DOCSLIB.ORG

Myd88-Dependent Pathway Lipopolysaccharide Activation Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Myd88-Dependent Pathway Lipopolysaccharide Activation Of Unique Properties of the Chicken TLR4/MD-2 Complex: Selective Lipopolysaccharide Activation of the MyD88-Dependent Pathway This information is current as of September 28, 2021. A. Marijke Keestra and Jos P. M. van Putten J Immunol 2008; 181:4354-4362; ; doi: 10.4049/jimmunol.181.6.4354 http://www.jimmunol.org/content/181/6/4354 Downloaded from References This article cites 65 articles, 26 of which you can access for free at: http://www.jimmunol.org/content/181/6/4354.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Unique Properties of the Chicken TLR4/MD-2 Complex: Selective Lipopolysaccharide Activation of the MyD88-Dependent Pathway1 A. Marijke Keestra and Jos P. M. van Putten2 During evolution, mammals have evolved a powerful innate immune response to LPS. Chickens are much more resistant to LPS-induced septic shock. Herein we report that chickens sense LPS via orthologs of mammalian TLR4 and myeloid differen- tiation protein-2 (MD-2) rather than the previously implicated chicken TLR2 isoform type 2 (chTLR2t2) receptor. Cloning and expression of recombinant chTLR4 and chMD-2 in HeLa 57A cells activated NF-␬B at concentrations of LPS as low as 100 pg/ml. Differential pairing of chicken and mammalian TLR4 and MD-2 indicated that the protein interaction was species-specific in contrast to the formation of functional human and murine chimeric complexes. The chicken LPS receptor responded to a wide Downloaded from variety of LPS derivatives and to the synthetic lipid A compounds 406 and 506. The LPS specificity resembled the functionality of the murine rather than the human TLR4/MD-2 complex. Polymorphism in chTLR4 (Tyr383His and Gln611Arg) did not influ- ence the LPS response. Interestingly, LPS consistently failed to activate the MyD88-independent induction of IFN-␤ in chicken cells, in contrast to the TLR3 agonist poly(I:C) that yielded a potent IFN-␤ response. These results suggest that chicken lack a functional LPS-specific TRAM-TRIF (TRIF-related adapter molecule/TIR-domain-containing adapter-inducing IFN-␤) signaling pathway, which may explain their aberrant response to LPS compared with the mammalian species. The Journal of Immunology, http://www.jimmunol.org/ 2008, 181: 4354–4362. oll-like receptors are components of the innate immune from the resistance to LPS of MD-2 null mice (5) and C3H/HeJ system that sense conserved microbial patterns and en- mice, which carry a point mutation in TLR4 (6). T dogenous danger signals (1). One of the molecules that is TLR4 is unique among the TLR family in that upon activation sensed by TLRs is the lipid backbone (lipid A) of the principal it recruits several different adaptor molecules including MyD88 bacterial surface glycolipid, known as LPS. In mammals the sens- and TIR-domain containing adapter protein (TIRAP) (MyD88-de- ing of LPS involves the LPS-binding protein (LBP)3-mediated pendent pathway) and TRIF-related adapter molecule (TRAM) transfer of LPS monomers to CD14, which commonly delivers the and TIR-domain-containing adapter-inducing IFN-␤ (TRIF) by guest on September 28, 2021 LPS to myeloid differentiation protein-2 (MD-2) (2). MD-2 binds (MyD88-independent pathway). All other TLRs, except TLR3, LPS in its hydrophobic pocket, which supposedly causes a con- solely activate the MyD88-dependent signaling route. TLR3 spe- formational change that is transferred upon the complexed TLR4 cifically makes use of the TRIF-signaling pathway but without the molecule (3, 4). This triggers the recruitment and modification of use of TRAM. The combined use of TRIF and TRAM is specific intracellular adaptor molecules at the Toll/IL-1R (TIR) domain of for the TLR4 signaling pathway (7). The type of signaling route the TLR4 receptor and initiates a cascade of signaling events that that is activated by TLRs is important for the nature of the innate ultimately drive the innate immune response to LPS. The central immune response. The TIRAP/MyD88 signaling pathway is acti- role of TLR4 and MD-2 in the mammalian LPS response is evident vated from the plasma membrane and causes nuclear translocation of the transcription factor NF-␬B, whereas the TRAM/TRIF-de- pendent pathway appears to be active in endosomes and induces the phosphorylation of IFN regulatory factor 3 (IRF3) and a de- Department of Infectious Diseases and Immunology, Utrecht University, Utrecht, The layed NF-␬B response (7–10). Activation of IRF3 ultimately re- Netherlands sults in the production of IFN-␤, IP-10, and RANTES (2). This Received for publication April 21, 2008. Accepted for publication July 15, 2008. response is not observed in TRIFϪ/Ϫ and TRAMϪ/Ϫ mice (7, 10). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance TLR4 and MD-2 are highly conserved during evolution with with 18 U.S.C. Section 1734 solely to indicate this fact. orthologs found in mammals, birds, and some fish species (11, 12). 1 This work was supported in part by grants of the Netherlands Organization for However, the avian species and fish appear much more resistant to Health Research and Development (grant numbers Zon-MW 912-03-007 and the toxic effects of LPS than do the mammalian species (13–15). Zon-MW 9120.6150). Analysis of the TLR repertoire of chicken indicates both common 2 Address correspondence and reprint requests to Dr. Jos P. M. van Putten, Depart- ment of Infectious Diseases and Immunology, Utrecht University, Yalelaan 1, 3584 and unique features compared with mammalian TLRs (16–26). CL Utrecht, The Netherlands. E-mail address: [email protected] Chickens express TLR4 and MD-2 orthologs, and polymorphisms 3 Abbreviations used in this paper: LBP, LPS-binding protein; chTLR2t2, chicken in the proteins have been associated with variable susceptibility to TLR2 isoform type 2; IRF3, IFN regulatory factor 3; MD-2, myeloid differenti- Salmonella infection (27, 28). Furthermore, chicken cells respond ation protein-2; MPL, monophosphoryl lipid A; SE, S. Enteritidis; S. Enteritidis, ␤ Salmonella enterica serovar Enteritidis; SG, S. Gallinarum; S. Gallinarum, Sal- to LPS with the induction of inducible NO synthase, IL-1 , IL-6, monella enterica serovar Gallinarum strain 9R; TIR, Toll/IL-1R; TIRAP, TIR- and IL-18 mRNA (29–31). Involvement of TLR4 and CD14 was domain containing adapter protein; TRAM, TRIF-related adapter molecule; TRIF, suggested by the effects of polyclonal Abs directed against human TIR-domain-containing adapter-inducing IFN-␤. TLR4 and rat CD14 (29, 30, 32). However, Fukui et al. (17) noted Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 that recombinant chicken TLR2 isoform type 2 (chTLR2t2) can www.jimmunol.org The Journal of Immunology 4355 Table I. Primers used in this study for cloninga Product Forward (5Ј to 3Ј) Reverse (5Ј to 3Ј) chTLR4 GCGGCCGCGCCACATGGCCAGCAGAGCGGCTCCCACC TCTAGATTACATGAGTTTTATCTCCTCGT Exon 1 GCGGCCGCGCCACATGGCCAGCAGAGCGGCTCCCACC AGGGGATGACCTCCAGGCACGGACTGGGGATGC Exon 2 TGCCTGGAGGTCATCCCCAGCACAGCTTTCAGAT GTGGCACCTTGAAAGATCCAGAAACTGCAGTTC Exon 3 TGGATCTTTCAAGGTGCCACATCCATACAATAGAAG TCTAGATTACATGAGTTTTATCTCCTCGT chMD-2 GGTACCGCCACCATGGTTGAGTTTGTCTTTTTC GAATTCTCAGAAAGCGTCTTGTTT mTLR4 GGTACCGCCACCATGGTGCCTCCCTGGCTCCTGGCTA GCGGCCGCTCAGGTCCAAGTTGCCGTTTCTTG mCD14 GAATTCGCCACCATGGAGCGTGTGCTT TCTAGATTAAACAAAGAGGCGATC a The underlined sequences represent restriction sites used in cloning of the PCR products. respond to LPS and hypothesized that this receptor covers the amplification of cDNA was