2019 CSID Abstract 2019CSID Plenary Lecture

2019 CSID Abstract 2019CSID Plenary lecture

Epigenetics in autoimmue skin diseases

Ming Zhao Department of Dermatology, Hunan Key Laboratory of Medical Epigenomics, The Second Xiangya Hospital of Central South University, Changsha

Systemic Lupus Erythematosus (SLE) is an autoimmune disease in which the immune system attacks its own tissues, causing widespread inflammation and tissue damage. T lymphocyte activation and differentiation and over-production of autoantibody and Immune complex deposits are the major immunological characters of SLE. CD4+ T effect cells play an important role in the autoimmune response. Previous studies have found that the increased Th17 cells and follicular T cells and the defect of Treg cells are involved in peripheral blood of SLE patients. According to our previous studies, these aberrantly epigenetic modifications such as DNA hypomethylation and histone hyper-acetylation contribute to the increased autoreactivity of CD4+ T cells via upregulating some immune related genes including CD11a, Perforin, CD70 and CD40L. In recent years, some DNA methylation array and sequencing have identified DNA hypomethylation in genome-wide in lupus CD4+ T cells. However, why the epigenetic modifications were changed in lupus compared to normal. How the aberrant epigenetic modifications contribute to the overactivation of CD4+ T cells in SLE? We try to clarify the question. Our results demonstrate that RFX1 expression defect leads to IL-17A overexpression and Th17 cell differentiation via inducing the increased histone acethylation and the decreased H3K9 tri-metylation and DNA hypomethylation in promoter region of IL17A gene in CD4+ T cells of SLE patients. RFX1 deficiency promotes the pathologic changes of autoimmune diseases. This work was published in Nature communication last year. In addition, we detected the DNA methylation level of IFI44L in two cohorts from China and one cohort from European. The methylation levels of two CG Paris were detected in SLE, healthy controls and disease control including rheumatoid arthritis and primary sjogren syndrome. Through the validation in the large cohorts, we identified that the sensitivity is about 94% and the specificity is about 98% when we distinguish SLE from healthy controls using IFI44L methylation levels. Based on the novel findings, we construct a DNA methylation diagnostic kit for SLE.

2019CSID Plenary lecture

Leprosy: an ideal model for infection, genetics and immunology

Hong Liu, Zihao Mi, Zhenzhen Wang, Chuan Wang, Lele Sun, Furen Zhang Shandong Provincial Hospital for Skin Diseases & Shandong Provincial Institute of Dermatology and Venereology, Shandong First Medical University & Shandong Academy of Medical Sciences, Jinan, Shandong, China

Leprosy, a chronic intracellular infectious skin disease, has affected humans for more than 1000 years and is a stigmatized disease even now. Due to the immune-related spectrum of clinical manifestation, leprosy is regarded as an ideal model for studying the interaction between host immune response and infection; in fact, the landscape of leprosy immune responses has been extensively investigated. Meanwhile, leprosy is to some extent a genetic disease because the genetic factors of hosts have long been considered major contributors to this disease. Many immune-related genes have been associated with leprosy. A total of 30 susceptibility genes of leprosy has been identified in Chinese population, which highlighted the crucial roles of NOD2 mediated innate immune response and Th-17-IL23-IL23R mediated adaptive immune response in the pathogenesis of leprosy. In this context, we have summarized advances in both the immunology and genetics of leprosy and present a combined analysis of immunological and genetic studies, which explain how gene variants alter the immune response against the leprosy pathogen and elucidate the molecular pathogenesis of leprosy.

2019CSID Plenary lecture

DC-HIL is a novel immune checkpoint and a promising target for treating melanoma and other cancers

P. Cruz, K. Ariizumi Department of Dermatology, University of Texas Southwestern Medical Center, Dallas, Texas, USA

Introduction Despite the success of immune checkpoint blockers (like anti-PD1/PDL1 mAb) in improving survival of patients with melanoma and other cancers, most cases fail to benefit from this current best-treatment option. Objective To develop better immunotherapy for melanoma and other cancers. Materials & Methods DNA subtraction analyses; Knock out mice; In vitro cell assays; mAb production. Results We discovered DC-HIL (also known as Gpnmb), which exists in 2 forms: a cell-bound receptor, and a soluble factor secreted into circulation. We have shown DC-HIL to inhibit T-cell activation by binding to its ligand syndecan-4 on effector T cells. In healthy individuals, we showed DC-HIL expressed by some immune cells at very low levels. By contrast, in patients with melanoma and other cancers (including breast, colorectal, kidney, lung, prostate), DC-HIL is expressed highly by myeloid-derived suppressor cells (MDSC) that expand exponentially with progression of the malignancy. Soluble DC-HIL (sDC-HIL) is also detectable in the blood of many of these patients at levels increasing with metastasis. MDSC are the most powerful suppressors of T-cell activation, and we showed the DC-HIL receptor on MDSC to mediate this adverse function. We have generated an anti-DC-HIL mAb that in animal models can reduce melanoma growth and metastasis dramatically, as well as block the T-cell suppressor function of MDSC from patients with metastatic melanoma and other cancers. Conclusions We identified a novel immune checkpoint molecule with great promise as a therapeutic target for melanoma and other cancers.

2019CSID Plenary lecture

Lessons from mouse models of psoriasis

Hwang ST1 1Department of Dermatology, University of California, Davis, Sacramento, CA, 95817, USA.

Murine models of human disease have helped further our understanding of the pathophysiology of dermatologic conditions ranging from skin cancer to psoriasis. In my laboratory, we have work with sseveral mouse models of psoriasis. To model psoriasis in mice, we have used injection of IL-23 directly into ear skin, application of topical imiquimod on skin, and, now, systemic hydrodynamic delivery of IL-23 via IL-23 minicircle DNA to induce both skin and joint changes that mimic the psoriasiform dermatitis and joint injury. The skin of IL-23 MC injected mice develop severe psoriasis-like epidermal hyperplasia and dermal inflammation as early as 5-7 days after initiation. The resulting dermatitis lasts >30 days. Years ago, we showed that CCR6 was a chemokine receptor that was abundant on Th17 cells in both mice and humans. CCR6 has been shown by us and others to be critical for the development of psoriasiform dermatitis in mice. Furthermore, in mice, CCR6 is strongly expressed by gamma-delta T cells, rendering them responsive to the chemotactic effects of its sole chemokine ligand, CCL20, that is produced by endothelial as well as keratinocytes. Remarkably, an engineered dimeric variant of the CCL20 ligand which binds to CCR6, but doesn't render chemotactic signaling, can effectively prevent both psoriasiform skin and joint signs of injury in the systemic IL-23 minicircle model at the clinical, histologic, and molecular levels. In summary, murine models of skin disease can help us identify key cells, receptors, and pathways that may also be critical in human skin diseases such as psoriasis. These models advance new therapeutic agents and concepts that may one day benefit patients.

2019CSID Plenary lecture

Molecular Insights into the Pathogenesis of Hand, Foot and Mouth Disease: Immunity Evasion and Beyond

Xiaobo Lei1, Zhendong Zhao1, Bin He2, Jianwei Wang1 1. NHC Key Laboratory of System Biology of Pathogens and Christophe Merieux Laboratory, Institute of Pathogen Biology, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, China; 2. Department of Microbiology and Immunology, College of Medicine, University of Illinois, Chicago, Illinois, USA

Hand, foot, and mouth disease (HFMD), a syndrome characterized by fever with vesicular eruptions mainly on the skin of the human hands, feet, and oral cavity, has been a great public health challenge in Asia-pacific area over the past decades. HFMD primarily affects infants and children less than five years old. Although most infection is mild and self-limited, severe or even fatal neurological complications may occur in some cases. HFMD can be caused by a number of enterovirus (EV) serotypes, belonging to the Enterovirus genus of the family of Picornavirridae. The most important serotype responsible for severe cases is EV71. However, there are no licensed antivirals as the pathogenesis of HFMD remains poorly understood. The innate immunity is the first line of defense against viral infection. Our studies suggested that EVs have evolved sophisticated strategies to evade such host antiviral responses. The virus genome encoded proteases, 3C and 2A, play pivotal roles on evasion the innate immunity by cleaving or blocking multiple key factors in the innate immunity signaling pathway, which may contribute to the pathogenesis of HFMD. In addition, pyroptosis, an inflammatory form of programmed cell death also emerges as a host defense against invasive pathogenic microbiology infection. We found that EV71 infection induces pyroptosis by triggering cleavage of GSDME, an essential switch for caspase-3-mediated apoptosis to pyroptosis. The caspase-3 activation is essential for the cleavage of GSDME by EV71 infection, in that GSDME cannot be cleaved in caspase-3 knockout cells upon EV71 infection. Importantly, GSDME severe EV71 infection in mice as deficiency of GSDME in mice alleviates the symptoms in mice against EV71 infection, suggested that GSDME is important for the pathogenesis of EV71. Our findings provide a new insight into the pathogenesis and potential targets for developing antiviral therapies against HFMD.

2019CSID Plenary lecture

Necroptosis in Stevens-Johnson syndrome/toxic epidermal necrolysis

Riichiro Abe 1Division of Dermatology, Niigata University Graduate School of Medical and Dental Sciences, Niigata, Japan

Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are rare, life- threatening mucocutaneous reactions characterized by extensive detachment of the skin. We previously showed that keratinocyte death in SJS/TEN can be triggered by the interaction of annexin A1 and formyl peptide receptor (FPR) 1 to induce necroptosis, a programmed form of necrosis. Recently we revealed a variety pattern of necroptosis-related molecules, such as RIP3 and MLKL, expression in non-severe adverse drug reaction, suggesting an adjustment mechanism of cell death in keratinocytes. In addition we show anti-SJS/TEN drug development targeting FPR1.

2019CSID Plenary lecture

Dermatological research in China: Past, Present and Future

Xuejun Zhang1, 2 1 Institute of Dermatology and Department of Dermatology, The First Affiliated Hospital, Anhui Medical University, Hefei, 230032, China. 2 Key Laboratory of Dermatology, Anhui Medical University, Ministry of Education, Hefei, 230032, China.

The development of dermatology in China originated from the establishment of the Chinese Society of Dermatology (CSD) in 1937. Before the reform and opening up, the older generation of dermatologists laid a solid foundation for the future development of Dermatology through their hard work and continuous struggles. After that, Chinese scholars have strengthened international and domestic academic exchanges and made remarkable achievements in accurate diagnosis, prevention and treatment, scientific research, popular science propaganda and continuing education of dermatosis, which has been highly recognized all over the world. 1. Standardized training of dermatologists: There are more than 22,000 dermatologists in China. Every year, the CSD and the Society of Dermatology and Venereology of the Chinese Medical Doctor Association continue to educate dermatologists through various forms, such as "grass-roots lectures" and "senior lecturer ". 2. Many journals, such as Chinese Journal of Dermatology, Chinese Journal of Dermatovenereology, and Journal of Clinical Dermatology, have been established, which have enhanced the platform for academic exchanges. 3. Scientific research achievements are outstanding and highly recognized by the international community. In recent years, Chinese scholars have made a lot of original research achievements in skin genetics, immunology, oncology and transformational medicine. A large number of academic papers have been published in the journals with high impact factors, such as Lancet, Science, Nature Genetics, JAMA Dermatol and J Invest Dermatol. Some of the research results have won the National Science and Technology Progress Award and the National Natural Science Award. 4. Continuous strengthening of international exchanges and cooperation has greatly enhanced the academic influence of Chinese scholars. Every year, Chinese dermatologists actively participate in the international dermatological conferences, such as the International Congress of Dermatology and the Asian Congress of Dermatology. Many Chinese scholars serve in the international dermatological academic groups and have made outstanding contributions to the development of dermatology in the world. Although Chinese dermatologists have achieved outstanding achievements in the medical treatment, scientific research, teaching and communication, it remains the direction of future efforts

2019CSID Plenary lecture to improve the level of original research results, intensify clinical transformation, improve the level of diagnosis and treatment of rare and difficult dermatoses, increase popular science publicity and education, and further to enhance the influence of Chinese dermatology in the world.

2019CSID Plenary lecture

Autoreactive B cell differentiation in diffuse ectopic lymphoid- like structures of inflamed pemphigus lesions

Shengru Zhou1, Meng Pan1*, 1Department of Dermatology, Rui Jin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Pemphigus is an organ-specific autoimmune disease targeting skin and/or mucous membranes. In 2016, we have done a 27- case retrospective study of topical glucocorticoids on mild pemphigus patients. The total effective rate of topical therapy is 70.4%. And our previous study showed that infiltrating lymphocytes in pemphigus vulgaris (PV) lesions produce anti-desmoglein (Dsg) 1/3 antibodies after in vitro culture. In this study, we found diffuse ectopic lymphoid-like structures (ELSs) commonly present in lesions of both PV and pemphigus foliaceus (PF). Notably, pemphigus lesions contained centroblasts, plasmablasts and plasma cells, which recapitulated the different stages of B cell differentiation. Elevated mRNA expression levels of the differentiation- related transcription factors BLIMP-1, IRF4 and BCL-6 were observed in pemphigus lesions. Moreover, B cell receptor (BCR) repertoire analysis revealed the clonal expansion of lesional B cells. Lesional B cells might recirculate among lesions, lymph nodes and peripheral blood. Increased mRNA expression levels of multiple chemokines in pemphigus lesions and elevated expression levels of chemokine receptors on lesional B cells were also observed. Collectively, these results show that ELSs in pemphigus lesions might act as a niche, supporting in situ B cell differentiation and clonal expansion.

2019CSID Plenary lecture

Neutrophils in psoriasis: new findings

Shuai Shao, MD, PhD Department of Dermatology, Xijing Hospital, Fourth Military Medical University, Xi'an, China..

Psoriasis is a common chronic inflammatory skin disease with a complex pathogenesis of genetic, infection, immune disorder, and other factors. In recent years, it is universally recognized that the T cell-dominant immune microenvironment disorder is the main cause of psoriasis. However, neutrophils migrate through the vasculature and infiltrate into the dermis, and then are further attracted to the epidermis to form Munro or Kogoj microabscess, which is one of the typical pathological manifestations of psoriasis in the early stage or pustular psoriasis. Several clinical trials have shown that selective depletion of elevated granulocytes and monocytes by adsorptive apheresis alleviates the symptoms and related disorders of generalized pustular psoriasis (GPP) and psoriasis arthritis, confirming that neutrophils contribute to the pathogenesis of psoriasis. However, the function of neutrophils in the development of psoriasis has remained unclear. Neutrophils are the most abundant immune cells in humans and are mainly known for the phagocytosis and killing of invading pathogens. They also play a vital role in a variety of diseases, including infections, autoimmune diseases, neoplastic diseases, and chronic inflammatory diseases. In recent years, studies have found that neutrophils can capture and kill pathogens by forming neutrophil extracellular traps (NETs). NETs are large, web-like structures composed of decondensed DNA, histones, and a variety of neutrophil granule proteins, including various granule enzymes and antimicrobial peptides. Although neutrophils are short-lived immune cells, NETs released by them can continue participating in the progression of various inflammation. In our study, we reveal that psoriatic neutrophils are pre-activated and form NETs, which can activate the TLR4 and its downstream signaling pathway in KCs, thus inducing the expression and secretion of various proinflammatory mediators. The highest expressed protein in NETs-treated KCs, LCN2, induces the chemotaxis and activation of neutrophils, forming a positive inflammatory loop that aggravates the local inflammation of the psoriatic lesions. In addition, exosomes derived from GPP neutrophils activate keratinocytes to express and secrete proinflammatory factors and neutrophil chemokines, promoting the formation of pustules and aggravating the autoinflammation of GPP. Our research clarifies the way in which neutrophils participate in the development of psoriasis, enriches the understanding of the pathogenesis of psoriasis, and provides new ideas for the clinical treatment of psoriasis in the future.

2019CSID Plenary lecture

Rare Heritable Skin Disorders: New Genes and Novel Mutations

Jouni Uitto, MD, PhD Professor and Chair, Department of Dermatology and Cutaneous Biology, and Director of the Jefferson Institute of Molecular Medicine, Thomas Jefferson University, Pennsylvania, USA

A disease is defined as rare in the United States when there are less than 200,000 affected individuals with the same diagnosis. There are collectively over 7,000 rare heritable diseases, and as many as 1,000 of them have skin manifestations. An example of rare heritable skin disorders is epidermolysis bullosa (EB) characterized by neonatal blistering and erosions with considerable morbidity and mortality. In some families, the blistering disorder is associated with extracutaneous manifestations, including renal or cardiac involvement, thus being syndromic, while in non- syndromic forms of EB the pathology is limited to cutaneous and mucosal epithelia. The spectrum of phenotypic manifestations reflects heterogeneity of the genes harboring mutations in different forms of EB. Initially, EB was divided into three broad categories based on the topographic level of blistering within the cutaneous basement membrane zone (simplex, junctional and dystrophic), and originally as many as 10 different genes were shown to harbor mutations in these subtypes. Subsequently, a number of additional candidate genes were identified by recognizing protein deficiencies within the epidermis, and more recently, next generation sequencing approaches, including EB-gene targeted sequencing arrays, whole exome sequencing and whole genome sequencing, assisted by homozygosity mapping and transcriptome profiling, have resulted in identification of novel genes and mutations in different subtypes of EB. Collectively, this work has resulted in identification of 21 causative genes associated with both syndromic and non-syndromic forms of EB. The importance of identifying the mutant genes and specific mutations in different families with EB is emphasized by the potential utility of such information for genetic counseling of the risk of recurrence for EB in the same and subsequent generations. Knowledge of the specific mutations also forms the bases for prenatal testing and preimplantation genetic diagnosis. Furthermore, recent development of a number of treatment approaches, some of which are already in early clinical trials, is based on specific information on the mutant genes and types of mutations, in attempts to develop allele-specific therapies in the realm of personalized medicine, for this, currently intractable group of disorders.

2019CSID Plenary lecture

New immunological aspects of phototherapy for refractory skin diseases

Akimichi Morita Department of Geriatric and Environmental Dermatology, Nagoya City University, Nagoya, JAPAN

Phototherapy utilizes the beneficial effects of ultraviolet (UV) wavelengths to affect immunoregulatory functions. UV light phototherapy using narrowband (NB) UVB and bath-psoralen UVA (bath-PUVA) therapy are well-established treatments. Dual-action operative mechanisms of UV phototherapy have been identified: apoptosis and immune suppression. NB-UVB depletes pathogenic T cells by inducing apoptosis and regulatory T cells. Other wavelengths are also utilized for phototherapy, i.e., 308-nm excimer light and 312-nm flat-typed NB-UVB. Excimer light (308 nm) therapy effectively targets the affected skin without unduly exposing other areas and increases the levels of T regulatory cells. Phototherapy improves impaired resting regulatory T cells and increases activated regulatory T cells in patients with psoriasis. More rational designs of phototherapy devices and irradiation protocols are under development. Biologics are highly effective for the treatment of psoriasis. The long-term safety of biologic therapies, however, is not well established, and they are expensive. Phototherapy takes advantage of wavelengths found in natural sunlight, which, despite its well-known deleterious effects, such as premature skin aging and increased risk of cancer, also has beneficial effects on diseased skin. Sunlight exposure has been historically recommended to maintain health and to treat disorders, and natural sunlight comprises beneficial wavelengths, such as 311-nm NB-UVB. Several ongoing studies are investigating various wavelength-dependent effects on both skin disease and the underlying immunomechanisms. The TL01 lamp is widely used as the light source of 311-nm NB-UVB. This lamp contains mercury, however, the use of which will soon be limited. Therefore, a light-emitting diode that emits UV will be a more desirable and feasible light source, particularly if it has a high enough intensity level for the treatment of skin diseases. Phototherapy is demonstrated to be a highly effective treatment option for patients with skin disease such as psoriasis, and developments to individualize treatments and improve the efficacy and safety of light therapies are ongoing.

2019CSID Plenary lecture

An epigenetic switch: from melanocyte to melanoma

Chunying Li Department of Dermatology, Xijing Hospital, Fourth Military Medical University, Xi'an, China.

Melanoma is the malignancy derived from epidermal melanocytes. It has great capacities of proliferation, invasion and metastasis, and a rather high mortality rate. With the development of social economy, the incidence of melanoma in China has increased year by year, with about 20,000 new cases every year, and most of the patients are in the advanced stage at the first diagnosis, leading to its extreme poorprognosis. Therefore, melanoma has become one of the most serious diseases that threaten the health of our people. Epigenetic modification refers to reversible, heritable changes in gene functionin the absence of changes in nuclear DNA sequence, including DNA methylation, histone acetylation, microRNA regulation, etc.,. Epigenetic modification changes are important for the maintenance of cell homeostasis, which abnormalities are closely related to the malignant transformation of normal cells and the development of tumors. However, its role in melanoma malignant transformation and melanoma development is not fully understood. Our group focused on epigenetic modification and explored the mechanism of melanoma development by emphasizing on histone acetylation and microRNA regulation. On the one hand, through systematic investigations, we discovered that the histone acetylation modifying enzyme SIRT6 exhibits a "two- way change pattern" in the whole process of melanoma development, and can play a role of "double-edged sword" in primary and metastasis melanomas respectively. On the other hand, we first revealed the melanoma-specific microRNA expression profile and found that peripheral blood microRNA can be used as an important non-invasive biomarker for the diagnosis and prognosis of skin tumors, especially melanoma. Moreover, we proved thatmiR-23a is greatly implicated in regulating malignant phenotypeof melanoma cell by targeting autophagy. Our series of studies have shown that the malignant progression from melanocytes to melanoma is essentially a process of epigenetic switch and remodeling. Specific intervention of epigenetic modifications, including histone acetylation and microRNA regulation, is expected to be a new strategy for melanoma treatment.

2019CSID Plenary lecture

Research Advanced in Melanoma

Hong Liu Department of Dermatology, Xiangya Hospital, Central South University, Changsha, China.

