DOCSLIB.ORG

Coexpression of Epha10 and Gli3 Promotes Breast Cancer Cell Proliferation, Invasion and Migration Jing Peng, Danhua Zhang ‍ ‍

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Coexpression of Epha10 and Gli3 Promotes Breast Cancer Cell Proliferation, Invasion and Migration Jing Peng, Danhua Zhang ‍ ‍ Original research J Investig Med: first published as 10.1136/jim-2021-001836 on 14 May 2021. Downloaded from Coexpression of EphA10 and Gli3 promotes breast cancer cell proliferation, invasion and migration Jing Peng, Danhua Zhang ► Additional supplemental ABSTRACT material is published online This study investigated the influences of EphA10 and Significance of this study only. To view, please visit Gli3 on breast cancer (BC) cell proliferation, invasion the journal online (http:// dx. What is already known about this subject? doi. org/ 10. 1136/ jim- 2021- and migration. Immunohistochemistry was used to 001836). reveal the expressions of EphA10 and Gli3 in 18 ► Breast cancer is a highly invasive and intraductal carcinomas, 124 invasive carcinomas, 50 heterogeneous malignancy that results in Department of General vast mortality. Surgery, The Second Xiangya paracancerous tissues (2 cm away from the tumor, Hospital, Central South when possible or available), 50 lobular hyperplastic ► EphA10 is highly expressed in breast University, Changsha, China tissues and 30 normal breast tissues. qRT-PCR cancer. and Western blotting were applied to detect the ► Gli proteins are implicated in various Correspondence to expressions of EphA10 and Gli3 in invasive BC cells tumorigenic processes. Dr Danhua Zhang, Department of General (MDA-MB-231, BT20 and Hs578T) and normal What are the new findings? human mammary epithelial cells (MCF10A). MDA- Surgery, The Second ► EphA10 and Gli3 were both highly Xiangya Hospital, Central MB-231 and BT20 cells were transfected with expressed in invasive breast carcinomas South University, Changsha sh- EphA10, sh- Gli3 or sh- EphA10+sh- Gli3. CCK-8 and cells. 410011, Hunan, China; was used to test the proliferation of transfected zhangdanhua@ csu. edu. cn ► Positive expressions of EphA10 and Gli3 are MDA-MB-231 and BT20 cells. Transwell and scratch associated with poor prognosis of invasive Accepted 17 March 2021 assays were used for evaluation of invasion and breast cancer. Published Online First migration of the transfected cells. EphA10 and Gli3 14 May 2021 ► EphA10 and Gli3 work in synergy to were highly expressed in invasive carcinomas and promote proliferation, migration and invasive BC cells. The expressions of EphA10 and invasion of breast cancer cells. Gli3 were associated with the clinicopathological characteristics and poor prognosis of patients How might these results change the focus with invasive BC. Knockdown of EphA10 or Gli3 of research or clinical practice? http://jim.bmj.com/ suppressed activities of BC cells. Knockdown ► EphA10 and Gli3 can be concurrently of both EphA10 and Gli3 was more effective targeted for treatment of breast cancer. than knockdown of Gli3 alone. Taken together, coexpression of EphA10 and Gli3 promotes BC cell proliferation, invasion and migration. early detection and diagnosis of BC, substantial challenges still remain in preventing the cancer initiation and improving the treatment of BC.6 on September 24, 2021 by guest. Protected copyright. In