UCP2) Knockout Mouse Model

Metabolic and Functional Characterization of an Inducible Pancreatic β Cell Specific Uncoupling Protein-2 (UCP2) Knockout Mouse Model

By Qian-yu Guo

A thesis submitted in conformity with the requirement for the degree of Masters of Science Graduate Department of Physiology University of Toronto

Abstract

Metabolic and Functional Characterization of an Inducible Pancreatic β Cell Specific Uncoupling Protein-2 (UCP2) Knockout Mouse Model

Qian-yu Guo

Master of Science Thesis 2012

Department of Physiology

University of Toronto

In order to elucidate how uncoupling protein 2 (UCP2) influences pancreatic β cells and glucose homeostasis, I have generated and characterized an inducible β cell-specific UCP2 deletion model, MIPCreER×loxUCP2 mice. Male littermates were injected with tamoxifen to induce UCP2 deletion (UCP2 iBKO) or with corn oil (CO). The phenotypes of both short-term (3-4 weeks after the last injection) and long-term (8-9 weeks after the last injection) were determined: Short-term iBKO mice displayed no differences in glucose or insulin tolerance, but enhanced in vivo and in vitro insulin secretion and suppressed islet reactive oxygen species (ROS) levels; while long-term iBKO mice displayed no difference in glucose tolerance, but impaired in vivo and in vitro insulin secretion and enhanced islet ROS levels. In conclusion, short-term UCP2 deletion in β cells promotes insulin secretion, while long-term UCP2 deletion impairs insulin secretion, possibly due to the opposite background of islet ROS.

Supervisor’s Declaration

This is to certify that the thesis entitled “Inducible Deletion of Uncoupling Protein-2 (UCP2) in Pancreatic β cells Enhances Insulin Secretion”, submitted by Qian-yu Guo in fulfillment of the degree of Master of Science, is ready for submission.

Professor Michael B. Wheeler, Ph.D

August 31 st , 2012

Author Declaration

I hereby declare that this thesis is entirely my own work. This thesis does not, to the best of my knowledge, contain any material from any other source, except where due reference is made. This thesis was written completely and solely for the degree of Master of Science, and has not been submitted for a higher degree or diploma at any other academic institution. Figure 1.1 has been published in “Basford CL, Prentice KJ, Hardy AB, Sarangi F, Micallef SJ, Li X, Guo Q, Elefanty

AG, Stanley EG, Keller G, Allister EM, Nostro MC and Wheeler MB. The functional and molecular characterisation of human embryonic stem cell-derived insulin-positive cells compared with adult pancreatic beta cells. Diabetologia 55(2):358-71 (2012) .” Part of the data in Chapter 3 has been published as “Guo Q , Robson-Doucette CA, Allister EM, Wheeler MB. Inducible deletion of UCP2 in pancreatic β cells enhances insulin secretion. Canadian Journal of Diabetes (Accepted)”.

Permissions to use the articles have been obtained from both journals and attached at the end.

Qian-yu Guo

August 31 st , 2012

iii

Acknowledgement

The thesis submission marks the end of an eventful journey for which there are many people that I would like to acknowledge for their support along the way.

I would like to extent my gratitude to my primary supervisor, Prof. Michael B. Wheeler, firstly for taking me on, and then for his passing of wisdom and guidance. I would also like to thank Drs.

Christine A. Robson-Doucette and Emma M. Allister for being my mentors and guiding me through every large and small endeavor.

I am grateful for my supervisory committee members, Drs. Zhong-ping Feng and Tianru Jin for their important discussions.

I also wish to thank my entire extended family and my friends for providing a loving environment and being supportive for me all the time.

Table of Contents Abstract…………………………………………………………………..………………….…...... i

Supervisor’s declaration……………………………………………………………………….……ii

Author declaration………………………………………………………………………….……….ii

Acknowledgement……………………………………………….……………………………….....iii

List of Abbreviations………………………………………………………………………..………v

List of Figures…………………………………………………………………………….………...viii

Chapter 1. Introduction.………………………………………………………….……………………1

Chapter 2. Methods……………………………………………………….………………………….17

Chapter 3. Results…………………………………………………………….……………………...23

Chapter 4. Discussion…………………………………………………………………..…………….36

Reference……………………………………………………………………………..………………44

List of Abbreviations

ANT - adenine nucleotide translocase

ATP - adenosine triphosphate

CoA - coenzyme A

CO - corn oil

CPT-I - carnitine-palmitoyl transferase-I

DM - diabetes mellitus

DMEM - Dulbecco’s modified Eagle’s medium

ESC - embryonic stem cells

EGTA - ethylene glycol tetraaccetic acid

FBS - fetal bovine serum

FFA - free fatty acids

GPx - glutathione peroxidase

GSIS - glucose stimulated insulin secretion mETC - mitochondrial electron transporter chain

MHC - melanin-concentrating hormone

MMP - mitochondrial membrane potential

MIP - mouse insulin 1 promoter

MIPCreER - cre recombinase-estrogen receptor fusion protein driven by the mouse insulin promoter mNCX - mitochondrial Na +/Ca 2+ exchange

NFκB - nuclear factor kappa-light-chain-enhancer of activated B cells

NO - nitric oxide

Nrf-2 –nuclear factor erythroid 2-related factor vi

O2 - oxygen

ORF - open reading frame

OGTT - oral glucose tolerance test

OXPHOS – oxidative phosphorylation

H2O2 - hydrogen peroxide

HO-1 - heme oxygenase-1 iAUC - incremental area under the curve

IR - insulin resistance

ITT - insulin tolerance test

JNK - c-Jun N-terminal kinase

KATP channel - ATP-sensitive potassium channel

Keap-1 - kelch-like ECH-associated protein 1

KRB - Kreb’s Ringer buffer

KV channel- voltage-gated potassium channel

PBS - phosphate buffered solution

PDX-1 - pancreatic and duodenal homeobox-1

PMF - proton motive force

POMC - pro-opiomelanocortin

PPAR - peroxisome proliferator activated receptor

PGC-1 - PPAR-γ coactivator-1

RIP - rat insulin 2 promoter

ROS - reactive oxygen species

RyR - ryanodine receptor vii

SOD - superoxide dismutases siRNA - small interference RNA

SIRT-1 - Sirtuin-1

SRE - sterol regulatory element

SREBP - sterol regulatory element binding protein

T2DM - type 2 diabetes mellitus

Tmx - tamoxifen

UCP2- uncoupling protein 2

UCP2 -/- - whole-body UCP2 knockout model

UCP2 BKO - β cell specific UCP2 knockout

UCP2 iBKO - inducible β cell specific UCP2 knockout

VDCC - voltage-dependent calcium channels

viii

List of Figures

Chapter 1. Introduction

Figure 1.1. The canonical GSIS pathway………………………………………………………..……3

Figure 1.2. The regulation of UCP2 expression………………………………………………………7

Figure 1.3. The mechanism of Nrf2-dependent antioxidant gene expression……………………….10

Figure 1.4. The influence of UCP2 on ROS production and insulin secretion……………………...14

Chapter 2. Methods

Figure 2.1. The key genetic constructs and timeline of experiments…………………………...…...18

Chapter 3. Results

Figure 3.1. Effective UCP2 deletion specifically from pancreatic β cells……………………...…...26

Figure 3.2. Co-localization of insulin and YFP in MIPCreER×ROSA26eYFP islet cells……...…..27

Figure 3.3. Tamoxifen treatment does not alter global glucose homeostasis…………………….…27

Figure 3.4. Body weight and fasting blood glucose……………………………..……………….….28

Figure 3.5. Short-term UCP2 iBKO mice exhibit normal glucose tolerance……………………...... 29

Figure 3.6. Short-term UCP2 iBKO mice exhibit in vivo glucagon secretion but enhanced in vivo insulin secretion during OGTT………………………………………………………………………30

Figure 3.7. Short-term UCP2 iBKO mice exhibit normal insulin sensitivity……………...………..31

Figure 3.8. Short-term UCP2 iBKO islets exhibit enhanced insulin secretion under the stimulation of high glucose…………………………………………………………………………………………..32

Figure 3.9. The mitochondrial membrane potential of short-term UCP2 deficient islet cells………33

Figure 3.10. Short-term UCP deleted iBKO islets exhibit decreased ROS levels…………………..34

Figure 3.11. Short-term UCP2 inhibited min-6 cells exhibit decreased ROS levels………………..35

Figure 3.12. ATP contents of UCP2 iBKO and CO islets were similar……………………………..36

Figure 3.13. Body weight and fasting blood glucose…………………………………………...…...36

Figure 3.14. Long-term UCP2 inducible BKO (iBKO) mice exhibited normal glucose tolerance but tended to have decreased plasma insulin levels during OGTT…………………………………..…..37

Figure 3.15. Long-term UCP2 iBKO islets exhibit impaired insulin secretion under the stimulation of high glucose……………………………………………………………………………….………38

Figure 3.16. Long-term UCP deleted iBKO islets exhibit increased ROS levels………………...…39

Figure 3.17. Long-term UCP2 inhibited min-6 cells tended to have increased ROS level………….39

CHAPTER 1. INTRODUCTION

1. Type 2 diabetes mellitus (T2DM)

The body maintains blood glucose levels within a relatively narrow range. The homeostatic system is consisted of of several components, of which hormone regulation is the most critical one. There are two types of mutually antagonistic metabolic hormones that regulate blood glucose levels: catabolic hormones, including glucagon, cortisol and catecholamines, which increase blood glucose, and one anabolic hormone, insulin, which decreases blood glucose. The islets of Langerhans are the region of the pancreas that plays a pivotal role in glucose homeostasis as they contain various endocrine cells, including α cells secreting glucagon, β cells producing insulin, δ cells generating somatostatin, PP cells secreting pancreatic polypeptide and ε cells producing ghrelin 1.

Diabetes mellitus (DM) is a disorder primarily defined by the level of hyperglycaemia giving rise to risk of microvascular damage (retinopathy, nephropathy and neuropathy)2. It is associated with reduced life expectancy, significant morbidity due to specific diabetes related microvascular complications, increased risk of macrovascular complications (ischaemic heart disease, stroke and peripheral vascular disease), and diminished quality of life 2.

According to its etiology, DM can be classified into type 1 diabetes mellitus (T1DM), type 2 diabetes mellitus (T2DM), gestational diabetes and other specific categories 3. T1DM is a result of

4 autoimmune destruction of pancreatic -cells, which leads to absolute insulin insufficiency . In comparison, T2DM is the end of a series of metabolic disturbances, starting with insulin resistance (IR), in which the body cannot use insulin efficiently, then proceeding to hyperglycemia, and finally T2DM 5. IR and impaired insulin secretion are usually present in patients with T2DM. Most T2DM is accompanied by the metabolic syndrome, which includes the following disorders: abdominal obesity; atherogenic dyslipidemia; elevated blood pressure; insulin resistance or glucose intolerance; prothrombotic state; proinflammatory state 6. People with the metabolic syndrome are at increased risk of T2DM 6. The dominant underlying risk factors for this syndrome are abdominal obesity and insulin resistance 6. This is why the metabolic syndrome is also called the insulin resistance syndrome 6. T2D was primarily diagnosed in older adults in the past. However, the proportion of overweight and obese children and young adults in the population worldwide is increasing rapidly; hence a growing number of children and young adolescents are now being diagnosed with T2DM 6. It is estimated that 285 million people around the world are currently diagnosed with diabetes7. This number is still increasing: 7 million additional people are diagnosed with T2DM each year. It is

projected that T2DM will affect 438 million people globally in 2029 7. Thus, efforts to better understand and prevent the rapid expansion of this syndrome and disease are critically needed.

2. The role of mitochondria in glucose stimulated insulin secretion

The degeneration of the islets of Langerhans, the secondary event to IR in T2DM, is characterized by β-cell dysfunction and loss, as well as abnormal α cell function and increased glucagon secretion. The underlying mechanisms of β cell dysfunction are not well understood. In order to better elucidate the mechanisms of β cell dysfunction, it is important to understand how the β cell works normally. Most mammalian cells uptake and metabolize fuels to generate adenosine triphosphate (ATP) based on their energy requirement and energy availability in the surrounding environment. They control their fuel uptake and metabolism to maintain their NADH/NAD+ and ATP/ADP ratios in a certain range over various energy demands, regardless of the amount or nature of fuel supplies. In comparison, pancreatic β cells work in a different way: instead of maintaining their ATP/ADP ratio, pancreatic β cells respond to blood glucose fluctuation by altering their ATP/ADP ratio as the major signal to secrete insulin. When blood glucose concentration is low, ATP production is limited. When blood glucose concentration increases, ATP generation is promoted ( Figure 1.1 ).

β Cell

hyperpolarisation K H+ ATP H+ Glut- + + H H depolarisation 1/2 F0 I II III IV F1

ATP ATP ADP pyruvate TCA Ca 2+ cycle mitochondria VDCC

Ca 2+

repolarisation

Figure 1. 1 The canonical GSIS pathway. Upon elevation of blood glucose, glucose is transported into β cells by the high capacity, low affinity glucose transporter-2 (GLUT-2) (GLUT-1/2 in human). Upon entry into the β cell, glucose is phosphorylated to glucose-6-phosphate by high K m glucokinase and enters the glycolytic pathway. Pyruvate and NADH, the products of glycolysis, are then further metabolized by the Krebs cycle and the mitochondrial electron transport chain (mETC), leading to an increase in the ATP/ADP ratio, which closes K ATP channels and depolarizes the plasma membrane. This depolarization opens VDCCs and mediates Ca + influx, triggering the exocytotic machinery to release insulin from the granules within the cell. Soon after upon depolarization of the β cell, K v channels open, repolarizing the cell which in turn stops insulin secretion. (Figure is contributed by Dr. Christina Basford)

Mitochondria are critical sub-cellular micro-organs that are involved in the regulation of insulin secretion because they generate most of the cellular ATP. NADH and FADH 2, the high redox potentials, are generated during fuel oxidation and further metabolized for oxidative phosphorylation (OXPHOS). In general, OXPHOS is a pathway of sequential passage of electrons from high to low redox potentials (from NADH and FADH 2 to O 2) down through the mitochondrial electron transporter chain (mETC). This electron transportation leads to active hydrogen movement from the mitochondrial matrix into the intra-membraneous space, thus generates proton motive force (PMF) across the inner mitochondrial membrane. Finally, PMF drives proton flow back into mitochondrial matrix through F 0/F 1 ATPase (ATP synthase) to generate ATP ( Figure 1.1 ).

In the canonical model of glucose stimulated insulin secretion (GSIS) of pancreatic β cells, the elevation of ATP level and high ATP/ADP ratio closes ATP-sensitive potassium (K ATP ) channels and depolarizes the plasma membrane. This depolarization opens voltage-dependent calcium channels (VDCCs) and mediates Ca 2+ influx, triggering the exocytotic machinery to release insulin granules. Finally, voltage-gated potassium (K V) channels open to repolarize the β cell and end the insulin secretion cycle ( Figure 1.1 ). There are many other non-canonical pathways/factors besides ATP, such as glutamate, nitric oxide (NO), etc, that may also directly trigger insulin exocytosis but they are less understood.

3. Uncoupling proteins (UCPs) and uncoupling protein-2 (UCP2)

In the canonical GSIS model, partial uncoupling of OXPHOS allows the transportation of protons back to mitochondrial matrix. The outcome of uncoupling is a decrease of PMF and ATP generation as well as suppression of GSIS. The UCPs are a family of putative mitochondrial proton channels which decrease PMF across the inner mitochondrial membrane to reduce the efficiency of ATP generation. Uncoupling protein 1 (UCP1), the classical UCP family member, is a strong uncoupler mediating thermogenesis in mammalian brown adipose tissue 8. UCP2 was discovered based on its amino acid sequence similarity with that of UCP1 9. It was originally hypothesized that UCP2 should regulate energy metabolism similar to UCP1. However, doubt arose when Arsenijevic and colleagues showed that mice lacking UCP2 had normal metabolic rate and body weight 10 . Investigations over the past couple of decades have shown that UCP2 level is much less abundant in mitochondria than UCP1 11 . Additionally, UCP2 was only observed to conduct limited proton leak and cause mild uncoupling within the presence of specific activators, such as fatty acids, reactive oxygen species (ROS) and free-radical derived alkenals 8. However, even such mild uncoupling has not been consistently observed in all investigations 12 , thus making the function of UCP2 still under debate. 4

Increased UCP2 expression is observed inmouse models of obesity and type 2 diabetes mellitus 13 , and in humans polymorphisms in the UCP2 gene have been linked with hyperinsulinism 14 and a

UCP2 -866G>A variant with increased risk of type 2 diabetes and obesity 15-18 .

4. Dynamic regulation of UCP2 activity and protein concentration in β cells

Many previous studies have suggested a potential role of UCP2 in insulin secretion (they are summarized in Sections 5, 6 and 7 ). If UCP2 is a critical regulator of GSIS in pancreatic β cells, it is important to strictly control UCP2 expression and activation. Here I describe the current knowledge about the regulation of UCP2 expression and degradation.

4. 1 Regulation of β cell UCP2 activity

It is observed that free fatty acids (FFA), ROS and the lipid peroxidation products, including hydroxyalkenals such as hydroxynonenal, are potent activators of proton transport by UCP2. Even though the mechanisms of UCP2 activation are not clear, these observations suggest a hypothesis for the main, ancestral function of UCP2: to cause mild uncoupling and diminish mitochondrial ROS production, thus protecting the cells from oxidative stress.

During the oxidation of FFA, ROS being produced through mETC is high 19 . ROS can either directly or indirectly (through the formation of hydroxyl radicals) attack the unsaturated fatty-acid chains of membrane phospholipids, forming fatty acid radicals 20 . Oxidation of these carbon-centered radicals to peroxyl radicals initiates a massive production of 4-hydroxynonenal and other reactive alkenals, which activate UCPs and decrease the original ROS production 20 . This provides a local negative feedback by which UCP2 tightly controls the mitochondrial ROS generation.

