What is happening in invasion?
T. cruzi invasion- non phagocytic
Phagocytosis Active invasion
Yeast Trypanosoma cruzi Actin filaments
Lamp-1
T. cruzi invasion summary Leishmania phagosome
Treatment for kinetoplastid diseases
HAT
Early (these drugs cannot cross the blood/brain barrier) Suramin (1916) highly charged compound Mode of action (?) - inhibits metabolic enzymes (NAD+) Pentamidine (some resistance) Mode of action (?) - likely multiple targets Differential uptake of drug - parasite conc. mM quantites Late Melarsoprol (lipophilic) (1947) Highly toxic arsenical - up to 10% treated die Mode of action (?) - possibly energy metabolism Eflornithine (drug has similar affinity to mammalian enzyme) suicide inhibitor of ornithine decarboxylase blocking polyamine biosynthesis
Treatments for HAT
1985 2005 Early Stage
First-line drugs Pentamidine Pentamidine Suramin Suramin Clinical trials - DB 289 (Phase III) Pre-clinical stage - -
Late-stage/CNS
First-line drugs Melarsoprol Melarsoprol Eflornithine Clinical trials - Nifurtimox + Eflornithine Pre-clinical stage - - Treatment for kinetoplastid diseases
Chagas
Acute Nifurtimox 60-90 days Mode of action (?) ROS - then DNA damage Benznidazole 30-120 days Mode of action - thought to inhibit nucleic acid synthesis (ROS?)
Chronic Virtually untreatable - just treat symptoms
Treatments for Chagas 1985 2005 Acute Stage First-line drugs Benznidazole Benznidazole Nifurtimox Nifurtimox Clinical trials Allopurinal
Indeterminate Stage
Clinical trials - Benznidazole
Chronic Stage First-line drugs - - Clinical trials - - Pre-clinical stage - Antifungal triazoles Cruzipain inhibitor
Treatment for kinetoplastid diseases
Pentavalent antimonial compounds (1947,1950) 10-30 day treatment
Pentamidine (for failed cases)(1940)
Amphotericine (1959) Drug interacts with plasma membrane ergosterol (also in fungi) Discriminates between ergosterol and cholesterol New formulation w/liposomes readily taken up by macrophages!
Allopurinol (experimental in humans, used for dogs) Inhibits hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) - feedback inhibition of purine biosynthesis Treatments for Leishmaniasis
New Drug Targets!
Putative drug targets
kDNA replication, mitochondrial RNA editing
RNA processing
Fatty acid metabolism - not well studied
Cell cycle and differentiation
Membrane transport - unique transporters (purines!) ++ ++ Acidocalcisomes - Storage for Ca , Mg , polyphosphates
Plant-like vacuolar H+ pyrophosphatase
Carbohydrate metabolism - glycosomes, alternative oxidase
Drug target validation
Is the gene essential for parasite survival? Redundancy
Classical gene knockout - diploid organisms
Now, RNA interference!
Gene Expression http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=mboc4.TOC&depth=2
Prokaryotic
Translation is concurrent with transcription
No barrier restricts movement of transcript to translation apparatus
Single RNA polymerase synthesizes all RNA species
Eukaryotic
Transcript must be processed
Capping, splicing, polyA addition
mRNA is sequestered as RNP in the nucleus, must be transported to cytoplasm
Genes are often split - coding sequence is not contiguous
3 different RNA polymerases required to synthesize RNA classes Polycistronic Transcripts
Operon - gene cluster
DNA
mRNA Polycistronic transcript multiple genes
Examples: Proteins perform a Carbohydrate degradation coordinated function Amino acid biosynthesis
Eukaryotic Transcripts
5’ 7-methylgaunosine cap structure
Post-transcriptional modification - after ~ 25 nucleotides
Prevents degradation by 5’ exonucleases
Helps in the export from the nucleus
Poly-adenylated tail
Post-transcriptional modification
Helps in stability of the mRNA
Mature transcript
Kinetoplastid Transcription Alternative Splicing
Discovered by D. Baltimore - immunoglobin heavy chain
Increases the diversity of protein repertoire
Improper alternative splicing can lead to disease
Cis-Splicing Mechanism
Splicing is mediated by the Spliceosome
•Several steps in the splicing reaction require ATP Splicesome mediated - simplified
Composed of snRNPs
Small nuclear ribonucleoprotein
Small nuclear U-rich RNA (snRNA)
Each complexed with ~ 7 proteins
Highly simplified version
1. U1 base-pairs with the 5’ splice-site 2. U2 binds/pairs with the branch point; also pairs with U6 in the assembled spliceosome 3. U4 pairs with U6 in snRNPs, but releases during spliceosome assembly 4. U5 interacts with both exons (only 1-2 nt adjacent to intron); helps bring exons together 5. U6 displaces U1 at the 5’ splice-site (pairs with nt in the intron); it also pairs with U2 in the catalytic center of the spliceosome
Trans-splicing: 1st discovered in trypanosomes
To date: ALL coding sequences are trans-spliced!