Melanoma is a skin disease with high mortality. Currently, the five-year survival rate is very low due to the shortage of effective therapy in the treatment of melanoma. In recent years, scientists and physicians spent great efforts to develop a new therapeutic strategy to treat melanoma such as target therapy and immunotherapy. However, the overall responsive rate of melanoma patients to target therapy or immunotherapy is still limited and drug -resistant is still common. Consider that there are differences between Chinese melanoma patients and Caucasian melanoma patients in the aspects of risk factors, lesion locations, clinical classification, and tumor mutations. Therefore, our group initiated the project of molecular characterization for Chinese melanoma patients, which may provide a strong foundation for the development of novel diagnostic strategy and therapeutic method for Chinese melanoma patients. Moreover, our group was mainly focused on the identification of molecular mechanism underlying the tumorgenesis and tumor progression of melanoma in the past decade. We are the first to elucidate the detrimental role of CD147, a membrane protein, in melanoma, and validated CD147 played an important role in the regulation of melanoma cell proliferation, invasion, and metastasis. In addition, the Nobel Prize in physiology or medicine was awarded to Dr. Allison and Dr. Honjo for the recognization of their discovery of immune checkpoints including PD-1/PD-L1 and CTLA4. In particular, neutralizing antibodies to block the interaction between PD-1 and PD-L1 were developed for the treatment of multiple tumor types with considerable effect, including melanoma and NSCLC. However, less than 40% across multiple cancer types were responsive to PD-L1/PD- 1 blockade and primary or secondary resistance to immunotherapy was reported. The underlying mechanism remains unclear. Recent studies showed that the tumor PD-L1 expression level is a determinant and common biomarker for the assessment of clinical response to anti-PD-L1/PD-1 therapy. Therefore, it is critical to understand the molecular mechanism of tumor PD-L1 regulation, which is important for the improvement of anti-PD-L1/PD-1 therapy and subsequently clinical effect. Our group identified several master regulators of tumor PD-L1, which revealed novel molecular mechanism regarding the regulation of tumor endogenous PD-L1, and developed potential therapeutic strategy for the treatment of melanoma.

2019CSID Plenary lecture

Loss of nuclear-localized AIM2 attenuates autoimmunity by impairing Tfh cell differentiation

Haijing Wu#1, Yaxiong Deng#1, Di Long1, Ming Yang1, Qianwen Li1, Yu Feng1, Yongjian Chen1, Hong Qiu1, Xin Huang1, Guangdi Li2, Yunkai Guo3, Ming Zhao1, Qianjin Lu*1 1Department of Dermatology, Second Xiangya Hospital, Central South University, Hunan Key Laboratory of Medical Epigenomics, Changsha, Hunan, China 2Department of Public Health, Central South University, Changsha, Hunan China 3Department of Otolaryngology Head and Neck Surgery, Second Xiangya Hospital, Central South University, Changsha, China

Absent in melanoma 2 (AIM2) is a well-known component of inflammasomes in innate immune cells. Here, we report our unexpected observation of elevated nuclear-localized AIM2 levels in T follicular helper cells (Tfh) and CD4+ T cells, and demonstrate that AIM2 functions in adaptive immunity by regulating Tfh cell differentiation. Conditional knockout of AIM2 specifically in CD4+ T cells revealed reduced CD4+ T cells in murine spleens and lymph nodes, and dampened KLH- induced Tfh cell responsivity. Work in two mouse models showed that AIM2 deficiency ameliorates lupus by reducing Tfh cells. Mechanistically, AIM2 regulates C-Maf and STAT3, thereby modulating IL-21 production, and IL-21 treatment increased AIM2 expression by recruiting the hydroxymethyltransferase enzyme TET2 to the AIM2 promoter. Our study thus reveals an inflammasome-independent function of AIM2 in CD4+ T cells and demonstrates how AIM2 attenuates lupus autoimmunity by inhibiting Tfh cell differentiation, implicating AIM2 as a target in autoimmune disorders.

2019CSID Plenary lecture

Unrevealing the innate immune antimicrobial function of dermal fat

Ling-juan Zhang, Ph.D. Professor School of Pharmaceutical Sciences, Xiamen University, Xiamen, China.

Dermal white adipose tissue or dermal fat is a unique layer of adipocytes within the reticular dermis of the skin. Recently, several nonmetabolic activities have been discovered for dermal fat and its fibroblast precursors. These functions include antimicrobial defense and roles in hair cycling, wound healing, and thermogenesis. We have found that dermal adipocytes play a critical role in skin defense against invasive S. aureus infection by producing antimicrobial peptides (Science, 2015). Recently, we have reported that this beneficial antimicrobial function of dermal fat is lost during aging by an age-dependent activation of the TGFBR pathway, which promotes a pro- adipogenic to pro-fibrotic switch of dermal fibroblasts, leading to a loss of antimicrobial function of dermal fat during aging (Immunity, 2019). Together, our research findings have unrevealed the role of dermal fat in the skin innate immune system and advanced current understanding of host innate immune defense mechanism of the skin against invading pathogens. Dermal fat may represent a unique skin defense layer providing direct antimicrobial defense protection and may indirectly communicate with other cutaneous immunocytes to enhance defense and potentially contribute to inflammatory diseases.

2019CSID Oral presentation

OR-001 Evaluation of chromatin accessibility in Th and Treg cells of individuals with psoriasis

Zheng Zhang1 1Huashan Hospital

Background Genome-wide association studies (GWAS) of psoriasis have identified 86 susceptibility loci. Most of these loci are located in non-coding regions，which makes it difficult for researchers to determine the functional effect of these risk-associated variants. One hypothesis is that these single nucleotide polymorphisms (SNPs) cause changes in gene expression levels rather than changes in protein function. Recently, a great progress in genome-wide epigenomic technique, make large-scale epigenetic biomarker annotation of diseases possible, these techniques including (i) Bisulfite sequencing to determine DNA methylation at base-pair resolution, (ii) Chip-Seq to identify protein binding sites on the genome, (iii) DNasel-Seq /ATAC-Seq to profile open chromatin and (iv) 4C-Seq and HiC-Seq to determine the spatial organization of chromosomes. Objective To explore the mechanism of non-coding regulatory elements in psoriasis. Methods we performed ATAC-seq and RNA-seq on Th and Treg cells from 20 individuals with psoriasis and 20 controls Results We identified 110,106 ATAC-seq peaks. 1890 differential peaks between Th cells from psoriasis patients and controls. 1167 differential peaks between Treg cells from psoriasis patients and controls. We also identified 1803 differential expressed genes in Th cells and 6633 differential expressed genes in Treg cells. These differential expressed genes contracted in metabolic related pathways. The accessible chromatin regions in Th and Treg cells are highly enriched for psoriasis SNP heritability. Accessible chromatin regions that overlap evolutionarily conserved regions exhibit an even higher heritability enrichment, indicating that sequence conservation can further refine functional risk variants. Conclusion altogether, we characterize chromatin accessibility in Th and Treg cells in psoriasis patients. And provide evidence that our dataset will allow for fine mapping of risk variants.

2019CSID Oral presentation

OR-002 Negative regulation of dendritic cell activation in psoriasis mediated via CD100-Plexin-B2

Chunying Xiao1 Zhu Zhenlai1 Zhang Chen1 Wang Gang1 Li Wei1,2 1Department of Dermatology, Xijing Hospital, Fourth Military Medical University, Xi’an, China 2Department of Dermatology, Huashan Hospital, Fudan University, Shanghai, China

Psoriasis is a chronic inflammatory skin disease, in which dendritic cells (DCs) play a pivotal role by inducing Th1/Th17 immune responses; however, the regulation of DCs activation in psoriasis remains largely unknown. Previously we found that the level of soluble CD100 was increased in sera of psoriasis patients, and CD100 promoted the activation of inflammasome in keratinocytes. In the present study, CD100 knockout mice were utilized to produce imiquimod (IMQ)-induced psoriatic dermatitis, and it turned out that skin inflammation in early, but not late, phase of the psoriatic dermatitis was significantly exacerbated compared to that in wide-type controls, which was mainly attributed to the deficiency of CD100 in hematopoietic cells. Bone marrow-derived DCs, but not T cells or keratinocytes, from CD100 knockout mice produced significantly increased levels of IL-1β, IL-36 and IL-23 upon stimulation with IMQ in a Plexin-B2- dependent manner. Moreover, the surface level of Plexin-B2 on DCs of psoriasis patients was lower than that of healthy individuals, and CD100 attenuated IMQ-induced production of IL-1β and IL-36 from monocyte-derived DCs of psoriasis patients. Our results uncovered a negative regulatory mechanism for DCs activation in psoriasis, which was mediated via CD100-Plexin-B2 in a cell type- and receptor- specific manner.

OR-003 Expression and immunophenotypes of invariant natural killer T cells in peripheral T cells of Moderate-to-Severe Plaque Psoriasis patients

Yifan Hu1 Zeyu Chen 1 Chen Youdong1 Zhang Xilin1 Gong Yu1 Shi Yuling1 1Shanghai Tenth People‘s Hospital,Tongji University School of Medicine

Background Psoriasis is a high-incident immune-mediated polygenic inherited skin disease. The pathogenesis of psoriasis mainly involves T-cell-mediated immunity. Invariant natural killer T(iNKT) cells are a unique lymphocyte subpopulation that share properties and express surface markers of

2019CSID Oral presentation both NK cells and T cells. iNKT cells are all CD1d-restricted and are involved in the development of various inflammatory diseases. Method we detected the expression of iNKT cells and CD4+CD25+FoxP3+Tregs, as well as naive and memory CD4+and CD8+T cells and their cytokine production, in a cohort of 40 moderate-to- severe plaque psoriasis patients with gender and age matched healthy controls. Results We found that the percentages of peripheral iNKT cells were significantly decreased in moderate-to-severe plaque psoriasis patients compared to that in healthy controls. The percentages of CD69+iNKTcells also decreased in the PBMCs of psoriasis patients, which means activated iNKT cells in psoriasis patients are less than that in healthy controls. However, there was no significant difference in peripheral iNKT cells cytokine secretion between psoriasis patients and healthy controls. The general immunophenotypes of CD4+and CD8+T cells and the percentage of CD4+CD25+FoxP3+Tregs have no significant difference among psoriasis patients and healthy controls. Conclusion iNKT cells are involved in the pathogenesis of psoriasis

OR-004 Keratin 17 upregulate the expression of CXCL1 in human psoriatic keratinocytes through going the nucleus

Yixin Luo1 Dang Erle1 Wang Gang1 1Department of Dermatology, Xijing Hospital, Fourth Military Medical University

Keratin 17(K17), as a cytoskeletal protein, is highly expressed in epithelial cells of inflammatory skin diseases and various tumor tissues. In recent years, the present of K17 in the nucleus was found in several tumors. However, such phenomenon had not been documented in inflammatory dermatoses. In our present study, K17 translocation into the nucleus of keratinocyte in psoriasis were found. Thus, greater insight into the mechanism of K17 translocation and its pathogenicity were explored. Initially, we found that K17 occurs as discrete punctate and/or in a diffuse pattern in the nucleus of keratinocytes in psoriastic lesion. Moreover, in human keratinocyte cell line HaCaT cells transfected with the fusion plasmid of wide type K17 with EGFP, K17 was aggregated as discrete punctate in the cytoplasm and then entering into the nucleus. In addition, prominent K17 retention inside the nucleus in HaCaT cells transfected with the K17NES(nuclear export signal)(-/-) mutant plasmid were observed but K17NLS(nuclear localization signal)(-/-) was not . Most importantly, we uncovered that CXCL1 was markedly upregulated when blocking K17 nuclear export with either nuclear transport inhibitor or K17 NES deletion in vitro. These findings reveal a new and unexpected role

2019CSID Oral presentation of K17 translocation into nucleus in psoriasis, which led to elevated expression of CXCL1 and may play an important role in the progression of psoriasis.

OR-005 Effects of Fecal Microbiota Transplantation on a Pristane-induced Lupus Mouse Model

Xiaoqing Yi1 Huang Cancan1 Zhao Ming1 Lu Qianjin1 1Department of Dermatology, Hunan Key Laboratory of Medical Epigenomics, Second Xiangya Hospital, Central South University

Objective To determine the gut dysbiosis and immunological changes in a lupus related mouse model and investigate possible microbial candidates in the pathogenesis of SLE(systematic lupus erythematosus). Method Oral gavage of feces from lpr or mpj mice to pristane-induced lupus model mice, regular and dynamic evaluation of weight, proteinuria and antibody titers during the observation period. Spleen, lymph nodes, intestine and kidneys are collected for flow cytometry or histopathology analysis after sacrifice. Fecal pellets of each experimental mice are collected for 16s rRNA analysis. Result There exist significant differences in proteinuria between two groups at the terminal stage. The level of dsDNA is higher in the lpr feces gavage group than that in the mpj feces gavage group. Renal histopathology from lpr feces gavage group exhibits more severe inflammatory infiltration and immune complex deposition. As for gut, besides more serious local inflammation, intestinal permeability is also increased in lpr feces gavage group due to the higher expression of ZO-1 detected by immunofluorescence. Flow cytometry analysis of isolated lymphocytes from intestine showed B220 or a B cell-relevant changes could be the immunological mechanism accounting for the phenotype differences. According to the 16s rRNA results for mapping the gut microbial communities, several taxa such as Bifidobacterium, Turicibacter, Dehalobacterium could be possible markers for inestinal dysbiosis in SLE. Conclusion Lpr feces gavage group showed accelerated course or aggravating conditions of disease. The alterations of B220 expression and disturbances of gut microbial composition in pristane-induced mouse model reveals the potential relevances among the gut microbiome, immunity and SLE, which lays the foundation for the mechanism researches and the following clinical treatments in SLE.

2019CSID Oral presentation

OR-006 Alterations in the gut microbiome, metabolism and immune status with vitiligo

Qingrong Ni1 Ye Zhubiao1 Li Shuli1 Li Kai1 Liu Yu1 Liu Ling1 Ma Cuiling1 Jian Zhe1 Gao Tianwen1 Li Chunying1 1Department of Dermatology of Xijing Hospital, Fourth Military Medical University, Xi’an, Shaanxi, China

Backgroud Emerging evidence has linked the gut microbiome to autoimmune diseases. However, there is a lack of evidence for the association of vitiligo disease status with the gut microbiome. We decided to create an integrated multi-omic framework of the vitiligo-related gut microbiome combined with serum metabolomics to determine how specific microbes and small molecules interact in the context of vitiligo to ultimately induce, maintain, promote or predict vitiligo development. Methods In this study, we performed differential gut microbiome identification using 16S rRNA sequencing in 30 vitiligo patients and 30 healthy volunteer controls, and we also performed non- targeted liquid chromatography-mass spectrometry (LC-MS) to identify serum metabolites in 15 vitiligo patients and 15 healthy controls enrolled in our cohort. Results We identified vitiligo-associated gut microbiome linked to changes in disease phenotypes, immunological indicates, and circulating metabolites. Firstly, we found that the uniqueness of gut microbes in vitiligo patients was due to a decrease in the proportion of Bacteroidetes/Firmicutes and signature taxonomies such as Subdoligranulum and Psychrobacter. Composition of gut microbiome related to vitiligo-specific factors and disease phenotypes, that could be used to distinguish vitiligo patients from our cohort accurately. Next, we identified 67 robust relationships and obtained significantly associated metabolites like taurochenodeoxycholate (TCDCA) and L-NG-monomethyl-arginine (L-NMMA). Combined with multi-omics data, we established a joint prediction model with a prediction accuracy of up to 0.929. And interleukin (IL)- 1β greatly assisted the accuracy of prediction models. Conclusion Our findings identify previously unknown links between gut microbiome alterations, circulating metabolites, and immunological status, providing a new insight for future studies aiming to understand the host–gut microbiome intervene in vitiligo pathogenesis.

2019CSID Oral presentation

OR-007 Keratinocyte Metabolic Reprogramming Promotes Self-RNA Sensation by Dendritic Cells in Psoriasis

Fangzhou Lou1 Yang Sun1 Honglin Wang1 1Shanghai Jiao Tong University School of Medicine

The maintenance of psoriasis as a skin-confined chronic inflammatory condition requires the abnormal interplay between hyperproliferative epidermal keratinocytes and self-reactive immune cells. In this context, targeting metabolism of keratinocytes is recently reported to be an approach for treating psoriasis, however whether and how the metabolic adaptations of keratinocytes introduce inflammatory cues are unknown. We report that in psoriatic lesions, Protein Phosphatase 6 (PP6) is diminished in the epidermis, and its levels negatively correlate with the disease severity. Mice with genetic deficiency of Pp6 in keratinocytes spontaneously develop psoriasis-like skin phenotype resembling psoriasis clinically, histologically, in its gene expression profile and in its response to therapy. Mechanistically, Pp6-/- keratinocytes rely on inordinate urea cycle along with enhanced oxidative phosphorylation (OXPHOS) to hyper-proliferate, mediated by increased Arginase-1 (Arg1) production resulting from the activation of CCAAT/enhancer-binding protein beta (C/EBPβ). Single-cell RNA-seq reveals the Arginine biosynthesis rate-limiting enzyme, Argininosuccinate synthetase 1 (ASS1), maintains the pool of Arginine in psoriatic epidermis. Moreover, accumulated polyamines branched from urea cycle promote self-RNA sensing by myeloid dendritic cells with the assistance of an RNA-binding peptide originated from heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), a probable autoantigen in psoriasis, which directly links keratinocyte hyperproliferation to autoimmune responses. Targeting metabolic nodes of urea cycle in imiquimod-induced mouse and non-human primate models of psoriasis markedly improves the skin inflammation. Thus, our data reveal for the first time the molecular basis of an auto-inflammatory condition and the functional significance of target organ-intrinsic metabolic reprogramming in inflammation, bringing forth novel insights into the pathogenesis and therapeutic strategies of chronic inflammatory disorders.

2019CSID Oral presentation

OR-008 Chlamydia-Phage peptide was selected and optimizated for inhibting/killing Chlamydia with unique mechanism

Quanzhong Liu1 Shao Lili1 Liu Yuanjun1 Kong Jie1 Hou Shuping1 1Tianjin Medical University general Hospital

Microbial resistance is one of the largest public security problem of the century, The new antibiotics are far less. especisally the emergence of "super-resistant bacteria" in 2010, It seems that we are fast approaching a "post-antibiotic era" in which no antibiotics are available. Genital Chlamydia trachomatis infection is the most common sexually transmitted disease (STD) all over the world in recent years, which has many complications, prolonged refractory and lack of effective vaccines The major events in the developmental cycle are categorized as described in the text to allow an overview of the processes and mechanisms associated with acute and persistent chlamdyial growth. A new special discovery: chlamydia phage peptide has obvious and specific inhibition/destruction effect on chlamydia trachomatis ！ CPG1 peptide destroys the Chlamydia trachomatis.Peptide good effect on C.t genital infection in Mouse model Optimization and its biological effects dfferent part of the peptide。 Chlamydia protein profile after peptide work.chlamydial protein associated with death domain, CADD mRNA Significantly elevated at 48 h. So far, no similar phenomena and mechanisms have no found in the main retrieval tools. Hypothesis and speculation: This peptide triggers the signaling pathway of chlamydia trachomatis, producing spontaneous inhibition and destruction

OR-009 Demethylzeylasteral Inhibits CD8+T cells skin trafficking in vitiligo via CXCL10 downregulation by suppressing the IFN-γ-JAK-STAT1 signaling pathway

Yuqian Chang1 Wang Gang1 Gao Tianwen1 Li Chunying1 1Department of Dermatology, Xijing hospital, Fourth Military Medical University

2019CSID Oral presentation

Background Vitiligo is an autoimmune disease of the skin characterized by patchy depigmentation. It has been showed that the CD8+T cells migrating to skin mediated by chemokines plays a critical role in the pathogenesis of vitiligo. However, there is remain no innovative and effective therapeutic agents targeting this step. Demethylzeylasteral (T-96), which is extracted from Tripterygium wilfordii, is considered to have immunosuppressive, anti-inflammatory and anti-angiogenic effects. Objective This study aimed to assess the effects of T-96 on melanocyte-specific CD8+ T cells that migrate into the depigmentation skin following chemokines which is secreted mainly by keratinocytes. Methods Normal human keratinocytes were pretreated with T-96 for 1 h, followed by the stimulation of IFN-γ for 24 h. The production of CXCL10 was detected by qRT-PCR and ELISA and the chemotactic migration of vitiligo CD8+T cells was measured by transwell assay. Total and phosphorylated JAK1, JAK2 and STAT1 expression were analyzed by RT-PCR and western blot , STAT1 nuclear translocation were assayed by immunofluorescence. Membrane protein expression of JAK1 and JAK2 were evaluated by flow cytometry. The expression of CD69, GzmB, IFN-γ and PRF in patients with vitiligo was detected by flow cytometry assay. The direct target of T-96 was analyzed by pull down， co-immunoprecipitation-mass spectrometry and bioinformatics analysis. Results We initially observed that T-96 significantly decreased the expression and secretion level of CXCL10. Furthermore, our transwell assay showed that under the treatment of IFN-γ, the culture supernatants of keratinocytes pretreated by T-96 induced less migration of CD8+ T cells from patients with vitiligo compared with control. We found that T-96 dramatically reduced total and phosphorylated JAK1, JAK2 and STAT1 expression using western blot. In addition, T-96 decreased STAT1 nuclear translocation and the cell membrane distribution of JAK1 and JAK2. T-96 pretreatment also significantly attenuated the increase of CD69, GzmB, IFN-γ and PRF in CD8+T in the peripheral blood in patients with vitiligo. Conclusions Taken together, our results show that T-96 inhibits chemotactic migration of CD8+ T cells from patients with vitiligo via IFN-γ-JAK-STAT1-CXCL10 signaling pathway, and accounts for the suppression of CD8+ T activation, thus supporting T-96 as a safe, targeted treatment option for patients with vitiligo.