Additionally, unsaturated fatty acids were also reported as an obligatory requirement for UCP2 to transport protons 21 but the mechanism is not clear. Since unsaturated fatty-acid side chains of membrane phospholipids are sensitive to oxidation, it is speculated that UCP2 might export fatty acid peroxide anions to protect the mitochondria 22 . If the exported fatty acids protonate and transport back across the membrane, UCP2 could catalyze net proton transport 23 .

4.2 Regulation of UCP2 expression by nutrients

Many of current investigations 24-29 of regulation of β cell UCP2 focuses on the effects of glucotoxicity and lipotoxicity because T2D patients, especially those with obesity, have hyperglycemia and hyperlipidemia.

Some studies suggest that FFAs not only activate the proton conductance of UCP2 but also induce UCP2 expression when the cells are chronically exposed to hyperlipidemia 24-27 . This UCP2 induction hence suppresses the acute glucose stimulation of ROS production and impairs GSIS 24-27 . FFAs may induce UCP2 expression by activating certain transcription factors. Peroxisome proliferator activated receptor α (PPARα) is such an example: the UCP2 promoter contains a PPARα response element and FFA serves as PPARα agonists to induce UCP2 26 . This process can be mimicked by the PPARα agonist clofibrate 30 . When there are excessive FFAs, PPARα does not only induce carnitine- palmitoyl transferase-I (CPT-I) to promote fatty acid oxidation but also enhances UCP2 expression to stimulate uncoupling respiration 31 . Sterol regulatory element binding protein (SREBP) is another example: UCP2 promoter also contains a sterol regulatory element (SRE) 32 and oleic acid itself may possibly bind to SREBP to activate the SRE activity in UCP2 promoter, thus promote UCP2 expression 32 . ( Figure 1.2 )

Chronic exposure to hyperglycemia may also influence UCP2 expression but the results are not consistent: Some studies suggested that hyperglycemia induced UCP2 to desensitize β cells and suppressed their ability to respond to the stimuli of high glucose 27, 33 , while others debated that hyperglycemia decreased UCP2 expression instead 34 . It remains to be elucidated how chronic hyperglycemia influence UCP2 expression and what are the potential molecular mechanisms behind.

4.3 Regulation of β cell UCP2 by other factors

Sirtuin-1: Sirtuins were originally identified as a group of NAD +-dependent histone deacetylases that regulate chromatin silencing 35 . However, sirtuins also have non-histone substrates which are involved in cell metabolism, such as acetyl coenzyme A (CoA) synthetase 2 and PPAR-γ coactivator-1 (PGC-1)35 . Sirtuin-1 (SIRT-1), a critical sirtuin family member, is highly expressed in β cells 36 . SIRT-1 has been reported to suppress UCP2 expression via both direct and indirect pathways: First of all, SIRT-1 is capable of binding to the UCP2 promoter to directly suppress UCP2 gene transcription and thus enhance ATP production and insulin secretion 36-37 . Second, SIRT-1 was also reported to suppress UCP2 indirectly by suppressing PPARα activity, a transcriptional factor which promotes UCP2 expression as described above, in adipocytes 38 . However, it is currently

unknown whether also SIRT-1 suppresses UCP2 levels via inhibiting PPARα activity. Additionally, SIRT-1 may also suppress UCP2 expression via inhibiting the activities of two transcriptional factors, PGC-1α and PGC-1β39-40 . Both PGC-1α and PGC-1β were reported to induce UCP2 and impair GSIS in INS-1 cells via inducing UCP2 expression but they work in different ways 40-41 : PGC-1α indirectly upregulates UCP2 expression through inducing SREBP expression, while PGC-1β directly acts as a coativator of SREBPs and promotes UCP2 expression 40 . ( Figure 1.2)

Figure 1. 2. The regulation of UCP2 expression. SIRT-1 can suppress UCP2 expression directly or indirectly through inhibition of PPARγ and PGC-1. PGC-1β is a co-activator of SREBPs, which also activates UCP2 expression, while PGC-α induces SREBPs. FFA can activate UCP2 expression through activating PPARα and SREBPs. FOXO1 can suppress UCP2 expression and FOXO1 activity can be suppressed by Akt. Therefore, leptin, which activates PI-3K/Akt pathway, may induce UCP2 expression but this pathway needs to be verified in β cells.

Leptin: Leptin is another factor that upregulates UCP2 in pancreatic islets and UCP2 protein is low in leptin-resistant ZDF rat islets 34, 42 . Leptin is also able to induce FFA metabolic enzymes to promote FFA metabolism 34 and thus enhance generation of ROS, which also induce UCP2 expression as described above. These studies suggested that leptin protected islets from oxidative stress through upregulation of UCP2 expression. Additionally, leptin may also induce UCP2 expression through activating IRS-1/PI-3K/Akt pathway 43 : FOXO1 was reported to bind to UCP2 promoter to suppress its expression 44 and FOXO1 activity is suppressed by Akt dependent phosphorylation. Hence, leptin may induce UCP2 expression through this duel inhibiting

mechanisms. However, this pathway needs to be verified in β cells ( Figure 1.2). Similarly, insulin also activates IRS-1/PI-3K/Akt pathway. Therefore, insulin may also induce UCP2 expression through inhibiting FOXO1 transcriptional activity. But no data has been reported about the effects of insulin itself on UCP2 expression.

4.4 Regulation of β cell UCP2 mRNA translation

UCP2 protein level is also under dynamic control at translational level. Pecqueur and colleagues described an interesting phenomenon in several peripheral tissues: UCP2 mRNA can be easily detected while its protein level is quite low, hardly detectable in mitochondria 45 , while oxidative stress quickly induces UCP2 protein expression without changing mRNA levels45 . Similarly, UCP2 protein in INS-1 cells has a very short half-life 46 , indicating the existence of a dynamic control system. Therefore, it can be extrapolated that UCP2 mRNA translation is usually suppressed under basal conditions but can be quickly induced according to metabolic changes in β cells.

A short 111-nucleotide open reading frame-1 (ORF-1) is localized upstream of the UCP2 coding region (ORF-2). The 3’ region of ORF-1 has been identified to play a role in suppressing UCP2 expression for a single-base substitution in this region significantly enhanced UCP2 translation 47 .

Additionally, glutamine, which is generated from α-ketoglutarate as an intermediate in the Krebs cycle, has not only been implicated in the insulin secretion pathway, but has also been reported to overcome the suppression of UCP2 mRNA translation in INS-1 cells 48 . When glutamine is removed, UCP2 protein level rapidly decreased but the UCP2 mRNA was not affected46 .

4.5 β cell UCP2 degradation

Studies of UCP2 degradation mechanisms lead to the surprising outcome that UCP2, a mitochondrial protein, was degraded through the cytosolic ubiquitin-proteosome system in INS-1 cells 49 . This degradation can be inhibited by proteasome inhibitor cocktails (PICs) 49 . However, many details of this degradation, such as the mechanisms of how the cytosolic proteasome interacts with UCPs in the mitochondrial inner membrane are still unknown.

5. UCP2 regulates both ATP and ROS production to influence insulin secretion

5.1 UCP2 regulates ATP production and insulin secretion

UCP2 is hypothesized to be involved in suppression of insulin secretion by decreasing ATP production. This opinion is supported by the notion that UCP2 level and activity is reversely related to ATP level by using both over-expression and null expression methods of UCP2: Over-expression of UCP2 reduced ATP dependent Ca 2+ influx and impaired GSIS in rat islets 50 , while UCP2 deficiency in mouse islets enhanced islet ATP content and their ability to secrete insulin when exposed to glucose 13 . When the UCP2 deficient mice were challenged with a high fat diet (HFD) for 4.5 months, they were more glucose tolerant and their islets had enhanced ATP levels and insulin secretory capacity compared to the control mice on HFD 51 . Additionally, it has been observed that UCP2-dependent inhibition of ATP generation is associated with decreased proton motive force (PMF), consistent with an uncoupling impact, in mouse, rat and human islets 13, 50, 52-54 . However, there are also some contradictory results that suggest that UCP2 does not impact uncoupling capacity or ATP production in mouse islets 55-57 .

5.2 UCP2 regulates ROS production and insulin secretion

Some studies in the late 1990s indicated that insulin secretion can not only be regulated by ATP synthesis but other putative factors are speculated to be involved in glucose-secretion coupling 56 . Reactive oxygen specicies (ROS) attracted researchers’ attention as a good candidate factor since they are rapidly produced and degraded. When Arsenijevic and colleagues were characterizing UCP2-knockout mice, they seemed to lack a phenotype related to energy homeostasis and were resistant to the infection by Toxoplasma gondii , an intracellular parasite 10 . To elucidate the mechanisms behind this surprising resistance to infection, Arsenijevic and colleagues examined the macrophages of UCP2-knockout mice and they found their macrophages produced significantly higher ROS 10 . Their insights therefore lead to the finding that UCP2 is a regulator of ROS production.

5.2.1 Mitochondrial ROS production and degradation

Mitochondria are one of the major subcellular organelles that generate ROS: when nutrients such as glucose and FFA are metabolized, reducing equivalents (NADH and FADH 2) are produced within Krebs cycle and then transferred to the mETC. The energy released from mETC is used to pump protons out of inner mitochondrial membrane which creates a transmembrane electrochemical

gradient and allows ATP generation. However, when the electrons are passed through the ETC, 1-3% of the electrons form ROS 58 .

ROS are quickly degraded by antioxidant enzymes after their production. The expression of these enzymes is mainly induced by Nrf-2 –nuclear factor erythroid 2-related factor (Nrf2), a redox- sensitive transcription factors. Nrf2 is sequestered by kelch-like ECH-associated protein 1 (Keap1) and targeted for ubiquitination and proteosomal degradation when ROS levels are low 59 . When ROS are elevated, cysteine residues of Keap1 are modified and Nrf2 is released from the sequestration of Keap1. Thus Nrf2 translocates into the nucleus, binds to the antioxidant response element (ARE) and induces the expression of antioxidant genes, including heme oxygenase-1 (HO-1), glutamate cysteine ligase (the rate-limiting enzyme for synthesis of gutathione), glutathione peroxidase (GPx) and superoxide dismutases (SODs) 59-61 . (Figure 1.3 )

ROS SH SH S S

Keap1 Nrf2 Keap1

Nrf2

Cytoplasm Nrf2

ARE Anti-oxidant Gene Expression

Nucleus

Figure 1.3. The mechanism of Nrf2 -dependent antioxidant gene expression. When ROS are elevated, cysteine residues of Keap1 are modified and Nrf2 is released from the sequestration of Keap1. Thus Nrf2 translocates into the nucleus, binds to the antioxidant response element (ARE) and induces the expression of antioxidant genes.

SODs are a class of enzymes that catalyze the breakdown of the superoxide anion into oxygen (O 2) 62 and hydrogen peroxide (H 2O2). SODs are highly expressed in β cells to cope with oxidative stress .

However, H 2O2 scavenging enzymes are expressed at a relatively low level in β cells (1% compared 62 to liver) . It is unclear why β cells express high levels of SODs but low levels of H 2O2 scavenging enzymes. Some results suggest that the imbalanced expression of SODs and H 2O2 scavenging enzymes make β cells extremely vulnerable to oxidative stress while others argue that this creates an environment which allows β cell to be sensitive to ROS signaling 57 .

5.2.2 UCP2 and ROS

ROS are generally regarded as cytotoxic, because they cause oxidative damage to various cellular macromolecules. However, in certain circumstances, ROS have been shown to serve as a second messenger for various physiological responses. In pancreatic β cells, ROS generated from glucose oxidation are regarded as a signal to elicit GSIS 63 . Since mitochondrial ROS production is very sensitive to the PMF set up across the inner membrane by mETC, even mild uncoupling caused by UCP2, which leads to slightly decreased PMF, may attenuate ROS production 10 . How UCP2 is related to ROS and GSIS depends on different stimuli of ROS production and the amount of ROS being produced. It is hypothesized that under physiological conditions, UCP2 is usually suppressed, allowing glucose stimulated physiological ROS generation to promote insulin secretion. In patho- physiological chronic oxidative stress, however, UCP2 is up-regulated in order to protect the β cells from the stress and preserve their capability of GSIS 63 .

5.2.3 The mechanisms behind ROS induced GSIS

As described at the beginning of the introduction, insulin release requires three critical ion channels:

KATP channels, the closure of which are responsible for β cell depolarization; VDCCs, which are 2+ required for the increase of intracellular Ca levels; and K V channels, which repolarize the cells and end insulin secretion. Theoretically, any modulations that suppress K ATP and K V activities or enhance cytoplasmic Ca 2+ levels will promote insulin secretion. It has been shown that ROS can modulate the activity of multiple ion channel activities that are involved in GSIS.

Potassium channels: ROS were reported to inhibit KATP channels directly by S-glutathionylation in vascular endothelial cells 64-65 . We may extrapolate that ROS may promote β cell depolarization and

GSIS through inhibiting K ATP , although this pathway has not been verified in β cells. Additionally,

ROS may influence the KV channel activity as well. Even though how ROS regulates K V channel activity in β cells is currently unknown, there are some studies in smooth muscle cells indicating that

ROS can influence the activity of K V channels, including K V2.1, which is also a critical K V subtype 66-68 in the β cells . One possible mechanism of such ROS-dependent modification of K V activity is that the direct redox modification of K V α-subunits (particularly cysteine residues) alters the channel 69 properties , while K V β-subunits, which also serves as a NADPH-oxidoreductase, senses the intracellular redox potential 70-72 . We may also extrapolate that ROS may inhibit β cell repolarization to promote GSIS through inhibiting K V, although this pathway needs to be verified in β cells as well.

Calcium channels: Several calcium channels that are responsible for the increase of cytoplasmic Ca 2+ are reported to be modified by ROS. Voltage-dependent calcium channels (VDCC) , especially L-type VDCCs, are critical electrogenic components of GSIS. Previous studies in hypoxia models of cardiac myocytes indicated that L-type VDCC can also be modified by ROS 73-75 . However, L-type VDCCs were inactivated in these oxidative stress models 73-75 . It is currently unknown whether physiological levels of ROS are involved in the regulation of L-type VDCCs. Ryanodine receptor (RyR) channels is a type of Ca 2+ channels localized on sarcoplasmic reticulum (SER) membranes. SER is another source of Ca 2+ and RyR mediates additional increase of cytoplasmic Ca 2+ in addition to the Ca 2+ influx through VDCC from extracellular space. Temporary ROS elevation results in cysteine modification and activation of RyR, resulting in Ca 2+ release from SER but prolonged ROS production leads to RyR inactivation 76-77 . RyR channels are expressed in pancreatic β cells 78 but whether they are involved in ROS-dependent insulin secretion is currently unknown. Mitochondrial Na +/Ca 2+ exchange (mNCX), an ion channel localized in the inner membrane of mitochondria, mediates the efflux of Ca 2+ from mitochondria in exchange for the influx of Na + into mitochondria 79-80 . Suppression of mNCX function potentiates mitochondrial metabolism and GSIS 79, 81 . The influence of ROS on NCX activity in other tissues varies from one to another 82-85 but its effect on pancreatic β cell mNCX is currently unknown.

Insulin expression: It is also reported that ROS modulates the transcriptional activity of pancreatic and duodenal homeobox-1 (PDX-1): PDX-1 is the critical transcriptional factor which induces insulin and glucokinase expression 86-87 . Previous studies have reported that oxidative stress induces the inactivation and nucleo-cytoplasmic translocation of PDX-1, possibly via its cysteine residue modification and c-Jun N-terminal kinase (JNK)-dependent phosphorylation 88-89 . However, it is not known whether physiological levels of ROS would activate PDX-1 transcriptional activity instead of suppressing it.

5.3 The influence of UCP2 on β cell function: protective or harmful?

It is debated whether UCP2 impairs β cell function or protects β cells from oxidative stress. The two major views about the influence of UCP2 on pancreatic β cell are described below:

Opinion 1: UCP2 overexpression is involved in the pathogenesis of T2D. UCP2 over-expression impairs insulin secretion from β cells. Evidence for this view comes from the investigation of both global and β cell-specific UCP2 knockout mouse models 13, 57 . The islets of global UCP2 knockout mice showed enhanced ATP contents and GSIS 13 and the islets of β cell-specific UCP2 knockout

mice showed enhanced ROS-dependent GSIS 57 . Additionally, UCP2 expression may promote β cell apoptosis. A recent study showed that UCP2 deficiency protected β cells against apoptosis: UCP2 deficiency suppressed nitric oxide (NO) production and NF-κB activation, thus significantly decreasing basal and cytokine-induced β cell apoptosis 90 . These results suggested that UCP2 deficiency is protective to β cells and preserves their insulin secretion capability.

Opinion 2: UCP2 reduces ROS production to protect β cells from oxidative stress and save their function. UCP2 has shown its cytoprotective capability in many cell types, such as neurons, cardiomyocytes, hepatocytes 91-94 . Therefore, it is natural to speculate that UCP2 may have protective function to β cells. Pi and colleagues showed global UCP2 knockout mice had elevated oxidative stress markers and impaired GSIS as described above 95 . Wang and colleagues showed UCP2 overexpression in rat islets increased insulin gene expression and improved capability of GSIS 42 . Thus the protective effects are likely to rely on UCP2 dependent attenuation of ROS production.

6. Previous studies of UCP2 in pancreatic β cell lines

Studying UCP2 function in β cell lines has pros and cons. It is relatively simple and can avoid the complicated genetic backgrounds and systemic impacts in animal studies. However, cultured cell lines are not identical to real β cells.

