Research Article Silencing PinX1 Compromises Telomere Length Maintenance As Well As Tumorigenicity in Telomerase-Positive Human Cancer Cells Bin Zhang,1 Yun Xiu Bai,1 Hang Hang Ma,1 Feng Feng,2 Rui Jin,1 Zhi Long Wang,1 Jian Lin,1 Shi Peng Sun,1 Pingxun Yang,1 Xiao Xiong Wang,2 Pei Tang Huang,1 Cui Fen Huang,1 Ying Peng,3 Yang Chao Chen,4 Hsiang-fu Kung,4 and Jun Jian Huang1 1Laboratory of Tumor and Molecular Biology, Beijing Institute of Biotechnology, 2Department of Urology, General Hospital of People’s Liberation Army, Beijing, P.R. China; 3Department of Neurology, The Second Affiliated Hospital, Sun Yat-Sen University, Guangzhou, P.R. China; and 4Stanley Ho Center for Emerging Infectious Diseases, Li Ka-Shing Medical Institute, Faculty of Medicine, The Chinese University of Hong Kong, Hong Kong, P.R. China Abstract Telomerase is a ribonucleoprotein complex minimally composed The nucleolar protein PinX1 has been proposed to be a of a single-stranded RNA (hTR) and a catalytic protein subunit putative tumor suppressor due to its binding to and inhibition (hTERT), which reverse transcripts and adds a template region of of the catalytic activity of telomerase, an enzyme that is highly the hTR RNA onto chromosomal ends as the telomeric DNA expressed in most human cancers in which it counteracts sequences (5, 6). The hTERT expression is the rate-limiting step for telomere shortening–induced senescence to confer cancer cell cellular telomerase activity (6). Oncogenic proteins such as c-Myc immortalization. However, the role of PinX1 in telomere and SP1 have been identified as transcriptional activators of the hTERT regulation, as well as in cancer, is still poorly understood. In gene, whereas multiple tumor suppressors have also been hTERT this study, we showed that the PinX1 protein is constitutively found to suppress gene expression (7). Therefore, aberrant expressed in various human cells regardless of their telomer- hyperactivity of oncogenic transcription factors and loss of ase activity and malignant status. Most interestingly, we found function of tumor suppressors during carcinogenesis may account hTERT that silencing PinX1 expression by a potent short hairpin RNA for derepression and telomerase reactivation in various construct led to a robust telomere length shortening and cancer cells. growth inhibition in telomerase-positive but not in telomer- After gene expression, the hTERT protein is subjected to a highly ase-negative human cancer cells. We further showed that programmed subcellular transportation that has important impli- silencing PinX1 significantly reduced the endogenous associ- cations in directing the biogenesis of telomerase ribonucleoprotein ation of telomerase with the Pot1-containing telomeric (i.e., the combination of hTERT protein and hTR RNA) and the protein complex, and therefore, could account for the access of telomerase to telomeres to meet its default substrates phenotypic telomere shortening in the affected telomerase- (8–11). The mechanisms involved in these processes are still poorly positive cancer cells. Our results thus reveal a novel positive understood. Notably, a particular mechanism in regulating the role for PinX1 in telomerase/telomere regulations and suggest hTERT nucleolar translocation seems to be widely disturbed by that the constitutive expression of PinX1 attributes to human cellular transformation. It has been shown that the telomere maintenance by telomerase and tumorigenicity in expressed hTERT displays a predominant nucleolar localization cancer cells. [Cancer Res 2009;69(1):75–83] in normal cells but exhibits a nucleolar exclusion distribution in various types of cancer cells (12). We have recently shown that the nucleolar localization of hTERT is unrelated to its telomerase Introduction function in human cells (13). Whether and how the deregulation of Telomerase is a specialized reverse transcriptase used by most hTERT nucleolar localization confers advantages to cancer cell eukaryotes to synthesize the terminal (telomeric) DNA sequences growth is still elusive. of chromosomes to ensure complete genome replication during cell PinX1 is a nucleolar protein evolutionarily conserved from the division. In humans, telomerase expression is suppressed in most yeasts to the human being. Both the human and the yeast PinX1 somatic cells. These normal cells suffer from a progressive telomere have been experimentally shown to be able to bind to and suppress shortening in each round of cell division due to the end-replication telomerase enzymatic activity (14). The human PinX1 contains two problem of chromosomes and eventually fall into senescence when hTERT-binding sites separately enclosed within its extreme NH2- their telomeres shorten to critical points (1, 