performed using pfu polymerase (Promega) function of TLR4 in chicken. We recently demonstrated that and the primers listed in Table I. PCR products were purified and cloned chTLR2t2 in conjunction with chTLR16 responds to both di- and into the pGEM-T Easy vector (Promega). The resulting plasmids were digested with the appropriate restriction enzymes (Table I), and isolated triacylated peptides combining the function of the mammalian inserts were ligated in the digested mammalian expression vector pTracer- TLR2/1 and TLR2/6 receptor complexes (22). Thus, the exact na- CMV2 (Invitrogen), yielding pTracer-chTLR4 and pTracer-chMD-2. ture of the LPS receptor(s) and the basis of the apparent relative The gene encoding chMD-2 of HD11 cells was cloned essentially as Downloaded from resistance of chickens toward the toxic effect of LPS remain to be described above, yielding pTracer-chMD-2H. The gene encoding chTLR4 of HD11 cells was constructed by overlap extension PCR (36) using iso- defined. lated chromosomal DNA as a template. In this procedure the three exons In the present study, we cloned the full-length chicken TLR4 from chtlr4 were PCR amplified with pfu polymerase using the primers and chicken MD-2 gene and assessed the function of the chTLR4/ listed in Table I. The resulting three PCR products were purified and fused chMD-2 complex, the species specificity of the interaction of in one PCR reaction using the chTLR4 forward and reverse primers (Table I). This PCR product was cloned into the pGEM-T Easy vector and was TLR4 and MD-2 using coexpression of the different mammalian http://www.jimmunol.org/ subsequently cloned into pTracer-CMV2, yielding pTracer-chTLR4H. and chicken proteins, and the LPS specificity of the chTLR4/ Murine TLR4 (mTLR4) and CD14 (mCD14) were PCR amplified with chMD-2 complex.
Load more

Recommended publications
  • TLR3-Dependent Activation of TLR2 Endogenous Ligands Via the Myd88 Signaling Pathway Augments the Innate Immune Response
    cells Article TLR3-Dependent Activation of TLR2 Endogenous Ligands via the MyD88 Signaling Pathway Augments the Innate Immune Response 1 2, 1 3 Hellen S. Teixeira , Jiawei Zhao y, Ethan Kazmierski , Denis F. Kinane and Manjunatha R. Benakanakere 2,* 1 Department of Orthodontics, School of Dental Medicine, University of Pennsylvania, Philadelphia, PA 19004, USA; [email protected] (H.S.T.); [email protected] (E.K.) 2 Department of Periodontics, School of Dental Medicine, University of Pennsylvania, Philadelphia, PA 19004, USA; [email protected] 3 Periodontology Department, Bern Dental School, University of Bern, 3012 Bern, Switzerland; [email protected] * Correspondence: [email protected] Present address: Department of Pathology, Wayne State University School of Medicine, y 541 East Canfield Ave., Scott Hall 9215, Detroit, MI 48201, USA. Received: 30 June 2020; Accepted: 12 August 2020; Published: 17 August 2020 Abstract: The role of the adaptor molecule MyD88 is thought to be independent of Toll-like receptor 3 (TLR3) signaling. In this report, we demonstrate a previously unknown role of MyD88 in TLR3 signaling in inducing endogenous ligands of TLR2 to elicit innate immune responses. Of the various TLR ligands examined, the TLR3-specific ligand polyinosinic:polycytidylic acid (poly I:C), significantly induced TNF production and the upregulation of other TLR transcripts, in particular, TLR2. Accordingly, TLR3 stimulation also led to a significant upregulation of endogenous TLR2 ligands mainly, HMGB1 and Hsp60. By contrast, the silencing of TLR3 significantly downregulated MyD88 and TLR2 gene expression and pro-inflammatory IL1β, TNF, and IL8 secretion. The silencing of MyD88 similarly led to the downregulation of TLR2, IL1β, TNF and IL8, thus suggesting MyD88 / to somehow act downstream of TLR3.