UCP2 small interference RNA (siRNA) treatment of INS-1 cells causes acute UCP2 knockdown. After 48 hrs siRNA treatment, approximately 80-90% UCP2 expression can be suppressed 96 . UCP2 knockdown significantly increased ATP production and GSIS 96 , while induction of UCP2 expression by PPARα in INS-1 cells and overexpression UCP2 in β-TC cell lines both lead to decreased ATP production and GSIS 31, 97 . These observations support the idea that UCP2 contributes to the attenuation of PMF, suppression of ATP generation and impairment of GSIS.

7. Previous UCP2-knockout animal models

The idea that UCP2 may cause mild uncoupling, decrease GSIS and regulate glucose homeostasis lead to various investigations in animal models. A large amount of our knowledge about the role of UCP2 in β cell function and glucose homeostasis came from various UCP2 knockout mouse models, including global and β cell specific UCP2 knockout models.

7.1 The whole body UCP2 knockout mouse model

Many studies that utilize mice with global UCP2 knockout or inhibition agree that UCP2 deficiency improves GSIS of β cells, impairs glucagon secretion from α cells and enhances insulin sensitivity in peripheral tissues such as adipose tissues 13, 51, 98-100 . However, there are also contradictory views: Pi and colleagues showed that when this global UCP2 knockout mouse strain was backcrossed onto three different congenic genetic backgrounds, UCP2 deficiency caused chronic oxidative stress, which was represented by decreased GSH/GSSG ratio, in all the tissues which would normally express high level of UCP2, including islets, spleen and lung 95 . Additionally, UCP2 deficient islets also displayed higher expression of various anti-oxidant enzymes 95 . The chronic oxidative stress in islets hence impaired GSIS 95 . However, it is unknown whether the decreased GSH/HSSG ratio in spleen and lung may represent a global oxidative stress status, which is a cause of insulin resistance. Since the peripheral insulin sensitivity in these mice was not determined on the backcrossed global UCP2 knockout mice 95 , it is not possible to compare whether global UCP2 knockout would cause insulin resistance in these mice instead, which is different from the phenotypes of other UCP2 global knockout models ( Table 1.1 ).

Regardless, global UCP2 knockout models have limitations for studying UCP2’s role in GSIS and β cell function because UCP2 is not solely expressed in pancreatic β cells but in many other cell types which are related to glucose metabolism, including glucose sensing hypothalamic neurons and pancreatic α cells 101-102 .

Table 1.1. The issues of whole body UCP2 and UCP2 BKO mice to study the function of β cell UCP2.

Whole body KO BKO Chronic UCP2 deletion & √ √ Developmental effects UCP2 is expressed in many √ N/A tissues UCP2 is expressed in other √ N/A islet cells UCP2 ectopic deletion N/A √

7.2 The β-cell specific UCP2 knockout mouse model

In order to study the function of UCP2 in β cells, it is critical to create a β cell specific UCP2 knockout (UCP2 BKO) model. The common way to make gene knockout mice is Cre-lox technology 103 . Our previous study utilized rat insulin 2 promoter (RIP)-Cre×loxUCP2 mouse strain, to generate a β cell specific UCP2 knockout model and study the role of UCP2 in β cell function and glucose homeostasis. β-cell specific UCP2 deletion was confirmed by standard PCR, quantitative PCR, and immunohistochemistry: UCP2 was detectable in <10% of islet insulin positive cells, suggesting approximately 90% of UCP2 deletion in β cells 57 . Standard PCR also showed sufficient UCP2 deletion in islets 57 .

Our group showed that RIPCre×loxUCP2 mouse islets had higher islet ROS levels and enhanced GSIS compared to the controls 57 . (Figure 1.4) Surprisingly, these mice were aberrantly glucose intolerant57 . Further in vitro investigation showed that RIPCre×loxUCP2 mouse islets had increased α cell area and aberrant elevation of islet glucagon content and glucagon secretion, possibly caused by the intra-islet ROS signals from the UCP2 deleted β cells 57 . The aberrant α cell function and increased glucagon secretion might be a major cause of the impaired glucose tolerance that was observed in RIPCre×loxUCP2 mice 57 .

β-cell Glucose ROS + H+ H H+

III F KATP I II IV UCP2 o Channel mETC Calcium influx Glycolysis F1 Ca 2+ H+ Depolarization ATP Pyruvate H+ TCA Insulin cycle Mitochondrion Secretion

Figure 1.4 . The influence of UCP2 on ROS production and insulin secretion. UCP2 was shown as a mild uncoupler that regulates ROS production without much influence on ATP. UCP2 deficiency increases the generation of ROS, which serves as a signal that enhances insulin secretion. (Figure is contributed by Dr. Christine Robson -Doucet te with modifications)

The major potential limitation of this model is specificity: Wicksteed and colleagues showed that the RIP-Cre recombinase construct had ectopic Cre expression in hypothalamus 104 . Our group also

confirmed that our RIPCre×loxUCP2 mice had ectopic UCP2 deletion in various brain regions, including hypothalamus, which may affect systemic metabolic homeostasis. Another limitation is that UCP2 was chronically deleted as the deletion would occur during embryonic development in this model 95 . Hence, this RIPCre×loxUCP2 mouse model may not be able to discern the function of UCP2 in β cells and glucose homeostasis from the potential influence of hypothalamic effects.

8. General Objective & Rationale

Since the discovery of UCP2, most studies have associated it with a negative impact on insulin secretion; however, as described above, this view of UCP2 has been debated 13, 95 . Our current knowledge of UCP2 function in β cells is that UCP2 does not behave as a classical uncoupler, unlike UCP1 which is highly expressed in brown adipose tissue. That is, UCP2 does not strongly dissipate the mitochondrial proton motive force to reduce ATP generation by ATP synthase. Instead, UCP2 mainly serves as a regulator of ROS production, which is natural byproduct of aerobic respiration. Most of our understanding of β cell UCP2 function is from two types of mouse models: A whole- body UCP2 knockout model and UCP2 BKO model. However, both models have their limitations. First, UCP2 is expressed in many tissues other than β cells, including energy-sensing hypothalamic neurons and other islet cells. Therefore, the whole body UCP2 knock out model is problematic to study UCP2 in β cells as deletions in these other tissues can influence β cell behavior and glucose homeostasis. The recent study of the RIPCre-loxUCP2 model, a new UCP2 BKO model, is superior to the whole-body knockout model for such studies 57 ; however, with this model UCP2 deletion occurs in β cells during embryonic development and therefore there is the potential for compensation as the deletion might be considered chronic. Additionally, this fragment of the rat insulin promoter also drives cre expression in hypothalamus and so is not truly beta cell specific 57, 104 . Therefore, a more acute and β cell-specific UCP2 deletion model would be beneficial to determine to role of UCP2 specifically in the beta cell. To accomplish this, we have generated and begun to characterize a novel β cell-specific inducible UCP2 knock out mouse model (mouse insulin 1 promoter (MIP)CreER×loxUCP2) and our OBJECTIVE is to better understand UCP2 function in β cells as well as to determine how β cell UCP2 contributes to whole body glucose homeostasis.

CHAPTER 2. METHODS

1. Animals.

The transcriptional unit of UCP2 gene is made of 2 untranslated exons followed by 6 exons that encode UCP2. Even though there are 3 ATG sites in exon 2, these sites have been shown not to influence the initiation site in exon 3 for UCP2 mRNA translation 105 .

The loxUCP2 mouse strain was a generous gift from Dr. Bradford Lowell, Harvard University. The generation of the loxUCP2 mice is briefly stated below: A targeting vector was designed to place a loxP site just upstream of exon 3, and a loxP-flanked neo/TK cassette just downstream of exon 4 of the UCP2 gene 105 (Figure 2.1A ). This construct was electroporated into the embryonic stem cells (ESC). Correctly targeted ES cells were then transiently transfected with a Cre expressing plasmid. The resulting ES cells with the selection cassette removed and a single loxP site remaining on each side of exon 3 and 4 were injected into C57BL/6 blastocysts. Chimeric mice were bred to C57BL/6 mice to generate loxUCP2 mutant mice.

A. MIPCreER allele MIP Cre ER

loxUCP2 allele ATG ROSA26 eYFP allele 1 2 3 4 5 6 7 8 ROSA26 promoter Stop codon eYFP

loxUCP2 allele after Cre excision ROSA26 eYFP allele after Cre excision 1 2 5 6 7 8 ROSA26 promoter eYFP

B. 6wks 7wks 8wks 9wks 10wks 11wks 12wks 13wks 14wks 15wks 16wks

Tamoxifen/Corn Oil Injection In vivo In vitro In vivo In vitro experiments experiments experiments experiments Short-term experiments Long-term experiments

Figure 2. 1. The key genetic constructs and timeline of experiments . A. Targeting construct for MIPCreER gene, Ucp2 gene flanked by loxP

sites and the Ucp2 allele after Cre recombinase excision, ROSA26eYFP allele with the stop codon flanked by loxP sites and ROSA26eYFP allele after Cre recombinase excision. Homozygote loxUCP2 mice that express CreER and receive tamoxifen undergo recombination of the DNA

between loxP sites, deleting exons 3 and 4, which contain the start codon of Ucp2 gene. Homozygote ROSA26eYFP mice that express CreER and receive tamoxifen undergo recombination of DNA between loxP sites, deleting the stop codon and turning on the expression of eYFP. B. Timeline of the experiments.

Inducible β cell-specific UCP2 deletion was obtained by crossing loxUCP2 mice 57, 106 with the mice that express the cre recombinase-estrogen receptor fusion protein driven by the mouse insulin 1 promoter (MIPCreER) mice (a generous gift from Dr. Lou Philipson, University of Chicago) 104 . These MIPCreER mice had been backcrossed to a C57BL/6 background for 5 generations before being crossed to the loxUCP2 mice. Mice were genotyped by standard multiplex PCR using ear notch DNA. Mice that express the CreER construct and were homozygous for the loxUCP2 gene were used for experiments. All mice were male and age matched and maintained on a 129J- C57BL/6-mixed background. Mice were injected i.p. with either 25mg/ml tamoxifen (dissolved in corn oil) to induce β cell-specific UCP2 deletion (inducible BKO, UCP2 iBKO) or with the same volume of corn oil (CO) alone. The mice were injected three times, on alternating days. Injections began at 6 week of age (Figure 2.1B. ).

To confirm the specificity of cre expression in β cells the MIPCreER mice were also crossed to ROSA26eYFP mice because there was no good UCP2 antibody available. In these mice β cells express eYFP when tamoxifen is presented to delete the loxP-flanked transcriptional “stop” sequence in ROSA26 locus 107 . (Figure 2.1A ) Similarly, these MIPCreER×ROSA26eYFP mice were injected i.p. with either 25mg/ml tamoxifen (dissolved in corn oil) or with the same volume of corn oil at 6 weeks of age and islets isolated 3-4 weeks after the last tamoxifen or corn oil injection.

C57BL/6 mice (The Jackson Laboratory, Bar Harbor, M.E.) were also used to test whether i.p. injection of tamoxifen had effects on glucose homeostasis and islet insulin secretion. Age matched 6- week old male C57BL/6 mice were injected with tamoxifen (Tmx) or corn oil (CO) in the same way as described above. Experiments were performed on MIPCreER×loxUCP2 and C57BL/6 mice two weeks after the last injection. Mice were then allowed to recover for one week post-tolerance tests before being sacrificed for islet isolation and in vitro studies. All animal experiments were approved by the University of Toronto Animal Care Committee, and animals were handled according to the guidelines of the Canadian Council of Animal Care.

2. Pancreatic islet isolation, cultural and dispersal

Pancreatic islets were isolated as previously described 55, 108 . Mice were anesthetized with 250 mg/kg tribromoethanol via intraperitoneal injection. The pancreas was perfused via the common bile duct with type-V collagenase (0.8 mg/ml) dissolved in RPMI-1640 solution supplemented with 100 U/ml penicillin/streptomycin and 2% BSA. Pancreata were then digested at 37ºC in the water bath for 16– 20 min. Islets were mechanically picked from debris tissue and cultured in RPMI-1640 media

(Sigma, MO) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin/streptomycin and were cultured overnight at 37ºC before experimentation (Gibco, NY).

Dispersed islet cells were also used for experimentation. Isolated islets were washed in phosphate buffered solution (PBS) supplemented with 2 mM ethylene glycol tetraaccetic acid (EGTA). Islets were dissociated into their constituent cells by digestion in the neutral protease accutase (Roche Applied Science) for 8 min at 37ºC, followed by mild pipetting to facilitate separation of cells. The digestion was halted by the addition of RPMI-1640 media supplemented with 10% fetal bovine serum. Dispersed cells were washed with fresh islet culture media and plated onto glass cover slips coated with poly-L-lysine and maintained at 37ºC before experimentation.

3. Cell Culture

MIN6 cells, a gift from Dr. S. Seino, Chiba University (passage number 35–45), were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Sigma, MO) supplemented with 10% fetal bovine serum, 48.6 µmol/l β-mercaptoethanol, 100 units/ml penicillin and 100 µg/ml streptomycin, at 37°C in a humidified atmosphere (5% CO2, 95% air). Cells were grown in monolayer to 80-90% confluency in 100-mm2 dishes 109 . Cells were the harvested and plated onto the 22mm glass coverslips in the 6-well plates for further experiments. Genipin (Wako Chemicals USA, Inc), a UCP2 inhibitor that is derived from herbal medicine 99 , was dissolved in 70% ethanol to make a stock solution (1M). Cells were treated with 25µM or 50µM genipin (final concentration) for 2hrs for the short-term UCP2 functional inhibitory experiments, or with 25µM genipin (final concentration) for 5 days for the long-term UCP2 functional inhibitory experiments, with corresponding amount of empty vehicle treated cells as controls.

4. RNA extraction & reverse transcription of animal tissues and cells

Mice were anesthetized using the protocol described above. Hypothalamus was isolated, washed in PBS and stored in RNA later solutions (Ambion, TX) at -20ºC until further use. Prior to extraction, hypothalamic tissues were homogenized using an electronic ploytron. Islets were isolated as described above and were homogenized manually (vigorously mixing with a pipette). RNA of hypothalamus, islets and min-6 cells was extracted using RNeasy Mini Kit (Qiagen, CA) and following the manufacturers’ instruction as previously described 110 . Reverse transcription to make cDNA was completed using SuperScript III Reverse Transcriptase Kit (Invitrogen, CA) and following the manufacturer’s instruction.

5. DNA extraction & PCR

Genotyping of the mice was completed using ear notch DNA and standard multiplex PCR. Genomic DNA was extracted from ear notch samples by using genomic DNA extraction kit (Sigma-Aldrich, Canada) according to manufacturer’s instruction. PCR was performed to determine the presence of the Cre transgene as well as the zygosity for loxUCP2 using RedTaq DNA polymerase (Sigma- Aldrich, Canada), with an annealing temperature of 59ºC and 62ºC, respectively.

The primer sequences were:

Cre Fwd: GGCAGTAAAAACTATCCAGCAA,

Cre Rev: GTAAAGACCCCTAACGAATATTG. loxUCP2 Fwd: ACCAGGGCTGTCTCCAAGCAGG, loxUCP2 Rev: AGAGCTGTTCGAACACCAGGCCA.

PCR products were then separated on 1% agarose gel with 0.1% RedSafe Dye (Chembio, UK) to identify the amplification of a 380bp band for loxUCP2, a 270bp band for wild type UCP2 gene, and the presence of 250bp band for Cre recombinase gene.

6. Mitochondrial membrane potential imaging and islet ATP content measurement

57, 102, Glucose-induced changes in ∆Ψ m were quantified in dispersed islet cells as previously described 111 . Cells adhered to cover slips were loaded with rhodamine 123 (25 µg/ml, 10 min) in Krebs-Ringer buffer (KRB) containing 0.1% BSA, 120mM NaCl, 2 mM CaCl 2, 1 mM MgCl 2, 24 mM NaHCO3, and 10 mM Hepes (pH 7.3). Glucose was then added to a final concentration of 20 mM. At the end of the experiment, 1 mM NaN 3 was added to inhibit the respiratory reaction and fully dissipate the

∆Ψ m. Measurement of ∆Ψ m was performed using an Olympus IX70 inverted epifluorescence microscope in combination with an Ultrapix camera and a computer with Merlin imaging software (LSR). Fluorescence excitation at 490 nm was used and measured with a 515-nm-long pass emission filter. For these experiments, three independent experiments were performed on different days. For experiments using dispersed islet cells, islets from three animals were combined and plated onto three coverslips. The experiment was repeated on three different days. Islet ATP content was quantified as previously described 57 . Briefly, 8-20 islets per condition were washed with ice-cold Kreb’s Ringer buffer (KRB) and pre-incubated at 37°C in 2.8mM glucose KRB for 1 hr. Tubes were put in ice water and the 2.8mM glucose KRB buffer was replaced with icecold 2.8mM or 16.7mM

glucose KRB and incubated for 30mins at 37°C. Islets were lysed with 0.1M NaOH/0.5mM EDTA and stored at -80°C until assayed with a luciferase ATP assay kit according to the manufacturer’s instructions (Sigma-Aldrich, USA).

7. Glucose-stimulated insulin secretion

Glucose-stimulated insulin secretion assay was performed as previously described 51, 57, 100 . 8-20 islets (mouse or human) per condition were washed with ice-cold KRB and pre-incubated at 37°C in 2.8mM glucose for 1 hr. Tubes were put in ice water and the 2.8mM glucose buffer was replaced with ice-cold 2.8mM or 16.7mM glucose KRB and incubated for 30mins at 37°C. Insulin secretion was measured using a RIA kit (Millipore, Canada) and normalized to islet numbers.

