3 Yang Chao Chen,4 Hsiang-fu Kung,4 and Jun Jian Huang1 1Laboratory of Tumor and Molecular Biology, Beijing Institute of Biotechnology, 2Department of Urology, General Hospital of People’s Liberation Army, Beijing, P.R. China; 3Department of Neurology, The Second Affiliated Hospital, Sun Yat-Sen University, Guangzhou, P.R. China; and 4Stanley Ho Center for Emerging Infectious Diseases, Li Ka-Shing Medical Institute, Faculty of Medicine, The Chinese University of Hong Kong, Hong Kong, P.R. China Abstract Telomerase is a ribonucleoprotein complex minimally composed The nucleolar protein PinX1 has been proposed to be a of a single-stranded RNA (hTR) and a catalytic protein subunit putative tumor suppressor due to its binding to and inhibition (hTERT), which reverse transcripts and adds a template region of of the catalytic activity of telomerase, an enzyme that is highly the hTR RNA onto chromosomal ends as the telomeric DNA expressed in most human cancers in which it counteracts sequences (5, 6). The hTERT expression is the rate-limiting step for telomere shortening–induced senescence to confer cancer cell cellular telomerase activity (6). Oncogenic proteins such as c-Myc immortalization. However, the role of PinX1 in telomere and SP1 have been identified as transcriptional activators of the hTERT regulation, as well as in cancer, is still poorly understood. In gene, whereas multiple tumor suppressors have also been hTERT this study, we showed that the PinX1 protein is constitutively found to suppress gene expression (7). Therefore, aberrant expressed in various human cells regardless of their telomer- hyperactivity of oncogenic transcription factors and loss of ase activity and malignant status. Most interestingly, we found function of tumor suppressors during carcinogenesis may account hTERT that silencing PinX1 expression by a potent short hairpin RNA for derepression and telomerase reactivation in various construct led to a robust telomere length shortening and cancer cells. growth inhibition in telomerase-positive but not in telomer- After gene expression, the hTERT protein is subjected to a highly ase-negative human cancer cells. We further showed that programmed subcellular transportation that has important impli- silencing PinX1 significantly reduced the endogenous associ- cations in directing the biogenesis of telomerase ribonucleoprotein ation of telomerase with the Pot1-containing telomeric (i.e., the combination of hTERT protein and hTR RNA) and the protein complex, and therefore, could account for the access of telomerase to telomeres to meet its default substrates phenotypic telomere shortening in the affected telomerase- (8–11). The mechanisms involved in these processes are still poorly positive cancer cells. Our results thus reveal a novel positive understood. Notably, a particular mechanism in regulating the role for PinX1 in telomerase/telomere regulations and suggest hTERT nucleolar translocation seems to be widely disturbed by that the constitutive expression of PinX1 attributes to human cellular transformation. It has been shown that the telomere maintenance by telomerase and tumorigenicity in expressed hTERT displays a predominant nucleolar localization cancer cells. [Cancer Res 2009;69(1):75–83] in normal cells but exhibits a nucleolar exclusion distribution in various types of cancer cells (12). We have recently shown that the nucleolar localization of hTERT is unrelated to its telomerase Introduction function in human cells (13). Whether and how the deregulation of Telomerase is a specialized reverse transcriptase used by most hTERT nucleolar localization confers advantages to cancer cell eukaryotes to synthesize the terminal (telomeric) DNA sequences growth is still elusive. of chromosomes to ensure complete genome replication during cell PinX1 is a nucleolar protein evolutionarily conserved from the division. In humans, telomerase expression is suppressed in most yeasts to the human being. Both the human and the yeast PinX1 somatic cells. These normal cells suffer from a progressive telomere have been experimentally shown to be able to bind to and suppress shortening in each round of cell division due to the end-replication telomerase enzymatic activity (14). The human PinX1 contains two problem of chromosomes and eventually fall into senescence when hTERT-binding