    [Show full text]
  • MYD88 L265P Is a Marker Highly Characteristic Of, but Not Restricted To, Waldenstro¨M’S Macroglobulinemia
    Leukemia (2013) 27, 1722–1728 & 2013 Macmillan Publishers Limited All rights reserved 0887-6924/13 www.nature.com/leu ORIGINAL ARTICLE MYD88 L265P is a marker highly characteristic of, but not restricted to, Waldenstro¨m’s macroglobulinemia C Jime´ nez1, E Sebastia´n1, MC Chillo´n1,2, P Giraldo3, J Mariano Herna´ndez4, F Escalante5, TJ Gonza´lez-Lo´ pez6, C Aguilera7, AG de Coca8, I Murillo3, M Alcoceba1, A Balanzategui1, ME Sarasquete1,2, R Corral1, LA Marı´n1, B Paiva1,2, EM Ocio1,2, NC Gutie´ rrez1,2, M Gonza´lez1,2, JF San Miguel1,2 and R Garcı´a-Sanz1,2 We evaluated the MYD88 L265P mutation in Waldenstro¨m’s macroglobulinemia (WM) and B-cell lymphoproliferative disorders by specific polymerase chain reaction (PCR) (sensitivity B10 À 3). No mutation was seen in normal donors, while it was present in 101/117 (86%) WM patients, 27/31 (87%) IgM monoclonal gammapathies of uncertain significance (MGUS), 3/14 (21%) splenic marginal zone lymphomas and 9/48 (19%) non-germinal center (GC) diffuse large B-cell lymphomas (DLBCLs). The mutation was absent in all 28 GC-DLBCLs, 13 DLBCLs not subclassified, 35 hairy cell leukemias, 39 chronic lymphocyticleukemias(16withM-component), 25 IgA or IgG-MGUS, 24 multiple myeloma (3 with an IgM isotype), 6 amyloidosis, 9 lymphoplasmacytic lymphomas and 1 IgM-related neuropathy. Among WM and IgM- MGUS, MYD88 L265P mutation was associated with some differences in clinical and biological characteristics, although usually minor; wild-type MYD88 cases had smaller M-component (1.77 vs 2.72 g/dl, P ¼ 0.022), more lymphocytosis (24 vs 5%, P ¼ 0.006), higher lactate dehydrogenase level (371 vs 265 UI/L, P ¼ 0.002), atypical immunophenotype (CD23 À CD27 þþFMC7 þþ), less Immunoglobulin Heavy Chain Variable gene (IGHV) somatic hypermutation (57 vs 97%, P ¼ 0.012) and less IGHV3–23 gene selection (9 vs 27%, P ¼ 0.014).
    [Show full text]
  • MYD88 and Beyond: Novel Opportunities for Diagnosis, Prognosis and Treatment in Waldenstro¨M’S Macroglobulinemia
    Leukemia (2014) 28, 1799–1803 & 2014 Macmillan Publishers Limited All rights reserved 0887-6924/14 www.nature.com/leu CONCISE REVIEW MYD88 and beyond: novel opportunities for diagnosis, prognosis and treatment in Waldenstro¨m’s Macroglobulinemia O Landgren and N Tageja Waldenstro¨m’s Macroglobulinemia (WM) is a rare disease of the elderly with a median age of 63–68 years at diagnosis. Despite recent progress in biological insights and therapeutics, WM remains clinically challenging to diagnose and is difficult to manage with significant morbidity and lack of established curative therapies. Recently, the use of whole-genome sequencing has helped to identify a highly recurrent somatic mutation, myeloid differentiation factor 88 [MYD88] L265P in WM. This has fueled major interest in the field and as newer evidence accumulates, it is clear that that discovery of MYD88 L265P mutation may represent an important breakthrough in understanding the pathogenesis of WM and lymphoproliferative disorders. Recent scientific work in this field has also guided the identification of new targets such as CXCR4 and PI3K-delta that may have major implications in the future treatment of WM. This review discusses the role of MYD88 L265P mutations as well as targets beyond MYD88 in the setting of pathogenesis and development of future rational therapeutic trials focusing on patients diagnosed with WM. Leukemia (2014) 28, 1799–1803; doi:10.1038/leu.2014.88 INTRODUCTION transduces signals to the NF-kB transcription factors in response to Waldenstro¨m’s Macroglobulinemia (WM) is a rare hematological IL-1R1 signaling. MYD88 has a modular structure with a Toll/IL-1R malignancy with a reported age-adjusted incidence rate of 3.4 per (TIR) domain at its COOH terminus and a death domain at its 12 11 million among men and 1.7 per million among women in the NH2 terminus.