8. Measurement of ROS by fluorescence microscopy

ROS measurements were performed using the H2O2-sensitive dye CM-H2-DCFDA as previously described 57, 100 . Islets were incubated at 37ºC and 5% CO2–95% air. Whole pancreatic islets were loaded with 5 mM CM-H2-DCFDA for 30 min in buffer solution (130 mM NaCl, 5 mM KCl, 2 mM

CaCl 2, 1 mM MgCl 2, 5 mM NaHCO 3, and 10 mM HEPES at pH 7.4). After the incubation, islets were transferred to an open chamber with buffer solution and placed on the microscope stage. Fluorescent excitation was achieved at 480 nm for 100 ms, and emission was detected with a 525 nm band pass filter using a 505 nm beam splitter. Fluorescence intensity levels were maintained within the upper and lower detection thresholds of the recording equipment. Experiments were carried out using an Olympus BX51W1 fluorescent microscope fitted with a 20×/0.95 water immersion objective and a cooled CCD camera equipped with a magnification changer (U-TVCAC, Olympus Canada Inc., Markham, ON, Canada). A xenon lamp-based DeltaRam high-speed monochromator (Photon Technology International, Birmingham, NJ, USA) was used for excitation. Control of the monochromator and video camera, as well as fluorescent data collection and analysis, were performed using ImageMaster 3 software (Photon Technology International).

9. Tolerance tests

The glucose and insulin tolerance were performed as previously described57, 112 . Oral glucose tolerance test (OGTT): Following a 16-hr fast, mice were gavaged with glucose (2g/kg body weight). Blood glucose was measured at 0, 10, 20, 30, 60, 120 minutes. Plasma insulin was measured at 0, 10, 20 and 60 minutes using an ELISA kit (ALPCO diagnostics, USA). Plasma glucagon was measured at 0 and 10 minutes by RIA (Millipore, Canada). Insulin tolerance test (ITT): Following a 4-hr fast,

insulin (1.5 IU/Kg body weight) was injected i.p. Blood glucose was measured at 0, 15, 30, 60, 120 minutes. Plasma glucagon was measured at 0 and 30 minutes.

10. Statistical analysis

Statistical significance was assessed by using the Student’s t test and analysis of variance (ANOVA) (GraphPad Prism 5). A p-value of less than 0.05 was considered significant. All data is expressed as the mean±SE.

CHAPTER 3. RESULTS

Objective

To better understand UCP2 function in β cells as well as to determine how β cell UCP2 contributes to whole body glucose homeostasis.

Hypothesis

1. Short-term UCP2 deletion in pancreatic β cells enhances insulin secretion while long-term UCP2 deletion causes oxidative stress and impairs insulin secretion.

2. UCP2 is a mild uncoupler which has a limited effect on ATP synthesis but influences ROS production.

Aim

1. Generate a UCP2 iBKO mouse line and confirm the efficient and specific deletion of UCP2 in the pancreatic β cells.

2. Characterize the in vivo metabolic parameters of the UCP2 iBKO mice.

3. Characterize the in vitro metabolic parameters of the UCP2 iBKO islets and primary β cells.

4. Characterize the in vitro metabolic parameters in functional UCP2 inhibited primary β cells and β cell lines where UCP2 is inhibited with genipin.

Results

1. Validation of the mouse model

1.1 Genotyping.

In order to establish the zygosity for loxUCP2 and the presence of Cre transgene in the mice, genomic DNA extracted from ear notch samples followed by standard multiplex PCR was performed. Figure 3.1A illustrates that the amplification of a band of 380bp was a homozygous mouse for loxUCP2, a band of 270bp was a wildtype mouse, and both bands together represented a heterozygous mouse 57, 106 . The presence of the Cre transgene was also ascertained using RT-PCR, where a 250bp band represented Cre-positive mice 57 . A PCR sample with water was used as a negative control to confirm whether there was any false positive amplification.

A. B. Islets Hypothalamus iBKO CO iBKO CO

Cre Floxed UCP2 Floxed WT UCP2 Δ Exons3&4

Figure 3. 1. Effective UCP2 deletion specifically from pancreatic β cells . A. Typical PCR results from mouse genotyping fpr loxUCP2 (floxing) and Cre expression. B. Standard PCR of islets and hypothalamus shows full-length UCP2 transcripts and truncated UCP2 (∆) where exons 3 and 4 have been removed by Cre recombinase activity. Wt, wild type.

1.2 Knockdown of UCP2 transcript in β cells and validation of the mouse model.

To assess the specificity of UCP2 knockdown in pancreatic β cells, standard RT-PCR was performed on islet and hypothalamic RNA devoid of genomic DNA that had been reverse transcribed to cDNA. A UCP2 deletion band was observed in whole iBKO islets. Note that the expression of UCP2 in non- β cells contributes to the detectable UCP2 expression in whole islets, which explain the co-existence of both a wild-type and truncated band in UCP2 iBKO islet sample 57 . A very faint UCP2 deletion band was observed in CO islets, suggesting some aberrant expression of the Cre recombinase transgene in the absence of tamoxifen. UCP2 deletion was not observed in the hypothalamus (Figure 3.1B ), indicating that our novel inducible model has improved β cell specificity compared to the UCP2 BKO model, which showed some deletion of UCP2 in the hypothalamus 101, 106 .

To confirm the specificity of Cre expression in β cells, the MIPCreER×ROSA26eYFP mice were used because there was no good UCP2 antibody available. MIPCreER×ROSA26eYFP mice were received tamoxifen or corn oil administration in the same way as MIPCreER×loxUCP2 mice and islets were isolated 3-4 weeks after the last injection. Immunofluorescent staining of dispersed MIPCreER×ROSA26eYFP islet cells showed YFP protein co-localized with insulin expressing β cells in the mice injected with tamoxifen, indicating that the MIPCreER construct shows tamoxifen inducible, β cell-specific Cre recombinase. The efficiency of recombination was approximately 75% (Figure 3.2). In line with the faint UCP2 deleted discussed above, very infrequently a YFP positive, insulin-expressing cell was observed in the corn oil injected mice ( Figure 3.2). YFP protein was not localized in glucagon positive α cells.

Tamoxifen CO Tamoxifen CO

Insulin + YFP Glucagon + YFP

Figure 3.2. Co -localization of insulin and YFP in MIPCreER×ROSA26eYFP islet cells. Immunostaining of insulin (red) (left panels)/glucagon (right panels), and YFP (green) in dispersed islet cells of MIPCreER×ROSA26eYFP mice that received tamoxifen administration showed 75% insulin expressing cells were also YFP positive but glucagon expressing cells were all YFP negative. In comparison, the islet cells of mice that received corn oil showed very infrequent YFP positive insulin expressing cells. Scale bar = 50µm.

A . B. 20 0.4 0.35 15 0.3 0.25 10 0.2 0.15 5 0.1

Blood Glucose (mM) Glucose Blood 0.05 Plasma Insulin (ng/ml) Insulin Plasma 0 0 0 20 40 60 80 100 120 0 20 40 60 Time (min) Time (min) CO Tmx C. D. 3.5 2000 3 2.5 1500 2 1000 1.5 (ngislets) 10 per

Insulin Secretion Insulin 1 500 0.5 0 (RFU) H2O2 Intracellular 0 1 LG HG Figure 3.3 . Tamoxifen treatment does not alter global glucose homeostasis . A. Tmx and CO mice did not display any difference in g lucose homeostasis during OGTT. B. Tmx and CO mice did not display any difference in plasma insulin levels during OGTT. C. Isolated islets from Tmx and CO mice did not display any difference in the ability of glucose to stimulate insulin secretion. D. The ROS levels of isolated islets from Tmx and CO mice did not display any difference. (n=6-8 per condition)

1.3 Determination of the potential effects of tamoxifen on glucose homeostasis, pancreatic β cell insulin secretion and islet ROS levels.

It was previously reported that tamoxifen, which is a fat-soluble mixed estrogen receptor antagonist/angonist, can affect mitochondrial membrane integrity and effectively uncouple the

mitochondrial electron transport chain from efficient ATP synthesis 113-114 . Therefore, I determined whether tamoxifen alone affected glucose homeostasis, insulin secretion, and/or islet ROS levels in our system. To accomplish this, 6-weeks old C57 BL/6 male mice were injected with either tamoxifen (Tmx) or corn oil (CO) in the same way as the MIPCreER×loxUCP2 mice. After the two weeks recovery period, OGTTs revealed no significant impact of tamoxifen on either glucose homeostasis or in vivo insulin secretion (n=6-8 mice per condition) ( Figure 3.3A & B). Additionally, in vitro GSIS assays indicated no significant difference in insulin secretion by islets isolated from Tmx- or CO-injected C57 BL/6 mice after exposure to high glucose (n=6-8 mice per condition) (Figure 3.3C). The islet ROS levels of Tmx- and CO-injected mice were also determined and no significant difference was observed between the two conditions ( Figure 3.3D). These results suggest that under the conditions studied, the dose and method of tamoxifen administration alone does not alter glucose homeostasis, islet insulin secretion or islet ROS levels.

2. Characterization of iBKO mice with short-term UCP2 deletion

Based on the hypothesis that different lengths of UCP2 deletion may cause different phenotypes, two sets of experiments after different times post injection were performed. Section 2 describes the results of short-term in vivo (2 weeks after the last injection) and in vitro (3-4 weeks after the last injection) experiments.

2.1 Body weight & fasting glucose.

Since body weight is also a potential factor that may influence glucose homeostasis, it was necessary to determine if iBKO mice have different weights compared to CO mice. Body weight was measured 2 weeks after the last tamoxifen or -corn oil injection. The body weight of UCP2 iBKO mice was not significantly different from CO mice. ( Figure 3.4A)

A. B. C. 30 10 8 7 25 8 6 20 6 5 15 4 4 3 (mmol/L) 10 (mmol/L)

Body Weight (g) Weight Body 2 5 2 4hr fast-Blood glucose glucose fast-Blood 4hr 1 16hr fast-Blood glucose glucose fast-Blood 16hr 0 0 0 1 1 1 CO iBKO Figure 3. 4. Body weight and fasting blood glucose. A. iBKO and CO mice had similar body weight. B. iBKO and CO mice had similar blood glucose after a 4-hr fast. (n=12-15 mice per condition) C. iBKO and CO mice displayed similar blood glucose levels aftr 16-hr fast. (n=10-12 per condition) 28

Previous studies on both UCP2 -/- and UCP2 BKO mice displayed similar fasting blood glucose compared to their respective controls 57 . I also determined the fasting glucose of UCP2 iBKO and CO mice after a 4-hr and 16-hr fast. Similarly, no significant difference was observed between these two groups. ( Figure 3.4B & C )

2.2 The short-term β cell specific UCP2 deletion does not impair glucose tolerance.

Previous studies performed by Zhang and colleagues on UCP2 -/- mice indicated that these mice had improved glucose tolerance 13 . However, it is hard to discriminate whether it is due to UCP2 deletion- dependent enhancement of insulin secretion or the effects of UCP2 deletion on other glucose- responsive central and peripheral tissues, including hypothalamus 106 , liver 115 , skeletal muscle 116-117 and adipose tissues 116, 118 . Our previous study on UCP2 BKO mice, on the other hand, showed that long-term deletion of UCP2 in the β cell impairs glucose tolerance, possibly due to enlarged α cell area and impaired suppression of glucagon secretion during an OGTT or the potential effects that come from the ectopic UCP2 deletion in a small population of glucose-responsive hypothalamic neurons 57 . Here, I examined glucose tolerance in the UCP2 iBKO model, an inducible shorter-term model of UCP2 deletion in the β cell which allows us to determine whether β cell-specific UCP2 deficiency would have any potential effect on global glucose homeostasis. An oral glucose tolerance test (OGTT) was conducted after a 16-hr fast. Interestingly, no significant differences in blood glucose levels between UCP2 iBKO and CO mice were observed after a gavage of 2g/Kg of glucose. (Figure 3.5A) The OGTT results were further analyzed by calculating the incremental area under the curve (iAUC), which allows an assessment of the overall glucose clearance over the entire glucose excursion. The UCP2 iBKO mice (1242.5±53.3mmol/L×120min) showed a similar response to glucose as the CO mice (1156.5±28.3mmol/L×120min) ( Figure 3.5B).

A. B. 16 1400 14 1200 12 1000 10 800 8

min) 600 6 400

Blood Glucose Blood 4

2 (mmol/L*120 iAUC 200

Concentration (mmol/L) Concentration 0 0 0 20 40 60 80 100 120 1 Time (min) CO iBKO

Figure 3.5 . Short -term UCP2 iBKO mice exhibit normal glucose tolerance . A. iBKO and CO mice displayed similar capacity of glucose tolerance during OGTT. B. OGTT resulted in no differences in response to glucose as assessed by incremental area under the curve (iAUC). (n=10-12 mice per condition)

2.3 Short-term β cell specific UCP2 deletion enhances plasma insulin levels during OGTT.

Zhang and colleagues found that UCP2 -/- mice displayed increased plasma insulin levels compared to the controls 13 , while our previous studies showed that UCP2 BKO mice displayed similar plasma insulin compared to the controls 57 . Thus, the plasma insulin levels of UCP2 iBKO and CO mice were also assessed during OGTT. Insulin concentration was measured in plasma samples collected at 0, 10, 20 and 60 minutes after oral glucose gavage. Despite there being no difference in glucose tolerance between iBKO and CO groups, the iBKO mice tended to have higher fasting plasma insulin levels (Figure 3.6A) and displayed significantly higher levels of in vivo glucose-stimulated insulin secretion at 20min and 60min ( Figure 3.6B).

The plasma insulin levels were further analyzed by calculating the iAUC, which allows an assessment of the overall insulin secretion over the entire process of OGTT. The UCP2 iBKO mice (27.67±2.73ng/ml×60min) also showed a significantly higher overall response to glucose compared to the CO mice (19.39±1.49ng/ml×60min) ( Figure 3.6C).

A. B. C. 35 0.4 0.6 * * * 30 0.35 0.5 0.3 25 0.4 0.25 20 0.3 0.2 15 0.15 0.2 10 0.1

0.1 (ng/ml*60min) iAUC 5 Plasma Insulin (ng/ml) Insulin Plasma Plasma Insulin (ng/ml) Insulin Plasma 0.05 0 0 0 1 CO1 iBKO 0 20 40 60 Time (min)

D. E. 80 0 1 70 60 -10 50 -20 40 30 -30 20 glucagon (pg/ml) glucagon -40

10 plasma of change Net Plasma Glucagon (pg/ml) Glucagon Plasma 0 1 -50

Figure 3.6 . Short -term UCP2 iBKO mice exhibit in vivo glucagon secretion but enhanced in vivo insulin secretion during OGTT . A. iBKO mice tended to have higher fasting plasma insulin levels compared to CO mice but not quite significant. (n=10-12 mice per condition) B. iBKO mice had significantly higher plasma insulin levels during OGTT compared to CO mice. (n=10-12 mice per condition, *p<0.05) C. OGTT resulted higher insulin secretion of iBKO mice in response to glucose as assessed by incremental area under the curve (n=10-12 mice per condition, *p<0.05) D. iBKO and CO mice displayed similar fasting plasma glucagon. (n= 8 per condition) E. iBKO and CO mice displayed similar net change of plasma glucagon levels from fasting to 10min. (n=8 per condition )

2.4 Short-term β cell specific UCP2 deletion does not influence plasma glucagon levels during OGTT.

The previous study from our lab suggested that the UCP2 BKO mice displayed elevated plasma glucagon from 0 to 10min while the controls decreased glucagon from 0 to 10min during OGTT 57 . This abnormal elevation of glucagon may contribute to the glucose intolerance of UCP2 BKO mice. However, our UCP2 iBKO mice displayed normal glucose tolerance but enhanced plasma insulin. Thus, glucagon concentration of UCP2 iBKO and CO mice was also measured to determine whether glucagon was also elevated to compensate the elevation of insulin to maintain normal glucose tolerance. Plasma samples collected from 0 to 10 minutes after oral glucose gavage and glucagon levels were measured using RIA. Interestingly, however, UCP2 iBKO and CO mice displayed similar levels of fasting plasma glucagon and a similar decrease in glucagon from 0 to 10min. (Figure 3.6D & E)

2.5 Short-term UCP2 deletion does not impair insulin sensitivity.

To further explore the potential reasons that lead to sustained elevated plasma insulin levels in iBKO mice observed in OGTT, it was necessary to eliminate the possibility of insulin resistance. Thus insulin sensitivity was assessed by an insulin tolerance test (ITT), which is an indicator of insulin resistance in peripheral tissues such as liver, muscle and adipose tissues119 . A dose of 1.5 IU/Kg of insulin was injected intraperitoneally after a 4-hr fast. No significant differences were observed between iBKO and CO mice, indicating the elevated plasma insulin of iBKO mice during OGTT may not be a sign of insulin resistance but possibly due to enhanced in vivo insulin secretion upon glucose stimulation. ( Figure 3.7)

A. 10

0 Plasma Glucose (mmol/L) Glucose Plasma 0 20 40 60 80 100 120 Time (min)

CO iBKO

Figure 3.7 . Short -term UCP2 iBKO mice exhibit normal insulin sensitivity. After 4-hr fast, iBKO and CO mice received a bolus of insulin and blood glucose concentrations over the next 120min were measured. iBKO and CO mice displayed similar blood glucose levels, which represents similar peripheral insulin sensitivity. (n=12-15 per condition)

2.6 UCP2 deficiency in β-cells enhances GSIS in vitro .

Previous studies using UCP2 -/- and UCP2 BKO mice have demonstrated that UCP2 deletion in the β cell since embryonic formation resulted in improved insulin secretion in vitro 13, 57 . To determine whether induced UCP2 deletion would have a similar effect on isolated islets, static insulin secretion assays were performed. The iBKO and CO islets had similar basal secretion levels in low glucose condition (2.8mM), while the iBKO islets secreted significantly more insulin/islet compared to CO islets in high glucose (16.7mM) ( Figure 3.8A). The diameters of iBKO and CO islets were not significantly different from each other, making it suitable to compare the insulin secretion capacity of iBKO and CO islets by normalizing the amount of insulin secretion to islet numbers ( Figure 3.8B).