Gene A Gene B Gene C Gene D Gene E
DNA
Trans-splicing Polyadenylation Polycistronic No evidence of transcript operons
SL RNA
AAAA AAAA Individual mRNAs each AAAA AAAA with a SL and poly A tail AAAA
Comparison of cis- and trans-splicing
transesterification
Lariat Y-branch intermediate intermediate
transesterification
Intramolecular Intermolecular Comparison of Spliceosomes
New Technology - SMaRT
Defects in alternative splicing can lead to human disease
Use of artificial trans-splicing to “repair” and give rise to a functional mRNA
Spliceosome-mediated RNA Trans-splicing
www.intronn.com
Correcting at the pre-mRNA level!
Trypanosomatid Mitochondrial RNA editing
Single mitochondrion
Unique mitochondrial DNA
Catenated structure composed of mini- and maxicircles
Size of molecules varies with species (15-80 kb) (1 - 2.5 kb)
50 maxicircles/network
5000-10,000 minicircles/network Maxicircle Minicircle 20 kb 1 kb Minicircles were initially thought to be nonfunctional, just a structural component Maxicircle sequence
Initial sequencing of the T. brucei maxicircles demonstrated that it encoded apocytochrome b, subunits 1 and 2 of cytochrome c oxidase (cox) and some unassigned reading frames (MURFs) (some later turned out to be subunits of NADH dehydrogenase). However some pseudogene features – e.g. cox2 had a –1 frameshift and this was conserved between kinetoplastid species. Sequence determination of cox2 cDNA in 1984 showed an insertion at the precise position of the frameshift converting GA to UUGUAU. This wasn’t accepted at first – there were 50 maxicircles and maybe one had the difference or the gene was encoded in the nucleus. Extensive analysis showed no conventional cox2 genes existed in the nucleus or mitochondrion but a mechanism of adding in U’s was way too outlandish to be accepted at that time.
Maxicircle Sequence
Sequencing of other mitochondrial cDNAs and their comparison to the genomic sequence showed not only the addition of U’s but also their deletion. In 1986 the first CAUTIOUS paper on a “co- or post-transcriptional nucleotide insertion process” was published (Benne et al.,1986 Cell 46, 819-826 - 18 page paper). Although the data showed deletion of one U, the authors didn’t dare to conclude that this form of editing could also occur. Other groups of investigators found similar editing processes and the number of edited trypanosomatid RNAs expanded. The mystery of missing AUG translational start codons was solved as these are provided by RNA editing by both addition and deletion of U’s
Mitochondrial RNA editing
Cryptic mRNAs produced Cell mRNA sequence DOES NOT exactly
correspond with genomic DNA sequence * * ** ** * Requires insertion of uridine residues ** *** (u) or deletion (*) to create a * *** functional ORF **** *** * * Extreme example is ND7 *** * ** * >90% of mRNA is edited *** Process is more active in *** ** ** ** procyclic form parasites **** **** * Minicircles encode gRNAs (guide **** ** * *** RNAs) that act as templates for * * *** **** insertion and deletion (1991) * *** * Process is essential (2001) * ** ******
Demonstrated by gene silencing in Edited T. brucei ND7 mRNA bloodstream form parasites Maxicircle Comparison
Ribosomal RNA sequences ARE NOT edited
Insertional RNA editing
Primary transcript (Maxicircle encoded) 5' GCGGAGAAAAAAGAAAGGGUCUUUUAAUG (A)n ::|:|||| ||:|||||||| 3'-UUUUUUUUUU CAGAAAAUUACppp5' U A Guide RNA U A (Minicircle encoded) Poly(U) tail U C A A Anchor C U U U U A
Editing Edited mRNA
5' GCGGAGAAAAAAUGAAAUGUGUUGUCUUUUAAUG (A)n ::|:||||||||||||||:||||||||||||| 3'-UUUUUUUUUUUUUACUUUAUACAACAGAAAAUUACppp5'
Pan-editing of the L. tarentolae A6 mRNA
Precursor mRNA Edited mRNA
Precursor mRNA
Edited mRNA
Precursor mRNA
Edited mRNA
Precursor mRNA Edited mRNA Mechanism of RNA Editing
Insertion Deletion
RNA Editing Proteins
Mediated by Protein Complex