    [Show full text]
  • And Sepsis-Induced Lung Inflammation and Mediates Myd88
    The Journal of Immunology Caveolin-1 Tyr14 Phosphorylation Induces Interaction with TLR4 in Endothelial Cells and Mediates MyD88-Dependent Signaling and Sepsis-Induced Lung Inflammation Hao Jiao,*,†,1 Yang Zhang,*,†,1 Zhibo Yan,* Zhen-Guo Wang,* Gongjian Liu,† Richard D. Minshall,*,‡ Asrar B. Malik,‡ and Guochang Hu*,‡ Activation of TLR4 by the endotoxin LPS is a critical event in the pathogenesis of Gram-negative sepsis. Caveolin-1, the signaling protein associated with caveolae, is implicated in regulating the lung inflammatory response to LPS; however, the mechanism is not understood. In this study, we investigated the role of caveolin-1 in regulating TLR4 signaling in endothelial cells. We observed that LPS interaction with CD14 in endothelial cells induced Src-dependent caveolin-1 phosphorylation at Tyr14. Using a TLR4-MD2- CD14–transfected HEK-293 cell line and caveolin-1–deficient (cav-12/2) mouse lung microvascular endothelial cells, we demon- strated that caveolin-1 phosphorylation at Tyr14 following LPS exposure induced caveolin-1 and TLR4 interaction and, thereby, TLR4 activation of MyD88, leading to NF-kB activation and generation of proinflammatory cytokines. Exogenous expression of phosphorylation-deficient Y14F caveolin-1 mutant in cav-12/2 mouse pulmonary vasculature rendered the mice resistant to LPS compared with reintroduction of wild-type caveolin-1. Thus, caveolin-1 Y14 phosphorylation was required for the interaction with TLR4 and activation of TLR4-MyD88 signaling and sepsis-induced lung inflammation. Inhibiting caveolin-1 Tyr14 phosphoryla- tion and resultant inactivation of TLR4 signaling in pulmonary vascular endothelial cells represent a novel strategy for preventing sepsis-induced lung inflammation and injury.
    [Show full text]
  • TLR Signaling Pathways
    Seminars in Immunology 16 (2004) 3–9 TLR signaling pathways Kiyoshi Takeda, Shizuo Akira∗ Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, and ERATO, Japan Science and Technology Corporation, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan Abstract Toll-like receptors (TLRs) have been established to play an essential role in the activation of innate immunity by recognizing spe- cific patterns of microbial components. TLR signaling pathways arise from intracytoplasmic TIR domains, which are conserved among all TLRs. Recent accumulating evidence has demonstrated that TIR domain-containing adaptors, such as MyD88, TIRAP, and TRIF, modulate TLR signaling pathways. MyD88 is essential for the induction of inflammatory cytokines triggered by all TLRs. TIRAP is specifically involved in the MyD88-dependent pathway via TLR2 and TLR4, whereas TRIF is implicated in the TLR3- and TLR4-mediated MyD88-independent pathway. Thus, TIR domain-containing adaptors provide specificity of TLR signaling. © 2003 Elsevier Ltd. All rights reserved. Keywords: TLR; Innate immunity; Signal transduction; TIR domain 1. Introduction 2. Toll-like receptors Toll receptor was originally identified in Drosophila as an A mammalian homologue of Drosophila Toll receptor essential receptor for the establishment of the dorso-ventral (now termed TLR4) was shown to induce the expression pattern in developing embryos [1]. In 1996, Hoffmann and of genes involved in inflammatory responses [3]. In addi- colleagues demonstrated that Toll-mutant flies were highly tion, a mutation in the Tlr4 gene was identified in mouse susceptible to fungal infection [2]. This study made us strains that were hyporesponsive to lipopolysaccharide [4]. aware that the immune system, particularly the innate im- Since then, Toll receptors in mammals have been a major mune system, has a skilful means of detecting invasion by focus in the immunology field.