sites separately enclosed within its extreme NH2- their telomeres shorten to critical points (1, 2). Bypassing this and COOH-terminal regions, with the COOH-terminal region being telomere length shortening–induced senescence is essential for characterized as the telomerase-inhibitory domain (TID; ref. 14). In human cancer formation and >85% of human cancer cells acquire their original report, Zhou and colleagues showed that ectopic this ability by reactivating telomerase (3, 4). overexpression of the PinX1 COOH-terminal TID fragment could block telomerase activity, shorten telomeres, and suppress tumor growth, whereas down-regulation of PinX1 expression via antisense Note: Supplementary data for this article are available at Cancer Research Online cDNA transfection could result in increased cellular telomerase (http://cancerres.aacrjournals.org/). Requests for reprints: Jun Jian Huang, Beijing Institute of Biotechnology, activity, increased telomere length, and enhanced tumorigenicity in 27 Taiping Road, Hai Dian District, Beijing, 100850 China. Phone: 86-10-6693-1323; the telomerase-positive HT1080 cancer cell line, thereby suggesting Fax: 86-10-6824-8045; E-mail: [email protected]. I2009 American Association for Cancer Research. PinX1 as an intrinsic telomerase/telomere inhibitor and a putative doi:10.1158/0008-5472.CAN-08-1393 tumor suppressor in human cells (14). www.aacrjournals.org 75 Cancer Res 2009; 69: (1). January 1, 2009 Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2009 American Association for Cancer Research. Cancer Research therapeutics in the two telomerase-positive HT1080 and HepG2 cancer cell lines but not in the telomerase-negative U2OS tumor cell line. We further provided evidence that depletion of PinX1 expression significantly reduced the endogenous association of telomerase with Pot1, a constitutive telomeric protein component that has important roles in regulating telomerase access to and in elongating telomeres (20–22). Our data thus clearly revealed a novel role for PinX1 in positively regulating telomerase-mediated telomere maintenance, possibly by facilitating the recruitment of telomerase function on telomeres in human cancer cells. Because depletion of PinX1 specifically impairs telomere maintenance by telomerase, our results also suggest that this PinX1-dependent telomere-maintaining pathway might represent a novel target for the antitelomerase cancer therapy that is currently being used by many studies (23–25). Materials andMethods Cell culture. All experimental cell lines used in this study were described in the text. Cells were cultured in DMEM (Invitrogen) supplemented with 10% FCS (HyClone) and penicillin/streptomycin, and maintained in an j incubator with 5% CO2 at 37 C. PinX1-expressing plasmids. PinX1 cDNA was obtained by reverse transcription-PCR from 293T cells total RNA. For Escherichia coli expression, the PinX1 cDNA was inserted into either the pGEX-4T-1 vector (expressed as the GST-PinX1 fusion protein; Invitrogen) or the pET28a vector (expressed as His-PinX1 fusion protein; Stratagen). For stable cell Figure 1. PinX1 protein expression in cultured human cell lines. expression, the fusion gene encoding Flag-PinX1 was cloned into the A A, characterization of the prepared anti-PinX1 IgGs. Cellular extracts (40 g) lentiviral vector pSL6 (26). The production of recombinant lentivirus and from either the vector or the Flag-PinX1 lentivirally infected HT1080 cells were subjected to SDS-PAGE. The transferred membrane was first detected their use in cell infection were performed according to ref. 26. with the F12 anti-Flag monoclonal antibody (sigma) and reprobed with the PinX1 shRNA. For constructing PinX1 shRNA, the two oligos, 5¶- anti-PinX1 antibodies, confirming the performance of the prepared antibodies GATCGGAGCTACCATCAATAATGAATATGTGTAATACGTCTTCATTATT- upon detection of the cellular expressed PinX1. B, Western blotting with GATGGTAGCTCCTTTTTT-3¶ and 5¶-AGCTAAAAAAGGAGCTACCATCAA- the prepared anti-PinX1 antibodies showed that the expression of endogenous ¶ PinX1 proteins was constitutively present, without obvious signs of TAATGAAGACGTATTACACATATTCATTATTGATGGTAGCTCC-3 ,were down-regulation, in all tested malignant cell lines as compared with the synthesized, annealed, and cloned into the vector pSilencerU6 (Ambion). normal BJ fibroblasts. h-Actin for loading control. The performance of this shRNA on specifically targeting the PinX1 sequence was confirmed by its cotransfection with plasmids in which cDNAs for PinX1 or other known telomerase/telomeric protein components were individually inserted downstream of the stop codon of GFP into 293T cells. Although with these facts, the roles of PinX1 in telomerase/ For stable expression, the U6 promoter-PinX1 shRNA–expressing cassette telomere regulations and in cancers still remains elusive. Analyzing was prepared