2019CSID Oral presentation

OR-010 A novel chalcone derivative induces cell cycle and apoptosis in Melanoma by targeting Fyn

Ling Tang1,2,3,4 Long Jing1,2,3 Li Keke1,2,3 Zhang Xu1,2,3 Chen Xiang1,2,3,4 Peng Cong1,2,3,4 1Department of Dermatology, Xiangya Hospital, Central South University 2Hunan Key Laboratory of Skin Cancer and Psoriasis, Xiangya Hospital, Central South University 3Hunan Engineering Research Center of Skin Health and Disease, Xiangya Hospital, Central South University 4Department of Clinical Pharmacology, Xiangya Hospital, Central South University

Purpose Melanoma is the leading cause of death in skin cancer. It is usually highly resistant to chemotherapy and associated with poor prognosis even with combined therapy, novel drugs need to be developed in melanoma therapy. Chalcones and its derivatives show great potential value due to its multiple biological activities. In this study, we synthesized series of chalcone derivatives. Among them, Lj-1-60 showed excellent anti-tumor effect in melanoma. We aim to explore the mechanism of the anti-tumor effect of chalcone derivative Lj-1-60 in melanoma. Methods We used Cell Counting Kit-8 to detect the viability of Lj-1-60 in melanoma cells and normal cells concurrently. Clone formation assay was performed to detect anti-proliferation effect of LJ-1-60. We also evaluated the proliferation of Lj-1-60 on xenograft mice model in vivo; then we analysed the cell cycle and apoptosis by flow cytometry and immunoblotting. To further detect the mechanism of Lj-1-60 in melanoma, RNA sequencing was performed and RT-PCR was generated to verify the candidate genes involving in cell cycle and apoptosis-related genes. Both molecular modeling and pull down assay confirmed that Lj-1-60 targeted to fyn, and in vitro phosphorylation assay further confirmed this. Finally, flow cytometry, immunoblotting and RT-PCR were used to detect cell cycle and apoptosis related genes. Results Lj-1-60 exhibited significantly anti-proliferative activity in melanoma in vivo and in vitro with less cytotoxicity to normal cells. Lj-1-60 treatment in melanoma cells induced the arrest of cell cycle in G2/M phase and apoptosis through upregulating P53, CDKN1A, Parp, Bax. Transcriptome sequencing data further confirmed that the anti-proliferative effect of Lj-1-60 in melanoma is involving in cell cycle and apoptosis related genes such as GADD45A, CDKN1A and MCM3. Lj-1- 60 was found to target fyn and inhibited the phosphorylation of its substrate BSG. Knockdown of Fyn in melanoma cells induced cell cycle arrest and apoptosis. Conclusion These results indicated that Lj-1-60 might be a promising drug in melanoma therapy.

2019CSID Oral presentation

OR-011 Aryl hydrocarbon receptor expression in serum, peripheral blood mononuclear cells and skin lesions of patients with atopic dermatitis and its correlation with disease severity

Yuqing Hu1 Liu Ping1 Mu Zhang-lei1 Zhang Jian-zhong1 1Peking Univeisity People’s Hospital

Objective To detect aryl hydrocarbon receptor and its downstream regulators including cytochrome P450(CYP1A1), AhR nuclear translocation(ARNT) and Aryl Hydrocarbon Receptor Repressor(AhRR) in serum, peripheral blood mononuclear cells(PBMCs) and skin in patients with atopic dermatitis(AD). Methods 29 patients with AD and 17 healthy controls were included. Enzyme-linked immunosorbent assay was performed to detect serum AhR level. The mRNA of AhR, AhRR, ARNT and CYP1A1 in PBMCs were measured by real-time quantitative polymerase chain reaction (RQ- PCR). AhR expression in skin lesions was measured by immunohistochemistry. Results AhR was highly expressed in serum and skin lesions of AD patients compared with healthy controls. AD patients had higher mRNA expression of AhR, AHRR, CYP1A1 and ARNT. AhR mRNA levels in PBMCs positively correlated with EASI score and serum IL-6. Conclusions AhR and its downstream regulators were highly expressed in serum, PBMCs and skin of AD patients, which might contribute to the pathogenesis of AD.

OR-012 CDK7 inhibition suppresses psoriasis inflammation via regrogramming metabolism to change the differentiation of CD4+T

Yiting Lin1 1Xijing hospital

Background Psoriasis is an autoimmune disease of the skin characterized by epidermal hyperplasia, increased angiogenesis, aberrant differentiation of keratinocytes and brisk immune cell infiltration. It has been showed that the subgroups of CD4+T such as Th17 and Treg play a critical role in the pathogenesis of psoriasis. However, there is remain no innovative and effective therapeutic agents targeting this step. THZ1, a highly selective and potent covalent CDK7 inhibitor,

2019CSID Oral presentation which plays a well-established role in the regulation of the eukaryotic cell division cycle, and recent studies indicated that it exerted anti-inflammatory effect. Objective This study aimed to investigate the effect of CDK7 on differentiation of CD4+T cells though reprogramming the metabolism to plays a key role in inflammatory response in psoriasis. Methods:CD4+T cells from the peripheral blood of three psoriasis patients and healthy people were done mass spectrometry. The CD4+T cells from human were treated with THZ1 on different levels under Th17 condition for 7 days , then flow cytometry analyze the percentage of Th17 and Treg. The C57BL/6 mice were injected with or without THZ1 in enterocoelia along with IMQ on back. The percentage of Th17 and Treg from mice splenic was analyzed by flow cytometry. Results The mass spectrometry indicated that CDK7 of CD4+T was significantly increased in psoriasis compared with healthy. Pathway enrichment analysis demonstrated that up-regulated proteins are significantly enriched in regulation of glycolysis pathways. CD4+T cells from the peripheral blood were treated with THZ1 increased and the percentage of Th17 and declined the percentage of Treg, furthermore it showed lower ECOR and OCR. The mice with THZ1 and IMQ showed milder skin lesion compare IMQ mice. And the percentage of Th17 increased and the percentage of Treg declined. Conclusions Taken together, our results showed that CDK7 inhibitor THZ1 inhibits glycolysis, therefore down-regulate Th17 and up-regulate Treg to suppress psoriasis inflammation, indicating CDK7 may be an attractive target for psoriasis therapies in the future.

OR-013 Plasma exosomal miR-375-3p regulates mitochondria-dependent apoptotic pathway in keratinocytes by targeting XIAP in SJS/TEN

CHEN ZHANG1 Wang Gang1 Fu Meng1 1Xijing hospital/Xi

Stevens-Johnson syndrome (SJS) and Toxic epidermal necrolysis (TEN) are severe drug- induced cutaneous reactions, with keratinocyte apoptosis characterized to be the primary histologic feature. Exosomes are nanometre-sized vesicles with a lipid bilayer membrane and present in body fluids, containing functional proteins, mRNAs and miRNAs, which induce immune dysfunction and influence disease progress. Nevertheless, the potential roles of plasma exosomes and the underlying mechanisms in the context of severe drug eruptions have yet to be explored. In our study, we uncovers that exosomes isolated from plasma of SJS/TEN patients showed the expected size between 30 and 150nm by using transmission electron microscopy and nanoparticle tracking

2019CSID Oral presentation analysis. Then, exosomes were further characterized by western blot and flow cytometry, and shown to be positive for exosomal markers CD9, CD63, CD81 and TSG101. Deep sequencing analysis and qRT-PCR of plasma exosomal derived miRNAs demonstrated that the miR-375-3p level was the markedly upregulated in SJS/TEN patients and was positively correlated with clinical features. Moreover, miR-375-3p was mainly expressed in the epidermal apoptotic keratinocytes of SJS/TEN patients by in situ hybridization. Then, plasma derived exosomes from patients were internalized by human primary keratinocytes and promoted the cell apoptosis. Additionally, transfection of the miR-375-3p mimic into keratinocytes resulted in increased the proportion of apoptotic cells via mitochondrial pathway. Besides, the miR-375-3p mimic also downregulated the expression of X-linked inhibitor of apoptosis protein (XIAP). Lastly, overexpression of XIAP attenuated miR-375-3p mimic-mediated apoptosis of keratinocytes. Our results indicate that XIAP downregulated by the overexpressed miR-375-3p mediates intrinsic keratinocyte apoptosis via mitochondrial pathway in SJS/TEN patients. Circulating exosomal miR-375-3p might be used as a potential disease marker for the diagnosis of SJS/TEN.

OR-014 Acitretin regulated the differentiation and apoptosis of MDSCs in the treatment of psoriasis

panpan Liu1,2,3,4 Kuang yehong1,2,3,4 Zhu wu1,2,3,4 Chen xiang1,2,3,4 1Xiangya Hospital of Central South Unversity 2Department of Dermatology, xiangya hospital 3Hunan Key Laboratory of Skin Cancer and Psoriasis 4Hunan Engineering Research Center of Skin Health and Disease

Objectives Myeloid-derived suppressor cells (MDSCs) were elevated in psoriatic patient peripheral blood with functionally impaired, and may contribute to the development of psoriasis. Acitretin considered to be used to inhibit proliferation and promote differentiation of keratinocytes in the treatment of psoriasis, but little is known about the role of acitretin to immune cells. The aim of this study was to investigate the mechanism of acitretin on MDSCs in psoriasis. Methods The concentration of MDSCs and the expression of PD-L1 of bone marrow, spleen, peripheral blood, and skin lesions in imiquimod(IMQ)-induced mouse model of psoriasis and acitretin-treated IMQ-induced mouse model were measured by Flow cytometry analyses. Acitretin treated MDSCs isolated from spleen and bone marrow in vitro and the differentiation and apoptosis of MDSCs was measured by Flow cytometry analyses.

2019CSID Oral presentation

Results The expansion of MDSCs, especially M-MDSCs, accumulated in the bone marrow, spleen, peripheral blood, and skin lesions of imiquimod (IMQ)-idunced psoriasis-like mouse models. In addition, after the IMQ-Induced mouse models were treated with acitretin, the percentage of MDSCs and M-MDSCs in spleen and skin lesions, as well as the percentage of M-MDSCs in peripheral blood significantly decreased compared with control groups. Furthermore, we revealed that acitretin played a role in the differentiation of MDSCs into macrophage, especially CD206+M2 macrophage, and CD11c+MHC II+ dendritic cells in vitro. Acitretin also promote the apoptosis of MDSCs isolated from bone marrow and spleen in vitro via several apoptosis-related signaling pathways, and could increase the expression of PD-L1 on MDSCs. Conclusions Abnormal activation of MDSCs played a key role in the pathogenesis of psoriasis. Acitretin regulated the differentiation and apoptosis of MDSCs in the treatment of psoriasis

OR-015 High IgE and T cell cross-reactivity between house dust mite and human transglutaminase 3 and Tropomyosin in patients with atopic dermatitis

Jing Sun1 zhang jianzhong1 1Peking university people

Background Autoimmunity has been postulated to be involved in pathogenesis of atopic dermatitis. However, the mechanism is not fully understood. Objective To study the cross-reactivity between house dust mite (HDM) and human transglutaminase3 and tropomyosin in patients with atopic dermatitis. Methods Forty-two patients with atopic dermatitis and 27 healthy controls were included. The IgE antibodies to HDM, human transglutaminase3 and tropomyosin were measured. The T cell line and T-cell clone generation tests were performed. Cytokines in culture supernatants of T cell clones were measured. Results In anti-HDM IgE positive patients, 83.3% also had IgE antibodies to human transglutaminase3 and/or tropomyosin，significantly higher than in anti-HDM negative patients ( 30.0%, P<0.001). Patients with anti-TG3/TMP IgE antibodies had more severe diseases. Transglutaminase3 stimulation induced lymphocyte proliferation in all anti-HDM positive patients (100% ), significantly higher than in anti-HDM negative patients ( 6.7%, P<0.001). Tropomyosin stimulation induced lymphocyte proliferation in 8 (66.7%) anti-HDM positive patients and none in

2019CSID Oral presentation anti-HDM negative patients. No lymphocyte proliferation was induced in healthy controls. The T cell clones produced both gamma interferon and interleukin-4. Conclusion High IgE and T cells cross-reactivity were found between house dust mite and human transglutaminase 3 and tropomyosin in patients with atopic dermatitis, suggesting a possible autoimmune mechanism in atopic dermatitis. Clinical Implications This study provides new evidences for IgE- and T cell–mediated cross- reactivity between human TG3/TMP and exogenous antigen house dust mite. These results support molecular mimicry as a possible autoimmune mechanism in AD. Capsule summary High IgE and T cell cross-reactivity between house dust mite and human transglutaminase3 and tropomyosin was found in patients with atopic dermatitis, suggesting a possible autoimmune mechanism through molecular mimicry.

OR-016 Ectopic lymphoid-like structures in the skin lesions of discoid lupus erythematosus

Qianwen Li1 Wu Haijing1 Lu Qianjin1 1The 2nd Xiangya Hospital,Central South University

Lupus erythematosus (LE) is an autoimmune disease with a broad clinical spectrum ranging from cutaneous lesions to severe systemic manifestations. Clinically, lupus patients with skin lesions can be divided into two subsets based on the organs involved: cutaneous LE (CLE), such as discoid LE (DLE), and systemic LE (SLE), e.g., acute LE (ACLE). Interestingly, the excessive production of autoantibodies can be found in serum and skin lesions of SLE, however, increased autoantibodies appear in the inflammatory skin lesions rather than serum of DLE. By now the pathomechanism of immune deposition in DLE remains unclear. Herein, with Multiplex immunofluorescence microscopy, we demonstrate that in over half of 112 DLE biopsies, lymphoid aggregates ranged from tight clusters of B cells and T cells to highly organized structures that comprise functional germinal centres (In 58% of cases (66/112), there were well-circumscribed aggregates of CD19+ B cells with CD4+ T cells. In 8% of biopsies (10/112), structures similar to GCs of human tonsil were observed.). Moreover, compared with SLE, the percentage of T cells in DLE showed no statistical difference (DLE 38.07±6.605% vs SLE 48.5±2.873%, n=20, P=0.158), but the percentage of B cells was significantly higher in DLE (DLE 44.33±5.621% vs SLE 23.17±2.821%, n = 20, P=0.0022). 5 samples were selected respectively from two group of LE to detect the proportions of Th1, Th2, Th17, Treg (CD4/T-bet/IL-4/IL17 /Foxp3) and Tfh cells

2019CSID Oral presentation

(CD4/IL21/BCL6/PD-1/CXCR5). Then we found a significantly increased population of T follicular helper (Tfh)-like cells expressing IL21, PD-1 and Bcl-6 but lacking CXCR5 in the dermis of DLE as compared to the SLE (DLE 5.303±0.8259% vs SLE 0.6767±0.2755%, n=5, P=0.0060). Meanwhile, we found an increased IL-21 in the lesion of DLE, as well as in non-Tfh-like cells, which is upstream of Bcl-6. IL-21 and abnormal increased Tfh-like cells in dermis may contribute to the formation of ectopic GCs structures and immune deposition in DLE. Our findings might provide new mechanisms for pathogenesis of DLE, as well as providing potential therapeutic targets.

OR-017 Transglutaminase 3 promotes skin inflammation in atopic dermatitis by activating monocyte-derived dendritic cells via DC-SIGN

Huichun Su1 Luo Yang1 Li Wei2 Wang Baoxi1 Yao Xu1 1Institute of Dermatology, Chinese Academy of Medical Science 2Huashan Hospital, Fudan University

Atopic dermatitis (AD) is often concomitant with increased level of IgE against not only foreign allergens but also autoallergens. AD patients with autoallergy are likely to be more severe and difficult to treat, and self-reactive IgE might be a contributing factor in the pathogenesis of AD. However, how autoallergens are recognized by immune system and what immune responses are induced subsequently remain largely unknown. We found that the serum level of IgE against Transglutaminase 3 (TGase3) was significantly higher in AD patients than that of healthy individuals, and was positively correlated with disease severity. Expression of TGase3 in lesional skin of AD patients was markedly increased compared with that of controls, and Th2 cytokines and/or allergen promoted the expression of TGase3 in keratinocytes. TGase3 bond monocytes-derived dendritic cells (MoDCs) via dendritic cell-specific ICAM-3-grabbing non-integrin (DC-SIGN), which resulted in the production of IL-6 and activation of the NF-κB signalling pathway in MoDCs; and TGase3- treated MoDCs facilitated Th1 polarization. Moreover, skin inflammation in mouse model of MC903- induced AD was attenuated when TGase3 was inhibited. In conclusion, TGase3 was uncovered as a novel autoallergen, and actively involved in skin inflammation of AD; TGase3-targeting might be a therapeutic strategy for the treatment of AD.

2019CSID Oral presentation

OR-018 Mast cells participate in imiquimod-induced psoriasis-like dermatitis via Mas-related G protein-coupled receptor B2

Yong Hao1,2 Che Delu Peng Bin1 Zheng Yi1 He Langchong Geng Songmei1 1Northwest Hospital, The second affiliated hospital of Xi 2The Second Affiliated Hospital of Baotou Medical College

Psoriasis is a chronic, inflammatory, polygenic disorder that is associated with both a physical and psychological burden，affecting approximately 2% of the global population, 0.47% of the china. To date, the pathogenesis of psoriasis is still not fully understood. However, it is now widely accepted that the IL23/Th17/IL17 axis is critical in the pathogenesis of psoriasis, eventually causing abnormal proliferation and differentiation of keratinocytes. Recent studies reported that mast cells increase and may be the main source ofIL-17, IL22 in psoriatic lesions. Moreover, it is identified the MRGPRX2 on mast cell play an important role in many chronic skin inflammatory diseases. whether Mast cells participate in psoriasis via MRGPRX2/MrgprB2 need to be addressed. We obtained H&E and immunofluorescence staining to observe changes of histopathology and mast cells in human psoriasis and imiquimod-induced psoriasis-like dermatitis. RNA-seq, enzyme-linked immunosorbent assays and degranulation assays were performed to investigate whether MrgprB2/MRGPRX2 is involved in the pathogenesis of psoriasis. The results suggested that mast cells participated in the formation of psoriasis-like dermatitis via MrgprB2 in mice, associated with the IL23/IL17 axis, which will help us understand the immunopathogenesis and provide new strategies for the prevention and treatment in psoriasis.

OR-019 Activation of CD100-Plexin-B2-GTPase axis in keratinocyte promotes the skin barrier function in atopic dermatitis

Ying Zou1 Zhang Chen2 Zhu Zhenlai2 Li Wei1 1Department of Dermatology，Huashan Hospital，Fudan University 2Department of Dermatology, Xijing Hospital The Fourth Military Medical University

Background Defective skin barrier is a critical component of atopic dermatitis (AD) pathigenesis. Decreased expression of filaggrin is frequently observed in the majority of moderate-to-severe AD

2019CSID Oral presentation patients. Immunoregulatory molecule CD100 has been confirmed to promotes the development and progression of certain skin disease. Yet the role of CD100 in AD has not been clear. Objective To detect expression of CD100 in AD patients. To investigate of the stimuli which promots keratinocyte(KC) to express CD100. To expore the effect of CD100 on KC and the signal pathway. To survey the skin barrier function of CD100 knockout mice and the role of CD100 in skin barrier in vivo. Methods Detected levels of CD100 in AD patients by enzyme-linked immunosorbent assay (ELISA), real-time quantitative real-time PCR (qRT-PCR), and immunohistochemistry. Investigate mechanisms for CD100 in skin barrier by qRT-PCR, Western Blot(WB) and immunofluorescence. Measure skin barrier funtion of CD100 KO mice by high performance liquid chromatography(HPLC), IHC, transmission electron microscope(TEM), and qRT-PCR. Results Expression of CD100 is elevated in sera and skin lesion in AD patients. IFN-γ, IL-17A , with the strongest promoting effects , and IL-22, the classical inflammatory factor in inflammatory response Th1/17/22 respectively in chronic stage of AD, promotes the expression of CD100 in KC. CD100 promotes the expression of barrier-related protein, such as filaggrin, IVL and CLDN-1, through CD100-PlexinB2-RhoGTPase signal pathway. The poor physiological barrier function and abnormal structure of skin barrier in CD100-/- mice leads to increased transdermal absorption of external stimulus, less content of natural moisturizing factor (NMF) and augmented immune response for transcutaneous immune. CD100-/- mice presents with dysfunction skin barrier, which confirmed with the promotion role in skin barrier of CD100 in vitro. Conclusion Slightly elevated CD100 in AD serves as a protective effect though CD100-PlexinB2- Rho GTPase signal pathway in KC to promote skin barrier integrity. Loss of CD100 in epidermal impairs barrier function.

OR-020 IL-18 Knockout alleviated Atopic Dermatitis-Like Lesions in MC903 induced Mouse Model

Jia-Long Chen1 Niu Xue-Li1 Gao Ya-Li1 Qi Rui-Qun1 Gao Xing-Hua1 Chen Hong-Duo1 1First Hospital of China Medical University

Backgrounds Interleukin (IL)-18, as a pro-inflammatory cytokine, play an important role in the diverse skin diseases. The purpose of this study was to investigate the pathogenesis of IL-18 in development of AD.

2019CSID Oral presentation

Methods Mice were divided into four groups: wild type (WT) control group, IL18 knockout (KO) control group, MC903 treated WT group and MC903 treated KO group. Each group has 5 mice. 4nmol MC903 (Sigma, St. Louis, Missouri) in ethanol was repeated applied topically to the exposed skin of mice daily for consecutive 15 days. AD-like symptoms and severity were evaluated by scoring of dermatitis (SCORAD). Serum immunoglobulin E (IgE) and thymic stromal lymphopoietin (TSLP) levels were measured by enzyme-linked immunosorbent assay (ELISA). Immunohistochemistry was used to assess the expressions of IL-1β, Signal transducer and activator of transcription (STAT) 3 and filaggrin (FLG) in skin lesions. Real-time polymerase chain reaction was performed to assess the mRNA levels of IL-1β, IL-4, IL-9, STAT3, Corticotropin- Releasing Hormone Receptor (CRHR)1, CRHR2, TSLP and Caspase-1 in skin lesions. Results It performed more serious AD-like lesions in MC903 treated skin of WT than of KO. SCORAD showed higher scores in WT than KO treated by MC903 (WT=6.8 ± 0.7348, KO=2.6 ± 0.9274, P=0.0075). Serum levels of TSLP had no significant difference between WT and KO. (MC903 treated: WT=192±50.29pg/ml, KO=128.3±13.94pg/ml, P>0.05. Control: WT=5.879±0.47pg/ml, KO=6.504±0.68pg/ml, P>0.05). Serum levels of total IgE in WT was obviously lower than KO. (M903 treated mice: WT=518.4±42.82, KO=637.4±28.22, P<0.05. Control: WT=41.07±3.856, KO=59.21±4.666, P<0.05). The mRNA expression of IL-4 and CRHR2 were significantly upregulated in WT AD-like lesions. (*P<0.05, **P<0.01, respectively). Immunohistochemistry showed less expression of filaggrin in epidermis of MC903 treated KO mice than of WT (P=0.01). Conclusions IL-18 acted as pleiotropic pro-inflammatory cytokines in development of AD-like lesion. IL-18 aggravated the AD-like lesion reduced by MC 903 through partially upregulating Th2 cytokines. IL-18 promoted the expression of FLG in epidermis and CRHR2 in AD-like lesion but downregulated the serum level of IgE.