China, the mortality of patients with BC has INTRODUCTION doubled over the last three decades.7 Further In United States, breast cancer (BC) accounts exploration of the progression of BC is urgently for about 29% of all new cancer cases in women needed to improve patients’ survival.8 annually.1 Tumor invasion and metastasis are Eph receptor tyrosine kinases together with dynamic multistep processes, which contribute their ligands known as ephrins are involved in to the vast majority of BC- associated mortali- a large spectrum of developmental processes.9 ties.2 3 Invasive ductal carcinoma is the most The Eph/ephrin signaling mediates cell- cell prevalent type of BC, followed by invasive interaction and contributes to the tumori- lobular carcinoma and other rare types. Both genesis, angiogenesis and metastasis in many invasive ductal and lobular BC can be diagnosed cancers.10 Eph receptor A10 (EphA10) was char- by pathological findings. However, the under- acterized as a more efficient biomarker than the 11 © American Federation for lying causes of the occurrence and development established prognostic marker Her-2 in BC. 4 Medical Research 2021. of BC remain a mystery. BC is heterogeneous EphA10 was highly expressed in various BC Re- use permitted under in molecular changes, clinicopathologic char- subtypes, and an anti-EphA10 antibody could CC BY- NC. No commercial acteristics, therapeutic responses and clinical significantly suppress tumor growth.12 More- re-use . Published by BMJ. outcomes. The initiation of BC is a complicated over, both mRNA and protein expressions of To cite: Peng J, process characterized by genetic and epigenetic EphA10 were positively correlated with tumor Zhang D. J Investig Med alterations that activate cellular pathways for metastasis in BC.13 Nevertheless, the function 2021;69:1215–1221. tumorigenesis.5 In spite of notable advances in of EphA10 in BC cells is uncharacterized. Peng J, Zhang D. J Investig Med 2021;69:1215–1221. doi:10.1136/jim-2021-001836 1215 Original research J Investig Med: first published as 10.1136/jim-2021-001836 on 14 May 2021. Downloaded from The Hedgehog (Hh) signaling pathway, which is well study. Synergic effect of EphA10 and Gli3 was observed in conserved in mammals and other vertebrate species, the malignant progression of BC. has long been known to regulate growth and patterning during embryonic development. Hh signaling pathways MATERIALS AND METHODS consist of Hh proteins (Sonic Hh, Indian Hh, and Desert Patients and tissue samples Hh), 12 transmembrane protein patched (patched 1 and One hundred and twenty- four BC tissues, 50 pericancerous patched 2), 7 transmembrane protein smoothened (Smo) tissues, 50 lobular hyperplastic tissues and 30 normal breast and 5- zinc finger transcription factor Gli proteins (Gli1, 14 15 tissues from benign lesions were obtained at the Second and Gli2 and Gli3). The Gli proteins are large and multi- Third Xiangya Hospitals, Central South University, from functional transcription factors. The three members of Gli January 2000 to December 2002 and were histologically proteins behave differently with partially redundant func- identified by two pathologists. The tumors were restaged tions and are implicated in tumorigenesis. Available data according to the seventh TNM Classification of Malig- has supported the positive correlation of Gli3 with the nant Tumors. Classification and histological grade of the 16 17 progression of hepatocellular carcinoma, colon cancer, cancerous tissues were determined with reference to the 18 19 non- small- cell lung cancer, prostate cancer and cervical WHO classification of tumors. 