Load more

Recommended publications
  • Pinx1: Structure, Regulation and Its Functions in Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 40 Review PinX1: structure, regulation and its functions in cancer Hai-Long Li1,2,*, Jun Song3,4,*, Hong-Mei Yong5,*, Ping-Fu Hou1,3, Yan-Su Chen1,3, Wen-Bo Song1, Jin Bai1 and Jun-Nian Zheng1,3 1 Jiangsu Key Laboratory of Biological Cancer Therapy, Xuzhou Medical College, Xuzhou, Jiangsu, China 2 Department of Urology, The Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu, China 3 Jiangsu Center for the Collaboration and Innovation of Cancer Biotherapy, Cancer Institute, Xuzhou Medical College, Xuzhou, Jiangsu, China 4 Department of General Surgery, The Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu, China 5 Department of Medical Oncology, Huai’an Hospital to Xuzhou Medical College, Huai’an, Jiangsu, China * These authors have contributed equally to this study Correspondence to: Jun-Nian Zheng, email: [email protected] Correspondence to: Jin Bai, email: [email protected] Keywords: PinX1; cancer; structure; regulation; function Received: March 14, 2016 Accepted: August 09, 2016 Published: August 19, 2016 ABSTRACT PIN2/TRF1-interacting telomerase inhibitor 1 (PinX1) is a novel cloned gene located at human chromosome 8p23, playing a vital role in maintaining telomeres length and chromosome stability. It has been demonstrated to be involved in tumor genesis and progression in most malignancies. However, some researches showed opposing molecular status of PinX1 gene and its expression patterns in several other types of tumors. The pathogenic mechanism of PinX1 expression in human malignancy is not yet clear. Moreover, emerging evidence suggest that PinX1 (especially its TID domain) might be a potential new target cancer treatment.
    [Show full text]
  • Expression of MCRS1 and MCRS2 and Their Correlation with Serum Carcinoembryonic Antigen in Colorectal Cancer
    EXPERIMENTAL AND THERAPEUTIC MEDICINE 12: 589-596, 2016 Expression of MCRS1 and MCRS2 and their correlation with serum carcinoembryonic antigen in colorectal cancer CHENGUANG LI1,2, MINGXIAO CHEN1, PINGWEI ZHAO1, DESALEGN ADMASSU AYANA3, LEI WANG1 and YANFANG JIANG2 1Department of Colorectal and Anal Surgery, The First Hospital, Jilin University, Changchun, Jilin 130032; 2Key Laboratory of Zoonosis Research, Ministry of Education, The First Hospital, Jilin University, Changchun, Jilin 130032, P.R. China; 3Department of Medical Laboratory Sciences, Haramaya University, Dire Dawa 3000, Ethiopia Received June 30, 2015; Accepted March 3, 2016 DOI: 10.3892/etm.2016.3424 Abstract. Cancer-associated genes serve a crucial role in patients with CRC. The results suggest that increased MCRS1 carcinogenesis. The present study aimed to investigate the and decreased MCRS2 expression appeared to be involved mRNA expression levels of microspherule protein 1 (MCRS1) in the pathogenesis of CRC. The present study provides and MCRS2 in colorectal cancer (CRC) and their associa- evidence suggesting that MCRS1 and MCRS2 may identify tion with clinical variables. The mRNA expression levels of CRC patients at a risk of disease relapse, and thus, may be MCRS1 and MCRS2 were assessed by semi-quantitative potential tools for monitoring disease activity and act as novel reverse transcription polymerase chain reaction in the tumor diagnostic markers in the treatment of CRC. and corresponding non-tumor tissues of 54 newly-diagnosed CRC patients, as well as in the normal colonic mucosa tissue of Introduction 19 age/gender‑matched healthy controls. Immunofluorescence was also employed to identify the expression of MCRS1 in Colorectal cancer (CRC) is one of the most prevalent malig- CRC tissues, while the concentration of serum carcinoem- nant tumors, with high incidence rate and mortality.