OR-021 Oral itraconazole can down-regulate serum PDGF-A of children with infantile hemangioma

Yuping Ran1 Xu Xiaoxi1 Luan Rongsheng1 Zhou Zonglei1 Yang Heli1 Ran Xin1 Xiao Hui1 1West China Hospital of Sichuan University

Background The incidence of infantile hemangiomas (IHs) is 8%-10% in children. We first found that itraconazole can treat infantile hemangiomas according to clinical experience. Our preliminary research showed itraconazole inhibits vascular endothelial cell proliferation in vitro. Vascular

2019CSID Oral presentation endothelial growth factor （VEGF） is a glycosylation-secreting polypeptide factor that promotes proliferation and migration of endothelial cells. Platelet-derived growth factor (PDGF) mediated PDGF signaling was particularly prominent in angiogenesis. When binding to the receptor, it promotes the formation of blood vessels and lymphatic vessels, thereby promoting the formation and metastasis of cancer cells. Objectives This study was aimed to evaluate the changes of serum VEGF and PDGF-A in child before and after oral itraconazole treatment. Methods This study included 17 children, including 6 males and 11 females; aging from 1 to 12 months (average 5.4 months); weighing from 5 to 10.5 kg. After all the parents had signed the informed consents and excluding medical diseases such as liver and kidney dysfunction, oral itraconazole 5mg/kg/d was administrated. Before and after treatment, the blood samples were collected and detected the concentration of serum VEGF and PDGF-A by ELISA kits. Results The treatment period varied from 13 to 63 days (average 32 days), the total dose of itraconazole was 390-2250 mg (average 1072.63 mg). During the treatment, biochemical indicators such as liver function were examined every 4 weeks, all within the normal range but 6 out of 17 children developed mild diarrhea. The serum PDGF-A concentration was 52879.92 ± 31435.65 pg/mL before treatment and 26289.34 ± 26095.77 pg/mL after treatment (2 of them increased and 15 decreased). The difference between the two groups was statistically significant (p< 0.05). But the serum VEGF concentration showed no statistical difference (p> 0.05). There was no statistical correlation between serum PDGF-A levels and treatment period or doses (p> 0.05). Conclusion Oral itraconazole could down-regulate serum PDGF-A of children with infantile hemangioma but the serum VEGF levels showed no significant difference. Further validation of large sample randomized controlled trials is still needed.

OR-022 UVA-induced photoaging inhibits autophagic degradation by impairing lysosomal function in dermal fibroblasts

qingfang Xu1 Huang Yunfen1 Li Yuying1 Qu Yingying1 Zheng Yue1 Lai Wei1 1Third Affiliated Hospital of Sun Yat-sen University

Background Autophagy，a lysosome-dependent cell degradation pathway, has been associated with a variety of diseases especially aging. Human dermal fibroblasts (HDFs) can internalize and then degrade elastin, collagen and advanced glycation end products（AGEs）in lysosomes, which plays prominent roles in extracellular matrix homeostasis and AGEs removal in dermis. Although

2019CSID Oral presentation autophagy has been reported to be decreased in photoaged fibroblasts, the underlying mechanism and its relevance to photoaging remain elusive. Objective This study aims to investigate the mechanism underlying deficient autophagy in UVA- induced photoaged dermal fibroblasts. Methods Repetitive UVA irradiation was used to induce primary HDFs photoaging in vitro. Effect of UVA-induced photoaging on autophagic flux was assessed through counting GFP-LC3 puncta and measuring LC3, Beclin 1 and p62 expression with Western-blot in fibroblasts, which was further confirmed with chloroquine (CQ) or rapamycin (RAP) treatment. Then, lysosomal degradative capacity was compared between photoaged and non-photoaged fibroblasts by detecting the degradation of formed autophagosomes, DQ-Green BSA and endogenous LC3 with confocal microscope and Western-blot. Further, lysosomal acidification was examined by transduction of ad-mCherry-GFP-LC3, LysoSensor yellow/blue DND 160 staining and flow cytometry. Finally, the expression and activity of cathepsin D, B and L were investigated between photoaged and non- photoaged fibroblasts. Results Fibroblasts underwent photoaging in vitro after repetitive UVA irradiation. UVA-induced photoaging significantly increased GFP-LC3 puncta per cell, LC3 Ⅰ / Ⅱ conversion and p62 expression, whereas didn’t alter beclin1 expression in fibroblasts. Moreover, autophagic flux was not significantly affected by CQ treatment, but was remarkably induced by RAP treatment in photoaged fibroblasts. Further lysosomal function studies demonstrated that degradation of formed autophagosomes, endogenous LC3 and DQ-Green BSA was all dramatically decreased in photoaged fibroblasts compared with non-photoaged cells. Also, photoaging obviously attenuated lysosomal acidification, and decreased expression and activity of cathepsin B, L and D. Conclusion UVA-induced photoaging inhibits autophagy at the degradation stage in dermal fibroblasts. Lowered lysosomal acidity, and decreased expression and activity of cathepsin B, L and D might contribute to the inhibition of autophagic degradation, which might be crucial in the development of photoaging through impairing intracellular degradation, collagen synthesis and matrix metalloproteinases expression.

OR-023 Human derived ES-MSCs have lower immunogenicity -- can be a potential donor for cell therapy for skin wounds healing

Yao Chen1 Chen Xiaodong1 1 Department of Medical Cosmetology, Affiliated Hospital of Nantong University, Nantong, Jiangsu, China

2019CSID Oral presentation

Background Adult mesenchymal stem cells (MSCs) have been isolated in different tissues, such as bone marrow, fat, muscle. In vitro culture, MSCs can maintain good proliferative capacity and multi-directional differentiation potential. MSCs have important clinical application value in cell replacement therapy, gene therapy and tissue engineering organ reconstruction. They have been successfully reported in various tissue damage repair and regeneration, including bone, cartilage, muscle, tendon and heart and nerve. Embryonic stem cells (ES) are derived from the inner cell mass of the embryonic blastocyst stage and have strong proliferation and differentiation potential. In theory, they can be expanded indefinitely and can be differentiated into any one of the three germ layers. In our previous work, we used an EB that differentiated ES cells into embryoid bodies (EB) and further differentiated from the inner, middle and outer germ layers. The embryonic stem cell source was obtained by adherent differentiation. Mesenchymal stem cells (hESd-MSCs), which have similar phenotypes to bone marrow-derived MSCs and can be differentiated into bone, cartilage, and fat, are known. Compared with adult MSCS, ES-derived MSCs have their special advantages: 1) the source is abundant and the material is not damaged, 2) it has strong proliferative ability, and the long-term passage (more than 25 generations) can still maintain the original cell characteristics. In addition to its multiple differentiation potential, mesenchymal stem cells have special immunological characteristics. Studies have shown that bone marrow-derived mesenchymal stem cells (BMSCs) do not express HLA class II antigens, B721, B722, CD40, CD40L and other immunomodulatory molecules. More importantly, it can inhibit mixed lymphocyte reaction in vitro. Systematic application of BMSCs in vivo can significantly inhibit immune rejection and prolong the survival time of allogeneic skin graft. Even in the presence of CD28 stimulating antibodies, MSCs are incompatible with the human leukocyte antigen system, and lymphocyte co-culture cannot induce T cell proliferation or activate natural killer cells (NK cells). Whether the embryonic stem cell-derived mesenchymal stem cells have similar immunological characteristics of adult mesenchymal stem cells and embryonic stem cells and how their mechanism of action has been studied so far. Objective The purpose of this study was to investigate the biological characteristics of human embryonic stem cells (ESCs) derived mesenchymal stem cells and their specific immunological properties and mechanisms, and to explore their potential as stem cells to promote skin wound repair. The possibility of a donor. Method 1. Mesenchymal stem cells (MSCs) were obtained from EBs differentiated from human ESCs for 10 days by embryoid body (EB) adherence method, and expanded to obtain human embryonic stem cell-derived mesenchymal stem cells. (hES-MSCs). After amplification, the cells were tested for cell phenotype and adipogenic, osteogenic and chondrogenic differentiation. And

2019CSID Oral presentation to detect the difference in the ability of adipogenic, osteogenic and chondrogenic differentiation after long-term passage. 2. hES-MSCs were cultured in vitro to the 5th generation, and the expression of immune molecules and the expression of type II HLA after IFN-r stimulation were detected. Adult adipose-derived stem cells (ADSC) were used as controls. The proliferation of lymphocytes after stimulation of lymphocytes by allogeneic cells was detected by hES-MSCs, and it inhibited the two-way lymphocyte proliferation reaction and the non-specific lymphocyte proliferation reaction. RT-PCR and real-time PCR were used to detect the expression of IFN-r receptor, JAK/STAT pathway signaling molecule, CIITA and its downstream molecules before and after IFN-r stimulation, and to detect the expression of LRR domain involved in nuclear insertion in CIITA protein. The expression site of HLA-II molecule was not regulated by IFN-r stimulation by CIITA immunofluorescence staining. Result 1. hES-MSCs were obtained by EB adherence method, and hES-MSCs were identified to express mesenchymal cell surface markers, which induced to fat, osteogenesis and chondrogenic differentiation. After long-term passage to 15 generations, they still have the same surface markers and three-way differentiation ability. hES-MSCs do not express HLA-DR. As allogeneic cells do not stimulate lymphocyte proliferation, hES-MSCs can inhibit two-way lymphocyte proliferation and PHA-activated lymphocyte proliferation, and its inhibition is cell-dependent. Similar to ADSC, hES-MSCs did not express HLA-DR. After IFN-r stimulation, the expression of HLA-DR in ADSC was up-regulated, while the expression of hES-MSCs was unchanged. RT-PCR analysis showed that IFN-r receptor, JAK/STAT pathway signaling molecule, CIITA several binding proteins were expressed in both cells, and HLA-II molecular transcription factor CIITA was rich in leucine domain. LRR is deleted in hES-MSCs, and there is no deletion of LRR in ADSC, which may be the reason why HLA class II molecules are not regulated by IFN-r stimulation. We confirmed by further experiments that the 12-18 exon in the LRR domain of CIITA has a deletion, and this part is present in adipose stem cells. Because the LRR leucine-rich region is involved in the nuclear import of transcription factors, this partial deletion may result in the inability of CIITA to fold into the correct conformation and be transported to the nucleus for function. Differences in CIITA genes result in the expression of MHC-II antigens in embryonic stem cell-derived mesenchymal stem cells (hES-MSCs), which are also not regulated by IFN-r, and therefore have lower immunogenicity, which can be a better as a seed cells for tissue engineering and skin wound repair.

OR-024

2019CSID Oral presentation

Lipodystrophia centrifugalis abdominalis infantilis, the same disease spectrum of lupus erythematosus panniculitis in children: A clinicopathological study of 24 cases

Qianyue Xu1 Qiu Yangyang1 Yu Hong1 Lu Zhiyong1 Ling Bo1 Li Yan1 Gu Yan1 Yao Zhirong1 1Xinhua Hospital, Shanghai Jiaotong University School of Medicine

Background Lipodystrophia centrifugalis abdominalis infantilis (LCAI) and lupus erythematosus panniculitis (LEP) are rare in children and traditionally they have been considered as two separate diseases. However, the similarities in clinical and histopathologic features in children, have prompted the discussion that LCAI and LEP may in fact represent a spectrum of the same disease. LEP responds successfully to hydroxychloroquine, while no effective treatments have been recommended for LCAI. Objective To compare the clinicopathological characteristics, treatment, and prognosis of LCAI and LEP in children. Methods We conducted a case series of twenty-four children diagnosed with LCAI or LCAI overlapping with LEP in our department between 2012 to 2018. Results Among twenty-four cases, based on the clinical features, eleven patients were diagnosed as LCAI, thirteen for LCAI overlapping with LEP. The ratio of males to females was 2:9 in LCAI, 6:7 in overlapping group. The most affected site was abdomen and groin in 90.9% of LCAI and 61.5% of overlapping group, followed by cervical region in 38.5% of overlapping group. Lymph node enlargements adjacent to affected lesions were detected in all patients. ANA positive result was found in one child of LCAI, 38.5% of overlapping group. One patient of LCAI overlapping with LEP was complicated with Hashimoto thyroiditis and ANA 1:40 (nucleolar pattern). Among all LACI cases, the skin lesions showed demarcated depression, bluish to brownish in color and the blood vessels were visible. Slightly erythema were found at the edge of depression. Histopathologically, mild inflammatory infiltrate of lymphocytes, histiocytes and few plasmas in the dermis and subcutaneous adipose tissue, membranous degeneration of adipocytes, fat necrosis were found in LCAI, while phagocytosis and/or multinucleated giant cells were only found in children overlapping with LEP. All patients were treated with hydroxychloroquine (5mg/kg/d) and 72.7% (8/11) in LCAI and all in overlapping group showed improvement including two patients showed ineffective to previous oral glucocorticorsteriods. Limitations This was a single-center, retrospective study. Conclusions Strong similarities and subtle differences in the clinical and histopathologic characteristics were observed between LCAI and LEP. Hydroxychloroquine (5mg/kg/d) was

2019CSID Oral presentation effective and safe in treating LCAI and LEP in children (age>1.5years). Our findings suggest that LCAI and LEP exist on a spectrum within the same disease.

2019CSID Oral presentation

OR-025 The expression and differential value of 5-Hydroxymethylcytosine and Retinoid acid receptor β in vulvar diseases

Qian Shang1 Zhao Lihong1 Zhou Hongmei1 Zhao Qiang1 Li Qingyan1 Wang Tian1 Geng Songmei1 1Department of Dermatology of Second Affiliated Hospital of Xi

Objective Diseases of the male genitalia range from infectious lesions to inflammatory and neoplastic conditions, including many genital manifestations of more general skin diseases. Common skin diseases, e.g. psoriasis and lichen planus, may have an atypical appearance in the genital area. The typical psoriatic scale is usually not apparent because of moisture and maceration. Erythroplasia of Queyrat is a carcinoma in situ,presenting as a sharply demarcated, slightly raised erythematous plaque on the glans penis or the inner side of the foreskin. Penile verrucous carcinoma, a variant of well-differentiated SCC, is characterized by slow growth and a locally aggressive nature, but it rarely metastasizes to regional nodes or distant regions.Penile squamous cell carcinoma is the most common malignant tumor of the penisOf all cancers affecting the penis 95% are SCC.Epigenetics plays an important role in the development and progress of many diseases. Deoxyribonucleic acid methylation is an important epigenetic modification that is frequently altered in cancer. 5-hmC is the most abundant mediator of DNA demethylation and plays a positive transcriptional regulatory role in normal development and cancer development.Retinoid acid receptor (RARs)are receptors in the cell nucleus in a variety of tissue. They not only effect on cell differentiation,but also relate to the function of retinoic acid (RA) inducing differentiation of tumor cells.Retinoid acid receptor β(RAR-β) as the main subtypes of RARS, have become a research focus in recently years. Studies have found that most of the tumor cells expressed RARs and with the change of it’s function, including loss of RAR -β gene or abnormal expression closely associated with carcinoma.In this study, we investigated 5- hydroxymethylcytosine and retinoid acid receptor β expression in male vulvar diseases.Moreover we analyzad the difference of 5-hydroxymethylcytosine and retinoid acid receptor β expression expression between benign and malignant lesions to provide evidence for differentiating benign and malignant diseases with similar clinical manifestations in male vulva. Methods We detected the expression of 5-hydroxymethylcytosine and retinoid acid receptor β in 14 patients with penile psoriasis 、 13 patients with penile lichen planus 、 14 patients with erythroplasia of Queyrat 、 6 patients with penile verrucous carcinoma and 7 patients with penile squamous cell carcinoma by immunohistochemistry. The IHC staining results were evaluated according to the IRS (semi-quantitative Remmele scoreing system) who scored the SI(IHC staining intensity) with the PP(percentage of positive cells). SI was scored between 0 and

2019CSID Oral presentation

3 as following: 0: no positive cells were observed, 1: all positive nuclei display a weak staining, 2: the most stained nuclei show a moderately positive, 3: the most stained nuclei display an intensive staining. PP was scored according to the following criteria: 0: no positive cells were observed, 1: only less than 10% nuclei display intense staining, 2: 11%–50% nuclei were observed, 3: 51%– 80%, 4: more than 80%. Kruskal-Wallis test and Bonferroni test were used to analyze the expression differences of 5-hydroxymethylcytosine and retinoid acid receptor β in five groups of diseases . Results There were differences in the expression of 5-hydroxymethylcytosine and retinoid acid receptor β in epidermal between the five groups of diseases.The results of Bonferroni test showed expression of 5-hydroxymethylcytosine was significantly increased in penile psoriasis and penile lichen planus compared with erythroplasia of Queyrat 、 penile verrucous carcinoma and. penile squamous cell carcinoma(P＜0.005).For retinoid acid receptor β, there was no significant difference in the expression between penile psoriasis and erythroplasia of Queyrat(P ＞ 0.005).Moreover, expression of retinoid acid receptor β was significantly increased in penile lichen planus compared with erythroplasia of Queyrat 、 penile verrucous carcinoma and. penile squamous cell carcinoma(P＜0.005). Conclusios The expression of 5-hydroxymethylcytosine was relatively higher in benign lesions(penile psoriasis 、 penile lichen planus)than that of malignant lesions(erythroplasia of Queyrat、penile verrucous carcinoma penile squamous cell carcinoma), the expression of retinoid acid receptor β was increased in penile psoriasis 、 penile lichen planus and erythroplasia of Queyrat than that of penile verrucous carcinoma and penile squamous cell carcinoma.The results suggest that 5-hydroxymethylcytosine and retinoid acid receptor β may provide evidence for differentiating benign and malignant diseases with similar clinical manifestations in male vulva.

OR-026 Effects of human umbilical cord mesenchymal stem cells on inflammatory factors and miR181a in T lymphocytes from patients with systemic lupus erythematosus

bowen zheng1 Zhang Peilian1 Yuan Limei1 Khatri Chhetri Ramkala1 Guo Yun1 Deng Danqi1 1The Department of Dermatology, The Second Affiliated Hospital of Kunming Medical University, Kunming, Yunnan province, China

Umbilical cord mesenchymal stem cells (UC-MSCs) have therapeutic effects in SLE, but the mechanism remains unclear. The aim of the study is to further explore the pathogenesis of SLE

2019CSID Oral presentation and the mechanism by which UC-MSCs affect SLE. Twenty-four hospitalized SLE patients were enrolled, alongside 28 healthy individuals undergoing physical examination, then T lymphocytes were sorted using Miltenyi magnetic beads. After addition of Recombinant Human Interleukin- 2(rhIL-2) and CD3CD28 T Cell Activator, cells were loaded into6-well plates pre-inoculated or not with UC-MSCs for about 1 week of culture. The supernatants were collected for testing inflammatory factors by ELISA. Meanwhile, T lymphocytes were collected to assess the expression levels of genes, proteins in relation to SLE and miR181a by PCR and immunoblot. Compared with T lymphocytes cultured alone, IFN-r, IL4, IL6 and IL10 levels were significantly decreased in T lymphocytes from SLE patients co-cultured with UC-MSCs. In addition, TNF-a, NF-Kb and OPN gene and protein expression levels in T lymphocytes were significantly decreased while miR181a expression was markedly elevated (P<0.05 or 0.008). UC-MSCs have certain immunomodulatory and inhibitory effects on T lymphocytes in healthy individuals and SLE patients, with pronounced effects in SLE patients. UC-MSCs may exert effects by upregulating miR181a and downregulating inflammation-related genes.

OR-027 Successful treatment of vitiligo with cold atmospheric plasma- activated hydrogel

SiYue Zhai1,2 Xu MeiFeng1 Liu ZhiJie2,3 Li QiaoSong2,3 Guo Kun1 Kong M.G.2,3 Xia YuMin1 1Department of Dermatology, The Second Affiliated Hospital, School of Medicine, Xi 2Center of Plasma Biomedicine, State Key Laboratory of Electrical Insulation and Power Equipment, Xi 3School of Electrical Engineering, Xi

Background Vitiligo shows insufficient response to current therapies, partially due to excessive oxidative stress and T lymphocyte dysfunction in lesions. Cold atmospheric plasma (CAP) is capable of modulating immune responses. Objectives We sought to explore the therapeutic effect of CAP on patients with active focal vitiligo. Methods A retrospective case series of 15 patients received topical application of CAP-activated hydrogel (some lesions treated with vehicle control), followed by scoring of lesional areas, and gp100-positive cells or CD8+ T lymphocytes were measured in biopsies. Results A 80.0% partial response rate and a 20.0% complete response rate with long-term follow-up (average of 3.3 months) were seen in patients treated with CAP-activated hydrogel.

2019CSID Oral presentation

Biopsy specimens of treated sites confirmed reduction of CD8+ T lymphocytes and recovery of melanocytes in CAP hydrogel-administered patients. The controls showed no response. We observed neither hyperpigmentation at surrounding areas nor treatment-related adverse events.