A. B. 1 0.0014 * 0.0012 0.8 0.001 0.6 0.0008 0.4 0.0006 0.0004 0.2 0.0002 Islet size (Arbitrary Unit) (Arbitrary size Islet Insulin Scretion (ng/islet) Scretion Insulin 0 0 1 LG HG 1 CO iBKO

Figure 3.8 . Short -term UCP2 iBKO islets exhibit enhanced insulin secretion under the stimulation of high glucose . A. iBKO islets displayed enhanced GSIS comparing to CO islets. LG = low glucose (2.8mM); HG = high glucose (16.7mM) B.The islet diameters of iBKO and CO were not significantly different (n=6 mice per condition, *p<0.05)

2.7 Short-term UCP2 deletion/functional inhibition in primary β cells impairs glucose induced mitochondrial membrane hyperpolarization

A previous study from our lab on UCP2 BKO islet cells demonstrated that UCP2 deletion in the β cell leads to enhanced glucose-induced mitochondrial hyperpolarization 57 , which potentially represents a consequence of lower level of uncoupling and greater respiratory flux. Similarly, Zhang and colleagues showed that genipin, a UCP2 inhibitor derived from herbal medicine, can inhibit UCP2-dependent proton leak in hypothalamic neurons 99 .

Thus, I first determined the effect of short-term UCP2 deficiency (3-4 weeks after the last tamoxifen or corn oil injection) on mitochondrial membrane potential. The mitochondrial membrane potential of iBKO and CO β cells in basal and high glucose conditions were measured. Basally (2.8mmol/L

glucose), iBKO and CO β cells have similar ∆Ψ m, supporting the notion that UCP2 is not involved in the classical proton leak in β cells; interestingly, however, in the presence of high glucose (16.7mmol/L glucose), the glucose-induced mitochondrial membrane hyperpolarization of iBKO β cells was significantly reduced compared with CO β cells ( Figure 3.9A & B).

The effect of short-term UCP2 deficiency can be mimicked by treating wild-type primary β cells with genipin. Genipin only enhanced insulin secretion of wild-type isolated islets rather than UCP2 -/- islets with a minimum concentration of 50nM, indicating that genipin’s effect was dependent on the presence of UCP2 99 . Previous published studies showed inhibition of UCP2 activity using a range of 10-100µM genipin on 3T3-1L adipocytes, 50nM-10µM genipin on islets, and 50µM on isolated mitochondria 99, 120 . In previous studies in our lab, people treated islets with 50µM genipin for 1hr and 2hrs 57 . Therefore, 50µM genipin was the concentration being initially used and after 2hrs treatment the dispersed cells looked healthy.

A. 40 B. * 1500 30 * 1300 Δ2 20 Δ3 1100 Δ1 10 Δ1 900

potential High glucose NaN 0 3 1 700 (% normalized (% basal) -10 Δ2 Δ3 Mitochondrialmembrane 500 Mitochondrialmembrane 0 20 40 60 80 100 -20 * (Fluorescentpotential Intensity) CO iBKO Number of frames CO iBKO C. D. 30 1500

20 1300 Δ2 * Δ3 1100 10 Δ1 Δ1 900

0 High glucose NaN 3 potentialo 1 700 Δ2 Δ3 -10 500 (% normalized (% tobasal) Mitochondrialmembrane

Mitochondrialmembrane 0 20 40 60 80 100

-20 (Fluorescentpotential Intensity) Number of frames * Control Genipin Control Genipin

Figure 3.9 . The mitochondrial membrane potential of short -term UCP2 deficient islet cells . ∆1 , the change in mitochondrial membrane hyperpolarization in response to increased glucose concentration. ∆2 , the change in mictochondrial membrane depolarization in response to NaN3 above basal membrane potential. ∆3 , the change in mitochondrial depolarization in response to NaN 3 above the mitochondrial membrane hyperpolarization in response to increased glucose concentration. A. Basally (2.8mmol/L glucose), iBKO and CO β cells have similar ∆Ψ m. However, in the presence of high glucose (16.7mmol/L glucose), the glucose-induced mitochondrial membrane hyperpolarization of iBKO β cells was significantly reduced compared with CO β cells, which was represented by decreased ∆1. In the presence of NaN 3, the mitochondrial membrane depolarization of iBKO β cells was significantly reduced compared with CO β cells as well, which was represented by decreased ∆2 and ∆3. B. Representative traces of the change of mitochondrial membrane potential of iBKO and COβ cells. . C. Basally (2.8mmol/L glucose), genipin treated and control β cells have similar ∆Ψm. However, in the presence of high glucose (16.7mmol/L glucose), the glucose-induced mitochondrial membrane hyperpolarization of genipin treated β cells was significantly reduced compared with control β cells, which was represented by decreased ∆1. In the presence of NaN3, the mitochondrial membrane depolarization of genipin treated β cells was significantly reduced compared with control β cells as well, which was represented by decreased ∆2 and ∆3. D. Representative traces of the change of mitochondrial membrane potential of genipin treated and control β cells.

The mitochondrial membrane potential of primary β cells from C57BL/6 mice treated with 50µM genipin or vehicle control were also measured and compared. Basally (2.8mmol/L glucose), genipin treated cells have similar ∆Ψ m compared to the controls. Similar to the iBKO primary cells, the glucose-induced mitochondrial membrane hyperpolarization of genipin treated cells (in high glucose condition) was significantly impaired compared with the controls ( Figure 3.9C & D).

These results suggest that unlike the long-term UCP2 deficiency in the UCP2 BKO model, short- term UCP2 deficiency in UCP2 iBKO model or functional inhibition caused by genipin leads to impaired glucose-induced mitochondrial membrane hyperpolarization instead.

2.8 Short-term UCP2 deletion in β cells decreases ROS levels

Our previous study on UCP2 BKO islet cells demonstrated that UCP2 deletion in the β cell leads to 57 elevated islet H2O2 levels . Thus, I determined whether a relatively short-term UCP2 deficiency (3- 4 weeks after the last tamoxifen injection, Figure 2.1B Chapter 2 ) would have a similar effect on

H2O2 levels. The intracellular ROS levels were measured using a cell-permeable fluorescent H 2O2 121 indicator (CM-H2-DCFDA) . Interestingly, however, short-term UCP2 iBKO islets displayed significantly lower intracellular ROS levels compared with CO control islets ( Figure 3.10 ).

2000 ***

(RFU) 1500 2 O 2 1000

500 Intracellular H Intracellular 0 1 CO iBKO Figure 3.10 . Short -term UCP deleted iBKO isle ts exhibit decreased ROS levels. Total islet ROS measurements showed that iBKO islets had lower ROS levels compared to CO islets 4 weeks after tamoxifen or corn oil treatment. (n=6 mice per condition, ***p<0.001)

2.9 Short-term UCP2 functional inhibition in β cells decreases ROS levels

The effect of UCP2 deficiency can be mimicked by treating β cells with genipin as described above. Genipin can also be used to determine whether functional inhibition of UCP2 by genipin would lead to similar patterns of ROS levels to the iBKO islets. The goal was to compare the potential different impacts between relatively short-term and long-term UCP2 inhibition on the intracellular ROS levels of β cells. However, isolated islets and dispersed primary β cells can only be maintained healthy for

24hr-48hrs. Therefore, min-6 cells, a mouse insulinoma cell line, were used for the following experiments: 25µM and 50µM genipin was used based on previous studies described above in section 3.2. The effects of treating min-6 cells 25µM and 50µM genipin were determined and the 2hrs treatment was regarded as a short-term experiment compared to chronic 5 day treatment in Section 3.6 . After being treated with 25µM genipin for 2hrs, the intracellular ROS levels in min-6 cells were not significantly changed ( Figure 3.11A). After being treated with 50µM genipin for 2hrs, intracellular ROS levels of min-6 cells were much lower compared to the controls ( Figure 3.11B).

2hrs 2hrs

A. B. 800 1400 700 1200 *

(RFU) 600 (RFU)

2 2 1000 O O

2 500 2 800 400 600 300 200 400 100 200 Intracellular H Intracellular 0 H Intracellular 0 Genipin 25μM1 50μ1 M concentration Control Genipin

Figure 3.11 . Short -term UCP2 inhibited min -6 cells exhibit decr eased ROS levels . A. min-6 cells treated with 25µM genipin for 2hrs had similar ROS levels compared to control cells. (n=9 coverslips from 3 independent experiments) B. min-6 cells treated with 50µM genipin for 2hrs had lower ROS levels compared to control cells. (n=9 coverslips from 3 independent experiments, *p<0.05)

2.10 Short-term UCP2 deficiency does not affect islet ATP content

Our previous study on UCP2 BKO islet cells demonstrated that UCP2 deletion in the β cell did not cause any significant change of islet ATP levels, indicating that UCP2 only serves as a mild uncoupler 57 . Thus, I also determined the effect of a more short-term UCP2 deletion in UCP2 iBKO islets on ATP levels. Similar to UCP2 BKO islets, iBKO and CO islets did not display significantly different ATP levels under both low and high glucose conditions, indicating that both genotypes have similar rates of uncoupling respiration. ( Figure 3.12 )

A. 16 14 12 10 8 6 4 ATP (pmol/islet) ATP 2 0 1 LG HG Figure 3. 12. ATP contents of UCP2 iBKO and CO islets were similar. Total islet ATP measurements showed no difference between iBKO and CO islets in both low and high glucose conditions (n=6 mice per condition)

3. In vivo and in vitro characterization of UCP2 iBKO mice with long-term UCP2 deletion

Section 3 describes the results of the effects of long-term in vivo (7 weeks after the last injection) and in vitro (8-9 weeks after the last injection) deletion of UCP2 in β cells.

3.1 Body weight, fasting glucose and fasting insulin.

The above studies showed that UCP2 iBKO mice with short-term UCP2 deletion displayed similar body weight and fasting blood glucose compared to their respective controls. Thus, I compared whether long-term UCP2 deletion had a different impact on body weight and fasting blood glucose. Therefore, the blood glucose after a 16-hr fast was also determined. Similarly, no difference was observed between these two groups. ( Figure 3.13)

A. B. 35 6 30 5 25 4 20 3 15

(mmol/L) 2 10

Body Weight (g) Weight Body 1

5 glucose blood Fasting 0 0 1 CO1 iBKO Figure 3. 13. Body weight and fasting blood glucose. A. iBKO and CO mice had similar body weight. B. iBKO and CO mice had similar blood glucose after a 16 -hr fast. (n= 4-5 mice per condition )

3.2 The long-term β cell specific UCP2 deletion does not impair glucose tolerance.

The above studies showed that UCP2 iBKO mice with short-term UCP2 deletion displayed similar glucose tolerance compared to their respective controls. Thus, I investigated whether long-term UCP2 deletion had a different impact on glucose tolerance. An OGTT was conducted after a 16-hr fast. Interestingly, no significant differences in blood glucose levels between UCP2 iBKO and CO

mice were observed after a gavage of 2g/Kg of glucose. ( Figure 3.14A) The OGTT results were further analyzed by calculating the iAUC, which allows an assessment of the overall glucose clearance over the entire OGTT period. The UCP2 iBKO mice (1346.25±149.92mmol/L×120min) showed a similar response to glucose as the CO mice (1294.90±54.58mmol/L×120min) ( Figure 3.14B).

A. B. 25 1600 1400 20 1200 15 1000 800 10 600 400

(mmonl/L) 5 200

0 (mmol/L*120min) iAUC 0

¡ ¢ £ ¤ ¥ ¥¡

Blood gucose concentration concentration gucose Blood 1 CO iBKO Time (min)

C. D. E. 0.3 0.7 40 0.25 0.6 35 0.5 30 0.2 0.4 25 20 0.15 0.3 15 0.1 0.2 10 0.05 0.1

iAUC (ng/ml*60min) 5 Plasma Insulin (ng/ml) Insulin Plasma

Plasma insulin (ng/ml) insulin Plasma 0 0 0

Figure 3.14. Long-term UCP2 inducible BKO (iBKO) mice exhibited normal glucose tolerance but tended to have decreased plasma insulin levels during OGTT. A. iBKO and CO mice displayed similar capacity of glucose tolerance during OGTT. B. OGTT resulted in no differences in response to glucose as assessed by incremental area under the curve (iAUC). C. iBKO and CO mice displayed similar fasting plasma insulin after 16-hr fasting. D. iBKO mice tended to have lower plasma insulin levels at 60min during OGTT. E. OGTT tented to lead to lower insulin secretion of iBKO mice in response to glucose as assessed by incremental area under the curve (n=4-5 mice per condition)

3.3 The long-term β cell specific UCP2 deletion tended to impair in vivo plasma insulin secretion during OGTT

The above studies showed that UCP2 iBKO mice with short-term UCP2 deletion displayed enhanced insulin secretion during OGTT. Thus, I would like to compare whether long-term UCP2 deletion would have a different impact on in vivo insulin secretion. The plasma insulin levels of UCP2 iBKO and CO mice were assessed in plasma samples collected at 0, 10, 20 and 60 minutes after oral glucose gavage. UCP2 iBKO mice had similar fasting plasma insulin compared to CO mice ( Figure

3.14C ). However, in contrast to short-term UCP2 iBKO mice, the long-term iBKO mice tended to have lower plasma insulin levels at 60 min ( Figure 3.14D ). The plasma insulin levels were further analyzed by calculating the iAUC, which allows an assessment of the overall insulin secretion over the entire process of OGTT. The difference between UCP2 iBKO mice (27.67±2.73ng/ml×60min) and CO mice (19.39±1.49ng/ml×60min), however, were not quite significant ( Figure 3.14E ).

3.4 Long-term UCP2 deficiency in β-cells impaired GSIS in vitro .

Previous studies have shown divergent results regarding the influence of UCP2 on insulin secretion. The studies in UCP2 -/- and UCP2 BKO mice showed that UCP2 deletion in the β cell resulted in improved insulin secretion in vitro 13, 57 , while another study in UCP2 -/- mice on a different genetic background suggested that UCP2 deletion caused oxidative stress and thus impaired insulin secretion 95 . To reconcile these debates, GSIS were also performed on long-term UCP2 iBKO islets. The UCP2 iBKO and CO islets shared similar basal insulin secretion in low glucose condition (2.8mM), while the UCP2 iBKO islets secreted significantly lower insulin per islet compared to CO in high glucose (16.7mM) ( Figure 3.15A). The sizes of UCP2 iBKO and CO islets were not significantly different from each other, making it suitable to compare the insulin secretion capacity of iBKO and CO islets by normalizing the amount of insulin secretion to islet numbers (Figure 3.15B).

A. B.

0.5 0.0014 * 0.0012 0.4 0.001 0.3 0.0008 0.0006 0.2 0.0004 0.1 0.0002 0 Unit) (Arbitrary size Islet 0 Insulin Secretion (ng/islet) Secretion Insulin LG 1 HG 1

CO iBKO Figure 3.15 . Long -term UCP2 iBKO islets exhibit impaired insulin secretion under the stimulation of high glucose . A. iBKO islets displayed impaired GSIS comparing to CO islets. LG = low glucose (2.8mM); HG = high glucose (16.7mM) B.The islet sizes of iBKO and CO were not significantly different (n=3 mice per condition, *p<0.05)

3.5 Long-term UCP2 deletion in β cells increases ROS levels

It is essential to determine ROS levels in islets from long-term UCP2 iBKO mice in order to elucidate the potential mechanisms of impaired GSIS observed in Section 3.4 . The intracellular ROS 121 levels were measured using a cell-permeable fluorescent H 2O2 indicator (CM-H2-DCFDA) . 38

Interestingly, isolated islets from UCP2 iBKO mice displayed significantly higher intracellular ROS levels compared with CO control islets ( Figure 3.16 ).

2500

2000 ***

1500

1000

500

Intracellular H2O2 (RFU) H2O2 Intracellular 0 1 CO iBKO Figure 3.16. Long -term UCP deleted iBKO isle ts exhibit increased ROS levels. Total islet ROS measurements showed that iBKO islets had higher ROS levels compared to CO islets 8 weeks after tamoxifen or corn oil treatment. (n=4-5 mice per condition, ***p<0.001)

3.6 Long-term inhibition of UCP2 activity in β cells increases ROS levels

The effect of UCP2 deficiency can be mimicked by treating β cells with genipin as described above. 25µM and 50µM genipin were used based on previous studies described above in Section 2.7 . The effects of treating min-6 cells with 25µM and 50µM genipin for 5 days (which was regarded as a long-term experiment) were determined, compared to the 2hrs treatment (which was regarded as a short-term experiment) shown above in Section 2.9 .

In contrast to the 2hrs treatment, the min-6 cells treated with 25µM genipin for 5 days tended to have higher ROS levels which did not quite reach significance (Figure 3.17). The min-6 cells treated with 50µM genipin for 5 days were unhealthy and undergoing cell death, thus their ROS levels were not measured.

5days

1000

800 (RFU) 2 O 2 600

400

200

Intracellular H Intracellular 0 Genipin 25μM1 concentration Control Genipin

Figure 3.17. Long -term UCP2 in hibited min -6 cells tended to have increased ROS levels . min-6 cells treated with 25µM genipin for 5 days tended to have higher ROS levels compared to control cells. (n=9 coverslips from 3 independent experiments)

CHAPTER 4. DISCUSSION

Our current inducible β cell specific UCP2 deletion has lead to a different phenotype compared to what was observed in the previous UCP2 BKO and global UCP2 knockout models. The comparison of various metabolic parameters was listed in Table 4.1. For simplicity, the global knockout originally characterized by Zhang and colleagues will be referred as z UCP2 -/- and the knockout generated by Pi and colleagues as p UCP2 -/-.