    [Show full text]
  • DATASHEET USA: [email protected]
    DATASHEET USA: [email protected] FOR IN VITRO RESEARCH USE ONLY Europe: [email protected] NOT FOR USE IN HUMANS OR ANIMALS China: [email protected] MCRS1 Polyclonal Anbody Catalog number: 11362-1-AP Background Size: 45 μg/150 μl MCRS1, also named INO80Q, MSP58 or p78, is a nucleolar protein expressed in the Source: Rabbit very early S phase. It modulates the transcripon repressor acvity of DAXX by Isotype: IgG recruing it to the nucleolus. MCRS1 is also present on polyribosomes of Synonyms: synaptoneurosome as a novel RNA-binding protein to acvate the rRNA MCRS1; 58 kDa microspherule transcripon. The forkhead-associated domain of MCRS1 is involved in associaon protein, ICP22BP, INO80 with centrosomal protein Nde1, comprising a component of the centrosome and complex subunit J, INO80Q, taking an essenal role in viability. Its isoform MCRS2 might be a linker between MCRS1, MCRS2, microspherule telomere maintenance and cell-cycle regulaon by interacng with LPTS/PinX1, a protein 1, MSP58, P78 telomerase-inhibitory protein. MCRS1 is detected by Western blot as a highly modified protein at 78 kDa and minor bands at about 62 and 55 kDa. Applications Tested applicaons: ELISA, WB Cited applicaons: WB Species specificity: Human,Mouse,Rat; other species not tested. Cited species: Human, mouse HeLa cells were subjected to SDS Caculated MCRS1 MW: 51 kDa PAGE followed by western blot with 11362-1-AP(MCRS1 anbody) at Observed MCRS1 MW: 55 kDa diluon of 1:500 Posive WB detected in HeLa cells, human brain ssue, human liver ssue, human spleen ssue, Jurkat cells, mouse spleen ssue, mouse uterus ssue, rat spleen ssue Recommended diluon: WB: 1:500-1:5000 Applicaon key: WB = Western blong, IHC = Immunohistochemistry, IF = Immunofluorescence, IP = Immunoprecipitaon Immunogen information Immunogen: Ag1904 GenBank accession number: BC011794 Gene ID (NCBI): 10445 Full name: Microspherule protein 1 Product information Purificaon method: Angen affinity purificaon Storage: PBS with 0.1% sodium azide and 50% glycerol pH 7.3.
    [Show full text]
  • DNA Binding Features of Human POT1 a NONAMER 5Ј-TAGGGTTAG-3Ј MINIMAL BINDING SITE, SEQUENCE SPECIFICITY, and INTERNAL BINDING to MULTIMERIC SITES*
    THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 279, No. 13, Issue of March 26, pp. 13241–13248, 2004 © 2004 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. DNA Binding Features of Human POT1 A NONAMER 5Ј-TAGGGTTAG-3Ј MINIMAL BINDING SITE, SEQUENCE SPECIFICITY, AND INTERNAL BINDING TO MULTIMERIC SITES* Received for publication, November 10, 2003, and in revised form, January 7, 2004 Published, JBC Papers in Press, January 7, 2004, DOI 10.1074/jbc.M312309200 Diego Loayza‡§, Heather Parsons‡, Jill Donigian, Kristina Hoke¶, and Titia de Langeʈ From the Laboratory for Cell Biology and Genetics, The Rockefeller University, New York, New York 10021 The human telomeric protein POT1 is known to bind tankyrase 1 and 2, Tin2, PINX1, and POT1 are recruited to single-stranded telomeric DNA in vitro and to partici- telomeres by TRF1 (4). The TRF1 complex is involved in the pate in the regulation of telomere maintenance by te- regulation of telomere length by cis-inhibition of telomerase. In lomerase in vivo. We examined the in vitro DNA binding telomerase-positive cells, the overexpression of TRF1 leads to features of POT1. We report that deleting the oligosac- telomere shortening, and the expression of a dominant nega- charide/oligonucleotide-binding fold of POT1 abrogates tive form leads to telomere elongation (5). The relationship its DNA binding activity. The minimal binding site between TRF1 and telomerase regulation at the 3Ј telomere (MBS) for POT1 was found to be the telomeric nonamer terminus is poorly understood. ؅ ؅ 5 -TAGGGTTAG-3 , and the optimal substrate is The human single-stranded telomeric DNA-binding protein [TTAGGG]n (n > 2).
