Coexpression of Epha10 and Gli3 Promotes Breast Cancer Cell Proliferation, Invasion and Migration Jing Peng, Danhua Zhang ‍ ‍

Coexpression of Epha10 and Gli3 Promotes Breast Cancer Cell Proliferation, Invasion and Migration Jing Peng, Danhua Zhang ‍ ‍

Original research J Investig Med: first published as 10.1136/jim-2021-001836 on 14 May 2021. Downloaded from Coexpression of EphA10 and Gli3 promotes breast cancer cell proliferation, invasion and migration Jing Peng, Danhua Zhang ► Additional supplemental ABSTRACT material is published online This study investigated the influences of EphA10 and Significance of this study only. To view, please visit Gli3 on breast cancer (BC) cell proliferation, invasion the journal online (http:// dx. What is already known about this subject? doi. org/ 10. 1136/ jim- 2021- and migration. Immunohistochemistry was used to 001836). reveal the expressions of EphA10 and Gli3 in 18 ► Breast cancer is a highly invasive and intraductal carcinomas, 124 invasive carcinomas, 50 heterogeneous malignancy that results in Department of General vast mortality. Surgery, The Second Xiangya paracancerous tissues (2 cm away from the tumor, Hospital, Central South when possible or available), 50 lobular hyperplastic ► EphA10 is highly expressed in breast University, Changsha, China tissues and 30 normal breast tissues. qRT-PCR cancer. and Western blotting were applied to detect the ► Gli proteins are implicated in various Correspondence to expressions of EphA10 and Gli3 in invasive BC cells tumorigenic processes. Dr Danhua Zhang, Department of General (MDA-MB-231, BT20 and Hs578T) and normal What are the new findings? human mammary epithelial cells (MCF10A). MDA- Surgery, The Second ► EphA10 and Gli3 were both highly Xiangya Hospital, Central MB-231 and BT20 cells were transfected with expressed in invasive breast carcinomas South University, Changsha sh- EphA10, sh- Gli3 or sh- EphA10+sh- Gli3. CCK-8 and cells. 410011, Hunan, China; was used to test the proliferation of transfected zhangdanhua@ csu. edu. cn ► Positive expressions of EphA10 and Gli3 are MDA-MB-231 and BT20 cells. Transwell and scratch associated with poor prognosis of invasive Accepted 17 March 2021 assays were used for evaluation of invasion and breast cancer. Published Online First migration of the transfected cells. EphA10 and Gli3 14 May 2021 ► EphA10 and Gli3 work in synergy to were highly expressed in invasive carcinomas and promote proliferation, migration and invasive BC cells. The expressions of EphA10 and invasion of breast cancer cells. Gli3 were associated with the clinicopathological characteristics and poor prognosis of patients How might these results change the focus with invasive BC. Knockdown of EphA10 or Gli3 of research or clinical practice? http://jim.bmj.com/ suppressed activities of BC cells. Knockdown ► EphA10 and Gli3 can be concurrently of both EphA10 and Gli3 was more effective targeted for treatment of breast cancer. than knockdown of Gli3 alone. Taken together, coexpression of EphA10 and Gli3 promotes BC cell proliferation, invasion and migration. early detection and diagnosis of BC, substantial challenges still remain in preventing the cancer initiation and improving the treatment of BC.6 on September 24, 2021 by guest. Protected copyright. In China, the mortality of patients with BC has INTRODUCTION doubled over the last three decades.7 Further In United States, breast cancer (BC) accounts exploration of the progression of BC is urgently for about 29% of all new cancer cases in women needed to improve patients’ survival.8 annually.1 Tumor invasion and metastasis are Eph receptor tyrosine kinases together with dynamic multistep processes, which contribute their ligands known as ephrins are involved in to the vast majority of BC- associated mortali- a large spectrum of developmental processes.9 ties.2 3 Invasive ductal carcinoma is the most The Eph/ephrin signaling mediates cell- cell prevalent type of BC, followed by invasive interaction and contributes to the tumori- lobular carcinoma and other rare types. Both genesis, angiogenesis and metastasis in many invasive ductal and lobular BC can be diagnosed cancers.10 Eph receptor A10 (EphA10) was char- by pathological findings. However, the under- acterized as a more efficient biomarker than the 11 © American Federation for lying causes of the occurrence and development established prognostic marker Her-2 in BC. 4 Medical Research 2021. of BC remain a mystery. BC is heterogeneous EphA10 was highly expressed in various BC Re- use permitted under in molecular changes, clinicopathologic char- subtypes, and an anti-EphA10 antibody could CC BY- NC. No commercial acteristics, therapeutic responses and clinical significantly suppress tumor growth.12 More- re-use . Published by BMJ. outcomes. The initiation of BC is a complicated over, both mRNA and protein expressions of To cite: Peng J, process characterized by genetic and epigenetic EphA10 were positively correlated with tumor Zhang D. J Investig Med alterations that activate cellular