The z UCP2 -/- mice showed equivalent body weight comparing to wild-type controls. Isolated islets from z UCP2 -/- mice showed enhanced glucose induced ATP production and insulin secretion. zUCP2 -/- mice displayed higher plasma insulin and improved glucose tolerance. Therefore, the investigation of z UCP2 -/- mice indicated that UCP2 served as a negative regulator of insulin secretion and may contribute to the development of T2D.

However, studies on p UCP2 -/- mice provided different point of view. p UCP2 -/- mice displayed chronic oxidative stress, which was represented by decreased GSH/GSSG ratio in blood and various organs/tissues, including islets. Additionally, p UCP2 -/- pancreatic islets had an increased compensatory oxidative stress response and impaired GSIS in vitro . These results suggested that UCP2 might protect the islets from oxidative stress and preserve their capacity of GSIS.

The generation and characterization of UCP2 BKO mice allowed us to specifically study the role of pancreatic β cell UCP2 on β cell function and glucose homeostasis. UCP2 BKO islets displayed enhanced ROS production and ROS-dependent insulin secretion, without any significant alterations in ATP levels. However, UCP2 BKO mice displayed increased α-cell area, abnormally enhanced glucagon secretion and glucose intolerance, possibly due to the intra-islet ROS signals altering α cell function 57 . In contrast to z UCP2 -/-, studies on UCP2 BKO mice suggested that UCP2 served as a mild uncoupling protein that only regulated ROS production to influence insulin secretion 57 . zUCP2 -/-, p UCP2 -/- and UCP2BKO mice all have UCP2 deleted during embryogenesis and thus UCP2 has been deleted from β cells for considerably longer. In contrast to the long-term UCP2 deletion in all the models listed above, our characterization of iBKO mice provided us a chance to look at the effects of induced β cell UCP2 deficiency.

Pancreatic β cell UCP2 and α cell function. In contrast to UCP2 BKO mice, glucagon levels were similarly suppressed in the UCP2 iBKO and CO injected mice during an OGTT, suggesting that compensatory effects on α cell function may not be observed in short-term deletion. Therefore, the

impaired glucose tolerance in the UCP2BKO mice and lack of effect on glucose tolerance in the short-term UCP2 iBKO mice might be partially explained by differential effects on α cell function.

Table 4.1. The phenotypical comparison of UCP2 -/-, UCP2 BKO and UCP2 iBKO models.

UCP2 iBKO UCP2 BKO zUCP2 -/- pUCP2 -/- Method of UCP2 Tamoxifen Cre-lox Replacement of Replacement of deletion induced CreER- Recombination introns 2-7 with exon 3-4 with lox recombination (deletion of PGK-neo PGK-neo (deletion of exon exon 3-4) cassette in UCP2 cassette in UCP2 3-4) gene from 129 gene from 129 mice, clones mice, clones microinjected microinjected into C57 BL/6 into C57 BL/6 mice mice, then backcrossed more than 12 generations onto pure strains Background Mixed 129/BL6 Mixed 129/BL6 Mixed 129/BL6 Pure strains of 129, B6 and A/J Glucose OGTT: no change OGTT: Improved GT N/A Tolerance (GT) (Figure3.5 ) impaired GT ipGTT: no change Insulin No change No change No change N/A sensitivity (Figure3.7 ) Mitochondrial ↓Glucose-induced ↑ Glucose- No change N/A membrane hyperpolarization induced potential (Figure3.9 ) hyperpolarizatio n Insulin secretion ↑GSIS ↑GSIS ↑GSIS ↓GSIS (In vitro ) (Figure3.8 ) Islet ATP content No change No change ↑ATP content N/A (Figure3.12 ) Basal ROS Short-term:↓ROS ↑Basal ROS ↑Basal ROS ↑Basal ROS accumulation Long-term:↑ROS (DCF) (Figure3.10 ) Anti-oxidant N/A ↑Expression of N/A ↑Expression of enzyme Gpx3, Gpx4 Sod1-3, Gpx2, expression Gpx4, Cat, HO-1

Pancreatic β cell UCP2 and ROS. By utilizing this UCP2 iBKO model, I showed that short-term iBKO mice displayed an increase of in vivo and in vitro glucose stimulated insulin secretion and decreased islet ROS levels, while long-term iBKO mice displayed impaired in vivo and in vitro glucose stimulated insulin secretion and increased islet ROS levels. Similarly, short-term genipin

treatment decreased the intracellular ROS levels in min-6 cells while long-term genipin treatment increased ROS levels. These differences between short-term and long-term UCP2 deletion/inhibition suggest that different durations of UCP2 deficiency may affect ROS background differently.

In order to explain the decreased ROS levels in short-term UCP2 iBKO islets and genipin treated cells, it is essential to point out the chain reaction to generate different types of ROS.

The major types of ROS include superoxide, hydrogen peroxide and hydroxyl radical. These three types of ROS are generated in the following chain reaction: While the mETC reduces oxygen to water, a small quantity of superoxide is also generated 122 . Superoxide is then converted into the more stable hydrogen peroxide by the catalysis of superoxide dismutases (SODs), which mainly includes SOD1 (copper-zinc SOD; Cu, Zn-SOD) and SOD2 (manganese SOD, Mn-SOD) 117-119 . Hydrogen peroxide has various possible fates: it can further be converted into hydroxyl radical, be metabolized to water by the catalysis of catalase, glutathione peroxide (GPx) and peroxiredoxin III (PrxIII), or serve as signaling molecule 123-124 . Thus, the levels of superoxide, hydrogen peroxide and hydroxyl radical are in flux until equilibrium is reached.

CM-H2DCFDA, the fluorescent dye that I used, mainly labels two types of ROS, hydrogen peroxide and hydroxyl radical. Therefore, there are two major possibilities to explain why lower ROS levels were observed in short-term UCP2 iBKO islets: One possibility could be that the acute UCP2 deletion caused increasing production of superoxide. However, the expression of SODs was not fully triggered to adapt to the elevated superoxide levels in the short-term UCP2 iBKO islets. Therefore, there was relatively lower amount of hydrogen peroxide and hydroxyl radical labeled by CM-

H2DCFDA. Another possibility could be that the entire antioxidant system had been quickly activated after UCP2 deletion and the overall ROS levels were low because of the efficient clearance of ROS. In order to test both possibilities, future studies shall determine mRNA and protein levels of major antioxidant genes, as well as the superoxide levels in short-term UCP2 iBKO islets, compared to CO islets.

As to the higher ROS levels observed in long-term UCP2 iBKO islets, it is possible that the cells had been adapted to cope with the enhanced superoxide generation by increasing the expressions of SODs, thus there was more hydrogen peroxide and hydroxyl radical being produced from superoxide by the catalysis of SODs. It is also possible that ROS had been gradually accumulated to the extent that the cells were maximized with their capability to deal with the ROS, thus the cells were stressed and the overall ROS levels were high. Future studies shall determine the levels of oxidized and

reduced forms of glutathione (GSH and GSSG) and to examine whether the long-term UCP2 iBKO islet cells are experiencing oxidative stress by determining the levels of oxidative stress markers and signaling pathway factors.

Pancreatic β cell UCP2 and insulin secretion. By utilizing this UCP2 iBKO model, I showed that both short-term and long-term deletion of UCP2 did not affect whole body glycemia over the time period studied, despite short-term iBKO mice displayed an increase of in vivo and in vitro glucose stimulated insulin secretion, while long-term iBKO mice displayed an impaired in vivo and in vitro glucose stimulated insulin secretion.

There are several potential explanations for the enhanced GSIS of short-term UCP2 iBKO islets despite the decreased islet ROS (mainly hydrogen peroxide) levels:

As I mentioned above, there’s a possibility that short-term UCP2 iBKO islets had enhanced superoxide but not enough SODs to convert superoxide to hydrogen peroxide. Therefore, it is possible that the assumed elevated superoxide was a critical signal that promotes insulin secretion. Despite the fact that certain physiological levels of ROS can promote insulin secretion, no study has ever addressed the question that whether there are specific ROS species that can promote insulin secretion. The previous studies in UCP2 BKO mice showed UCP2 deletion can cause both increased ROS and GSIS. Additionally, elevated hydrogen peroxide can directly promote insulin secretion. Thus, it is possible that superoxide and hydrogen peroxide are both significant ROS species that promote insulin secretion.

Another possibility is that short-term UCP deletion promoted nitric oxide (NO) generation. Several recent studies have proposed that UCP2 does not only modulate ROS production but also NO production: Bai and colleagues showed that macrophages from UCP2 -/- mice produced more NO upon the challenge of bacterial lipopolysaccharide (LPS) 125 ; Kizaki and colleagues showed that macrophage cell line displayed decreased UCP2 expression and increased NO levels upon LPS challenge 126 . Additionally, evidence indicates a possible link between NO production and insulin secretion, even though it is still under debate whether NO promotes 127 or suppresses 128-129 insulin secretion. Thus future investigation should be done to determine whether nitric oxide (NO) might also serve as a novel enhancer of insulin secretion in the iBKO islets, which displayed high capacity of GSIS independent on ATP and H 2O2 levels.

In contrast to the short-term UCP2 iBKO islets, the long-term UCP2 iBKO islets displayed decreased GSIS capability compared to CO islets. Based on the elevated ROS levels in these islets, it

is possible that a status of oxidative stress has been established in those β cells, causing impaired β cell function and decreased insulin secretion. The role of oxidative stress in β cell dysfunction and apoptosis has been well-established. Therefore, future studies shall determine whether oxidative stress exists in the long-term UCP2 iBKO β cells and whether those β cells have higher apoptotic rates compared to CO cells.

Pancreatic β cell UCP2 and mitochondrial membrane potential (MMP). Rhodamine 123, a cationic fluorescent dye for the specific labeling of respiring mitochondria, distributes according to the negative membrane potential across the mitochondrial inner membrane 130-131 . Glucose metabolism induces the transportation of protons into the intermembrane space which then leads to hyperpolarization of the intermembrane, the loss of proton motive force, loss of the dye and therefore, the fluorescence intensity 130-131 . The mitochondrial membrane potential of primary β cells was monitored using Rhodamine 123.

Oxidative phosphorylation is incompletely coupled, since protons can leak across the inner membrane and relieve proton motive force (∆p) independently of ATP synthase. Proton leak is usually classified into two categories: 1) Constitutive, basal proton conductance, Adenine nucleotide translocase (ANT) is a critical conductor that mediates basal proton leak independently of its ATP/ADP exchange or fatty-acid-dependent proton-leak functions 132 . 2) Regulated, inducible proton conductance catalyzed by uncoupling proteins (UCPs). UCP2 is an important pancreatic β cell UCP that mediates induced proton leak. Previous studies using the UCP2 BKO model indicated that UCP2 deficiency resulted in a slight but significantly higher level of glucose-dependent mitochondial membrane potential hyperpolarization and elevated ROS levels 57 . However, the findings in our short- term UCP2 deficient models were completely the opposite: The glucose-induced hyperpolarization in both iBKO and the genipin treated C57BL/6 primary β cells were impaired compared to their controls. The opposite results could be due to the difference between short-term and long-term UCP2 deficiency. One possible mechanism is that the short-term UCP2 deletion in β cells triggered compensational increased proton leak from other mitochondrial proton transporters, perhaps ANT.

The NaN 3-induced depolarization in both iBKO and the genipin treated C57BL/6 primary β cells were enhanced compared to their controls. It is an indication of enhanced mitochondrial capacity, possibly due to increased mitochondrial numbers.

Several previous studies have shown an elevation of islet ATP production because of UCP2 deletion 13, 96 , indicating that UCP2 influences the uncoupling respiration. However, our previous studies in UCP2 BKO islets showed no change in ATP levels compared to control islets, indicating 45

the UCP2 is a mild uncoupler that only influences ROS production rather than ATP generation. Similarly, the short-term UCP2 iBKO islets also showed no change in ATP levels compared to CO islets, possibly supporting the notion that UCP2 is a mild uncoupler. Another possibility is that the ATP level itself was not significantly changed but ATP/ADP ratio was enhanced in high glucose condition. However, there was currently no suitable kit to measure ATP/ADP ratio in 8-20 islets. Therefore, future studies shall determine both ATP and ADP levels and the respiratory rates in those islets to determine whether UCP2 is a mild uncoupler in this UCP2 iBKO model.

Tamoxifen treatment of control mice influenced neither glucose homeostasis nor insulin secretion. The availability of inducible cre/lox mouse models has facilitated the study of genes of interest with both cell specificity and temporal control. Here I used such a model to delete UCP2 in the β cells of adult mice. Tamoxifen, which is required to induce deletion, is recognized as an uncoupling agent and has also been shown to inhibit electron transfer in the respiratory chain at the levels of complex III (ubiquinol-cytochrome-c reductase) and complex IV (cytochrome-c oxidase) 113- 114 . One suggested function of UCP2 is to uncouple mitochondrial respiration and affect ATP synthesis. Therefore, to eliminate the possibility of tamoxifen having intracellular effects that negate the deletion of UCP2 I initially examined the effect of tamoxifen alone on glucose homeostasis and insulin secretion in control mice. Six week-old C57BL/6 mice treated with tamoxifen showed no difference in glucose tolerance compared to corn oil mice and plasma insulin levels during an OGTT and in vitro GSIS were also similar. These data indicated that the tamoxifen treatment itself, while causing efficient UCP2 deletion in pancreatic β cells of UCP2 iBKO mice, did not alter glucose homeostasis or islet function in control animals and thus validated the use of our model to explore the role of UCP2 in β cell function.

The advantages and disadvantages of the UCP2 iBKO mouse model. Wicksteed and colleagues have shown that the MIP is the most specific promoter to drive Cre recombination-dependent gene deletion in the β cells without driving cre expression in the brain 104 . Therefore, the UCP2 iBKO mouse model was created by crossing MIPCreER mice to loxUCP2 mice and this model allowed more acute deletion of UCP2 in adult mice, without deletion in the hypothalamus 104 .

The one limitation of this current model that must be acknowledged is that it is accompanied by a low but detectable level of basal Cre expression in the non-induced state, indicating tamoxifen- independent Cre recombination and potentially lower β cell UCP2 expression in the control compared to wild type mice 133 . I have also shown that MIPCreER construct had approximately 75%

CreER-dependent recombination in the MIPCreER cROSA26eYFP mouse islets. Previous studies by

Zhang and colleagues indicated that the amount of insulin that UCP2+/- mice secreted is between UCP2 -/- and wild-type mice 13 , indicating there is a potential dose-dependent effects of UCP2 deletion on insulin secretion. Thus, it is more suitable to regard that the iBKO and CO mice were comparison between two different levels of pancreatic β-cell-UCP2, rather than between full UCP2 deficiency and wild type UCP2 expression.

Future directions. Future studies shall focusing on elucidating the reasons that different lengths of UCP2 deletion lead to different islet ROS background and capacity of β cells to secrete insulin in response to glucose. Specifically, the following things shall be examined:

1) qPCR for UCP2 mRNA and western blots for UCP2 protein levels to further confirm the knockdown of UCP2 expression by tamoxifen.

2) The mRNA and protein levels of major antioxidant genes, the levels of oxidized and reduced forms of glutathione (GSH and GSSG), as well as the superoxide levels in both short-term and long- term UCP2 iBKO islets, compared to CO islets.

3) The levels of NO in short-term UCP2 iBKO islets compared to CO and whether insulin secretion is dependent on NO levels in this model.

4) The levels of both ATP and ADP levels and the respiratory rates in short-term UCP2 iBKO islets compared to CO islets to determine whether UCP2 is a mild uncoupler in this UCP2 iBKO model.

5) The levels of oxidative stress markers, signaling pathway factors and β cell apoptotic rate in long- term UCP2 iBKO islets.

Additionally, it is also necessary to select a mid-point in between short-term and long-term experiments to characterize the mice in order to better address the transition of the effects of pancreatic β cell UCP2 deletion.

REFERENCE

1. Cabrera O, Berman DM, Kenyon NS, Ricordi C, Berggren PO, Caicedo A. The unique cytoarchitecture of human pancreatic islets has implications for islet cell function. Proc Natl Acad Sci U S A. Feb 14 2006;103(7):2334-2339. 2. WHO I. Definition and diagnosis of diabetes mellitus and intermediate hyperglycemia. World Health Organization. 2006. 3. Bloomgarden ZT. American Diabetes Association 60th Scientific Sessions, 2000: glucose tolerance, diabetes and cancer, glycemic control, monitoring, and related topics. Diabetes Care. Apr 2001;24(4):779-784. 4. Kelly MA, Rayner ML, Mijovic CH, Barnett AH. Molecular aspects of type 1 diabetes. Mol Pathol. Feb 2003;56(1):1-10. 5. Matthaei S, Stumvoll M, Kellerer M, Haring HU. Pathophysiology and pharmacological treatment of insulin resistance. Endocr Rev. Dec 2000;21(6):585-618. 6. Amed S, Daneman D, Mahmud FH, Hamilton J. Type 2 diabetes in children and adolescents. Expert Rev Cardiovasc Ther. Mar;8(3):393-406. 7. AusDiab 2005 Tracking the Accelerating Epidemic: Its Causes and Outcomes. The Australian Diabetes, Obesity and Lifestyle Study (AusDiab). 8. Brand MD, Esteves TC. Physiological functions of the mitochondrial uncoupling proteins UCP2 and UCP3. Cell Metab. Aug 2005;2(2):85-93. 9. Bouillaud F, Couplan E, Pecqueur C, Ricquier D. Homologues of the uncoupling protein from brown adipose tissue (UCP1): UCP2, UCP3, BMCP1 and UCP4. Biochim Biophys Acta. Mar 1 2001;1504(1):107-119. 10. Arsenijevic D, Onuma H, Pecqueur C, et al. Disruption of the uncoupling protein-2 gene in mice reveals a role in immunity and reactive oxygen species production. Nat Genet. Dec 2000;26(4):435-439. 11. Brand MD, Parker N, Affourtit C, Mookerjee SA, Azzu V. Mitochondrial uncoupling protein 2 in pancreatic beta-cells. Diabetes Obes Metab. Oct 2010;12 Suppl 2:134-140. 12. Couplan E, del Mar Gonzalez-Barroso M, Alves-Guerra MC, Ricquier D, Goubern M, Bouillaud F. No evidence for a basal, retinoic, or superoxide-induced uncoupling activity of the uncoupling protein 2 present in spleen or lung mitochondria. J Biol Chem. Jul 19 2002;277(29):26268-26275.