20 cancer. However, the role of Gli3 in BC remains to be Clinicopathological data of the intraductal carcinomas clarified. and invasive carcinomas are summarized in table 1. Survival The expressions of EphA10 and Gli3 were investigated in data of the 124 patients with invasive BC were collected. surgically resected BC tissues and cultured BC cells in this The follow-up time for patients was 13 years. Twenty-six Table 1 Association between clinicopathological characteristics (CPC) and tumor types Intraductal carcinoma Invasive carcinoma CPC Case number Positive number (%) Positive number (%) χ2 P value Age (years) ≤45 81 13 (72.7) 68 (54.8) 1.938 0.164 >45 61 5 (27.8) 56 (45.2) Menopausal status Premenopausal 80 9 (50.0) 71 (57.3) 0.337 0.562 Postmenopausal 62 9 (50.0) 53 (42.7) Pathologic types Ⅰ 22 5 (27.8) 17 (13.7) 11.132 0.004 http://jim.bmj.com/ Ⅱ 61 12 (66.7) 49 (39.5) Ⅲ 59 1 (5.6) 58 (46.8) Tumor size ≤3 cm 72 15 (83.3) 57 (46.0) 8.87 0.003 >3 cm 70 3 (16.7) 67 (54.0) ER + 73 14 (77.8) 59 (47.6) 5.738 0.017 on September 24, 2021 by guest. Protected copyright. – 69 4 (22.2) 65 (52.4) PR + 79 15 (83.38) 64 (51.6) 6.408 0.011 – 63 3 (16.7) 60 (48.4) CerB2 + 85 7 (38.9) 78 (62.9) 3.773 0.052 – 57 11 (61.1) 46 (37.1) Lymph node metastasis No 73 17 (94.4) 56 (45.2) 15.283 0.000 Yes 69 1 (5.6) 68 (54.8) TNM stage Ⅰ +Ⅱ 83 17 (36.4) 66 (36.4) 10.081 0.014 Ⅲ +Ⅳ 59 1 (1.7) 58 (70.3) EphA10 + 8 (44.4) 76 (61.3) 1.846 0.174 – 10 (55.6) 48 (38.7) Gli3 + 9 (50.0) 69 (55.6) 0.202 0.653 – 9 (50.0) 55 (44.4) ER, estrogen receptor; PR, progesterone receptor; TNM, tumor lymph node metastasis. 1216 Peng J, Zhang D. J Investig Med 2021;69:1215–1221. doi:10.1136/jim-2021-001836 Original research J Investig Med: first published as 10.1136/jim-2021-001836 on 14 May 2021. Downloaded from patients who survived longer than 13 years were included Table 2 Primer sequences in the analysis as censored cases. Pericancerous tissues were collected from the above 50 Name of primers Sequences patients with invasive BC. The age of these 50 patients GAPDH- F GCAAGGATGCTGGCGTAATG ranged from 32 to 70 (46.5±9.4) years. The pathological GAPDH- R TACGCGTAGGGGTTTGACAC examination showed 18 normal breast tissues, 14 mild EphA10- F CCTGGTTAGGGCAGCGTTTA dysplasia, 10 moderate dysplasia and 8 severe dysplasia EphA10- R CTGACTGGAGTGGCTGAGTC cases. Lobular hyperplastic tissues were collected from 50 Gli3- F GGCCATCCACATGGAATATC patients aged from 28 to 60 (36.7±8.4) years. The patho- Gli3- R TGAAGAGCTGCTACGGGAAT logical examination showed 16 normal lobular tissues, F, forward; R, reverse. 19 mild dysplasia, 10 moderate dysplasia and 5 severe dysplasia cases. Normal breast tissues were collected from normal tissues beside 30 breast fibroadenoma and patho- the instruction of the fluorescent quantitative PCR kit logically identified. (SYBR Green Mix, Roche Diagnostics). Each sample had All tissues were made into paraffin sections for three duplicates. The internal reference gene of mRNA was immunohistochemistry. GAPDH. The 2−ΔΔCt method was used for data analysis.