Conclusions Topical application of CAP-activated hydrogel concomitantly with single betamethasone injection is a promising therapeutic option for managing active focal vitiligo.

OR-028 Clinical characteristics and prognosis of 324 cases of malignant melanoma

Aidi Mao1 Chen Aijun1 Wang Ping1 1The first affiliated hospital of chongqing medical university

Purpose Malignant melanoma is a malignant tumor derived from melanocytes of the skin and other organs. It has a high degree of malignancy, poor prognosis, and racial differences in the characteristics of the disease. This article aims to discuss the clinical characteristics of the pathogenesis, pathological type, location, treatment and other aspects of malignant melanoma patients in this region, and to analyze the prognostic factors of this disease, to provide a basis for exploring the characteristics of malignant melanoma in China, and to help Further improve the understanding of the disease and the level of diagnosis and treatment. Materials and methods Clinical data of 324 patients with malignant melanoma admitted to the First Affiliated Hospital of Chongqing Medical University and the Army Special Medical Center from January 1, 2013 to December 31, 2017 were collected. All patients were confirmed by histopathology. All patients were excluded from severe cardiovascular and other serious complications. There were 181 males and 143 females, 118 cases of age >65 years, 206 cases of age ≤65 years, median age 62 years (19-93 years old); 217 cases of I+II+III stage and 107 cases of stage IV. This article retrospectively analyzed the clinical characteristics of 324 patients with cutaneous malignant melanoma, followed up the overall survival of all patients, and analyzed the prognostic factors. All statistical analyses were performed using SPSS 22.0 software package with P < 0.05 as the significant standard. The prognostic univariate analysis was performed using the Kaplan-Meier method and the survival curve was drawn. The prognostic multivariate analysis was performed using the COX regression risk model. Results 1. From January 1, 2013 to December 31, 2017, patients with malignant melanoma admitted to the First Affiliated Hospital of Chongqing Medical University and the Army Special

2019CSID Oral presentation

Medical Center did not increase year by year. 2. Among the 324 patients with malignant melanoma, 150 cases (46.30%) had skin, including 109 cases of palmar/underarm (acrosis), 18 cases of upper limbs/lower limbs, 11 cases of trunk, 12 cases of head and neck. There were 44 cases (13.58%) in the mucosa, 56 cases (17.28%) in the nasal cavity, 55 cases (16.98%) in the eyes, and 19 cases (5.90%) in the other. Among them, 324 cases of skin malignant melanoma patients had 214 cases (66.05%) without ulcers, and 110 cases (33.95%) with ulcers. Of the 324 patients, 230 (70.99%) were normal LDH, 52 (16.05%) were abnormal, 42 (12.96%) were untested, and 230 (70.99%) of 3.324 patients had no history of smoking, 94 (29.01%) patients had a history of smoking; 158 (48.77%) had no obvious lymphadenopathy, 166 (51.24%) had different degrees of lymphadenopathy; 67.24 (20.68%) of the 4.324 patients underwent biopsy, not Fourteen patients underwent adjuvant surgery, of which 1 patient received only interferon therapy, 5 received radiotherapy alone, 6 received chemotherapy only, 10 received comprehensive therapy, and 257 (79.32%) The patients underwent surgical resection, expansion and other surgical treatment. Among them, 139 patients were not treated with adjuvant therapy, and 118 patients underwent surgery and adjuvant therapy. Among them, 56 patients received only interferon therapy and 3 patients only received targeted immunotherapy. For example, only chemotherapy was given, 3 patients received radiotherapy only, and 39 patients received chemotherapy, radiotherapy, immunotherapy, and traditional Chinese medicine. Eight of the 324 patients with cutaneous malignant melanoma were unable to be contacted. The 193 patients who died of the disease were followed up. 4. The median survival time of the 324 patients was 30.31 months. The 1-, 2-, and 5- year survival rates were 88.30%, 60.7%, and 23.1%, respectively. Univariate prognostic analysis showed that clinical stage, presence or absence of ulcer on the surface of the skin lesion, LDH, lymphadenopathy, presence or absence of surgery were associated with prognosis (P<0.05). Multivariate prognostic analysis of COX regression showed that the location of the lesion, the presence or absence of ulcer on the surface, and the clinical stage were independent prognostic risk factors for malignant melanoma. Conclusions 1. The incidence of malignant melanoma in this region has not increased year by year in the past five years.2. There are more males than females in malignant melanoma in this region. The overall high-risk age is 60-79 years old, the male high-grade age is 60-69 years old, and the female high-grade age is 50-79 years old. At the time of initial diagnosis, patients with I+II+III had more than stage IV.3, the most common site of malignant melanoma in this area is the skin, of which the extremities (palsy / lower armpit) are the most common. 4, malignant melanoma patients with poor prognosis, clinical stage, skin lesions on the surface of ulcers, LDH values, lymphadenopathy, surgery, or adjuvant treatment are associated with prognosis. Multivariate prognostic analysis of COX regression showed that the location of the lesion,

2019CSID Oral presentation the presence or absence of ulcer on the surface, and the clinical stage were independent prognostic risk factors for malignant melanoma.

2019CSID Oral presentation

OR-029 The Risk Drugs of SJS/TEN in China and Comparing to Asian Countries

Jing Zhang1 Chao Ji1 Cheng Bo1 1Department of Dermatology, the First Affiliated Hospital of Fujian Medical University Background：Stevens–Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are life- threatening severe cutaneous adverse reactions and are mainly related to medications. Recent studies have shown that different ethnic populations may have different risks of medication-induced SJS/TEN.

Objective To analyze the causality and outcome of treatment for SJS/TEN in China and comparing the risk drugs with FDA label in Asian countries. Methods We reviewed case reports of patients with SJS/TEN from the China National Knowledge Infrastructure (CNKI) and Wanfang database and the patients diagnosed with SJS/TEN who were admitted to the First Affiliated Hospital of Fujian Medical University from 2006 to 2016. We also reviewed the registration databases from asian countries during 1998–2017. Results There were 166 patients enrolled from 2006 to 2016.The most common offending drugs were antibiotics and anticonvulsants. Carbamazepine, allopurinol, and penicillins were the most common single offending drugs.A total 1,028 SJS/TEN cases were identified with the drug causality for SJS/TEN. Conclusions 1.Similar to other Asian countries, carbamazepine and allopurinol were of the leading causative drugs for SJS/TEN in China2.Oxcarbazepine,sulfasalazine, COX-II inhibitors, and strontium ranelate were identified as new potential causes.3.In addition to sulfa drugs and beta-lactamantibiotics, quinolones were also a common cause.

OR-030 Chromoblastomycosis: A retrospective study of 219 cases in North China from 1978 to 1982

Yunfang Meng1 1Shandong Provincial Hospital

Background Chromoblastomycosis is a chronic cutaneous and subcutaneous fungal infection caused by certain dematiaceous fungi which was mostly distributed in tropical and subtropical

2019CSID Oral presentation zones. Chromoblastomycosis is fairly common in China, especially in Shandong province, but no epidemiological studies of CBM in China have ever been published in English. Methods This article reevaluated the clinical and epidemiological characteristics of 219 patients collected from 1978 to 1982 in Zhangqiu District in Shandong Province. Results The majority of the patients were male (77.27%) rural workers (89.40%) of between 21 and 60 years old. A total of 144 cases out of 219 cases have records of previous trauma. The most frequent localization of lesions are upper limbs (72.1%). Direct mycological examination was performed with 97.7% tested positive. Culture and microculture were performed in vitro and the most prevalent aetiological agents are Cladophialophora carrion. Conclusion Chromoblastomycosis is a chronic disease and difficult to cure and easy to recur which makes it very important to make the right diagnosis and effective treatment early.

OR-031 Exploring the possibilities of genome editing therapy for dystrophic epidermolysis bullosa via non-homologous end-joining pathway

Satoru Shinkuma1 1Niigata University

Genome editing with engineered site-specific endonucleases induce site-specific DNA double- strand breaks (DSBs), leading to the activation of cellular DNA repair through either the homologous recombination (HR) or non-homologous end-joining (NHEJ) pathways. The HR pathway uses a donor DNA template to guide repair and can be used to create specific sequence changes to the genome, including the targeted addition of whole genes. Application of HR technology in a clinical setting requires the selection and expansion of gene-corrected cells because the frequency of HR-mediated gene correction is quite low. In contrast, the NHEJ pathway, which is activated more frequently than HR, is error-prone and thus conducive to generating frameshift mutations, leading to intentional knockout of a gene or correction of a disrupted reading frame. Dystrophic epidermolysis bullosa (DEB) is a rare genetic skin blistering disorder caused by mutations in COL7A1, which encodes type VII collagen (COL7). Homotrimeric COL7 is secreted from both keratinocytes and fibroblasts, and is the main protein component of anchoring fibrils, which attach the dermis and epidermis. DEB has two patterns of inheritance: autosomal dominant (DDEB) and autosomal recessive (RDEB). We hypothesized that the NHEJ pathway is applicable

2019CSID Oral presentation to DDEB and RDEB through intentional knockout of a gene and restoration of a reading frame, respectively. DDEB is caused by dominant negative mutations in COL7A1. Glycine substitution or in-frame small insertion/deletion (indel) mutations in one allele of COL7A1 result in DDEB, in which one- eighth of all trimers are normal and seven-eighths of all trimers are disrupted by the abnormal protein. We show that mutation site-specific NHEJ using CRISPR/Cas9 can be applied to DDEB. We postulate that the disease can be treated simply by knocking out the mutant allele, while leaving the wild-type allele unchanged. Our data established the feasibility of mutation site-specific genome editing in dominant negative disorders. For RDEB, we applied gene reframing therapy to a recurrent frameshift mutation, c.5819delC, in COL7A1, which results in a premature termination codon. CRISPR/Cas9 targeting this specific mutation site were delivered to RDEB patient fibroblasts. We identified a significant number (17/50) of clones in which the frameshift in COL7A1 was restored. The reframed COL7 was functional, as demonstrated by triple-helix formation assay in vitro, and was correctly distributed in the basement membrane zone in mice. Our data suggests that mutation site-specific NHEJ might also be a highly efficient gene therapy for inherited disorders caused by frameshift mutations.

OR-032 Gene Mutation Analysis Of Congenital Alopecia/Hypotrichosis And A Functional Study On Snrpe Gene

Xueyan Yao1 Yu Cong1 Wen Guangdong1 Zhang Jianzhong1 Zhou Cheng1 1Peking University People

Background Congenital alopecia or hypotrichosis is a group of rare congenital monogenic hair loss disorders．Great clinical heterogeneity and genetic heterogeneity have been reported．Affected individual shows diffuse or local absence or sparse of hair at birth or soon after birth. Hereditary hypotrichosis simplex (HHS) is a rare autosomal dominant form of congenital hair loss disorders characterized by generalized hair loss without characteristic hair shaft changes and anomalies in other organ systems. APCDD1, RPL21, SNRPE gene were reported as the causative gene of HHS in recent studies. Woolly hair (WH) is a rare congenital hair loss disorders characterized by hair shaft wool-like changes and some with anomalies in other organ systems. LIPH, KRT25, KRT71, KRT74 gene were reported as the causative gene of WH in recent studies. However, further study of genetic mechanism and function is needed.

2019CSID Oral presentation

Objective 1) To analyze the clinical features of a family member with HHS, and to identify the causative gene mutation. 2) To analyze the clinical features of a family member with WH, and to identify the causative gene mutation. 3) To study the expression of SNRPE in human hair follicles. To investigate the influence on cell proliferation, cell cycle and migration after knocking down SNRPE in HaCaT cells. Methods 1)The family with HHS was investigated by their clinical features, the shape of hair shaft and systemic involvement. Genome DNA(gDNA) of every family member was extracted from peripheral blood. Every gDNA of familial individuals was analyzed by sequencing all exons of each candidate gene by PCR. The mutation sites were checked by healthy family members and 100 ethnically matched normal controls. 2) The family with WH was investigated by their clinical features, the shape of hair shaft and systemic involvement. Genome DNA(gDNA) of every family member was extracted from peripheral blood. Every gDNA of familial individuals was analyzed by sequencing all exons of each candidate gene by PCR. The mutation sites were checked by healthy family members and 100 ethnically matched normal controls. 3) The expression of SNRPE in the scalp skin of the normal controls was detected by immumohistochemical staining. Knocking down the SNRPE in HaCaT cells by shRNA, get to know the change of cell proliferation by CCK8, the change of cell cycle by flow cytometry (FCM) and the change of cell migration by wound healing and Transwell cultures. Results 1) The HHS family consisted only one individual, the proband. Based on the clinical manifestations, the diagnosis of generalized form of HHS was clear. The causative heterozygous mutation was identified as a c.144+4A>C in SNRPE gene in the individual. The same nucleotide mutation site was not found in the other family members and 100 healthy controls. 2) The WH family consisted only one individual, the proband. Based on the clinical manifestations, the diagnosis of WH was clear. Three heterozygous missense mutations, c.973C>T , c.614A>G , c.454G>A were identified in the LIPH gene of the patient. Two heterozygous missense mutations, c.973C>T and c.614A>G were identified in the LIPH gene of the patient’s father. One heterozygous missense mutation c.454G>A was identified in the LIPH gene of the patient’s mother. The same nucleotide mutation sites were not found in the other 100 healthy controls. 3) Immunohistochemical staining of scalp in normal adults show that SNRPE was widely expressed in skin, high-expressed in epidermis, hair follicle, sebaceous glands, sweat glands and vascular epithelial cells, but low- expressed in the upper part of dermal papilla and outer hair root sheath. After knocking down SNRPE in HaCaT cells, the cell proliferation detected by CCK8 was decreased, the cell percentage of S/G2 stage was decreased and that of S was increased, the cell migration ability detected by wound healing and Transwell cultures was decreased. Conclusion 1)Using genetic analysis and exons sequencing, we identified a new heterozygous mutation site c.144+4A>C in the SNRPE gene in a Chinese patient with HHS. 2) We identified three

2019CSID Oral presentation heterozygous missense mutations, c.973C>T, c.614A>G, c.454G>A in the LIPH gene in a Chinese patient with ARWH. c.973C>T, c.614A>G were from her father. c.454G>A was from her mother. 3) SNRPE widely expressed in human skin including the hair follicles. Lack of SNRPE inhibited cell proliferation and migration.

OR-033 Permanent alteration of Abcc6 with in vivo CRISPR-Cas9 genome editing

Dalong Zhi1 Dang Erle1 Wang Gang1 1Department of Dermatology, Xijing Hospital, Fourth Military Medical University

Pseudoxanthoma elasticum (PXE), a heritable ectopic mineralization disorder, is caused by mutations in the Abcc6 gene primarily expressed in the liver and the kidneys. The fundamental question on pathogenesis of PXE, whether lack of Abcc6 expression in liver or kidney is the primary site of molecular pathology in peripheral tissues, has not been addressed. Previous studies have used a systemic knockout to construct mice or zebrafish model, these animal models do not simulate the onset of PXE very well. Specific knock-out of the Abcc6 gene in the liver may better mimic the onset of PXE. Therefore, it is imperative to construct an animal model that specifically knocks out the ABCC6 gene in the liver.The goal of this study was to construct a liver-specific knockout animal model of Abcc6 gene, aiming to better simulate the pathogenesis of PXE and provide new ideas for its pathogenesis research and treatment.Our previous study found a new PXE site in Chinese, so we designed sgRNA at the same sites in mice and constructed a CRISPR/Cas9 plasmid co-expressing lentivirus. Then we used tail vein injection to achieve knockout Abcc6 gene in the liver.We found that 1 month of administration of the virus, the mutagenesis of Abcc6 in the liver was found. We also found that 6 months of administration of the virus, pyrophosphate (PPi) level was reduced in the knock-out mice and depicted ectopic mineralization in the dermal sheath of vibrissae in muzzle skin.Gene editing with the CRISPR/Cas9 system disrupts the Abcc6 gene in vivo with high efficiency and reduces PPi levels in mice, and depicts ectopic mineralization in the skin. Specific knock-out of the Abcc6 gene in the liver may better mimic the onset of PXE. This approach may have therapeutic potential for the prevention of PXE in humans

2019CSID Oral presentation

OR-034 Association of IL-23R gene polymorphisms with behcet disease susceptibility: a meta-analysis of case-control studies

Hai-bo Gong1 Wu Xiu-juan2 Pu Xiong-ming1 Kang Xiao-jing1 1People’s Hospital of Xinjiang Uygur Autonomous Region 2Central Hospital of Shanghai Xuhui District

Objective The aim of the present study was to investigate the association between IL-23R gene polymorphisms and behcet disease susceptibility. Methods Comprehensive literature searching was carried out in 4 online databases including PubMed, Embase, Cochrane Library, Web of science. The included studies have to be published before May 15, 2019. We used the Newcastle–Ottawa scale to assess the quality of every included study, and pooled odds ratios (ORs) and 95% confidence intervals (95%CIs) were calculated under allele model of inheritance to evaluate potential associations between IL-23R gene polymorphisms and behcet disease risk. Results 12 case-control studies comprising 7899 BD patients and 10851 controls were identified and included in this meta-analysis. 5 loci of IL-23R gene polymorphisms were estimated in this meta-analysis. 2 loci were found significantly associated with BD susceptibility, rs17375018 (G VS A, OR=1.46, 95%CI: 1.30-1.63, P<0.00001) and rs924080 (T VS C, OR = 1.36, 95%CI: 1.29-1.43, P < 0.00001). For there were insufficient data of rs12119179, rs11209032, and rs12141431, we only conducted a systematic review for them. Conclusions This meta-analysis indicated that both rs17375018(G/A) and rs924080(T/C) were found to have an increased risk with BD susceptibility. Limited evidences were observed to estimate the other IL-23R polymorphisms due to a lack of original studies.

OR-035 KRT6A gene mutation and new PLEC gene mutation were found in a family by gene sequencing

Keying Guo1 Zhang Li1 Li Xiaoying1 1Shandong Provincial Hospital affiliated to Shandong University

Objective To find out the causes of complex skin symptoms in the proband and his family members, so as to make a definite diagnosis and better treat the proband. The proband, a 23-year-old man,

2019CSID Oral presentation was unable to walk for half a month due to extensive plantar erosion and pain then admitted to our department. Ten years ago, he was diagnosed "pityriasis rubra pilaris". Intermittent symptomatic treatment did not alleviate the symptoms. Dermatological examination: His skin was a little black and dry. Oral leukoplakia. Miliary blisters could be found on the face and wrist. There were follicular papules and fine debris on the stretched side of the body. The nails of both hands and toes were thick and brown-black. And the palms of both hands were dry and slightly keratinized. Bilateral plantar keratosis was clear, immersion erosion, with diffuse blisters. Follow-up medical history:Sweat hands and feet in peacetime. The blisters of facial, hands and feet often occur in friction, warm season, high temperature, fever, cold. Family history: 1)The 50-year-old father. The symptoms of immersion erosion and blister were similar to those of the proband during the period of 10-30 years old, and gradually decreased to complete disappearance with age. Most of the original skin lesions were replaced by keratotic plaque. 2)The 49-year-old aunt. She said that the sole and toe of the foot have been repeatedly crusted and scabbed, which has not occurred in recent years. In the warm season, facial rashes and herpes are prone to occur. Pale brown superficial scar skin lesion on the front of left anterior tibia, keratotic patches were seen at the friction of the voix pedis and digiti pedis. 3)Grandfather (dead) had symptoms of palm and sole thickening. Others family members are asymptomatic. Methods 1)The three-generation family of 7 members were genetically sequenced—proband and parents were subjected to whole exome sequencing(WES), and then all of family members were verified by Sanger sequencing based on WES results. 2)Laboratory tests were conducted for fungal, HPV and HSV infections. Histological sections of skin lesions on the lateral edge of the right heel were made and observed under microscope. Results 1) Two heterozygous mutations were found. pachyonychia congenitais(PC)-6a with heterozygous variant c.516_c.518delCAA(p.Asn172_Lys173delinsLys) within exon 1 in KRT6A, and Ogna-Epidermolysis bullosa simplex(Ogna-EBS) with the same variant c.3970C>T(p.Arg1324Cys) within exon27 in PLEC. The proband and father each was revealed two gene mutations(KRT6A and PLEC), while grandmother and aunt each showed PLEC mutation. 2)Histopathologic examination showed the epidermis highly hyperplasia and hypertrophy, in the epithelial 1/3 cell ballooning degeneration, perifollicular koilocytotic cell, prickle layer intercellular edema, full-thickness derma anapetia and vasocongestion, band-like lymphocyte infiltration, macerated dermatitis papillomavirus infection. Conclusion 1)The proband and his father were diagnosed as PC with Ogna-EBS, while the aunt and grandmother were Ogna-EBS. 2)PLEC(p.Arg1324Cys) gene is pathogenic, but because the carrier of the mutant gene has different clinical symptoms, the research team speculates that PLEC gene has the characteristics of nonpenetrance. We have discovered a novel pathogenic mutation

2019CSID Oral presentation in the PLEC gene that causes Ogna-EBS. This case is the first Ogna-EBS found in China. Pathogenic genes need further functional studies.