    [Show full text]
  • A Synthetic Cd8a:Myd88 Coreceptor Enhances
    Published OnlineFirst October 20, 2017; DOI: 10.1158/0008-5472.CAN-17-0653 Cancer Microenvironment and Immunology Research A Synthetic CD8a:MyD88 Coreceptor Enhances CD8þ T-cell Responses to Weakly Immunogenic and Lowly Expressed Tumor Antigens Sabina Kaczanowska1, Ann Mary Joseph1, Jitao Guo1, Alexander K Tsai1, Jackline Joy Lasola1, Kenisha Younger1, Yuji Zhang1,2, Cruz Velasco Gonzales3, and Eduardo Davila1,4 Abstract Tcell–based immunotherapies are a promising approach for and Toll-like receptor signaling-related proteins. CD8a: patients with advanced cancers. However, various obstacles MyD88–expressing T cells improved antitumor responses in limit T-cell efficacy, including suboptimal T-cell receptor mice. Enhanced antitumor activity was associated with a (TCR) activation and an immunosuppressive tumor environ- unique tumor cytokine/chemokine signature, improved T-cell ment. Here, we developed a fusion protein by linking CD8a infiltration, reduced markers of T-cell exhaustion, elevated þ and MyD88 (CD8a:MyD88) to enhance CD8 T-cell levels of proteins associated with antigen presentation, and responses to weakly immunogenic and poorly expressed fewer macrophages with an immunosuppressive phenotype in tumor antigens. CD8a:MyD88–engineered T cells exhibited tumors. Given these observations, CD8a:MyD88 represents a increased proliferation and expression of effector and costi- unique and versatile approach to help overcome immunosup- mulatory molecules in a tumor antigen–dependent manner. pression and enhance T-cell responses to tumor antigens. These effects were accompanied by elevated activation of TCR Cancer Res; 77(24); 7049–58. Ó2017 AACR. Introduction ciated macrophage (6) and Th2 cytokine accumulation hamper antitumor T-cell responses. Moreover, chronic exposure to factors T cell–based immunotherapies are one of the most promising in the TME induces the expression of receptors that foster T-cell treatments for patients with advanced cancers, including melano- exhaustion, such as Tim-3, Lag-3, and PD-1 (7).
    [Show full text]
  • Induced IFN Regulatory Factor 1 Transcription Factor by Myd88 in Toll-Like Receptor-Dependent Gene Induction Program
    Evidence for licensing of IFN-␥-induced IFN regulatory factor 1 transcription factor by MyD88 in Toll-like receptor-dependent gene induction program Hideo Negishi*, Yasuyuki Fujita*, Hideyuki Yanai*, Shinya Sakaguchi*, Xinshou Ouyang*, Masahiro Shinohara†, Hiroshi Takayanagi†, Yusuke Ohba*, Tadatsugu Taniguchi*‡, and Kenya Honda* *Department of Immunology, Graduate School of Medicine and Faculty of Medicine, University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-0033, Japan; and †Department of Cell Signaling, Graduate School, Tokyo Medical and Dental University, Yushima 1-5-45, Bunkyo-ku, Tokyo 113-8549, Japan Contributed by Tadatsugu Taniguchi, August 18, 2006 The recognition of microbial components by Toll-like receptors (TLRs) In the present study we investigated how IFN-␥-induced IRF1 initiates signal transduction pathways, which trigger the expression contributes to TLR-mediated signaling. We demonstrate that of a series of target genes. It has been reported that TLR signaling is IRF1 forms a complex with MyD88, similar to the case of IRF4, enhanced by cytokines such as IFN-␥, but the mechanisms underlying IRF5, and IRF7. We also provide evidence that IRF1 induced this enhancement remain unclear. The MyD88 adaptor, which is by IFN-␥ is activated by MyD88, which we refer to as ‘‘licensing,’’ essential for signaling by many TLRs, recruits members of the IFN and migrates rapidly into the nucleus to mediate an efficient regulatory factor (IRF) family of transcription factors, such as IRF5 and induction of IFN-␤, iNOS, and IL-12p35. Our study therefore IRF7, to evoke the activation of TLR target genes. In this study we revealed that IRF1 is a previously unidentified member of the demonstrate that IRF1, which is induced by IFN-␥, also interacts with multimolecular complex organized via MyD88 and that the IRF1 and is activated by MyD88 upon TLR activation.