Load more

Recommended publications
  • Mtorc1-Independent Autophagy Regulates Receptor Tyrosine Kinase Phosphorylation in Colorectal Cancer Cells Via an Mtorc2-Mediated Mechanism
    Cell Death and Differentiation (2017) 24, 1045–1062 & 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved 1350-9047/17 www.nature.com/cdd mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism Aikaterini Lampada1,2, James O’Prey3, Gyorgy Szabadkai4, Kevin M Ryan3, Daniel Hochhauser*,2,5 and Paolo Salomoni*,1,5 The intracellular autophagic degradative pathway can have a tumour suppressive or tumour-promoting role depending on the stage of tumour development. Upon starvation or targeting of oncogenic receptor tyrosine kinases (RTKs), autophagy is activated owing to the inhibition of PI3K/AKT/mTORC1 signalling pathway and promotes survival, suggesting that autophagy is a relevant therapeutic target in these settings. However, the role of autophagy in cancer cells where the PI3K/AKT/mTORC1 pathway is constitutively active remains partially understood. Here we report a role for mTORC1-independent basal autophagy in regulation of RTK activation and cell migration in colorectal cancer (CRC) cells. PI3K and RAS-mutant CRC cells display basal autophagy levels despite constitutive mTORC1 signalling, but fail to increase autophagic flux upon RTK inhibition. Inhibition of basal autophagy via knockdown of ATG7 or ATG5 leads to decreased phosphorylation of several RTKs, in particular c-MET. Internalised c-MET colocalised with LAMP1-negative, LC3-positive vesicles. Finally, autophagy regulates c-MET phosphorylation via an mTORC2- dependent
    [Show full text]
  • Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease
    Supplementary Online Content Ganz P, Heidecker B, Hveem K, et al. Development and validation of a protein-based risk score for cardiovascular outcomes among patients with stable coronary heart disease. JAMA. doi: 10.1001/jama.2016.5951 eTable 1. List of 1130 Proteins Measured by Somalogic’s Modified Aptamer-Based Proteomic Assay eTable 2. Coefficients for Weibull Recalibration Model Applied to 9-Protein Model eFigure 1. Median Protein Levels in Derivation and Validation Cohort eTable 3. Coefficients for the Recalibration Model Applied to Refit Framingham eFigure 2. Calibration Plots for the Refit Framingham Model eTable 4. List of 200 Proteins Associated With the Risk of MI, Stroke, Heart Failure, and Death eFigure 3. Hazard Ratios of Lasso Selected Proteins for Primary End Point of MI, Stroke, Heart Failure, and Death eFigure 4. 9-Protein Prognostic Model Hazard Ratios Adjusted for Framingham Variables eFigure 5. 9-Protein Risk Scores by Event Type This supplementary material has been provided by the authors to give readers additional information about their work. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Supplemental Material Table of Contents 1 Study Design and Data Processing ......................................................................................................... 3 2 Table of 1130 Proteins Measured .......................................................................................................... 4 3 Variable Selection and Statistical Modeling ........................................................................................
    [Show full text]
  • Protein Tyrosine Kinases: Their Roles and Their Targeting in Leukemia
    cancers Review Protein Tyrosine Kinases: Their Roles and Their Targeting in Leukemia Kalpana K. Bhanumathy 1,*, Amrutha Balagopal 1, Frederick S. Vizeacoumar 2 , Franco J. Vizeacoumar 1,3, Andrew Freywald 2 and Vincenzo Giambra 4,* 1 Division of Oncology, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada; [email protected] (A.B.); [email protected] (F.J.V.) 2 Department of Pathology and Laboratory Medicine, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada; [email protected] (F.S.V.); [email protected] (A.F.) 3 Cancer Research Department, Saskatchewan Cancer Agency, 107 Wiggins Road, Saskatoon, SK S7N 5E5, Canada 4 Institute for Stem Cell Biology, Regenerative Medicine and Innovative Therapies (ISBReMIT), Fondazione IRCCS Casa Sollievo della Sofferenza, 71013 San Giovanni Rotondo, FG, Italy * Correspondence: [email protected] (K.K.B.); [email protected] (V.G.); Tel.: +1-(306)-716-7456 (K.K.B.); +39-0882-416574 (V.G.) Simple Summary: Protein phosphorylation is a key regulatory mechanism that controls a wide variety of cellular responses. This process is catalysed by the members of the protein kinase su- perfamily that are classified into two main families based on their ability to phosphorylate either tyrosine or serine and threonine residues in their substrates. Massive research efforts have been invested in dissecting the functions of tyrosine kinases, revealing their importance in the initiation and progression of human malignancies. Based on these investigations, numerous tyrosine kinase inhibitors have been included in clinical protocols and proved to be effective in targeted therapies for various haematological malignancies.