OR-036 The transcriptional profiling of mycosis fungoides with large cell transformation

Fengjie Liu1 Wang Yang1 1Department of Dermatology and Venereology Peking University First Hospital

Mycosis fungoides (MF) is the most common type of cutaneous T cell lymphoma(CTCL). 8- 55% of mycosis fungoides will go through large cell transformation (LCT), which is classified as transformed if biopsy shows large cells (>4 times the size of a small lymphocyte) in more than 25% of the infiltrate or if they form microscopic nodules. LCT is associated with aggressive clinical courses, resistance to multiple drugs and poor prognosis. However, the molecular mechanisms of LCT are not very clear. In order to figure out some of the mechanisms involved in LCT, we performed transcriptome sequencing to compare the differences between LCT group (27 patient samples) and NLCT group (22 patient samples) of MF with both tumor stage on the level of transcription. We found that upregulated genes in LCT group were significantly enriched in the pathways associated with cell cycle, cancer metastasis, glucose metabolism, downstream of drug target (such as HDAC inhibitors and proteasome inhibitors), infection-related molecular changes (such as TSST and LPS stimulation) and T cell activation through gene set enrichment analysis(GSEA), demonstrating that LCT group has increased proliferation capacity, metabolism status and T cell activation level. What’s more, upregulation of genes located in chromosome 7 in LCT group was also with significant difference by GSEA and further copy number variation analysis discovered that LCT group with higher copy number gains in chromosome 7. PEG10, parentally expressed gene 10, was located in chromosome 7 and ranked first in the list of differentially expressed genes with higher expression in LCT group. We found that PEG10 was positively associated with ki-67 proliferation index and LCT group presented with higher ki-67 proliferation index compared with NLCT group. PEG10 gradually upregulated along with disease progression and higher PEG10 expression was related to worse prognosis in an enlarged patient cohort. Furthermore, PEG10 was linked to the sensitivity to HDAC inhibitors and proteasome inhibitors, while higher PEG10 expression was associated with a higher likelihood of resistance to bortezomib and SAHA, supporting the use of PEG10 as a biomarker to identify patients likely to benefit from these drugs and as a potential target for further therapy. Collectively, our findings provide novel

2019CSID Oral presentation insights into the transcriptional profiling of MF with LCT and suggest potential diagnosis markers and targets for therapies.

OR-037 PRKAR2B is regulated by TOX and overexpressed in early stage mycosis fungoides

Jie Liu1 Cheng Chi1 Zhaorui Liu1 Sam T Hwang2 Yuehua Liu1 1Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College 2School of Medicine, University of California Davis, Sacramento, CA, USA

Background Mycosis fungoides is the most common type of primary cutaneous T cell lymphoma, and Sézary syndrome is a more severe type of pCTCL which is related to MF. TOX is overexpressed in MF, corresponding with disease severity and prognosis. TOX is a DNA-binding protein, which enables it to regulate the expression of multiple downstream genes directly or indirectly, thus aberrant expression of TOX may cause malignancies. TOX plays an oncogenic role in pCTCL, but the specific mechanism is still unclear. Objectives To find downstream target of TOX and explore its effects on cellular functions. To investigate the virtual expression level of the TOX-regulated gene in MF patients. Further on, to clarify the pathogenic mechanism of TOX and TOX-regulated gene in MF/SS. Methods Two cell lines were used in this study, Myla cell line and Hut78 cell line, respectively representing MF cells and SS cells. Overexpression and knockdown of TOX and TOX-regulated gene were performed by viral vector transduction. Transcriptome sequencing data were analyzed by Software EdgeR and GO Enrichment. Gene expressions at the level of mRNA and protein in cell lines and skin tissues were detected by qRT-PCR and western blot or immunohistochemistry. Cell proliferative activity was investigated by CCK8 cell proliferation assay. Results Multiple genes were regulated by TOX in Myla cells, with an enrichment in 36 gene ontology (GO) terms regarding cellular compartments and biological processes. Among these genes, 25 genes were profoundly regulated by TOX, including PRKAR2B. Knockdown of PRKAR2B in Myla/Hut78 cell line inhibited cell proliferative activity. In MF patients’ lesions, immunohistochemical positive rate of PRKAR2B was much higher than that in controls’ (55.17% VS 0%), and varied among different MF stages. Moreover, the immunohistochemical scores of PRKAR2B had a negative correlation to clinical stages.

2019CSID Oral presentation

Conclusions PRKAR2B was regulated by TOX and knockdown of PRKAR2B impaired cell proliferation. PRKAR2B was overexpressed in MF patients in early stages.

2019CSID Oral presentation

OR-038 TRAF6 activates fibroblasts to cancer-associated fibroblasts(CAFs) through FGF19 in tumor microenvironment to benefit the malignant phenotype of melanoma cells

yeye guo1 Zhang Xu1 Xu Xiaowei1 Chen Xiang1 Peng Cong1 1Xiangya Hospital, Central South University

Introduction Tumor necrosis factor receptor-associated factor 6(TRAF6), is an E3 ubiquitin- protein ligase. We found that it promotes invasion and metastasis of melanoma, the most malignant skin cancer. However, the function of TRAF6 in stromal fibroblasts has not been elucidated. In this study, we investigated the role of TRAF6 in the interaction between melanoma cells and stromal fibroblasts. Methods The biological effect of TRAF6 in BJ cells was demonstrated by both in vitro and in vivo studies through ectopic expression or knockdown of TRAF6 in BJ cells including cell counting kit- 8, wound healing, transwell migration assay, western blot. Melanoma cells treated with conditioned media(CM) from TRAF6-overexpression or knockdown BJ were detected in the malignant phenotype. A melanoma xenograft model was established by mixing TRAF6 knockdown BJ with melanoma cells (1.5: 1) to study the effect of TRAF6 on melanoma formation. RNA sequencing of melanoma cells with TRAF6 knockdown was conducted and the results were validated by qPCR. The molecular pathway influenced by TRAF6 was characterized using in silico target prediction tools, dual luciferase reporter assays, knockdown and rescue experiments. Results TRAF6 promoted the proliferation, migration, MMPs and SMA expression of BJ cells. The expression of TRAF6 in BJ affects the proliferation and migration in melanoma cells. Interestingly, the expression of TRAF6 in melanoma cells could also affect the proliferation, migration and the expression of MMPs and SMA in BJ cells. RNA sequencing indicates that FGF19 is the key cytokine regulated by TRAF6 in melanoma cells. Mechanistic investigations identified FGF19 as a direct target of NFκB. Exogenous FGF19 significantly promote the conversion of BJ cells to cancer-associated fibroblasts(CAFs). Conclusions Our data highlight the etiology and significance of TRAF6 in TME of melanoma and reveal its major downstream molecular and biological function. Targeting TRAF6 both in CAFs and in melanoma cells is a new treatment strategy for melanoma.

2019CSID Oral presentation

OR-039 Abnormal autophagosome formation in vitiligo melanocytes increased melanocyte sensitivity to H2O2-induced oxidative stress in vitiligo

Tingting Cui1 Wang Gang1 Gao Tianwen1 Li chunying1 1Department of Dermatology, Xijing hospital, Fourth Military Medical University, Xi

Background Autophagy is a controlled self-digestion process which can protect cells against oxidative damage. Disregulated autophagy has been demonstrated to increase melanocyte sensitivity to H2O2-induced oxidative stress in vitiligo. The process of Autophagy is consisted of autophagosome formation and autolysosome degradation. However, the exact mechanism of autophagy in vitiligo melanocytes in response to oxidative stress is still not clear. Objective This study aimed to determine the implications of autophagy for melanocyte survival in response to oxidative stress. Methods Normal human melanocyte cell line PIG1 and vitiligo melanocyte cell line PIG3V were firstly transfected with lentiviral plasmid mRFP-GFP-LC3, then both PIG1 and PIG3V were exposed to a certain concentration of H2O2, autophagic flux were monitored at any time by laser confocal microscope through signal of mRFP-GFP-LC3, cell transfection were performed using liposome 3000, cell apoptosis were detected by flow cytometry, the protein expression level were detected by western blot, autophagosome morphology were visualized by transmission electron. microscopy. Results we initially found that the autophagic flux in normal melanocyte cell line PIG1 exposure to H2O2 was significantly enhanced compared with that in vitiligo melanocyte cell line PIG3V, which were accompanied by high level of ROS accumulation, membrane potential changes, and increased apoptosis. It indicates that vitiligo melanocytes exhibited hypersensitivity to H2O2- induced oxidative injury due to dysregulated autophagy. We further explored the mechanism of autophagy disorder, our study confirmed that inhibition of autolysosome degradation can not promote autophagosome accumulation in vitiligo melanocytes, LC3II/I was not upregulated as expected, indicating that the impairment of autophagosome formation is responsible for the defects of autophagy in vitiligo melanocytes, the further study showed that phosphoralation level of the main transcription factor for Atg5 and Atg12, HSF is significantly lower than that in normal menaocytes when exposed to H2O2, upregulation of Atg5 or Atg12 reduced H2O2-induced oxidative damage of vitiligo melanocytes. Conclusions Taken together, our data show that dysregulated autophagy owing to the impairment of Nrf2-p62 pathway and autophagosome formation increase the sensitivity of vitiligo

2019CSID Oral presentation melanocytes to oxidative stress, thus promote the development of vitiligo. Our results indicating that targeting autophagy may be a potential therapy option.

OR-040 SIRT7 insufficiency reinforces hair follicle stem cells quiescence via compromising NFATc1 degradation

Guo Li1 Tang Xiaolong2 Li Ji1 Liu Baohua2 1Xiang ya hospital 2Shenzhen University Health Science Center

The disorder of hair regeneration caused by aging or other dysfunction of hair follicle, on which the activation of hair follicle stem cells (HFSCs) plays a key role, is the main cause of alopecia. Therefore, in-depth study of the molecular network regulating HFSCs activity can provide clues for the management of alopecia. Sirt7 is involved in the regulation of many physiological activities, including the process of aging and the maintenance and activity of stem cells. However, the role of Sirt7 in hair follicle stem cell has not been reported. Objective 1. To elucidate the expression pattern of Sirt7 in hair cycle and aging; 2. To clarify the regulation of Sirt7 on HFSCs and its specific mechanism. Methods 1. Via immunohistochemistry (IHC), western blot (WB) and reverse transcription PCR (RT-qPCR), we detected the expression pattern of Sirt7 during hair cycle and aging; 2. Using Sirt7 knockout and overexpressing mice, via hair regeneration models of shaving and plucking, we explored the regulation of Sirt7 on HFSCs activity and hair follicle cycle by phenotypic observation, HE staining and immunofluorescence(IF).3.Using Sirt7 knockout/overexpressing mouse keratinocytes (KCs),we screened for the possible Sirt7 target gene by WB, RT-qPCR, and verified by IHC staining in vivo; 4. We detected the specific mechanism of Sirt7’s regulation on target gene by means of WB and co-immunoprecipitation (IP) in HEK293T cell line; 5. We further confirmed the mechanism by topical application of inhibitor of target gene in Sirt7 KO mice. Results 1. Sirt7 was periodically up-regulated in anagen and down-regulated in hair follicle aging; 2. Sirt7 knockout/overexpression in mice inhibited/promoted HFSCs activation and resulted in a prolonged/shortened telogen; 3. The overexpression of Sirt7 in mice can partially delayed the aging associated hair loss; 4.Sirt7 interacted with and promoted the degradation of NFATc1 in HFSCs;5.The delay of hair regeneration in Sirt7-/- mice can be rescued by topical application NFATc1 inhibitor CSA. Conclusion Sirt7 regulated the quiescence-activation balance of HFSCs in hair cycle and aging via down-regulating NFATc1.

2019CSID Come see my poster

PS-001 Tumor necrosis factor (TNF) receptor mediates the TNF-like weak inducer of apoptosis (TWEAK) regulation of keratinocyte fates

Xunening Wang1 Dan Cheng2 Hu Guanglei1 Xiao Tong1 Xiao Shengxiang1 Xia Yumin1 1Department of Dermatology, The Second Affiliated Hospital, School of Medicine, Xi 2College of Life Sciences, Wuhan University, Wuhan, China

Objectives Tumor necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK)/fibroblast growth factor-inducible 14 (Fn14) interaction regulates the fates of keratinocytes, depending on the expression profile of TNF receptor (TNFR). However, the precise mechanism underlying such regulation of TWEAK remains unclear. This study was designed to reveal the exact associations between the Fn14, TNFR, and other relevant molecules and to elucidate structural basis for the TWEAK/Fn14 regulation of cell fates. Materials and Methods Human primary keratinocytes (mainly expressing TNFR1) and TNFR2- overexpressing keratinocytes were cultured in vitro, and received stimulation of TWEAK. Proliferation and apoptosis were assessed by colorimetric method and flow cytometry, respectively. The associations between different molecules were analyzed by immunoprecipitation and Western blotting. Surface plasmon resonance was used for determining the binding affinities. Results The associations between the Fn14, TNFR-associated factor 2 (TRAF2), cellular inhibitor of apoptosis protein 1 (cIAP1), and TNFR molecules were confirmed in protein lysates of cells. TRAF2 exhibited binding affinities to Fn14, cIAP1, and TNFR molecules. Moreover, TWEAK induced the apoptosis of normal keratinocytes and the proliferation of TNFR2-overexpressing keratinocytes, in a TNF-α-independent manner while TRAF2 inhibition abrogated such effect of TWEAK on keratinocytes. Interestingly, TWEAK/Fn14 interaction increased the TNFR1-associated death domain protein and caspase 8 expressions in normal keratinocytes, and also promoted cytoplasmic import of cIAP1 in TNFR2-overexpressing keratinocytes. Conclusion The Fn14-TRAF2-TNFR signaling axis mediates the TWEAK regulation of cell fates of keratinocytes, possibly involving the TNF-α-independent TNFR signal transduction.

2019CSID Come see my poster

PS-002 The role of CCR5 in the maintenance of intestinal immune homeostasis

Xin Huang1,2 Utzschneider Daniel2,3 Fujita Yu4,5 Wu Haijing1 Lu Qianjin1 Delpoux Arnaud2 Hedrick Stephen2 1Department of Dermatology, Hunan Key Laboratory of Medical Epigenomics, Second Xiangya Hospital, Central South University, Changsha, Hunan, China 2Molecular Biology Section, Division of Biological Sciences, UC San Diego, La Jolla, CA 92093 3The Peter Doherty Institute for Infection and Immunity, The University of Melbourne, Department of Microbiology & Immunology Melbourne, Australia. 4National Cancer Institute (NCI) Cancer Center, Sanford Burnham Prebys Medical Discovery Institute, La Jolla, CA 92037, USA 5Division of Respiratory Medicine, Department of Internal Medicine, Jikei University School of Medicine, Tokyo 105-8461, Japan

Objectives To set up novel CCR5-DTR transgenic mice model, monitor the phenotype after the depletion of CCR5 cells and illustrate the underlying mechanism. Methods CRISPR-Cas9 and DTR cell ablation system were used to create such mice model. The expression profile of CCR5 in gut associated lymphoid tissue was mapped by flow cytometry. Temperature and Weight of the CCR5-DTR mice was monitored during the DT injection. Intestine length was measured after 4 DT injections. Intestine permeability was measured using FD4 intestine permeability assay. Bone marrow chimera was set up for distinguishing the role of hematopoietic and nonhematopoietic system in the CCR5 mediated immune response, Long term antibiotic treatment was given to the mice before and during the DT treatment. Results We mapped the CCR expression file in gut associated lymphoid tissue (GALT)and showed that administration of DT lead to a complete loss of CCR5+ cells in corresponding cell subsets in DTR+ Cre+ mice. Interestingly, sustained loss of CCR5+ cells induced the disruption of intestine integrity, which we found was due to the loss of hematopoietic CCR5+ macrophages and nonhematopoietic CCR5+ cells. Finally, we showed that the administration of a broad-spectrum antibiotic cocktail prevented the occurrence of illness, indicating its dependency of gut microbiome. Conclusion We generated a novel and flexible mouse model for identifying or killing CCR5+ cells, characterized the key importance and mechanism of CCR5 in the maintenance of intestinal immune homeostasis.

2019CSID Come see my poster

PS-003 Propionibacterium acnes and peptidoglycan activate aryl hydrocarbon receptor and modify differentiation of SZ95 sebocytes in vitro

Ke Cao1 Chen Guangjie2 Hou Xiaoxiao1 Hu Tingting1 Wang Lanqi1 Pan Zhanyan1 Wu Qiong1 Lu Lingyi1 Li Xin1 Ma Ying3 Xia Longqing1 Christos C. Zouboulis4 Ju Qiang1 1Department of Dermatology, Renji Hospital, Shanghai Jiaotong University School of Medicine, Shanghai2000127, PR China 2Department of Immunology and Microbiology, School of Medicine, Shanghai Jiaotong University 3Department of Dermatology, Huashan Hospital, Fudan University, Shanghai, PR China 4Departments of Dermatology, Venereology, Allergology and Immunology, Dessau Medical Center, Brandenburg Medical School Theodor Fontane, Dessau, Germany

Individual acne comedones can undergo spontaneous remission in association with shrunken sebaceous glands (SGs) containing undifferentiated cells under unknown mechanisms. It is also still controversial whether sebum-induced follicular Propionibacterium acnes（P. acnes）interacts with the SGs. We explored the effects of P. acnes and peptidoglycan (PGN) on the aryl hydrocarbon receptor (AhR) activation, lipogenesis and differentiation in cultured human SZ95 sebocytes in vitro. Both formaldehyde-inactivated P. acnes and PGN upregulated mRNA levels of AhR characteristic downstream genes CYP1A1, CYP1B1, CYP1A2, as well as significantly induced translocation of AhR protein from cytoplasm into nucleus. GSEA revealed pathways of downregulated lipogenesis and upregulated keratinization. In addition, P.acnes and PGN inhibited linoleic acid(LA)-induced neutral lipid synthesis and expressions of Keratin 7 and Mucin1/EMA (sebocyte markers) and increased the expression of Keratin 10 and involucrin (keratinocyte markers), which were abolished after AhR gene silencing. Moreover, inhibited expressions of lipogenesis-related genes such as SREBP1 were observed. In conclusion, we provide evidence that P. acnes can switch sebocytes into a keratinocyte-like differentiation with reduced lipogenesis via AhR, indicating that follicular P. acnes should not only be considered as acnegenic but also as a factor promoting acne remission through feedback regulation of sebum production.

2019CSID Come see my poster

PS-004 The expression, purification of IL-21 recombinant protein and its function in inhibiting exosome secretion

Di Long1 Chen Yongjian1 Yang Ming1 Zhao Ming1 Wu Haijing1 Lu Qianjin1 1The 2nd Xiangya Hospital, Central South University

Background Interleukin-21 (IL-21), a pleiotropy cytokine, plays an indispensable role in autoimmune, anaphylactic, inflammatory diseases and cancer. Increasing evidence has shown the potential therapeutic role of IL-21 in autoimmune diseases. However, the existing IL-21 protein cannot reach the higher requirements of well-modified spatial structure and intact physiological function to provide required protein activity. Methods We successfully transferred overall-length IL-21 cDNA into HEK293F cells and innovatively cultured in suspension system. IL-21 protein was purified to homogeneity via sequential nickel affinity chromatography and ultrafiltration, with nondenaturing method to amend structural damage. Results The yield of recombinant IL-21 protein produced by HEK293F combined with suspension culture system was higher than HEK293T plus adherent culture system. Recombinant IL-21 demonstrated a function of prompting CD4+ T cells proliferation with low concentration, while high concentration displayed reverse effects. In addition, we found that recombinant IL-21 suppressed exosome secretion significantly. Conclusions This study provides a full-length functional recombination human IL-21 protein, and demonstrates a new role that IL-21 inhibited exosome secretion which provides basis for fields of exosome research and cancer treatment.

PS-005 Preventable effect of ginsenoside Rb1 against chemotherapeutic drug-induced premature catagen development in human hair follicles

Meitong JIN1 LI Chuying1 LUO Yinli1 PI Longquan1 JIN Zhehu1 1Yanbian University Affiliated Hosptial

Background & Objective Chemotherapy-induced alopecia (CIA) is one of the most distressing side effects for patients undergoing chemotherapy. The purpose of this study was to investigate

2019CSID Come see my poster the protective effect of ginsenoside Rb1(G-Rb1) on CIA in a well-established ex vivo human hair follicle organ culture model as it occurs in vivo. Methods We examined whether G-Rb1 can prevent premature hair follicle dystrophy in a human hair follicle organ culture model during treatment with a key cyclophosphamide metabolite, 4- hydroperoxycyclophosphamide (4-HC). Results 4-HC inhibited human hair growth, induced premature catagen development, and induced apoptosis of hair matrix keratinocytes. In addition, 4-HC induced ROS generation, increased caspase-3 and p53 protein expression. Pretreatment with G-Rb1 protected against 4- HC-induced hair growth inhibition and premature catagen development.G-Rb1 also suppressed 4- HC induced apoptosis of follicular keratinocyte. Moreover, G-Rb1 reduced 4-HC-induced caspase- 3 and p53 expression. Conclusion These results indicate that G-Rb1 may protect against 4-HC-induced premature catagen development.

PS-006 TRAF4 promotes fibroblast proliferation in keloids by destabilizing p53 via interacting with the deubiquitinase USP10

Chengcheng Deng1 Ding-Heng Zhu1 Yong-Jun Chen1 Tao-Yuan Huang1 Yang Peng1 Si-Ya Liu1 Ping Lu1 Yao-Hua Xue1 Ying-Ping Xu1 Bin Yang1 Zhili Rong1 1Southern Medical University

Objective Keloids represent one extreme of aberrant dermal wound healing. One of the important characteristics of keloids is uncontrolled fibroblasts proliferation. However, the mechanism of excessive proliferation of fibroblasts in keloids remains elusive. Method In this study, we compared the expression of TRAF4 between keloid and normal skin by immunohistochemistry and real-time PCR. Next we changed the expression of TRAF4 by using siRNA and lentivirus, and studied the function of TRAF4 in keloid proliferation and apoptosis by multiple methods in cell biology. At last we used experiments such as co-immunoprecipitation and ubiquitination assay to explore the molecular mechanism of TRAF4 in inhibiting p53 pathway. Result In this study, we demonstrated that TRAF4 was highly expressed in keloid fibroblasts and promoted fibroproliferation. We investigated the underlying molecular mechanism and found that TRAF4 suppressed the p53 pathway independent of its E3 ubiquitin ligase activity. Specifically, TRAF4 interacted with the deubiquitinase USP10 and blocked the access of p53 to USP10, resulting in p53 destabilization. Knockdown of p53 rescued cell proliferation in TRAF4-knockdown

2019CSID Come see my poster keloid fibroblasts, suggesting that the regulation of proliferation by TRAF4 in keloids relied on p53. Furthermore, in keloid patient samples, TRAF4 expression was inversely correlated with p53-p21 signaling activity. Discussion In summary, our study suggests that TRAF4 promotes cell proliferation by inhibiting p53 pathway in keloids. Mechanistically, TRAF4 destabilizes p53 via competing with p53 for USP10 binding. These findings will help to elucidate keloid pathogenesis and identify novel targets for keloid treatment.