2). Bypassing this and COOH-terminal regions, with the COOH-terminal region being telomere length shortening–induced senescence is essential for characterized as the telomerase-inhibitory domain (TID; ref. 14). In human cancer formation and >85% of human cancer cells acquire their original report, Zhou and colleagues showed that ectopic this ability by reactivating telomerase (3, 4). overexpression of the PinX1 COOH-terminal TID fragment could block telomerase activity, shorten telomeres, and suppress tumor growth, whereas down-regulation of PinX1 expression via antisense Note: Supplementary data for this article are available at Cancer Research Online cDNA transfection could result in increased cellular telomerase (http://cancerres.aacrjournals.org/). Requests for reprints: Jun Jian Huang, Beijing Institute of Biotechnology, activity, increased telomere length, and enhanced tumorigenicity in 27 Taiping Road, Hai Dian District, Beijing, 100850 China. Phone: 86-10-6693-1323; the telomerase-positive HT1080 cancer cell line, thereby suggesting Fax: 86-10-6824-8045; E-mail: [email protected]. I2009 American Association for Cancer Research. PinX1 as an intrinsic telomerase/telomere inhibitor and a putative doi:10.1158/0008-5472.CAN-08-1393 tumor suppressor in human cells (14). www.aacrjournals.org 75 Cancer Res 2009; 69: (1). January 1, 2009 Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2009 American Association for Cancer Research. Cancer Research therapeutics in the two telomerase-positive HT1080 and HepG2 cancer cell lines but not in the telomerase-negative U2OS tumor cell line. We further provided evidence that depletion of PinX1 expression significantly reduced the endogenous association of telomerase with Pot1, a constitutive telomeric protein component that has important roles in regulating telomerase access to and in elongating telomeres (20–22). Our data thus clearly revealed a novel role for PinX1 in positively regulating telomerase-mediated telomere maintenance, possibly by facilitating the recruitment of telomerase function on telomeres in human cancer cells. Because depletion of PinX1 specifically impairs telomere maintenance by telomerase, our results also suggest that this PinX1-dependent telomere-maintaining pathway might represent a novel target for the antitelomerase cancer therapy that is currently being used by many studies (23–25). Materials andMethods Cell culture. All experimental cell lines used in this study were described in the text. Cells were cultured in DMEM (Invitrogen) supplemented with 10% FCS (HyClone) and penicillin/streptomycin, and maintained in an j incubator with 5% CO2 at 37 C. PinX1-expressing plasmids. PinX1 cDNA was obtained by reverse transcription-PCR from 293T cells total RNA. For Escherichia coli expression, the PinX1 cDNA was inserted into either the pGEX-4T-1 vector (expressed as the GST-PinX1 fusion protein; Invitrogen) or the pET28a vector (expressed as His-PinX1 fusion protein; Stratagen). For stable cell Figure 1. PinX1 protein expression in cultured human cell lines. expression, the fusion gene encoding Flag-PinX1 was cloned into the A A, characterization of the prepared anti-PinX1 IgGs. Cellular extracts (40 g) lentiviral vector pSL6 (26). The production of recombinant lentivirus and from either the vector or the Flag-PinX1 lentivirally infected HT1080 cells were subjected to SDS-PAGE. The transferred membrane was first detected their use in cell infection were performed according to ref. 26. with the F12 anti-Flag monoclonal antibody (sigma) and reprobed with the PinX1 shRNA. For constructing PinX1 shRNA, the two oligos, 5¶- anti-PinX1 antibodies, confirming the performance of the prepared antibodies GATCGGAGCTACCATCAATAATGAATATGTGTAATACGTCTTCATTATT- upon detection of the cellular expressed PinX1. B, Western blotting with GATGGTAGCTCCTTTTTT-3¶ and 5¶-AGCTAAAAAAGGAGCTACCATCAA- the prepared anti-PinX1 antibodies showed that the expression of endogenous ¶ PinX1 proteins was constitutively present, without obvious signs of TAATGAAGACGTATTACACATATTCATTATTGATGGTAGCTCC-3 ,were down-regulation, in all tested malignant cell lines as compared with the synthesized, annealed, and cloned into the vector pSilencerU6 (Ambion). normal BJ fibroblasts. h-Actin for loading control. The performance of this shRNA on specifically targeting the PinX1 sequence was confirmed by its cotransfection with plasmids in which cDNAs for PinX1 or other known telomerase/telomeric protein components were individually inserted downstream of the stop codon of GFP into 293T cells. Although with these facts, the roles of PinX1 in telomerase/ For stable expression, the U6 promoter-PinX1 shRNA–expressing cassette telomere regulations and in cancers still remains elusive. Analyzing was prepared