    [Show full text]
  • The Kinesin Spindle Protein Inhibitor Filanesib Enhances the Activity of Pomalidomide and Dexamethasone in Multiple Myeloma
    Plasma Cell Disorders SUPPLEMENTARY APPENDIX The kinesin spindle protein inhibitor filanesib enhances the activity of pomalidomide and dexamethasone in multiple myeloma Susana Hernández-García, 1 Laura San-Segundo, 1 Lorena González-Méndez, 1 Luis A. Corchete, 1 Irena Misiewicz- Krzeminska, 1,2 Montserrat Martín-Sánchez, 1 Ana-Alicia López-Iglesias, 1 Esperanza Macarena Algarín, 1 Pedro Mogollón, 1 Andrea Díaz-Tejedor, 1 Teresa Paíno, 1 Brian Tunquist, 3 María-Victoria Mateos, 1 Norma C Gutiérrez, 1 Elena Díaz- Rodriguez, 1 Mercedes Garayoa 1* and Enrique M Ocio 1* 1Centro Investigación del Cáncer-IBMCC (CSIC-USAL) and Hospital Universitario-IBSAL, Salamanca, Spain; 2National Medicines Insti - tute, Warsaw, Poland and 3Array BioPharma, Boulder, Colorado, USA *MG and EMO contributed equally to this work ©2017 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2017.168666 Received: March 13, 2017. Accepted: August 29, 2017. Pre-published: August 31, 2017. Correspondence: [email protected] MATERIAL AND METHODS Reagents and drugs. Filanesib (F) was provided by Array BioPharma Inc. (Boulder, CO, USA). Thalidomide (T), lenalidomide (L) and pomalidomide (P) were purchased from Selleckchem (Houston, TX, USA), dexamethasone (D) from Sigma-Aldrich (St Louis, MO, USA) and bortezomib from LC Laboratories (Woburn, MA, USA). Generic chemicals were acquired from Sigma Chemical Co., Roche Biochemicals (Mannheim, Germany), Merck & Co., Inc. (Darmstadt, Germany). MM cell lines, patient samples and cultures. Origin, authentication and in vitro growth conditions of human MM cell lines have already been characterized (17, 18). The study of drug activity in the presence of IL-6, IGF-1 or in co-culture with primary bone marrow mesenchymal stromal cells (BMSCs) or the human mesenchymal stromal cell line (hMSC–TERT) was performed as described previously (19, 20).
    [Show full text]
  • Association Between the PINX1 and NAT2 Polymorphisms and Serum Lipid Levels
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 69), pp: 114081-114094 Research Paper Association between the PINX1 and NAT2 polymorphisms and serum lipid levels Qing-Hui Zhang1, Rui-Xing Yin1, Feng Huang1, De-Zhai Yang2, Wei-Xiong Lin2 and Shang-Ling Pan3 1Department of Cardiology, Institute of Cardiovascular Diseases, The First Affiliated Hospital, Guangxi Medical University, Nanning 530021, Guangxi, People’s Republic of China 2Department of Molecular Genetics, Medical Scientific Research Center, Guangxi Medical University, Nanning 530021, Guangxi, People’s Republic of China 3Department of Pathophysiology, School of Premedical Sciences, Guangxi Medical University, Nanning 530021, Guangxi, People’s Republic of China Correspondence to: Rui-Xing Yin, email: [email protected] Keywords: the PIN2/TERF1-interacting telomerase inhibitor 1; the N-acetyltransferase 2; single nucleotide polymorphism; lipids; environmental factor Received: September 27, 2017 Accepted: November 29, 2017 Published: December 09, 2017 Copyright: Zhang et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Jing nationality is a relatively conservative and isolated minority in China. Little is known about the association of the PIN2/TERF1-interacting telomerase inhibitor 1 (PINX1) and N-acetyltransferase 2 (NAT2) single nucleotide polymorphisms (SNPs) and serum lipid levels in the Chinese populations. This study aimed to clarify the association of 6 SNPs of the PINX1 and NAT2 and serum lipid levels in two Chinese populations. Genotyping of the SNPs was performed in 1236 Han subjects and 1248 Jing participants.