    [Show full text]
  • Identification of Transcriptional Mechanisms Downstream of Nf1 Gene Defeciency in Malignant Peripheral Nerve Sheath Tumors Daochun Sun Wayne State University
    Wayne State University DigitalCommons@WayneState Wayne State University Dissertations 1-1-2012 Identification of transcriptional mechanisms downstream of nf1 gene defeciency in malignant peripheral nerve sheath tumors Daochun Sun Wayne State University, Follow this and additional works at: http://digitalcommons.wayne.edu/oa_dissertations Recommended Citation Sun, Daochun, "Identification of transcriptional mechanisms downstream of nf1 gene defeciency in malignant peripheral nerve sheath tumors" (2012). Wayne State University Dissertations. Paper 558. This Open Access Dissertation is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Dissertations by an authorized administrator of DigitalCommons@WayneState. IDENTIFICATION OF TRANSCRIPTIONAL MECHANISMS DOWNSTREAM OF NF1 GENE DEFECIENCY IN MALIGNANT PERIPHERAL NERVE SHEATH TUMORS by DAOCHUN SUN DISSERTATION Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY 2012 MAJOR: MOLECULAR BIOLOGY AND GENETICS Approved by: _______________________________________ Advisor Date _______________________________________ _______________________________________ _______________________________________ © COPYRIGHT BY DAOCHUN SUN 2012 All Rights Reserved DEDICATION This work is dedicated to my parents and my wife Ze Zheng for their continuous support and understanding during the years of my education. I could not achieve my goal without them. ii ACKNOWLEDGMENTS I would like to express tremendous appreciation to my mentor, Dr. Michael Tainsky. His guidance and encouragement throughout this project made this dissertation come true. I would also like to thank my committee members, Dr. Raymond Mattingly and Dr. John Reiners Jr. for their sustained attention to this project during the monthly NF1 group meetings and committee meetings, Dr.
    [Show full text]
  • The Utility of Resolving Asthma Molecular Signatures Using Tissue-Specific Transcriptome Data 11 12 13 Debajyoti Ghosh1, Lili Ding2, Jonathan A
    G3: Genes|Genomes|Genetics Early Online, published on September 8, 2020 as doi:10.1534/g3.120.401718 1 2 3 4 5 6 7 8 9 10 The utility of resolving asthma molecular signatures using tissue-specific transcriptome data 11 12 13 Debajyoti Ghosh1, Lili Ding2, Jonathan A. Bernstein1, and Tesfaye B. Mersha3* 14 15 1Immunology and Allergy, Department of Internal Medicine, University of Cincinnati, Cincinnati, OH, 16 United States of America 17 2Division of Biostatistics and Epidemiology, Cincinnati Children’s Hospital Medical Center, Department 18 of Pediatrics, University of Cincinnati, Cincinnati, OH, United States of America 19 3Division of Asthma Research, Cincinnati Children’s Hospital Medical Center, Department of Pediatrics, 20 University of Cincinnati, Cincinnati, OH, United States of America 21 22 23 24 25 Corresponding author: 26 27 Tesfaye B. Mersha, Ph.D. 28 Associate Professor 29 Cincinnati Children's Hospital Medical Center 30 Department of Pediatrics 31 University of Cincinnati 32 3333 Burnet Avenue 33 MLC 7037 34 Cincinnati, OH 45229-3026 35 Phone: (513) 803-2766 36 Fax: (513) 636-1657 37 Email: [email protected] 38 39 40 41 1 © The Author(s) 2020. Published by the Genetics Society of America. 42 Graphical Abstract 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 2 61 ABSTRACT 62 An integrative analysis focused on multi-tissue transcriptomics has not been done for asthma. Tissue- 63 specific DEGs remain undetected in many multi-tissue analyses, which influences identification of 64 disease-relevant pathways and potential drug candidates.
    [Show full text]
  • And IRF7 Through a Mechanism Involving IRF1, IRF3, in Dendritic Cells Lactobacillus Acidophilus Response to Β Myd88 Drives
    MyD88 Drives the IFN-β Response to Lactobacillus acidophilus in Dendritic Cells through a Mechanism Involving IRF1, IRF3, and IRF7 This information is current as of September 24, 2021. Gudrun Weiss, Kristina Maaetoft-Udsen, Sebastian A. Stifter, Paul Hertzog, Stanislas Goriely, Allan R. Thomsen, Søren R. Paludan and Hanne Frøkiær J Immunol 2012; 189:2860-2868; Prepublished online 15 August 2012; Downloaded from doi: 10.4049/jimmunol.1103491 http://www.jimmunol.org/content/189/6/2860 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2012/08/15/jimmunol.110349 Material 1.DC1 References This article cites 58 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/189/6/2860.full#ref-list-1 Why The JI? Submit online. by guest on September 24, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology MyD88 Drives the IFN-b Response to Lactobacillus acidophilus in Dendritic Cells through a Mechanism Involving IRF1, IRF3, and IRF7 Gudrun Weiss,*,† Kristina Maaetoft-Udsen,* Sebastian A.