    [Show full text]
  • Ephrin A4-Ephrin Receptor A10 Signaling Promotes Cell Migration
    www.nature.com/scientificreports OPEN Ephrin A4‑ephrin receptor A10 signaling promotes cell migration and spheroid formation by upregulating NANOG expression in oral squamous cell carcinoma cells Yu‑Lin Chen1, Yi‑Chen Yen1, Chuan‑Wei Jang1, Ssu‑Han Wang1, Hsin‑Ting Huang1, Chung‑Hsing Chen2,3, Jenn‑Ren Hsiao4, Jang‑Yang Chang1 & Ya‑Wen Chen1,5* Ephrin type‑A receptor 10 (EPHA10) has been implicated as a potential target for breast and prostate cancer therapy. However, its involvement in oral squamous cell carcinoma (OSCC) remains unclear. We demonstrated that EPHA10 supports in vivo tumor growth and lymphatic metastasis of OSCC cells. OSCC cell migration, epithelial mesenchymal transition (EMT), and sphere formation were found to be regulated by EPHA10, and EPHA10 was found to drive expression of some EMT‑ and stemness‑ associated transcription factors. Among EPHA10 ligands, exogenous ephrin A4 (EFNA4) induced the most OSCC cell migration and sphere formation, as well as up‑regulation of SNAIL, NANOG, and OCT4. These efects were abolished by extracellular signal‑regulated kinase (ERK) inhibition and NANOG knockdown. Also, EPHA10 was required for EFNA4‑induced cell migration, sphere formation, and expression of NANOG and OCT4 mRNA. Our microarray dataset revealed that EFNA4 mRNA expression was associated with expression of NANOG and OCT4 mRNA, and OSCC patients showing high co‑expression of EFNA4 with NANOG or OCT4 mRNA demonstrated poor recurrence‑free survival rates. Targeting forward signaling of the EFNA4‑EPHA10 axis may be a promising therapeutic approach for oral malignancies, and the combination of EFNA4 mRNA and downstream gene expression may be a useful prognostic biomarker for OSCC.
    [Show full text]
  • Neurod Family Transcription Factors Regulate Corpus Callosum Formation and Cell Differentiation During Cerebral Cortical Development
    Aus dem Institut für Cell und Neurobiologie der Medizinischen Fakultät Charité – Universitätsmedizin Berlin DISSERTATION NeuroD Family Transcription Factors Regulate Corpus Callosum Formation and Cell Differentiation during Cerebral Cortical Development zur Erlangung des akademischen Grades Doctor of Philosophy (PhD) Im Rahmen des International Graduate Program Medical Neurosciences vorgelegt der Medizinischen Fakultät Charité – Universitätsmedizin Berlin von Kuo Yan aus: Jinan, China Datum der Promotion: 5. Juni 2016 1 Table of Contents Abstract .................................................................................................................... 5 Zusammenfassung .................................................................................................. 7 1. Introduction ......................................................................................................... 9 1.1 Cerebral cortex development ………………………………………...................... 9 1.1.1 Layering and wiring of the neocortex ........................................................... 9 1.1.2 Formation of the corpus callosum ................................................................ 12 1.2 Basic helix-loop-helix transcription factors ........................................................ 13 1.2.1 NeuroD family transcription factors .............................................................. 14 1.2.2 NeuroD2/6 double deficient mice as a model for axogenesis study ............ 15 1.3 Ephrin-Eph signaling ........................................................................................