pathways for metastasis in BC.13 Nevertheless, the function 2021;69:1215–1221. tumorigenesis.5 In spite of notable advances in of EphA10 in BC cells is uncharacterized. Peng J, Zhang D. J Investig Med 2021;69:1215–1221. doi:10.1136/jim-2021-001836 1215 Original research J Investig Med: first published as 10.1136/jim-2021-001836 on 14 May 2021. Downloaded from The Hedgehog (Hh) signaling pathway, which is well study. Synergic effect of EphA10 and Gli3 was observed in conserved in mammals and other vertebrate species, the malignant progression of BC. has long been known to regulate growth and patterning during embryonic development. Hh signaling pathways MATERIALS AND METHODS consist of Hh proteins (Sonic Hh, Indian Hh, and Desert Patients and tissue samples Hh), 12 transmembrane protein patched (patched 1 and One hundred and twenty- four BC tissues, 50 pericancerous patched 2), 7 transmembrane protein smoothened (Smo) tissues, 50 lobular hyperplastic tissues and 30 normal breast and 5- zinc finger transcription factor Gli proteins (Gli1, 14 15 tissues from benign lesions were obtained at the Second and Gli2 and Gli3). The Gli proteins are large and multi- Third Xiangya Hospitals, Central South University, from functional transcription factors. The three members of Gli January 2000 to December 2002 and were histologically proteins behave differently with partially redundant func- identified by two pathologists. The tumors were restaged tions and are implicated in tumorigenesis. Available data according to the seventh TNM Classification of Malig- has supported the positive correlation of Gli3 with the nant Tumors. Classification and histological grade of the 16 17 progression of hepatocellular carcinoma, colon cancer, cancerous tissues were determined with reference to the 18 19 non- small- cell lung cancer, prostate cancer and cervical WHO classification of tumors. 20 cancer. However, the role of Gli3 in BC remains to be Clinicopathological data of the intraductal carcinomas clarified. and invasive carcinomas are summarized in table 1. Survival The expressions of EphA10 and Gli3 were investigated in data of the 124 patients with invasive BC were collected. surgically resected BC tissues and cultured BC cells in this The follow-up time for patients was 13 years. Twenty-six Table 1 Association between clinicopathological characteristics (CPC) and tumor types Intraductal carcinoma Invasive carcinoma CPC Case number Positive number (%) Positive number (%) χ2 P value Age (years) ≤45 81 13 (72.7) 68 (54.8) 1.938 0.164 >45 61 5 (27.8) 56 (45.2) Menopausal status Premenopausal 80 9 (50.0) 71 (57.3) 0.337 0.562 Postmenopausal 62 9 (50.0) 53 (42.7) Pathologic types Ⅰ 22 5 (27.8) 17 (13.7) 11.132 0.004 http://jim.bmj.com/ Ⅱ 61 12 (66.7) 49 (39.5) Ⅲ 59 1 (5.6) 58 (46.8) Tumor size ≤3 cm 72 15 (83.3) 57 (46.0) 8.87 0.003 >3 cm 70 3 (16.7) 67 (54.0) ER + 73 14 (77.8) 59 (47.6) 5.738 0.017 on September 24, 2021 by guest. Protected copyright. – 69 4 (22.2) 65 (52.4) PR + 79 15 (83.38) 64 (51.6) 6.408 0.011 – 63 3 (16.7) 60 (48.4) CerB2 + 85 7 (38.9) 78 (62.9) 3.773 0.052 – 57 11 (61.1) 46 (37.1) Lymph node metastasis No 73 17 (94.4) 56 (45.2) 15.283 0.000 Yes 69 1 (5.6) 68 (54.8) TNM stage Ⅰ +Ⅱ 83 17 (36.4) 66 (36.4) 10.081 0.014 Ⅲ +Ⅳ 59 1 (1.7) 58 (70.3) EphA10 + 8 (44.4) 76 (61.3) 1.846 0.174 – 10 (55.6) 48 (38.7) Gli3 + 9 (50.0) 69 (55.6) 0.202 0.653 – 9 (50.0) 55 (44.4) ER, estrogen receptor; PR, progesterone receptor; TNM, tumor lymph node metastasis. 1216 Peng J, Zhang D. J Investig Med 2021;69:1215–1221. doi:10.1136/jim-2021-001836 Original research J Investig Med: first published as 10.1136/jim-2021-001836 on 14 May 2021. Downloaded from patients who survived longer than 13 years were included Table 2 Primer sequences in the analysis as censored cases. Pericancerous tissues were collected from the above 50 Name of primers Sequences patients with invasive BC. The age of these 50 patients GAPDH- F GCAAGGATGCTGGCGTAATG ranged from 32 to 70 (46.5±9.4) years. The pathological GAPDH- R TACGCGTAGGGGTTTGACAC examination showed 18 normal breast tissues, 14 mild EphA10- F CCTGGTTAGGGCAGCGTTTA dysplasia, 10 moderate dysplasia and 8 severe dysplasia EphA10- R CTGACTGGAGTGGCTGAGTC cases. Lobular hyperplastic tissues were collected from 50 Gli3- F GGCCATCCACATGGAATATC patients aged from 28 to 60 (36.7±8.4) years. The patho- Gli3- R TGAAGAGCTGCTACGGGAAT logical examination showed 16 normal lobular tissues, F, forward; R, reverse. 19 mild dysplasia, 10 moderate dysplasia and 5 severe dysplasia cases. Normal breast tissues were collected from normal tissues beside 30 breast fibroadenoma and patho- the instruction of the fluorescent quantitative PCR kit logically identified. (SYBR Green Mix, Roche Diagnostics). Each sample had All tissues were made into paraffin sections for three duplicates. The internal reference gene of mRNA was immunohistochemistry. GAPDH. The 2−ΔΔCt method was used for data analysis.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    7 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us