13. Zhang CY, Baffy G, Perret P, et al. Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes. Cell. Jun 15 2001;105(6):745-755. 14. Gonzalez-Barroso MM, Giurgea I, Bouillaud F, et al. Mutations in UCP2 in congenital hyperinsulinism reveal a role for regulation of insulin secretion. PLoS ONE. 2008;3(12):e3850. 15. Gable DR, Stephens JW, Cooper JA, Miller GJ, Humphries SE. Variation in the UCP2-UCP3 gene cluster predicts the development of type 2 diabetes in healthy middle-aged men. Diabetes. May 2006;55(5):1504-1511. 16. Hsu YH, Niu T, Song Y, Tinker L, Kuller LH, Liu S. Genetic variants in the UCP2-UCP3 gene cluster and risk of diabetes in the Women's Health Initiative Observational Study. Diabetes. Apr 2008;57(4):1101-1107. 17. Krempler F, Esterbauer H, Weitgasser R, et al. A functional polymorphism in the promoter of UCP2 enhances obesity risk but reduces type 2 diabetes risk in obese middle-aged humans. Diabetes. Nov 2002;51(11):3331-3335. 18. Jia JJ, Zhang X, Ge CR, Jois M. The polymorphisms of UCP2 and UCP3 genes associated with fat metabolism, obesity and diabetes. Obes Rev. Sep 2009;10(5):519-526. 19. St-Pierre J, Buckingham JA, Roebuck SJ, Brand MD. Topology of superoxide production from different sites in the mitochondrial electron transport chain. J Biol Chem. Nov 22 2002;277(47):44784-44790. 20. Evans P, Halliwell B. Free radicals and hearing. Cause, consequence, and criteria. Ann N Y Acad Sci. Nov 28 1999;884:19-40. 21. Jaburek M, Varecha M, Gimeno RE, et al. Transport function and regulation of mitochondrial uncoupling proteins 2 and 3. J Biol Chem. Sep 10 1999;274(37):26003-26007. 22. Goglia F, Skulachev VP. A function for novel uncoupling proteins: antioxidant defense of mitochondrial matrix by translocating fatty acid peroxides from the inner to the outer membrane leaflet. FASEB J. Sep 2003;17(12):1585-1591. 23. Jaburek M, Miyamoto S, Di Mascio P, Garlid KD, Jezek P. Hydroperoxy fatty acid cycling mediated by mitochondrial uncoupling protein UCP2. J Biol Chem. Dec 17 2004;279(51):53097-53102. 24. Sako Y, Grill VE. A 48-hour lipid infusion in the rat time-dependently inhibits glucose- induced insulin secretion and B cell oxidation through a process likely coupled to fatty acid oxidation. Endocrinology. Oct 1990;127(4):1580-1589.

25. Zhou YP, Grill VE. Long-term exposure of rat pancreatic islets to fatty acids inhibits glucose- induced insulin secretion and biosynthesis through a glucose fatty acid cycle. J Clin Invest. Feb 1994;93(2):870-876. 26. Lameloise N, Muzzin P, Prentki M, Assimacopoulos-Jeannet F. Uncoupling protein 2: a possible link between fatty acid excess and impaired glucose-induced insulin secretion? Diabetes. Apr 2001;50(4):803-809. 27. Saleh MC, Wheeler MB, Chan CB. Endogenous islet uncoupling protein-2 expression and loss of glucose homeostasis in ob/ob mice. J Endocrinol. Sep 2006;190(3):659-667. 28. Galetti S, Sarre A, Perreten H, Produit-Zengaffinen N, Muzzin P, Assimacopoulos-Jeannet F. Fatty acids do not activate UCP2 in pancreatic beta cells: comparison with UCP1. Pflugers Arch. Feb 2009;457(4):931-940. 29. Liu YQ, Tornheim K, Leahy JL. Glucose-fatty acid cycle to inhibit glucose utilization and oxidation is not operative in fatty acid-cultured islets. Diabetes. Sep 1999;48(9):1747-1753. 30. Shimabukuro M, Zhou YT, Lee Y, Unger RH. Troglitazone lowers islet fat and restores beta cell function of Zucker diabetic fatty rats. J Biol Chem. Feb 6 1998;273(6):3547-3550. 31. Tordjman K, Standley KN, Bernal-Mizrachi C, et al. PPARalpha suppresses insulin secretion and induces UCP2 in insulinoma cells. J Lipid Res. Jun 2002;43(6):936-943. 32. Medvedev AV, Robidoux J, Bai X, et al. Regulation of the uncoupling protein-2 gene in INS- 1 beta-cells by oleic acid. J Biol Chem. Nov 8 2002;277(45):42639-42644. 33. Sako Y, Grill VE. Coupling of beta-cell desensitization by hyperglycemia to excessive stimulation and circulating insulin in glucose-infused rats. Diabetes. Dec 1990;39(12):1580- 1583. 34. Zhou YT, Shimabukuro M, Koyama K, et al. Induction by leptin of uncoupling protein-2 and enzymes of fatty acid oxidation. Proc Natl Acad Sci U S A. Jun 10 1997;94(12):6386-6390. 35. Elliott PJ, Jirousek M. Sirtuins: novel targets for metabolic disease. Curr Opin Investig Drugs. Apr 2008;9(4):371-378. 36. Bordone L, Motta MC, Picard F, et al. Sirt1 regulates insulin secretion by repressing UCP2 in pancreatic beta cells. PLoS Biol. Feb 2006;4(2):e31. 37. Yamamoto H, Schoonjans K, Auwerx J. Sirtuin functions in health and disease. Mol Endocrinol. Aug 2007;21(8):1745-1755. 38. Picard F, Kurtev M, Chung N, et al. Sirt1 promotes fat mobilization in white adipocytes by repressing PPAR-gamma. Nature. Jun 17 2004;429(6993):771-776.

39. Yoon JC, Xu G, Deeney JT, et al. Suppression of beta cell energy metabolism and insulin release by PGC-1alpha. Dev Cell. Jul 2003;5(1):73-83. 40. Oberkofler H, Hafner M, Felder T, Krempler F, Patsch W. Transcriptional co-activator peroxisome proliferator-activated receptor (PPAR)gamma co-activator-1beta is involved in the regulation of glucose-stimulated insulin secretion in INS-1E cells. J Mol Med (Berl). Mar 2009;87(3):299-306. 41. Liu C, Lin JD. PGC-1 coactivators in the control of energy metabolism. Acta Biochim Biophys Sin (Shanghai). Apr 2011;43(4):248-257. 42. Wang MY, Shimabukuro M, Lee Y, et al. Adenovirus-mediated overexpression of uncoupling protein-2 in pancreatic islets of Zucker diabetic rats increases oxidative activity and improves beta-cell function. Diabetes. May 1999;48(5):1020-1025. 43. White DW, Kuropatwinski KK, Devos R, Baumann H, Tartaglia LA. Leptin receptor (OB-R) signaling. Cytoplasmic domain mutational analysis and evidence for receptor homo- oligomerization. J Biol Chem. Feb 14 1997;272(7):4065-4071. 44. Nakae J, Cao Y, Oki M, et al. Forkhead transcription factor FoxO1 in adipose tissue regulates energy storage and expenditure. Diabetes. Mar 2008;57(3):563-576. 45. Pecqueur C, Alves-Guerra MC, Gelly C, et al. Uncoupling protein 2, in vivo distribution, induction upon oxidative stress, and evidence for translational regulation. J Biol Chem. Mar 23 2001;276(12):8705-8712. 46. Azzu V, Affourtit C, Breen EP, Parker N, Brand MD. Dynamic regulation of uncoupling protein 2 content in INS-1E insulinoma cells. Biochim Biophys Acta. Oct 2008;1777(10):1378-1383. 47. Hurtaud C, Gelly C, Bouillaud F, Levi-Meyrueis C. Translation control of UCP2 synthesis by the upstream open reading frame. Cell Mol Life Sci. Aug 2006;63(15):1780-1789. 48. Newsholme P, Bender K, Kiely A, Brennan L. Amino acid metabolism, insulin secretion and diabetes. Biochem Soc Trans. Nov 2007;35(Pt 5):1180-1186. 49. Azzu V, Brand MD. Degradation of an intramitochondrial protein by the cytosolic proteasome. J Cell Sci. Feb 15 2010;123(Pt 4):578-585. 50. Chan CB, MacDonald PE, Saleh MC, Johns DC, Marban E, Wheeler MB. Overexpression of uncoupling protein 2 inhibits glucose-stimulated insulin secretion from rat islets. Diabetes. Jul 1999;48(7):1482-1486. 51. Joseph JW, Koshkin V, Zhang CY, et al. Uncoupling protein 2 knockout mice have enhanced insulin secretory capacity after a high-fat diet. Diabetes. Nov 2002;51(11):3211-3219.

52. Chan CB, De Leo D, Joseph JW, et al. Increased uncoupling protein-2 levels in beta-cells are associated with impaired glucose-stimulated insulin secretion: mechanism of action. Diabetes. Jun 2001;50(6):1302-1310. 53. Echtay KS, Esteves TC, Pakay JL, et al. A signalling role for 4-hydroxy-2-nonenal in regulation of mitochondrial uncoupling. EMBO J. Aug 15 2003;22(16):4103-4110. 54. Graier WF, Trenker M, Malli R. Mitochondrial Ca2+, the secret behind the function of uncoupling proteins 2 and 3? Cell Calcium. Jul 2008;44(1):36-50. 55. Pecqueur C, Alves-Guerra C, Ricquier D, Bouillaud F. UCP2, a metabolic sensor coupling glucose oxidation to mitochondrial metabolism? IUBMB Life. Jul 2009;61(7):762-767. 56. Maechler P, Wollheim CB. Role of mitochondria in metabolism-secretion coupling of insulin release in the pancreatic beta-cell. Biofactors. 1998;8(3-4):255-262. 57. Robson-Doucette CA, Sultan S, Allister EM, et al. {beta}-Cell Uncoupling Protein 2 Regulates Reactive Oxygen Species Production, Which Influences Both Insulin and Glucagon Secretion. Diabetes. Nov 2011;60(11):2710-2719. 58. Bindokas VP, Kuznetsov A, Sreenan S, Polonsky KS, Roe MW, Philipson LH. Visualizing superoxide production in normal and diabetic rat islets of Langerhans. J Biol Chem. Mar 14 2003;278(11):9796-9801. 59. Gao L, Mann GE. Vascular NAD(P)H oxidase activation in diabetes: a double-edged sword in redox signalling. Cardiovasc Res. Apr 1 2009;82(1):9-20. 60. Kumar A, Singh CK, Lavoie HA, Dipette DJ, Singh US. Resveratrol restores Nrf2 level and prevents ethanol-induced toxic effects in the cerebellum of a rodent model of fetal alcohol spectrum disorders. Mol Pharmacol. Sep 2011;80(3):446-457. 61. Chen XL, Dodd G, Thomas S, et al. Activation of Nrf2/ARE pathway protects endothelial cells from oxidant injury and inhibits inflammatory gene expression. Am J Physiol Heart Circ Physiol. May 2006;290(5):H1862-1870. 62. Tiedge M, Lortz S, Drinkgern J, Lenzen S. Relation between antioxidant enzyme gene expression and antioxidative defense status of insulin-producing cells. Diabetes. Nov 1997;46(11):1733-1742. 63. Pi J, Bai Y, Zhang Q, et al. Reactive oxygen species as a signal in glucose-stimulated insulin secretion. Diabetes. Jul 2007;56(7):1783-1791. 64. Yang Y, Shi W, Cui N, Wu Z, Jiang C. Oxidative stress inhibits vascular K(ATP) channels by S-glutathionylation. J Biol Chem. Dec 3 2010;285(49):38641-38648.

65. Zinkevich NS, Gutterman DD. ROS-induced ROS release in vascular biology: redox-redox signaling. Am J Physiol Heart Circ Physiol. Sep 2011;301(3):H647-653. 66. Archer SL, Wu XC, Thebaud B, Moudgil R, Hashimoto K, Michelakis ED. O2 sensing in the human ductus arteriosus: redox-sensitive K+ channels are regulated by mitochondria-derived hydrogen peroxide. Biol Chem. Mar-Apr 2004;385(3-4):205-216. 67. Firth AL, Gordienko DV, Yuill KH, Smirnov SV. Cellular localization of mitochondria contributes to Kv channel-mediated regulation of cellular excitability in pulmonary but not mesenteric circulation. Am J Physiol Lung Cell Mol Physiol. Mar 2009;296(3):L347-360. 68. Fike CD, Aschner JL, Kaplowitz MR, Zhang Y, Madden JA. Reactive oxygen species (ROS) scavengers improve voltage gated K+ channel (Kv) function in resistance pulmonary arteries of piglets with chronic hypoxia-induced pulmonary hypertension. FASEB J. 2011;25(10). 69. Ruppersberg JP, Stocker M, Pongs O, Heinemann SH, Frank R, Koenen M. Regulation of fast inactivation of cloned mammalian IK(A) channels by cysteine oxidation. Nature. Aug 22 1991;352(6337):711-714. 70. McCormack T, McCormack K. Shaker K+ channel beta subunits belong to an NAD(P)H- dependent oxidoreductase superfamily. Cell. Dec 30 1994;79(7):1133-1135. 71. Chouinard SW, Wilson GF, Schlimgen AK, Ganetzky B. A potassium channel beta subunit related to the aldo-keto reductase superfamily is encoded by the Drosophila hyperkinetic locus. Proc Natl Acad Sci U S A. Jul 18 1995;92(15):6763-6767. 72. Chouinard SW, Lu F, Ganetzky B, Macdonald MJ. Evidence for voltage-gated potassium channel beta-subunits with oxidoreductase motifs in human and rodent pancreatic beta cells. Receptors Channels. 2000;7(3):237-243. 73. Fearon IM, Palmer AC, Balmforth AJ, Ball SG, Varadi G, Peers C. Modulation of recombinant human cardiac L-type Ca2+ channel alpha1C subunits by redox agents and hypoxia. J Physiol. Feb 1 1999;514 ( Pt 3):629-637. 74. Lacampagne A, Duittoz A, Bolanos P, Peineau N, Argibay JA. Effect of sulfhydryl oxidation on ionic and gating currents associated with L-type calcium channels in isolated guinea-pig ventricular myocytes. Cardiovasc Res. Nov 1995;30(5):799-806. 75. Gill JS, McKenna WJ, Camm AJ. Free radicals irreversibly decrease Ca2+ currents in isolated guinea-pig ventricular myocytes. Eur J Pharmacol. Mar 16 1995;292(3-4):337-340. 76. Holmberg SR, Cumming DV, Kusama Y, et al. Reactive oxygen species modify the structure and function of the cardiac sarcoplasmic reticulum calcium-release channel. Cardioscience. Mar 1991;2(1):19-25.

77. Zima AV, Blatter LA. Redox regulation of cardiac calcium channels and transporters. Cardiovasc Res. Jul 15 2006;71(2):310-321. 78. Luciani DS, Gwiazda KS, Yang TL, et al. Roles of IP3R and RyR Ca2+ channels in endoplasmic reticulum stress and beta-cell death. Diabetes. Feb 2009;58(2):422-432. 79. Lee B, Miles PD, Vargas L, et al. Inhibition of mitochondrial Na+-Ca2+ exchanger increases mitochondrial metabolism and potentiates glucose-stimulated insulin secretion in rat pancreatic islets. Diabetes. Apr 2003;52(4):965-973. 80. Pei Y, Lilly MJ, Owen DJ, et al. Efficient syntheses of benzothiazepines as antagonists for the mitochondrial sodium-calcium exchanger: potential therapeutics for type II diabetes. J Org Chem. Jan 10 2003;68(1):92-103. 81. Hamming KS, Soliman D, Webster NJ, et al. Inhibition of beta-cell sodium-calcium exchange enhances glucose-dependent elevations in cytoplasmic calcium and insulin secretion. Diabetes. Jul 2010;59(7):1686-1693. 82. Reeves JP, Bailey CA, Hale CC. Redox modification of sodium-calcium exchange activity in cardiac sarcolemmal vesicles. J Biol Chem. Apr 15 1986;261(11):4948-4955. 83. Kato M, Kako KJ. Na+/Ca2+ exchange of isolated sarcolemmal membrane: effects of insulin, oxidants and insulin deficiency. Mol Cell Biochem. Sep 1988;83(1):15-25. 84. Santacruz-Toloza L, Ottolia M, Nicoll DA, Philipson KD. Functional analysis of a disulfide bond in the cardiac Na(+)-Ca(2+) exchanger. J Biol Chem. Jan 7 2000;275(1):182-188. 85. Goldhaber JI. Free radicals enhance Na+/Ca2+ exchange in ventricular myocytes. Am J Physiol. Sep 1996;271(3 Pt 2):H823-833. 86. Habener JF, Stoffers DA. A newly discovered role of transcription factors involved in pancreas development and the pathogenesis of diabetes mellitus. Proc Assoc Am Physicians. Jan-Feb 1998;110(1):12-21. 87. Ohlsson H, Karlsson K, Edlund T. IPF1, a homeodomain-containing transactivator of the insulin gene. EMBO J. Nov 1993;12(11):4251-4259. 88. Kawamori D, Kajimoto Y, Kaneto H, et al. Oxidative stress induces nucleo-cytoplasmic translocation of pancreatic transcription factor PDX-1 through activation of c-Jun NH(2)- terminal kinase. Diabetes. Dec 2003;52(12):2896-2904. 89. Numazawa S, Sakaguchi H, Aoki R, Taira T, Yoshida T. Regulation of the susceptibility to oxidative stress by cysteine availability in pancreatic beta-cells. Am J Physiol Cell Physiol. Aug 2008;295(2):C468-474.