    [Show full text]
  • Eph Receptor Signalling: from Catalytic to Non-Catalytic Functions
    Oncogene (2019) 38:6567–6584 https://doi.org/10.1038/s41388-019-0931-2 REVIEW ARTICLE Eph receptor signalling: from catalytic to non-catalytic functions 1,2 1,2 3 1,2 1,2 Lung-Yu Liang ● Onisha Patel ● Peter W. Janes ● James M. Murphy ● Isabelle S. Lucet Received: 20 March 2019 / Revised: 23 July 2019 / Accepted: 24 July 2019 / Published online: 12 August 2019 © The Author(s) 2019. This article is published with open access Abstract Eph receptors, the largest subfamily of receptor tyrosine kinases, are linked with proliferative disease, such as cancer, as a result of their deregulated expression or mutation. Unlike other tyrosine kinases that have been clinically targeted, the development of therapeutics against Eph receptors remains at a relatively early stage. The major reason is the limited understanding on the Eph receptor regulatory mechanisms at a molecular level. The complexity in understanding Eph signalling in cells arises due to following reasons: (1) Eph receptors comprise 14 members, two of which are pseudokinases, EphA10 and EphB6, with relatively uncharacterised function; (2) activation of Eph receptors results in dimerisation, oligomerisation and formation of clustered signalling centres at the plasma membrane, which can comprise different combinations of Eph receptors, leading to diverse downstream signalling outputs; (3) the non-catalytic functions of Eph receptors have been overlooked. This review provides a structural perspective of the intricate molecular mechanisms that 1234567890();,: 1234567890();,: drive Eph receptor signalling, and investigates the contribution of intra- and inter-molecular interactions between Eph receptors intracellular domains and their major binding partners. We focus on the non-catalytic functions of Eph receptors with relevance to cancer, which are further substantiated by exploring the role of the two pseudokinase Eph receptors, EphA10 and EphB6.
    [Show full text]
  • Overcoming Challenges for CD3-Bispecific Antibody Therapy In
    cancers Review Overcoming Challenges for CD3-Bispecific Antibody Therapy in Solid Tumors Jim Middelburg 1 , Kristel Kemper 2, Patrick Engelberts 2 , Aran F. Labrijn 2 , Janine Schuurman 2 and Thorbald van Hall 1,* 1 Department of Medical Oncology, Oncode Institute, Leiden University Medical Center, 2333 ZA Leiden, The Netherlands; [email protected] 2 Genmab, 3584 CT Utrecht, The Netherlands; [email protected] (K.K.); [email protected] (P.E.); [email protected] (A.F.L.); [email protected] (J.S.) * Correspondence: [email protected]; Tel.: +31-71-5266945 Simple Summary: CD3-bispecific antibody therapy is a form of immunotherapy that enables soldier cells of the immune system to recognize and kill tumor cells. This type of therapy is currently successfully used in the clinic to treat tumors in the blood and is under investigation for tumors in our organs. The treatment of these solid tumors faces more pronounced hurdles, which affect the safety and efficacy of CD3-bispecific antibody therapy. In this review, we provide a brief status update of this field and identify intrinsic hurdles for solid cancers. Furthermore, we describe potential solutions and combinatorial approaches to overcome these challenges in order to generate safer and more effective therapies. Abstract: Immunotherapy of cancer with CD3-bispecific antibodies is an approved therapeutic option for some hematological malignancies and is under clinical investigation for solid cancers. However, the treatment of solid tumors faces more pronounced hurdles, such as increased on-target off-tumor toxicities, sparse T-cell infiltration and impaired T-cell quality due to the presence of an Citation: Middelburg, J.; Kemper, K.; immunosuppressive tumor microenvironment, which affect the safety and limit efficacy of CD3- Engelberts, P.; Labrijn, A.F.; bispecific antibody therapy.
    [Show full text]
  • FGF/FGFR Signaling in Health and Disease
    Signal Transduction and Targeted Therapy www.nature.com/sigtrans REVIEW ARTICLE OPEN FGF/FGFR signaling in health and disease Yangli Xie1, Nan Su1, Jing Yang1, Qiaoyan Tan1, Shuo Huang 1, Min Jin1, Zhenhong Ni1, Bin Zhang1, Dali Zhang1, Fengtao Luo1, Hangang Chen1, Xianding Sun1, Jian Q. Feng2, Huabing Qi1 and Lin Chen 1 Growing evidences suggest that the fibroblast growth factor/FGF receptor (FGF/FGFR) signaling has crucial roles in a multitude of processes during embryonic development and adult homeostasis by regulating cellular lineage commitment, differentiation, proliferation, and apoptosis of various types of cells. In this review, we provide a comprehensive overview of the current understanding of FGF signaling and its roles in organ development, injury repair, and the pathophysiology of spectrum of diseases, which is a consequence of FGF signaling dysregulation, including cancers and chronic kidney disease (CKD). In this context, the agonists and antagonists for FGF-FGFRs might have therapeutic benefits in multiple systems. Signal Transduction and Targeted Therapy (2020) 5:181; https://doi.org/10.1038/s41392-020-00222-7 INTRODUCTION OF THE FGF/FGFR SIGNALING The binding of FGFs to the inactive monomeric FGFRs will Fibroblast growth factors (FGFs) are broad-spectrum mitogens and trigger the conformational changes of FGFRs, resulting in 1234567890();,: regulate a wide range of cellular functions, including migration, dimerization and activation of the cytosolic tyrosine kinases by proliferation, differentiation, and survival. It is well documented phosphorylating the tyrosine residues within the cytosolic tail of that FGF signaling plays essential roles in development, metabo- FGFRs.4 Then, the phosphorylated tyrosine residues serve as the lism, and tissue homeostasis.