PS-007 Application of Induced Pluripotent Stem Cells in the Melanocytes Regeneration

Liping Liu1 Guo Ningning1 Li Yumei1 Zheng Yunwen2,3 1Affiliated Hospital of Jiangsu University 2University of Tsukuba 3Yokohama City University

Objectives The development of induced pluripotent stem cells (iPSCs) is a significant breakthrough in the field of stem cell research and these cells show unlimited proliferation potential and multi-differentiation capabilities. In addition, there are fewer immuno-rejection and ethical concerns when compared to embryonic stem cells. Thus, iPSCs show great advantages and application prospects in the regeneration medicine. Melanocytes transplantation is a promising therapy for vitiligo which shows less adverse events and better superior cosmetic results. However, it is difficult to satisfy demands for large area of lesions. Moreover, collection of melanocytes from patient is a traumatic procedure and may lead to new lesions. Therefore, generation of large quantities of iPSCs-derived melanocytes with high proliferation capability might address this issue. However, their reconstitution functions in vivo have not been confirmed. Methods iPSC lines were established from patients with vitiligo and induced melanocytes (iMels) were generated using a novel 3D suspensive differentiation system. RNA-sequencing and bio- informative assay were performed to compare the similarity of patient iMels and human epidermal melanocytes (HEMs). IPA analysis was conducted to explore the associated signaling pathways associated with pathogenesis of vitiligo. To confirm the in vivo functions of iMels, they were transplanted into immunodeficient mice using a modified hair follicle reconstitution assay. Results Compared with the conventional 2D culture condition, the newly established 3D suspensive system significantly enhanced the differentiation efficiency of iPSCs-derived

2019CSID Come see my poster melanocytes. Large quantities of patient iMels with great capability of proliferation were generated at week 5-6 of differentiation. High similarity between patient iMels and normal HEMs were confirmed by Real-time PCR, immunofluorescence staining, transmission electron microscope as well as RNA-sequencing. IPA analysis indicated that patient iMels might be involved in multiple vitiligo-associated signaling pathways, such as interferon signaling and oxidative stress. In the hair follicle reconstitution assay, it is showed that MITF+PAX3+TYRP1- iMelanocyte stem cells integrated into the bulge regions and co-localized with KRT15+/ITGA6+ hair follicle stem cells while MITF+PAX3+TYRP1+ iMels were localized in the mouse hair bulb and epidermis. These mature melanocytes transferred melanin and produced pigmented hair shafts for up to 7 weeks. Conclusions Patient iMels possessed capacities of long-term function maintenance in vivo and their integration regions in the hair follicle reconstitution assay were normal sites for both mature melanocytes and melanocyte stem cells in human. Thus, they might provide an alternative source of personalized cellular therapy for depigmentation. More significantly, since the depigmentation pathogenesis in vitiligo is still unclear, our work provides new insight into the pathogenesis of vitiligo.

PS-008 Histopathology in diagnosing herpetiform pemphigus

GUANRU WU1 ZHOU SENGRU1 ZHAO XIAOQING1 PAN MENG1 1Ruijin Hospital

Purpose Herpetiform pemphigus (HP) is a rare kind of pemphigus, which is generally considered as a subtype of pemphigus foliaceus (PF). It is characterized by clinical feature of annular erythema on the trunk and limbs, accompanied by tensive vesicles. Nikolsky's sign is usually negative. Lesions rarely involve mucosa, and differential diagnosis with dermatitis herpetiformis is always required. Histopathological manifestations are variable. As the result, diagnosis can be really challenging because the biopsy result can only be the reference. Method Collect the biopsy of 33 Patients in two different hospitals which had been diagnosed as Herpetiform pemphigus and reviewed the medical literature (PubMed) on May 2019, using the terms “pemphigus herpetiformis” or “herpetiform pemphigus”. Collecting the result of the histopathological manifestations in the literature and compared with our own data. Result Epidermal blisters , acantholysis and inflammatory cell infiltration can be found in over 70% of our cases. Eosinophilic spongiosis used to be considered as the unique presentation of Herpetiform pemphigus, which is approximately at 60%. The position of the blisters in epidermis are mostly at the middle.

2019CSID Come see my poster

Conclusion In the past, the diagnosis of Herpetiform pemphigus rely on clinical feature and Direct immunofluorescence. With the result of our study, histopathological manifestations can stand as a crucial part of the diagnosis, and the position of the blisters in epidermis can be one of the explanations of the clinical and histopathological features of Herpetiform pemphigus.

PS-009 LncRNA RP11-670E13.6 delays cellular senescence by sponging microRNA-663a in UVB damaged dermal fibroblasts

Mengna Li1 Li Li1 Yan Yan1 1Plastic Surgery Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College

Ultraviolet (UV) irradiation from the sunlight is a major etiologic factor for premature skin aging. Long noncoding RNAs (lncRNAs) are involved in various biological processes, and their roles in UV irradiation-induced skin aging have recently been described. Aims We initially found that lncRNA RP11-670E13.6 was upregulated in UVB-irradiated primary human dermal fibroblasts (HDFs). In this study, we aim to investigate how lncRNA RP11-670E13.6 contributes to UVB responses in HDFs by characterizing its molecular function. Methods We used telomere length analysis and β-galactosidase staining to measure cellular senescence, qRT-PCR to quantify relative gene expression, western blot to identify protein expression, siRNA transfection to knock down lncRNA RP11-670E13.6, fluorescence in situ hybridization (FISH) to examine the cellular distribution of lncRNA RP11-670E13.6, luciferase reporter assays to investigate the putative miR-663a binding sites, and flow cytometry to analyze apoptosis and cell cycle distribution. Results In the present study, we found that knockdown of lncRNA RP11-670E13.6 promoted UVB induced cellular senescence. In physiological conditions, FISH revealed lncRNA RP11-670E13.6 in the nucleus, whereas this lncRNA was detected in the cytoplasm after UVB irradiation. Moreover, our results showed that miR-663a promoted cellular senescence by targeting CDK4 and CDK6, lncRNA RP11-670E13.6 directly bound to miR-663a and functioned as a sponge for miR-663a to modulate the derepression of Cdk4 and Cdk6.Therfore, we demonstrated that the lncRNA RP11- 670E13.6 delayed cellular senescence by increasing Cdk4 and Cdk6 levels via competition for miR-663a in UVB damaged HDFs.

2019CSID Come see my poster

Conclusion We concluded that the lncRNA RP11-670E13.6/miR-663a/CDK4 and lncRNA RP11- 670E13.6/miR-663a/CDK6 axis, which may function as competitive endogenous RNA networks, played important roles in UVB-induced cellular senescence.

PS-010 Raffinose protects HaCaT cells against UVB irradiation through activating autophagy in an mTOR-independent manner

Shangqing Lin1 Gu Heng1 Chen Xu1 1Institute of Dermatology, Chinese Academy of Medical Sciences & Peking Union Medical College

Objective Autophagy is an intracellular homeostatic process in which damaged and superfluous cytosolic components are “self-ate” by autophagosomes and sequentially fused to lysosomes for degradation. Ultraviolet (UV) radiation is a common stressor of skin, which is related with many cutaneous disorders. Autophagy has been reported to be down-regulation in many ultraviolet stress-irradiated models of keratinocytes. Raffinose, a natural Oligosaccharide, is a novel inducer of autophagy and as a balance agent to modulate diversity of stress. But whether raffinose could be able to balance the ultraviolet damage by regulating autophagy pathway is still unclear. Methods In this study, we confirmed that raffinose enhanced autophagy in an mTOR- independent manner in HaCaT cells. The inhibition of autophagy level in UVB-challenged HaCaT cells can be rescued by the treatment of raffinose, whereas the apoptosis levels were not able to alter. However, raffinose incubation could alleviate cytotoxicity in UVB-irradiated condition. And this effect was abrogated when suppressing autophagy either by ATG5 siRNA transfection or by wortmannin treatment. Results In conclusion, we demonstrated that raffinose plays a protective role in UVB-induced cytotoxicity in keratinocytes by mTOR-independent autophagy mechanism. Conclusion Raffinose served as a novel activator of autophagy and as a balance agent to regulate diversity of environmental stress.

PS-011 Sublingual immunotherapy in mite-sensitized patients with atopic dermatitis: A multi-centre, randomized, double-blind, placebo- controlled study

2019CSID Come see my poster

lunfei liu1 chen jisu1 zheng min1 1The Second Affiliated hospital of Zhejiang University School of Medicine

Background In China, allergen specific immunotherapy has been widely used for allergic rhinitis and asthma. Its efficacy and safety in atopic dermatitis remains to be verified. Method This study was to evaluate the efficacy and safety of sublingual immunotherapy with Dermatophagoides farinae extracts for HDM induced AD. 239 subjects were recruited for a multi- centre, randomized, double-blind, placebo-controlled, 36 weeks’ clinical trial, which were divided into placebo, high, medium and low-dose treatment groups. Results Efficacy analysis was performed in full analysis set and per protocol set. As primary outcomes, a marginal decrease in SCORAD and total medication score was showed in medium and high dose group. In the 6th visit, the skin lesion area showed statistically significant difference between high / medium-dose and placebo group (P<0.05). Other analysis of the full analysis set and per protocol set showed no statistically significant (P>0.05). Adverse events are mostly mild local adverse events, and no life-threatening adverse drug reaction happened during the clinical trial. Conclusion Our patients demonstrate positive responses to SLIT with high and medium dose Dermatophagoides farinae extracts, and the treatment was well tolerated. But a longer term immunotherapy is needed for further study.

PS-012 IL-21 Induces an Imbalance of Th17/Treg Cells in Moderate-to- severe Plaque Psoriasis Patients

Zeyu Chen1 Shi Yuling1 1Shanghai Tenth People

Background Psoriasis is a chronic immune-mediated inflammatory skin disease, with over- activated interleukin (IL)-17-producing CD4+ T cells (Th17) and repressed regulatory T (Treg) cells. IL-21 is a Th17-related cytokine and plays an important role in the pathogenesis of psoriasis. However, the mechanism by which IL-21 affects the pathogenic progress of psoriasis remains poorly understood. Methods IL-21 and IL-21 receptor (IL-21R) expression in normal and psoriatic lesional skin were determined by immumohistochemical staining, immunofluorescence staining, and western blotting.

2019CSID Come see my poster

The levels of IL-21, IL-17A, and IL-22 in the culture supernatants were measured by enzyme-linked immunosorbent assay (ELISA). The level of IL-10 in the culture supernatants was measured by cytometric bead array (CBA). The mRNA expression levels were assessed by quantitative polymerase chain reaction (qPCR). CD4+ T cells were isolated from the peripheral blood mononuclear cells (PBMCs) from the psoriasis patients and healthy individuals and then treated with or without IL-21 for 3 days. The proportions of Th17 and Treg cells were determined by flow cytometric analysis. Results IL-21 and IL-21R were highly expressed in the lesional skin and peripheral blood of psoriasis patients. IL-21 promoted CD4+ T cells proliferation and Th17 cells differentiation and inhibiting Treg cells differentiation by upregulating RORγt expression and downregulating Foxp3 expression, with increased expression and secretion of IL-17A and IL-22. The proportion of Treg cells was negatively correlated with that of Th17 cells in psoriasis patients. Conclusion Our results suggest that IL-21 may promote psoriatic inflammation by inducing imbalance in Th17 and Treg cell populations.

PS-013 Bullous pemphigoid and atopic dermatitis: comparison for expression of thymic stromal lymphogenin and lesional inflammatory subsets

Yuqing Hu1 Zhang Jianzhong1 1Department of Dermatology, Peking University People’s Hospital, Beijing 100044

Abstract Background Thymic stromal lymphopoietin (TSLP) is an epithelial derived cytokine which plays an important role in the development and progression of allergic diseases such as atopic dermatitis(AD) and asthma. However, the association between TSLP and bullous pemphigold(BP) has not been studied. And comparative analysis of lesional inflammatory cell infiltration between BP and AD was sparsely performed. Objective To investigate TSLP expression in serum, blister fluids and lesional skin in patients with BP and AD. To compare BP vs. AD and healthy controls with respect to cytokines in serum and inflammatory cell subsets in skin. Methods Enzyme-linked immunosorbent assay(ELISA) was performed to detect TSLP level in serum and blister fluids. Inflammatory cell subsets(CD4+ T cells, CD8+ T cells, CD1a+ cells, eosinophils and mast cells) were stained immunohistochemically and quantified using image analysis.

2019CSID Come see my poster

Results TSLP expression was significantly increased in blister fluids and lesional skin in BP and AD compared with controls. Serum levels of IL-6, IL-4, IL-22, IFN-γ and thymic activation regulates chemokines(TARC) were significantly increased in patients with BP and AD compared with healthy controls. Higher numbers of CD4+ T cells, CD8+ T cells and CD1a+ cells were found in upper dermis of lesional skin in BP patients and AD patients compared with healthy controls. Eosinophils were more frequently observed in deep dermis of patients with BP. Mast cells in the deep dermis of lesional skin in AD patients were significantly more than those in BP patients and healthy controls. A distinct correlation was found between CD4+ T cells, CD1a+ cells in upper dermis and TSLP expression levels in skin. Conclusion TSLP were highly expressed in blister fluids and skin in BP, which might contribute to the pathogenesis of BP. And BP exhibited a similar immunological pathogenesis and lesional inflammatory cell infiltrations with AD.

PS-014 Observation of umbilical cord mesenchymal stem cell-derived exosomes on the treatment of psoriasis mouse model and its effect on IL-23/IL-17 inflammation axis

Yuli Zhang1 Sun Qing1 1Qilu hospital of shandong university

Objectives Psoriasis is a chronic immune-mediated inflammatory skin disease. Although the pathogenesis of psoriasis is not fully understood, It has been recognized that the IL-23/IL-17 cytokine axis plays a pivotal role in the inflammatory response in psoriasis . Mesenchymal stem cells (MSCs), the major stem cells in the field of cell therapy, have been used in the clinic for more than 10 years and proven to be safe and effective on the treatment of various intractable autoimmune and inflammatory disorders. Recent studies have showed that the majority of the therapeutic benefits of MSCs result from the release of paracrine soluble factors. They can increase levels of anti-inflammatory cytokines and decrease levels of proinflammatory cytokines. Therefore, in this study, we investigated whether umbilical cord mesenchymal stem cell-derived exosomes (hucMSCs-exo) can ameliorate psoriasis-like skin inflammation in mice. and explored the underlying mechanisms. Methods HucMSCs-exo were isolated by differential ultracentrifugation. 1.Animal experiments: After induction of psoriasis-like skin inflammation using topical application of imiquimod with or without treatment with hucMSCs-exo, mouse skins were collected, and H&E staining and Western

2019CSID Come see my poster blot were performed. 2. In vitro: After hucMSCs-exo are applied to hacat cells and dendritic cells respectively, cellular proteins were extracted and cell supernatants were collected, then Western blot and ELISA were performed. Results1.Subcutaneous injection of hucMSC-exo significantly prevented psoriasis development in our imiquimod-induced mouse model by inhibition of signaling pathways such as The Janus kinase/signal transducer and activator of tran-ions, (JAK-STATs) as well as the expression of IL- 17、IL-23、CCL20. 2. in vitro experiments also showed anti-inflammatory effects of hucMSC-exo. HucMSC-exo can suppress the activation of dendritic cells, which are important for the pathogenesis of psoriasis. Conclusion 1.Subcutaneous injection of allogeneic hucMSC-exo significantly prevented psoriasis development in our imiquimod-induced mouse model, likely through suppression of JAK-STATs and inhibition the expression of cytokines and chemokines ,such as IL-17、IL-23、CCL20. 2. Our data offers a novel therapeutic approach to chronic inflammatory skin diseases such as psoriasis by leveraging immunomodulatory effects of hucMSC-exo.

PS-015 RNA-seq Analysis Reveals Unique Transcriptome Signatures in Dermatomyositis and Clinically Amyopathic Dermatomyositis Patients with Positive Expression of Anti-MDA5 Antibody

Ke Xue1 Quan Cheng1 Zhao Qian1 Xue Feng1 Chen Mengya1 Diao Licheng1 Ruan Yeping1 Zhao Xiaoqing1 Zhu Xuemei1 Li Hao1 Zheng Jie1 Cao Hua1 1Rui Jin Hospital, School of Medicine, Shanghai Jiao Tong University

Background In dermatomyositis (DM), disease-specific autoantibodies now covered more than 70% of patients. These autoantibodies closely correlate with distinct clinical manifestations. Autoantibodies against melanoma differentiation antigen 5 (MDA5) levels closely correlated with the severity of skin ulcerations, ILD and the prognosis of the disease. Previous studies focused on the serotype and phenotype of DM patients with anti-MDA5 antibody. However, there is no study investigates the genotype of these patients. Objective To investigate messenger RNA expression patterns in peripheral blood of DM patients with or without anti-MDA5 antibody and healthy individuals. And analyzing the relationship between clinical characteristics and genes expression patterns. Methods After extracting RNA from peripheral blood of 19 DM/CADM patients, including 10 cases of anti-MDA5 antibody positive patients, messenger RNA expression patterns were investigated by

2019CSID Come see my poster

RNA sequencing (RNA-seq), including differential gene expression analysis and pathway enrichment analysis. Quantitative RT-PCR was used to validate findings. Serum level of anti-MDA5 antibody was measured by ELISA. Results We found 4 genes including IFI27, DEFA3, RETN and RNASE2 were significantly up- regulated in anti-MDA5 antibody positive patients, which were closely correlated with serum level of anti-MDA5 antibody and serum ferritin level. Besides, these genes were also highly expressed in the A/SIP subset than those without A/SIP. Conclusions The expression of IFI27, DEFA3, RETN and RNASE2 were higher in DM/CADM patients with anti-MDA5 antibody, which may play an important role in the occurrence of clinical manifestation of DM/CADM and may be involved in anti-MDA5 antibody pathogenic mechanism. Especially DEFA3 may play a role in DM inflammatory process.

PS-016 A case of primary Cutaneous CD30-positive T-cell lymphoma accompanied by Epstein-Barr virus associated diffuse large B-cell lymphoma and herpes zoster

Yingjie LI1 WANG Zai-xing1 1Department of Dermatology and Venereology，the Frist Affiliated Hospital of Anhui Medical University

Objective To explore the mechanism and clinical characteristics of the co-existence of T-cell lymphoma and B-cell lymphoma, in order to facilitate clinical diagnosis and treatment. Methods Histopathology and immunohistochemistry of subcutaneous nodules have been taken to make a clear diagnosis in combined with pathological, clinical features and the patient's medical history. Results The histologic of nodules showed a large number of lymphocyte infiltration and necrosis, and local lymphocyte grow actively. Immunohistochemistry yielded results positive for CD30, LCA, CD3, CD43, Ki-67(30%+), CD5,Bcl-6, but negative for CD20, CD21, CD10, CD23, CD56, Perforin, TIA-1 and Granzyne. Besides, the patient has a history of Epstein-Barr virus associated diffuse large B-cell lymphoma (DLBCL) for half a year and get regression after R-CHOP (rituximab and CHOP) chemotherapy. The final diagnosis were primary cutaneous CD30-positive T-cell lymphoma, DLBCL and herpes zoster. Finally, the patient continued to receive R-CHOP chemotherapy and the subcutaneous nodules were subsided after treatment.

2019CSID Come see my poster

Conclusion The co-existence of B-cell lymphoma and T-cell lymphoma in a single person has rarely been reported, including some cases of an inimical lymphoma with subsequent development of a second lymphoma. Among these rare cases, angioimmunoblastic T-cell lymphoma and diffuse large B-cell lymphoma are the most common types of T- and B-cell lymphoma, respectively.Because of the possibility of clonal T-cell proliferation in patient with B-cell malignancy, new skin lesions in patients with lymphoma should be confirmed by biopsy to determine the nature and source of it, and then corresponding treatment should be taken. Methotrexate and other drugs, EBV infection, age and autoimmunity damage are considered to play a role in the pathogenesis of T-cell lymphoma in patients with B-cell lymphoma. Our case revealed clear benefit of treatment with an R-CHOP regimen in patient with primary Cutaneous CD30-positive T-cell lymphoma and DLBCL. It is necessary to perform lymph node and skin biopsies regularly to detect the progression to secondary lymphomas for patients with DLBCL.

PS-017 Overexpression and Implications of Melanoma-associated Antigen A12 in Pathogenesis of Human

Guohua Zhao1 1Yanbian Univercity Hospital

A12 (MAGEA12) has recently been reported as a repressor of tumor-suppressor genes. This study aimed to investigate the implications of MAGEA12 expression in the pathogenesis of cutaneous squamous cell carcinoma (cSCC). Materials and Methods: MAGEA12 and p21 expression were investigated in 15 samples of normal skin and 111 of cSCC tissues by immunohistochemistry. The biological functions of MAGEA12 in cSCC were also investigated both in vitro and in vivo. Results: Expression of both MAGEA12 and p21 was significantly increased in cSCC. MAGEA12 expression showed a positive correlation, while p21 expression showed negative correlation with the recurrence-free survival of patients with cSCC. In addition, MAGEA12 knockdown significantly attenuated proliferative, migratory, invasive, and tumorigenic activities of cSCC cells and was negatively correlated with p21 expression both in vitro and in vivo. Conclusion: MAGEA12-mediated down- regulation of p21 may be involved in cSCC pathogenesis and MAGEA12 may serve as a molecular biomarker in cSCC.