    [Show full text]
  • Supplemental Table 1 Telomere Pathway Genes Evaluated in the Current Study
    Supplemental Table 1 Telomere pathway genes evaluated in the current study Gene (alias) Name Gene ID Chromosome Functions * ** Binding to the telomerase catalytic subunit hTERT, and inhibiting telomerase activity. Functions as a potent telomerase inhibitor and a PINX1 interacting protein 1 54984 8p23 putative tumor suppressor. Encoding a nuclear protein involved in the telomere maintenance system. Functions by regulating telomere length and protecting Protection of telomeres 1 chromosome ends from illegitimate recombination, catastrophic POT1 homolog 25913 7q31.33 chromosome instability, and abnormal chromosome segregation. Interacting with Rad6, an enzyme required for post-replication repair RAD18 RAD18 homolog 56852 3p25-p24 of damaged DNA, through a conserved ring-finger motif. As an RNA component of telomerase, it serves as a template for the TERC telomerase RNA component 7012 3q26 telomere repeat, and plays a role in maintaining telomere ends. telomeric repeat binding ^ Interacting with TERF2 at the telomere and causing elongation of TERF2IP (RAP1) factor 2, interacting protein 54386 16q23.1 telomeric DNA Encoding a protein component with reverse transcriptase activity, telomerase reverse and playing a role in cellular senescence by regulation of telomerase TERT transcriptase 7015 5p15.33 activity. tankyrase, TRF1-interacting ankyrin-related ADP-ribose With PARP activity, it can modify TERF1, and contribute to the TNKS polymerase 8658 8p23.1 regulation of telomere length. Encoding a telomere specific protein -- a component of the telomere telomeric repeat binding nucleoprotein complex, functions as an inhibitor of telomerase, TRF1 (TERF1) factor (NIMA-interacting) 1 7013 8q13.3 acting in cis to limit the elongation of individual chromosome ends. Encoding a component of the telomere nucleoprotein complex and telomeric repeat binding being a second negative regulator of telomere length, it plays a key TRF2 (TERF2) factor 2 7014 16q22.1 role in the protective activity of telomeres.
    [Show full text]
  • MCRS1 Associates with Cytoplasmic Dynein and Mediates
    www.nature.com/scientificreports OPEN MCRS1 associates with cytoplasmic dynein and mediates pericentrosomal material Received: 14 March 2016 Accepted: 13 May 2016 recruitment Published: 06 June 2016 Si-Hyung Lee1, Mi-Sun Lee2, Tae-Ik Choi2, Hyowon Hong1, Jun-Young Seo3, Cheol-Hee Kim2 & Joon Kim1 MCRS1 is involved in multiple cellular activities, including mitotic spindle assembly, mTOR signaling and tumorigenesis. Although MCRS1 has been reported to bind to the dynein regulator NDE1, a functional interaction between MCRS1 and cytoplasmic dynein remains unaddressed. Here, we demonstrate that MCRS1 is required for dynein-dependent cargo transport to the centrosome and also plays a role in primary cilium formation. MCRS1 localized to centriolar satellites. Knockdown of MCRS1 resulted in a dispersion of centriolar satellites whose establishment depends on cytoplasmic dynein. By contrast, NDE1 was not necessary for the proper distribution of centriolar satellites, indicating a functional distinction between MCRS1 and NDE1. Unlike NDE1, MCRS1 played a positive role for the initiation of ciliogenesis, possibly through its interaction with TTBK2. Zebrafish with homozygous mcrs1 mutants exhibited a reduction in the size of the brain and the eye due to excessive apoptosis. In addition, mcrs1 mutants failed to develop distinct layers in the retina, and showed a defect in melatonin-induced aggregation of melanosomes in melanophores. These phenotypes are reminiscent of zebrafish dynein mutants. Reduced ciliogenesis was also apparent in the olfactory placode ofmcrs1 mutants. Collectively, our findings identify MCRS1 as a dynein-interacting protein critical for centriolar satellite formation and ciliogenesis. Microspherule protein 1 (MCRS1) and its isoform 58-kDa microspherule protein (MSP58) are localized to electron dense bodies within the nucleoli, designated as microspherules1.