    [Show full text]
  • Introduction 1 1
    r r r Cell Signalling Biology Michael J. Berridge Module 1 Introduction 1 1 Module 1 Introduction The aim of this website is to describe cell signalling within otransmitter, hormone or growth factor), which then al- its biological context. There has been an explosion in the ters the activity of target cells. The latter have receptors characterization of signalling components and pathways. capable of detecting the incoming signal and transferring The next major challenge is to understand how cells exploit the information to the appropriate internal cell signalling this large signalling toolkit to assemble the specific sig- pathway to bring about a change in cellular activity. nalling pathways they require to communicate with each other. The primary focus is the biology of cell signalling. Communication through electrical The emerging information on cell signalling pathways is signals integrated and presented within the context of specific cell Communication through electrical signals is found mainly types and processes. The beauty of cell signalling is the in excitable systems, particularly in the heart and brain. It way different pathways are combined and adapted to con- is usually fast and requires the cells to be coupled together trol a diverse array of cellular processes in widely different through low-resistance pathways such as the gap junc- spatial and temporal domains. tions (Module 1: Figure cell communication). In addition The first half of the website characterizes the compon- to passing electrical charge, the pores in these gap junctions ents and properties of the major cell signalling pathways, are large enough for low-molecular-mass molecules such with special emphasis on how they are switched on and as metabolites and second messengers to diffuse from one off.
    [Show full text]
  • Epha2 and EGFR: Friends in Life, Partners in Crime
    cancers Review EphA2 and EGFR: Friends in Life, Partners in Crime. Can EphA2 Be a Predictive Biomarker of Response to Anti-EGFR Agents? Mario Cioce 1,* and Vito Michele Fazio 1,2,3,* 1 Laboratory of Molecular Medicine and Biotechnology, Department of Medicine, University Campus Bio-Medico of Rome, 00128 Rome, Italy 2 Laboratory of Oncology, Fondazione IRCCS Casa Sollievo della Sofferenza, 71013 San Giovanni Rotondo, Italy 3 Institute of Translational Pharmacology, National Research Council of Italy (CNR), 00133 Rome, Italy * Correspondence: [email protected] (M.C.); [email protected] (V.M.F.) Simple Summary: The Ephrin receptors and their ligands play important roles in organ formation and tissue repair, by orchestrating complex programs of cell adhesion and repulsion, however, this same system plays a role in cancer development In fact, EphA2 levels are higher in tumors vs normal tissue and further increased upon treatment, in vivo and in vitro. Changes in the molecular status of EphA2, of its subcellular localization, the absence of ligand and signals derived from the tumor context unleash the oncogenic role of EphA2 and its broad ability to promote resistance to radiotherapy, chemotherapy and targeted agents, including inhibitors of Epidermal-Growth-Factor- Receptor (EGFR). High levels of EphA2 may reduce response to cetuximab even in RAS wt CRC patients. In this work, we aim to review the current knowledge of the EphA2 function which is crucial for achieving a more effective therapeutic management of tumors resistant to EGFR inhibitors and to many other agents. Abstract: The Eph receptors represent the largest group among Receptor Tyrosine kinase (RTK) Citation: Cioce, M.; Fazio, V.M.