90. Nino Fong R, Fatehi-Hassanabad Z, Lee SC, Lu H, Wheeler MB, Chan CB. Uncoupling protein-2 increases nitric oxide production and TNFAIP3 pathway activation in pancreatic islets. J Mol Endocrinol. 2011;46(3):193-204. 91. Fridell YW, Sanchez-Blanco A, Silvia BA, Helfand SL. Targeted expression of the human uncoupling protein 2 (hUCP2) to adult neurons extends life span in the fly. Cell Metab. Feb 2005;1(2):145-152. 92. Mattiasson G, Shamloo M, Gido G, et al. Uncoupling protein-2 prevents neuronal death and diminishes brain dysfunction after stroke and brain trauma. Nat Med. Aug 2003;9(8):1062- 1068. 93. Teshima Y, Akao M, Jones SP, Marban E. Uncoupling protein-2 overexpression inhibits mitochondrial death pathway in cardiomyocytes. Circ Res. Aug 8 2003;93(3):192-200. 94. Collins P, Jones C, Choudhury S, Damelin L, Hodgson H. Increased expression of uncoupling protein 2 in HepG2 cells attenuates oxidative damage and apoptosis. Liver Int. Aug 2005;25(4):880-887. 95. Pi J, Bai Y, Daniel KW, et al. Persistent oxidative stress due to absence of uncoupling protein 2 associated with impaired pancreatic beta-cell function. Endocrinology. Jul 2009;150(7):3040-3048. 96. Affourtit C, Brand MD. Uncoupling protein-2 contributes significantly to high mitochondrial proton leak in INS-1E insulinoma cells and attenuates glucose-stimulated insulin secretion. Biochem J. Jan 1 2008;409(1):199-204. 97. McQuaid TS, Saleh MC, Joseph JW, et al. cAMP-mediated signaling normalizes glucose- stimulated insulin secretion in uncoupling protein-2 overexpressing beta-cells. J Endocrinol. Sep 2006;190(3):669-680. 98. De Souza CT, Araujo EP, Stoppiglia LF, et al. Inhibition of UCP2 expression reverses diet- induced diabetes mellitus by effects on both insulin secretion and action. FASEB J. Apr 2007;21(4):1153-1163. 99. Zhang CY, Parton LE, Ye CP, et al. Genipin inhibits UCP2-mediated proton leak and acutely reverses obesity- and high glucose-induced beta cell dysfunction in isolated pancreatic islets. Cell Metab. Jun 2006;3(6):417-427. 100. Lee SC, Robson-Doucette CA, Wheeler MB. Uncoupling protein 2 regulates reactive oxygen species formation in islets and influences susceptibility to diabetogenic action of streptozotocin. J Endocrinol. Oct 2009;203(1):33-43.

101. Parton LE, Ye CP, Coppari R, et al. Glucose sensing by POMC neurons regulates glucose homeostasis and is impaired in obesity. Nature. Sep 13 2007;449(7159):228-232. 102. Diao J, Allister EM, Koshkin V, et al. UCP2 is highly expressed in pancreatic alpha-cells and influences secretion and survival. Proc Natl Acad Sci U S A. Aug 19 2008;105(33):12057- 12062. 103. Araki K, Imaizumi T, Okuyama K, Oike Y, Yamamura K. Efficiency of recombination by Cre transient expression in embryonic stem cells: comparison of various promoters. J Biochem. Nov 1997;122(5):977-982. 104. Wicksteed B, Brissova M, Yan W, et al. Conditional gene targeting in mouse pancreatic ss- Cells: analysis of ectopic Cre transgene expression in the brain. Diabetes. Dec 2010;59(12):3090-3098. 105. Pecqueur C, Cassard-Doulcier AM, Raimbault S, et al. Functional organization of the human uncoupling protein-2 gene, and juxtaposition to the uncoupling protein-3 gene. Biochem Biophys Res Commun. Feb 5 1999;255(1):40-46. 106. Kong D, Vong L, Parton LE, et al. Glucose stimulation of hypothalamic MCH neurons involves K(ATP) channels, is modulated by UCP2, and regulates peripheral glucose homeostasis. Cell Metab. Nov 3 2010;12(5):545-552. 107. Srinivas S, Watanabe T, Lin CS, et al. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol. 2001;1:4. 108. Joseph JW, Koshkin V, Saleh MC, et al. Free fatty acid-induced beta-cell defects are dependent on uncoupling protein 2 expression. J Biol Chem. Dec 3 2004;279(49):51049- 51056. 109. Wang X, Li H, De Leo D, et al. Gene and protein kinase expression profiling of reactive oxygen species-associated lipotoxicity in the pancreatic beta-cell line MIN6. Diabetes. Jan 2004;53(1):129-140. 110. Basford CL, Prentice KJ, Hardy AB, et al. The functional and molecular characterisation of human embryonic stem cell-derived insulin-positive cells compared with adult pancreatic beta cells. Diabetologia. Nov 11 2011. 111. Lu H, Koshkin V, Allister EM, Gyulkhandanyan AV, Wheeler MB. Molecular and metabolic evidence for mitochondrial defects associated with beta-cell dysfunction in a mouse model of type 2 diabetes. Diabetes. Feb 2010;59(2):448-459. 112. Xiao Q, Giguere J, Parisien M, et al. Biological activities of glucagon-like peptide-1 analogues in vitro and in vivo. Biochemistry. Mar 6 2001;40(9):2860-2869.

113. Cardoso CM, Moreno AJ, Almeida LM, Custodio JB. 4-Hydroxytamoxifen induces slight uncoupling of mitochondrial oxidative phosphorylation system in relation to the deleterious effects of tamoxifen. Toxicology. Oct 15 2002;179(3):221-232. 114. Tuquet C, Dupont J, Mesneau A, Roussaux J. Effects of tamoxifen on the electron transport chain of isolated rat liver mitochondria. Cell Biol Toxicol. 2000;16(4):207-219. 115. Ruiz-Ramirez A, Chavez-Salgado M, Peneda-Flores JA, Zapata E, Masso F, El-Hafidi M. High-sucrose diet increases ROS generation, FFA accumulation, UCP2 level, and proton leak in liver mitochondria. Am J Physiol Endocrinol Metab. Dec 2011;301(6):E1198-1207. 116. Langin D, Larrouy D, Barbe P, et al. Uncoupling protein-2 (UCP2) and uncoupling protein-3 (UCP3) expression in adipose tissue and skeletal muscle in humans. Int J Obes Relat Metab Disord. Jun 1999;23 Suppl 6:S64-67. 117. Schrauwen P, Hesselink M. UCP2 and UCP3 in muscle controlling body metabolism. J Exp Biol. Aug 2002;205(Pt 15):2275-2285. 118. Vidal-Puig A, Rosenbaum M, Considine RC, Leibel RL, Dohm GL, Lowell BB. Effects of obesity and stable weight reduction on UCP2 and UCP3 gene expression in humans. Obes Res. Mar 1999;7(2):133-140. 119. Ferrannini E, Mari A. How to measure insulin sensitivity. J Hypertens. Jul 1998;16(7):895- 906. 120. Zhou H, Zhao J, Zhang X. Inhibition of uncoupling protein 2 by genipin reduces insulin- stimulated glucose uptake in 3T3-L1 adipocytes. Arch Biochem Biophys. Jun 1 2009;486(1):88-93. 121. Chen F, Castranova V, Li Z, Karin M, Shi X. Inhibitor of nuclear factor kappaB kinase deficiency enhances oxidative stress and prolongs c-Jun NH2-terminal kinase activation induced by arsenic. Cancer Res. Nov 15 2003;63(22):7689-7693. 122. Fridovich I. Superoxide radical and superoxide dismutases. Annu Rev Biochem. 1995;64:97- 112. 123. Finkel T. Signal transduction by mitochondrial oxidants. J Biol Chem. Feb 10 2012;287(7):4434-4440. 124. Finkel T. Signal transduction by reactive oxygen species. J Cell Biol. Jul 11 2011;194(1):7- 15. 125. Bai Y, Onuma H, Bai X, et al. Persistent nuclear factor-kappa B activation in Ucp2-/- mice leads to enhanced nitric oxide and inflammatory cytokine production. J Biol Chem. May 13 2005;280(19):19062-19069.

126. Kizaki T, Suzuki K, Hitomi Y, et al. Uncoupling protein 2 plays an important role in nitric oxide production of lipopolysaccharide-stimulated macrophages. Proc Natl Acad Sci U S A. Jul 9 2002;99(14):9392-9397. 127. Krause M, Bittencourt A, Homem de Bittencourt PI, et al. Physiologic concentrations of IL-6 directly promote insulin secretion, signal transduction, nitric oxide release and redox status in a clonal pancreatic beta-cell line and mouse islets. J Endocrinol. Jul 3 2012. 128. Zhao Z, Zhao C, Zhang XH, et al. Advanced glycation end products inhibit glucose- stimulated insulin secretion through nitric oxide-dependent inhibition of cytochrome c oxidase and adenosine triphosphate synthesis. Endocrinology. Jun 2009;150(6):2569-2576. 129. Corbett JA, Sweetland MA, Wang JL, Lancaster JR, Jr., McDaniel ML. Nitric oxide mediates cytokine-induced inhibition of insulin secretion by human islets of Langerhans. Proc Natl Acad Sci U S A. Mar 1 1993;90(5):1731-1735. 130. Divakaruni AS, Brand MD. The regulation and physiology of mitochondrial proton leak. Physiology (Bethesda). Jun 2011;26(3):192-205. 131. Baracca A, Sgarbi G, Solaini G, Lenaz G. Rhodamine 123 as a probe of mitochondrial membrane potential: evaluation of proton flux through F(0) during ATP synthesis. Biochim Biophys Acta. Sep 30 2003;1606(1-3):137-146. 132. Brand MD, Pakay JL, Ocloo A, et al. The basal proton conductance of mitochondria depends on adenine nucleotide translocase content. Biochem J. Dec 1 2005;392(Pt 2):353-362. 133. Liu Y, Suckale J, Masjkur J, et al. Tamoxifen-independent recombination in the RIP-CreER mouse. PLoS ONE. 2010;5(10):e13533.

SPRINGER LICENSE TERMS AND CONDITIONS Oct 02, 2012 This is a License Agreement between Qian -yu Guo ("You") and Springer ("Springer") provided by Copyright Clearance Center ("CCC"). The license consists of your order details, the terms and conditions provided by Springer, and the payment terms and conditions.

All payments must be made in full to CCC. For payment instructions, please see information listed at the bottom of this form.

License Number 3000871400948

License date Oct 02, 2012

Licensed content publisher Springer

Licensed content publication Diabetologia

Licensed content title The functional and molecular characterisation of human embryonic stem cell-derived insulin- positive cells compared with adult pancreatic beta cells

Licensed content author C. L. Basford

Licensed content date Jan 1, 2011

Volume number 55

Issue number 2

Type of Use Thesis/Dissertation

Portion Figures

Author of this Springer article Yes and you are the sole author of the new work Order reference number Title of your thesis / dissertation Metabolic and Functional Characterization of an Inducible Pancreatic β Cell Specific Uncoupling Protein-2 (UCP2) Knockout Mouse Model

Expected completion date Oct 2012

Estimated size(pages) 70

Total 0.00 USD

Terms and Conditions

Introduction The publisher for this copyrighted material is Springer Science + Business Media. By clicking "accept" in connection with completing this licensing transaction, you agree that the following terms and conditions apply to this transaction (along with the Billing and Payment terms and conditions established by Copyright Clearance Center, Inc. ("CCC"), at the time that you opened your Rightslink account and that are available at any time at http://myaccount.copyright.com ).

Limited License With reference to your request to reprint in your thesis material on which Springer Science and Business Media control the copyright, permission is granted, free of charge, for the use indicated in your enquiry.

Licenses are for one-time use only with a maximum distribution equal to the number that you identified in the licensing process.

This License includes use in an electronic form, provided its password protected or on the university’s intranet or repository, including UMI (according to the definition at the Sherpa website: http://www.sherpa.ac.uk/romeo/). For any other electronic use, please contact Springer at ([email protected] or

[email protected]).

The material can only be used for the purpose of defending your thesis, and with a maximum of 100 extra copies in paper.

Although Springer controls copyright to the material and is entitled to negotiate on rights, this license is only valid, provided permission is also obtained from the (co) author (address is given with the article/chapter) and provided it concerns original material which does not carry references to other sources (if material in question appears with credit to another source, authorization from that source is required as well).

Permission free of charge on this occasion does not prejudice any rights we might have to charge for reproduction of our copyrighted material in the future.

Altering/Modifying Material: Not Permitted You may not alter or modify the material in any manner. Abbreviations, additions, deletions and/or any other alterations shall be made only with prior written authorization of the author(s) and/or Springer Science + Business Media. (Please contact Springer at ([email protected] or [email protected])

Reservation of Rights Springer Science + Business Media reserves all rights not specifically granted in the combination of (i) the license details provided by you and accepted in the course of this licensing transaction, (ii) these terms and conditions and (iii) CCC's Billing and Payment terms and conditions.

Copyright Notice:Disclaimer You must include the following copyright and permission notice in connection with any reproduction of the licensed material: "Springer and the original publisher /journal title, volume, year of publication, page, chapter/article title, name(s) of author(s), figure number(s), original copyright notice) is given to the publication in which the material was originally published, by adding; with kind permission from Springer Science and Business Media"

Warranties: None

Example 1: Springer Science + Busines s Media makes no representations or warranties with respect to the licensed material.

Example 2: Springer Science + Business Media makes no representations or warranties with respect to the licensed material and adopts on its own behalf the limitations and disclaimers established by CCC on its behalf in its Billing and Payment terms and conditions for this licensing transaction.

Indemnity You hereby indemnify and agree to hold harmless Springer Science + Business Media and CCC, and their respective officers, directors, employees and agents, from and against any and all claims arising out of your use of the licensed material other than as specifically

authorized pursuant to this license.

No Transfer of License This license is personal to you and may not be sublicensed, assigned, or transferred by you to any other person without Springer Science + Business Media's written permission.

No Amendment Except in Writing This license may not be amended except in a writing signed by both parties (or, in the case of Springer Science + Business Media, by CCC on Springer Science + Business Media's behalf).

Objection to Contrary Terms Springer Science + Business Media hereby objects to any terms contained in any purchase order, acknowledgment, check endorsement or other writing prepared by you, which terms are inconsistent with these terms and conditions or CCC's Billing and Payment terms and conditions. These terms and conditions, together with CCC's Billing and Payment terms and conditions (which are incorporated herein), comprise the entire agreement between you and Springer Science + Business Media (and CCC) concerning this licensing transaction. In the event of any conflict between your obligations established by these terms and conditions and those established by CCC's Billing and Payment terms and conditions, these terms and conditions shall control.

Jurisdiction All disputes that may arise in connection with this present License, or the breach thereof, shall be settled exclusively by arbitration, to be held in The Netherlands, in accordance with Dutch law, and to be conducted under the Rules of the 'Netherlands Arbitrage Instituut' (Netherlands Institute of Arbitration). OR:

All disputes that may arise in connection with this present License, or the breach thereof, shall be settled exclusively by arbitration, to be held in the Federal Republic of Germany, in accordance with German law.

Other terms and conditions: v1.3

If you would like to pay for this license now, please remit this license along with your payment made payable to "COPYRIGHT CLEARANCE CENTER" otherwise you will be invoiced within 48 hours of the license date. Payment should be in the form of a check or money order referencing your account number and this invoice number RLNK500869075. Once you receive your invoice for this order, you may pay your invoice by credit card. Please follow instructions provided at that time.

Make Payment To: Copyright Clearance Center Dept 001 P.O. Box 843006 Boston, MA 02284-3006

For suggestions or comments regarding this order, contact RightsLink Customer Support: [email protected] or +1-877-622-5543 (toll free in the US) or +1-978-646-2777.

Gratis licenses (referencing $0 in the Total field) are free. Please retain this printable license for your reference. No payment is required.

Re: Copyright

Dear Qian-Yu, Thank you for contacting the Canadian Diabetes Association. Canadian Diabetes Association publications are in the public domain for educational purposes, and individuals can use this information to communicate to their respective audiences without prior approval from the Canadian Diabetes Association, just as long as the sources are sited. Should you require further information, please contact us at [email protected] or 1-800-BANTING (1-800-226-8464). Sincerely, Yang Yang Zhuang Virtual Branch Representative Canadian Diabetes Association 1400-522 University Ave Toronto, ON, M5G 2R5 diabetes.ca | 1-800-BANTING | ======Would you like to become a member of the Canadian Diabetes Association? There are currently 9 million Canadians living with diabetes or prediabetes, with another 20 being diagnosed every hour. By becoming a member you will join a powerful alliance of people, connected by the cause and united in the search to find a cure. Click here to learn more, or call us at 1-800-BANTING (1-800-226-8464) extension 7758. Your Privacy is Important to Us: Information you provide will help guide the Association in the development and promotion of new programs and services relevant to Canadians with diabetes and those at risk, as well as the formulation of future fund-raising initiatives to support our mission. We will not use this information for any other purposes without your consent. Click here to review our privacy policy.