    [Show full text]
  • Loss of Heterozygosity and Histone Hypoacetylation of the PINX1 Gene Are Associated with Reduced Expression in Gastric Carcinoma
    Oncogene (2005) 24, 157–164 & 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc Loss of heterozygosity and histone hypoacetylation of the PINX1 gene are associated with reduced expression in gastric carcinoma Tomohiro Kondo1, Naohide Oue1, Yoshitsugu Mitani1, Hiroki Kuniyasu2, Tsuyoshi Noguchi3, Kazuya Kuraoka1, Hirofumi Nakayama1 and Wataru Yasui*,1 1Department of Molecular Pathology, Hiroshima University Graduate School of Biomedical Sciences, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8551, Japan; 2Department of Molecular Pathology, Nara Medical University, Kashihara, Japan; 3Department of Oncological Science (Surgery II), Oita University Faculty of Medicine, Oita, Japan The expression of PINX1, a possible telomerase inhibitor cloned previously (Liao et al., 2000). LPTS gene is and a putative tumor suppressor, has not been studied transcribed into two transcripts. The longer transcript, in human cancers, including gastric cancer (GC). We which is referred to as LPTS-L, encodes a 328-amino- examined expression of PINX1 by quantitative reverse acid protein (Liao et al., 2002) that is highly homo- transcription (RT)–PCR in 73 cases of GC, and 45 of logous to PinX1 (Zhou and Lu, 2001). LPTS-L and these cases were further studied for loss of heterozygosity PinX1 have different 30-untranslated regions but encode (LOH) by PCR with microsatellite marker D8S277. the same protein, which is referred to as LPTS-L/PinX1 Reduced expression (tumor vs normal ratioo0.5) of (Liao et al., 2003). LPTS-L/PinX1 has strong telomerase PINX1 was detected in 50 (68.5%) of 73 cases of GC. inhibitory activity both in vivo and in vitro (Zhou and GC tissues with reduced expression of PINX1 showed Lu, 2001; Liao et al., 2002).
    [Show full text]
  • Aberrant Telomere Structure Is Characteristic of Resistant Chronic Lymphocytic Leukaemia Cells
    Letters to the Editor 246 7 Life Sciences Division, Department of Statistics, University of 3 Michaud J, Simpson KM, Escher R, Buchet-Poyau K, Beissbarth T, California, Lawrence Berkeley National Laboratory, Carmichael C et al. Integrative analysis of RUNX1 downstream Berkeley, CA, USA and pathways and target genes. BMC Genomics 2008; 31: 363. 8Department of Pediatric Hemato-oncology, Radboud 4 Mikhail FM, Sinha KK, Saunthararajah Y, Nucifora G. Normal and University Nijmegen Medical Center, Nijmegen, transforming functions of RUNX1: a perspective. J Cell Physiol The Netherlands 2006; 207: 582–593. E-mails: [email protected] or 5 Renneville A, Roumier C, Biggio V, Nibourel O, Boissel N, [email protected] Fenaux P et al. Cooperating gene mutations in acute myeloid 9These authors contributed equally to this work. leukemia: a review of the literature. Leukemia 2008; 22: 915–931. 6 Ripperger T, Steinemann D, Go¨hring G, Finke J, Niemeyer CM, Strahm B et al. A novel pedigree with heterozygous germline RUNX1 mutation causing familial MDS-related AML: can these families serve as a multistep model for leukemic transformation? References Leukemia 2009; 23: 1364–1366. 7 Michaud J, Wu F, Osato M, Cottles GM, Yanagida M, Asou N et al. 1 Owen CJ, Toze CL, Koochin A, Forrest DL, Smith CA, Stevens JM In vitro analyses of known and novel RUNX1/AML1 mutations in et al. Five new pedigrees with inherited RUNX1 mutations causing dominant familial platelet disorder with predisposition to acute familial platelet disorder with propensity to myeloid malignancy. myelogenous leukemia: implications for mechanisms of pathogen- Blood 2008; 112: 4639–4645.