    [Show full text]
  • Identifying the Biomarkers of Spinal Cord Injury and the Effects of Neurotrophin-3 Based on Microrna and Mrna Signature
    Identifying the Biomarkers of Spinal Cord Injury and the effects of Neurotrophin-3 Based on MicroRNA and mRNA Signature Shuang Qi Department of Anesthesiology, China-Japan Union Hospital, Jilin University Zinan Li Department of Anesthesiology, China-Janpan Union Hospital Shanshan Yu ( [email protected] ) China-Japan Union Hospital, Jilin University https://orcid.org/0000-0001-5383-9924 Research article Keywords: spinal cord injury, regulatory network, Neurotrophin-3 Posted Date: June 22nd, 2020 DOI: https://doi.org/10.21203/rs.3.rs-20687/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/15 Abstract Background To gain a better understanding of the molecular mechanisms of spinal cord injury and the effects of Neurotrophin-3, differentially expressed microRNAs (DEmiRNAs) and genes (DEGs) were analyzed. Methods The miRNA transcription prole of GSE82195 and the mRNA transcription prole of GSE82196 were downloaded from the Gene Expression Omnibus (GEO). Then, DERs were identied using limma. The noise-robust soft clustering of the intersection DERs was performed using Mfuzz package. Additionally, the integrated miRNAs–targets regulatory network was constructed using Cytoscape. Finally, the Comparative Toxicogenomics Database 2019 update was used to search the central nervous system injury related pathway. Results A total of 444 DERs including 382 DEGs and 62 DEmiRNAs were screened between group injury and group none whlie 576 DERs including 523 DEGs and 55 DEmiRNAs were screened between group NT-3 and group injury. Moreover, 80 intersections DERs were identied. DREs in cluster 1 were rstly signicantly down-regulated in group injury and subsequently were signicantly up-regulated in group NT- 3.
    [Show full text]
  • Harnessing the Power of Eph/Ephrin Biosemiotics for Theranostic Applications
    pharmaceuticals Review Harnessing the Power of Eph/ephrin Biosemiotics for Theranostic Applications Robert M. Hughes 1 and Jitka A.I. Virag 2,* 1 Department of Chemistry, East Carolina University, Science and Technology Building, SZ564, East 5th St, Greenville, NC 27858, USA; [email protected] 2 Department of Physiology, Brody School of Medicine, East Carolina University, Warren Life Sciences Building, LSB239, 600 Moye Blvd, Greenville, NC 27834, USA * Correspondence: [email protected] Received: 11 April 2020; Accepted: 27 May 2020; Published: 1 June 2020 Abstract: Comprehensive basic biological knowledge of the Eph/ephrin system in the physiologic setting is needed to facilitate an understanding of its role and the effects of pathological processes on its activity, thereby paving the way for development of prospective therapeutic targets. To this end, this review briefly addresses what is currently known and being investigated in order to highlight the gaps and possible avenues for further investigation to capitalize on their diverse potential. Keywords: Eph/ephrin; receptor tyrosine kinase; therapeutic target; smart drug; nanoparticles; liposomes; exosomes 1. Introduction Detection, transduction and appropriate response behavior of neighboring cells are essential components of optimal communication and the coordinated and integrated function necessary for survival. In a complex system, this is determined by the summative and timely intracellular processing of a myriad of intersecting signals from various distances and directions. The Eph receptors and ephrin ligands are the largest tyrosine kinase (RTK) superfamily, comprised of 22 known members, subdivided into A- and B-subclasses, and are heterogeneously expressed in almost every tissue [1]. These membrane-anchored proteins exhibit unique cell-to-cell communication via bidirectional signaling, which modulates cytoskeletal dynamics and thus cell–cell recognition and motility, making them integral mediators in developmental processes and the maintenance of homeostasis [2,3].
    [Show full text]