    [Show full text]
  • New Mechanisms of Receptor Crosstalk Shannon Lillian O’Brien Bbiomedsc
    New mechanisms of receptor crosstalk Shannon Lillian O’Brien BBiomedSc A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2018 Faculty of Medicine School of Biomedical Sciences ii Abstract Dysregulation of the Renin Angiotensin System (RAS), and its cognate receptor, the angiotensin (AngII) type 1 receptor (AT1R), has been implicated in the pathogenesis of several cardiovascular disorders including hypertension, fibrosis, congestive heart failure and stroke. Despite the development of pharmacological agents that target the RAS, the persistent burden of cardiovascular disease remains. My PhD focuses on the AT1R, specifically its ability to ‘crosstalk’ and transactivate signalling pathways downstream of the Epidermal Growth Factor Receptors (EGFR). This paradigm of EGFR transactivation thereby enables the AT1R to potentially regulate cell growth, differentiation, apoptosis and promote cancerous cell growth. Part of ongoing work in the Thomas laboratory is to better understand the roll of previously identified novel proteins in AT1R-EGFR transactivation, including CHKA (Choline Kinase Alpha), BMX (non-receptor tyrosine kinase) and TRIO (Triple Functional Domain PTPRF Interacting). It is therefore the focus of my research to use molecular and cellular approaches to interrogate the mechanistic basis for EGFR transactivation and better define the relative role of these novel proteins in AT1R-EGFR signalling. Although it is of great interest to identify and characterise the molecular, temporal and spatial mechanisms of AT1R-EGFR transactivation, demonstrating EGFR transactivation directly, in live cells, and in real-time has been challenging. Typically, end-point assays (e.g., phospho- ERK1/2) are used as a surrogate readout of EGFR activation, however they are often downstream readouts and are not applicable to live cells.
    [Show full text]
  • TLR-Independent Anti-Inflammatory Function of Intestinal Epithelial
    Experimental colitis ORIGINAL ARTICLE TLR-independent anti-inflammatory function Gut: first published as 10.1136/gutjnl-2014-308323 on 11 March 2015. Downloaded from of intestinal epithelial TRAF6 signalling prevents DSS-induced colitis in mice Katerina Vlantis,1,2,3 Apostolos Polykratis,1,2,3 Patrick-Simon Welz,1,2,3,4 Geert van Loo,5,6 Manolis Pasparakis,1,2,3 Andy Wullaert1,2,3,7,8 ▸ Additional material is ABSTRACT published online only. To view Objective The gut microbiota modulates host Significance of this study please visit the journal online fl (http://dx.doi.org/10.1136/ susceptibility to intestinal in ammation, but the cell gutjnl-2014-308323). types and the signalling pathways orchestrating this bacterial regulation of intestinal homeostasis remain What is already known on this subject? poorly understood. Here, we investigated the function of ▸ fi Studies in germfree mice showed that the gut For numbered af liations see intestinal epithelial toll-like receptor (TLR) responses in end of article. microbiota has a protective role during dextran the dextran sodium sulfate (DSS)-induced mouse model sodium sulfate (DSS) colitis in mice. Correspondence to of colitis. ▸ Gene targeting in mice showed that the toll- Dr Andy Wullaert, Department Design We applied an in vivo genetic approach like receptor (TLR) signalling molecule, MyD88, of Medical Protein Research, allowing intestinal epithelial cell (IEC)-specific deletion of mediates protective effects during DSS colitis. VIB; Department of ▸ Biochemistry, Ghent University, the critical TLR signalling adaptors, MyD88 and/or TIR- Bone marrow transplant experiments showed Technologiepark 927, 9052 domain-containing adapter-inducing interferon-β (TRIF), that MyD88/TRIF-mediated TLR signalling acts Ghent, Belgium; as well as the downstream ubiquitin ligase TRAF6 in in non-haematopoietic cells to protect mice [email protected] order to reveal the IEC-intrinsic function of these TLR from DSS colitis.
    [Show full text]