    [Show full text]
  • Telomerase Inhibitors from Natural Products and Their Anticancer Potential
    International Journal of Molecular Sciences Review Telomerase Inhibitors from Natural Products and Their Anticancer Potential Kumar Ganesan ID and Baojun Xu * ID Food Science and Technology Program, Beijing Normal University–Hong Kong Baptist University United International College, Zhuhai 519087, China; [email protected] * Correspondence: [email protected]; Tel.: +86-756-3620-636; Fax: +86-756-3620-882 Received: 23 November 2017; Accepted: 19 December 2017; Published: 21 December 2017 Abstract: Telomeres and telomerase are nowadays exploring traits on targets for anticancer therapy. Telomerase is a unique reverse transcriptase enzyme, considered as a primary factor in almost all cancer cells, which is mainly responsible to regulate the telomere length. Hence, telomerase ensures the indefinite cell proliferation during malignancy—a hallmark of cancer—and this distinctive feature has provided telomerase as the preferred target for drug development in cancer therapy. Deactivation of telomerase and telomere destabilization by natural products provides an opening to succeed new targets for cancer therapy. This review aims to provide a fundamental knowledge for research on telomere, working regulation of telomerase and its various binding proteins to inhibit the telomere/telomerase complex. In addition, the review summarizes the inhibitors of the enzyme catalytic subunit and RNA component, natural products that target telomeres, and suppression of transcriptional and post-transcriptional levels. This extensive understanding of telomerase biology will provide indispensable information for enhancing the efficiency of rational anti-cancer drug design. Keywords: telomere; telomerase inhibitors; natural products; anticancer 1. Introduction Telomerase was initially investigated in the transformed cervical carcinoma (HeLa) cell line in 1989 [1]. In eukaryotes, terminal bases of a linear DNA molecule cannot replicate by normal DNA polymerases and primases.
    [Show full text]
  • And Attenuates the Pinx1 Inhibition on Telomerase Activity
    www.nature.com/scientificreports OPEN Nucleophosmin Interacts with PIN2/TERF1-interacting Telomerase Inhibitor 1 (PinX1) and Received: 06 October 2016 Accepted: 27 January 2017 Attenuates the PinX1 Inhibition on Published: 03 March 2017 Telomerase Activity Derek Hang-Cheong Cheung1,*, Sai-Tim Ho1,*, Kwok-Fai Lau1, Rui Jin2, Ya-Nan Wang2, Hsiang-Fu Kung3, Jun-Jian Huang2 & Pang-Chui Shaw1 Telomerase activation and telomere maintenance are critical for cellular immortalization and transformation. PIN2/TERF1-interacting telomerase inhibitor 1 (PinX1) is a telomerase regulator and the aberrant expression of PinX1 causes telomere shortening. Identifying PinX1-interacting proteins is important for understanding telomere maintenance. We found that PinX1 directly interacts with nucleophosmin (NPM), a protein that has been shown to positively correlate with telomerase activity. We further showed that PinX1 acts as a linker in the association between NPM and hTERT, the catalytic subunit of telomerase. Additionally, the recruitment of NPM by PinX1 to the telomerase complex could partially attenuate the PinX1-mediated inhibition on telomerase activity. Taken together, our data reveal a novel mechanism that regulates telomerase activation through the interaction between NPM, PinX1 and the telomerase complex. Telomeres are G-rich non-coding tandem-repeated DNA sequences located at the ends of eukaryotic linear chro- mosomes that preserve the coding region and maintain chromosomal integrity. A human telomere consists of TTAGGG repeats extended in the 5′ to 3′ direction from double-stranded telomeric DNA to the single-stranded end of the telomere1,2. Telomeres are bound by the shelterin complex, which includes TRF1, TRF2, PotI, TPP1, TIN2 and RAP13–6, serving to protect and regulate the length of telomeres.
    [Show full text]