PS-018

2019CSID Come see my poster

Association of Passive Cigarette Smoke Exposure with Atopic Dermatitis and Hand Eczema in Adolescents

Danrong Jing1 Li Yajia1 Xiao Yi1 Shen Minxue1 Chen Xiang1 1Xiangya Hospital, Central South University

Objectives Smoking has been proved to be the adverse effects of asthma and dermatitis like AD. But less is known about influence of passive cigarette smoke exposure to the risk of developing AD and hand eczema. The aim of this study is to investigate the association of passive cigarette smoke exposure with atopic dermatitis and hand eczema in adolescents. Methods This was a cross-sectional that recruited first-year college students. The students underwent health examinations and a questionnaire survey inquiring about the passive smoke exposure. Two-level logistic models were used to estimate the associations, and odds ratios (ORs) were presented as the effect size. Results A total of 20129 participants that underwent skin examination and questionnaire survey were included in the analyses. The mean age was 18.3±0.8 years, and 51.1% of the participants were male. In this group of adolescents, the prevalence rates of atopic dermatitis and hand eczema were 3.86% and 3.35%, respectively. Interdigital eczema was the most common type (1.53%). Crude and adjusted estimates consistently showed that passive cigarette smoke exposure was significantly associated with the prevalence of atopic dermatitis and hand eczema. Both the frequency and duration of exposure were positively associated with hand eczema in a clear dose- response manner. In contrast, the frequency of exposure showed some variations in its correlation with atopic dermatitis, where one to two days per week exposure was associated with the greatest risk (AOR=1.29; 95% CI: 1.06–1.56; P=0.010). In addition, more frequent passive smoke exposure showed larger effect size compared to longer duration of exposure. Active smoking was also associated with higher risk of atopic dermatitis (AOR=1.51; 95% CI: 0.80–2.85; P=0.201) and hand eczema (AOR=1.33; 95% CI: 0.68–2.60; P=0.399), although the associations were not statistically significant owing to the small number of smokers. Conclusions Passive smoke exposure is significantly associated the risk of hand eczema and atopic dermatitis in adolescents.

PS-019 Clinical significance of Koebner phenomenon in vitiligo: A hospital- based epidemiological investigation

2019CSID Come see my poster

Yankun Zhang1 Li Man1 Wang Fang1 Ding Xiaolan1 Du Juan1 1Department of Dermatology, Peking University People’s Hospital

Background Vitiligo is clinically divided into four types: segmental, non-segmental, mixed and undetermined. It is also divided into advanced and stable phases according to the course of the disease. One important feature of the advanced phase is homomorphic response (Koebner phenomenon, KP). KP has attracted more and more attention for its significance in vitiligo. The Vitiligo European Task Force (VETF) has recently updated the definition and classification of KP in vitiligo, A few of epidemiological investigations based on new KP classification has been reported in some countries except China. Objectives To conduct a clinical investigation of the clinical features of KP based on new KP classification in our department, clarify its correlation with the clinical type, staging, daily behavioral habits and basic body conditions by analyzing the questionnaire. Methods A prospective cross-sectional study was undertaken between June 2017 and February 2019 at the department of dermatology , Peking University people's hospital. Patients with vitiligo were eligible for recruitment in this study. KP was classified according to the new classification into different subtypes: KP1, by history; KP2A and KP2B by clinical examination (A: lesions on friction areas; B, linear, artefactual lesions). In addition, the definition of KP1 was extended in our study, including but not limited in one year. Results Among 418 vitiligo patients, according to our extended definition of KP (including but not limited to 1 year) ,the incidence of all KP types was 62.0%,and KP1 was positive in 38.0% of the patients, 48.3% were KP2A positive and 11.5% showed KP2B. Mixed vitiligo has the highest incidence of KP (90% ,9/10) ,followed by non-segmental,(75.7%,218/288),undetermined (36.5%,19/52) and segmental vitiligo,( 19.1% ,13/68). Most patients (n = 321⁄418,76.8%) had been in the advanced phases，and the incidence of KP was 67.3% (216/321), which was higher than the stable phases(44.3%,43/97, p<0.001). In addition, 48.3% (138/321) patients found that the extent of disease progression was associated with KP. Disease duration was 6.7±8.4 years in the KP-positive group vs. 4.2±7.0 years in the KP-negative group (p = 0.003), and significantly longer in KP2A-positive(p=0.001) patients. Body surface area (BSA) was higher in KP-positive patients, especially in KP2A-positive patients. The mean BMI (Body Mass Index) of the KP-positive group was higher than that of the KP-negative group, with a significant difference in KP2A-positive patients, p<0.005. Conclusion Our study showed that KP of vitiligo can occur at a high rate, especially in the friction area (KP2A), and correlated with the progression of the disease. The incidence of KP was higher in patients with higher BMI levels, especially KP2A which may be related to increased friction caused by obesity, but whether there is an intrinsic related mechanism still needs further study.

2019CSID Come see my poster

Unlike previous literature reports, our survey showed that KP can also occur in segmental vitiligo, suggesting that patients with segmental vitiligo should also pay attention to avoid KP. The mechanism of different KP type in vitiligo still remains uncertain ,requires more clinical and laboratory research.

2019CSID Come see my poster

PS-020 Hypomelanosis of Ito with a loss of heterozygosity in the chromosome 7q31.31-7q32.1 region and KRT5 & KRT14 mutation

Ziqi Liu1 Zhang Chengfeng1 Xiang Leihong1 1Huashan Hospital

Hypomelanosis of Ito (HI) is characterized by hypopigmentation following the Blaschko’s lines, usually associated with chromosomal mosaicism. Previous studies reported heterogeneous structural abnormalities in disparate chromosome regions, 88% of which later proved to be overlapped with one or more pigmentary genes. Research on the genetic background of HI might enhance our knowledge of molecular genetics underlying melanocyte development and function. We here reported a 19-year-old Chinese male born to non-consanguineous parents with asymptomatic patches and streaks of hypo- and hyperpigmentation on the right side of his face, trunk and extremities. The unilateral hypomelanotic lesions appeared early since infancy and gradually extended from forehead to extremities before the age of two. Multiple brown hyperpigmented macules spontaneously filled within the edge of hypomelanotic lesions on the age of seven and gradually stabled in one year, leaving the invariable mottled appearance thereafter. Systematic evaluation revealed no history of epilepsy, congenital malformations or delays in mental and physical development. Neither did the family members had any history of pigmentary or other cutaneous disorders. Histological findings of the hypomelanotic patch revealed few melanocytes and decreased pigmentation in basal layer. Electron microscopic found dysfunctional melanocytes with vacuolated mitochondria and immature melanosomes. The hyperpigmented lesion exhibited increased pigmentation in basal layer manifested as numerous pigment caps containing piles of mature melanosomes over the nuclei of basal cells under electron microscopy. Microarray analysis with DNA isolated from both peripheral blood cells and hypomelanotic lesions showed no mosaicism but a loss of heterozygosity in the 7q31.31-7q32.1 region. Further whole exome sequencing found two novel variants at KRT5 (c.115G>T, p.Gly39Trp) and KRT14 (c.580C>T, p.Arg194Cys). By literature review and protein class analysis, we speculate that the allelic loss of the 7q31.31- 7q32.1 region might be responsible for the segmental hypopigmentation, while the conservative KRT5 and KRT14 mutation might lead to the abnormal hyperpigmentation. Further case series integrating phenotypes and genotypes of pigmentary abnormalities might elucidate the potential pigmentary loci, thus enhancing our knowledge of melanogenesis and novel treatment of pigmentation disorders.

2019CSID Poster communication

PO-001 ALW peptide ameliorates lupus nephritis in MRL/lpr mice

Huixia Wang1 Lu Mei1 Zhai Siyue1 Wu Kunyi1 Peng Lingling1 Xia Yumin1 Yang Jie2 1 The Second Affiliated Hospital of Xi 2Tangdu Hospital of The Fourth Military Medical University

Background Lupus nephritis (LN) is a common and serious complication of systemic lupus erythematosus. Anti-double-stranded (ds) DNA IgG plays a pivotal role in the pathogenesis of LN. There are various therapies for patients with LN currently, which, however, are associated with considerable side effects. We confirmed previously that ALW (ALWPPNLHAWVP), a 12 amino acid peptide, inhibited the binding of polyclonal anti-dsDNA antibodies to mesangial cells and isolated glomeruli in vitro. In this study, we further investigate whether administration of ALW peptide reduces renal IgG deposition and relevant damage in MRL/lpr lupus-prone mice. Methods Forty female MRL/lpr mice were randomly divided into four groups. They were intravenously injected with D-form ALW peptide (ALW group), scrambled peptide (PLP group), normal saline (NaCl group), or not treated as blank controls. The IgG deposition, histopathologic changes, and the expressions of profibrotic factors were analyzed in the kidney of MRL/lpr mice. Results Compared with the other groups, glomerular deposition of IgG, IgG2a, IgG2b and IgG3 was reduced in the ALW group. Moreover, ALW administration attenuated renal histopathologic changes in MRL/lpr mice, including mesangial proliferation and infiltration of inflammatory cells. Furthermore, the expressions of profibrotic cytokines, such as transforming growth factor-beta1 (TGF-β1) and platelet-derived growth factor B (PDGF-B), decreased in the serum and kidney tissue of ALW-treated mice. Conclusions Our study demonstrated that ALW peptide ameliorates murine model of LN, possibly through inhibiting renal IgG deposition and relevant tissue inflammation and fibrosis.

2019CSID Poster communication

PO-002 Clinical Investigation on Relationship between Fading Change of Cutaneous Hyperemia-erythema after Cupping on Back-shu Acupuncture Points and Serum Cholesterol /HDL-C Ratio level

Fang Xu1,2 Wang Hongbo1 Hou Youhong1 1Dermatological Hospital of Yunnan, Kunming, China, 2Acupuncture-Hou , Toronto, Canada

Object To observe the relationship between fading of Traditional Chinese medical (TCM) cupping-led cutaneous hyperemia-erythema (CHE) on the acupuncture points (acu-points) of back-shu zone and serum cholesterol / high-density lipoprotein-C ratio (SCR),and to confirm the reciprocity among CHE,SCR and TCM tests, and the investigation on the earlier formation of arteriosclerosis in cutaneous micro-artery web resulted from high SCR. Methods 61 patients took cupping on the spinal vertebra acu-points, BL13, BL43, BL15, BL17, BL20,BL18, BL23, BL25, BL52 , EX-B1, etc. All patients had to take the serum exam of cholesterol and high-density lipoprotein-C (HDL-C) and complexion, tongue and pulse before cupping, and the patients divided into two groups, normal health (SCR<6.0) and Cardiac- vascular diseases-focused risk (CVDR) (SCR>6.0), and the fading percent and score of CHE were statistically analysed with χ2 test between groups for significant difference (p<0.05). See Table 1 and Table 2. Results The fading percent and score of CHE in each duration and total record were showed as below: in normal health (SCR<6.0), 86.03±1.08% in 3rd day, 98.05±0.53% in 7th day(1st week) and totally meant for 98.26±1.25%, and in CVDR group (CVDR >6.0), 42.06±3.05% in 3rd day, 68.12±0.62% in 7th day and totally meant 63.04±2.05%, and statistical significant difference (p<0.05) and relative index (R)=0.92 . See Table 3, Fig. 1, Fig.2, Fig. 3 and Fig. 4. Discussion The results of observation suggested that those with higher SCR will surf from TCM syndrome, severe Qi-blood stagnation in richer meridian such as food Taiyang bladder, and the specific cupping-led reaction may be a novel examination way for earlier formation of cutaneous Atherosclerosis，vascular sclerosis and even internal artery in important organs.

2019CSID Poster communication

PO-003 A case of erythema multiforme drug eruption caused by Duyiwei soft capsule

Yuhui Fang1 Yang Huiming2 Yang Kai3 Zhu Xiaohua3 Zhao Ying3 Wu Wenyu3 1Dermatology Department, Yanbian University Affiliated Hospital 2Medical College of Yanbian University 3Huashan Hospital Affiliated to Fudan University

Objective To report a case of erythema multiforme eruption after taking Duyiwei Soft Capsule, and to improve dermatologists'understanding that Duyiwei Soft Capsule can cause allergic reactions in people with allergic constitution, and to summarize its clinical characteristics, diagnosis and treatment to promote rational drug use. Methods A case of allergic reaction of Yiwei soft capsule with skin erythema multiforme drug eruption was reported for the first time in China. Its clinical manifestations, histopathology and related literature were analyzed. Results The patient, female, was 71 years old. After taking Duyiwei Soft Capsule orally, the whole body got red rash for 13 days. Histopathology of the lesion (left thigh) showed old blisters in the corneal layer, occasional dyskeratosis cells in the spinous layer, liquefaction degeneration of focal basal cells, infiltration of small patches of lymphocytes around small vessels in the superficial and middle dermis with slightly more eosinophils. There was no significant abnormality in DIF results. It was diagnosed as erythema multiforme drug eruption according to the history, clinical and histopathological findings. Conclusion Most of the adverse reactions of Duyiwei soft capsule are general adverse reactions. The main adverse reactions of Duyiwei soft capsule are gastrointestinal reactions, nausea, abdominal pain and itching reactions. The systemic erythema allergic reactions caused by Duyiwei soft capsule are more serious and less reported, which should be paid attention to. The adverse reactions of Duyiwei soft capsule can be cured after anti-allergic treatment.

2019CSID Poster communication

PO-004 IFN-γ enhances cell-mediated cytotoxicity against keratinocytes via JAK2/STAT1 in lichen planus

Shuai Shao1 Xue Ke1 Johann Gudjonsson2 Wang Gang1 1Xijing hospital, Fourth Military Medical University, Xi 2Department of Dermatology, University of Michigan, Ann Arbor, Michigan, USA

Objective Lichen planus (LP) is a chronic debilitating inflammatory disease of unknown etiology affecting the skin, nails, and mucosa. Despite some recent progress, much is still unknown about the pathogenesis of LP, and there is urgent need for more effective treatments. The aim of this study was to demonstrate that IFN-γ plays a pathogenic role in LP and to validate the JAK as a therapeutic target. Methods The first objective was illustrated by microarray profiling performed on skin biopsy samples demonstrating that IFN-γ and IFN-γ-regulated genes were enriched in the LP skin transcriptome, and by cell co-culture model showing that IFN-γ increased keratinocytes susceptibility to CD8+ T cell-mediated cytotoxicity. The second objective was investigated by in vitro cell co-culture model studies using CRISPR/Cas9 KO cells and JAK inhibitor baricitinib. Results Here, using global transcriptomic profiling of LP samples(n=37) and healthy controls (n=24), we demonstrate that LP is characterized by type II, but not type I, interferon (IFN) inflammatory response. The type II IFN, IFN-γ, is demonstrated to prime keratinocytes and increase their susceptibility to cytotoxic responses. We further demonstrate that the promotion of cytotoxic responses to IFN-γ-in keratinocytes are MHC class I dependent and reliant upon JAK1/STAT1 but not JAK1 or STAT2 signaling. Thus, JAK2 or STAT1 knock-outs by CRISPR/Cas9 completely inhibit cell-mediated cytotoxic responses to IFN-γ primed keratinocytes. Lastly, using drug prediction algorithms on our transcriptomic data JAK inhibitors are identified as promising therapeutic agents in LP, which we confirm using the JAK1/2 inhibitor baricitinib, which fully protects keratinocytes against cell-mediated cytotoxic responses. Conclusion In conclusion, our findings support targeting IFN-γ or its downstream signaling as a therapeutic strategy for LP. In addition, we provide evidence that diseases characterized by the interface inflammatory reaction may utilize IFN-γ as a common pathway, and therefore the implications of our findings are likely to apply to a wide range of inflammatory skin diseases.

2019CSID Poster communication

PO-005 Lipid accumulation in epidermal Langerhans cells correlate with aberrant immunofunctions in psoriasis-like inflammation

Xilin Zhang1,2 Li Xiaorui3 Wu Jianhua4 Ding Yangfeng1,2 Shi Yuling5,2 Gu Jun4,2 1Shanghai Skin Disease Hospital, Shanghai 2Institute of Psoriasis, Tongji University School of Medicine, Shanghai 3Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai 4Shanghai Changhai Hospital, Second Military Medical University, Shanghai 5Shanghai Tenth People

Psoriasis is a chronic, inflammatory, systemic disease characterized by abnormal lipid metabolism. Dendritic cells (DCs), an essential mediator in the pathogenesis of psoriasis, are recently discovered to be functionally regulated by intracellular lipid content. Being the sole DC subset within the epidermis, Langerhans cells (LCs) are potent regulators of immune surveillance and tolerance. Previous studies indicate a varying role of LCs in psoriasis with the underpinning mechanism remains elusive. Here, we demonstrated aberrant maturation, enhanced phagocytosis and interleukin-23 (IL-23) over-secretion of LCs in imiquimod (IMQ)-induced psoriasis-like mouse skin. Remarkably, disease-associated LCs possessed an elevated level of neutral lipid content probably due to impaired autophagy of lipids other than altered lipid engulfment. Moreover, the inhibition of fatty acids synthesis, which resulted in a decrease in cellular neutral lipids, would significantly impair LC maturation and their production of IL-23. Conversely, hyperlipidemia does not influence LC homeostasis and immunofunction. Further LC- MS analysis revealed a group of triglycerides (TG), diglycerides (DG), phosphatidylethanols (PEt) and phosphatidylcholines (PC) contributed to the increased neutral lipid level of LCs within IMQ- induced psoriasis-like skin. In accordance, low-input mRNA sequencing analysis uncovered the expressions of multiple genes involved in lipid metabolism were dysregulated in disease- associated LCs. In summary, intracellular lipid accumulation in epidermal LCs might drive their abnormal maturation, increased antigen capture and over-secretion of IL-23, which eventually contribute to the development and progression of psoriasis. Our results suggest that epidermal LCs might be a potential immunometabolic target in treating psoriasis.

2019CSID Poster communication

PO-006 Serum galectin-1, galectin-3 and galectin-9 are bystander molecules for chronic spontaneous urticarial

Lin Zheng1 1Sun yet-san memorial hospital

Background Galectins are carbohydrate-binding proteins that are involved in many immunological processes by affecting cell proliferation, differentiation, apoptosis and function. Of the 15 galectins in mammals, galectin-1, -3 and - 9, particularly galectin- 10 are expressed by eosinophils and participate the development of allergic diseases by regulating the recruitment and function of eosinophils. In addition, galectin-1 was shown a therapeutic potency for intestinal allergy by inhibiting mast cell activation and facilitating Treg development. Moreover, the four galectins are all recognized as IgE-binding proteins, however little has been known about their roles in CSU, one of the commonest allergic diseases mediated by mast cells, eosinophils and IgE. Objectives The object of the present study was to evaluate the involvement of the four galectins in CSU development. Methods Fifty-five patients (35 female and 20 male) were enrolled in this study with the average age of 34.33 ± 11.82 years and the disease duration of 14.87 ± 22.17 months (mean ± SD). Serum was collected at the time when patients were experiencing wheals and itch. Twenty-seven individuals were selected for healthy controls with age (mean ± SD 30.74 ± 10.28 years) and gender (F:M=19:8) matched to the patients. We first examined the serum level of each galectin using enzyme-linked immunoassay (ELISA) according to the manufacturer’s instruction. Results The mean levels (ng/ml) of galectin-1, -3 and -9 were 32.15 ± 1.38, 8.59 ± 0.69 and 10.99 ± 0.43 in patients, respectively, higher than in healthy controls (26.94 ± 1.165, 5.77 ± 0.50, and 9.475 ± 0.42, respectively) (P = 0.035, P = 0.015 and P = 0.046, respectively). However, the mean level of galectin-10 was comparable between the two groups (10.06 ± 2.62 vs 12.37 ± 4.15, P = 0.63). Galectin-1 and -3, but not -9 was positively associated with disease duration. None of the three galectins was correlated with the Chronic Urticaria Quality of Life Questionnaire (CU- Q2oL, 31.36 ±10.32, mean ± SD). The disease activity of CSU was measured by the Urticaria Activity Score Over 7 Days (UAS7) and Sabroe’s grade. None of the three galectins varied with the disease activity regardless of the grading methods. Seventeen of 37 (45.9%) patients were tested ASST-positive. Serum galectin-1, -3 and -9 were comparable between ASST-positive and -

2019CSID Poster communication negative patients (28.02 ± 1.58 vs 31.55 ± 1.87; 8.44 ± 1.15 vs 6.88 ± 0.82; 10.86 ± 0.62 vs 10.21 ± 0.84 ng/ml, respectively) ( P = 0.17, P = 0.26, P =0.23, respectively). Conclusions our current findings suggest that serum galectin-1, -3 and -9 are bystander molecules for CSU.

PO-008 Study on the change and function of protein crotonylation modification in CD4+T cells of systemic lupus erythematosus

Jiali Wu1 1The Second XIANGYA Hospital Of Central South University

Systemic lupus erythematosus (SLE) is a kind of autoimmune disease involving multiple organs and systems. DNA damage can lead to mutation overlap, genomic instability and apoptosis. Obstacles to remove apoptotic cells and apoptotic substances can cause these apoptotic substances as autoantigens to stimulate the body's immune system continuously, resulting in a large number of anti-apoptotic agents. These pathogenic antibodies can bind to various antigenic components in human body, such as double-stranded DNA and mitochondrial DNA, and form immune complexes that precipitate in various organs, thus triggering a series of clinical symptoms. In the pathogenesis of SLE, abnormal function of CD4+T cells and post- translational modification of proteins play an important role. Protein crotonylation modification is a new post-translational modification discovered in recent years. Protein crotonylation modification has been proved to have the function of promoting gene expression and affecting protein activity. At present, there is no report on crotonylation modification in CD4+T cells. The role of SLE in the pathogenesis of SLE. Based on the above research background, we intend to explore the changes of protein crotonylation modification in CD4 + T cells of SLE patients and its possible role. Therefore, we carried out a preliminary study on the detection and function of protein crotonylation in CD4 + T cells of SLE patients. We found that crotonylation modification of non- histone in CD4 + T cells of SLE patients was significantly enhanced by western blot. Further, the important protein X-ray repair cross-complementation protein 5 (XRCC5), which had crotonylation changes in CD4 + T cells of SLE patients, was identified by protein spectrum LC-MS/MS. In addition, we preliminarily revealed that crotonylation can promote the apoptosis of CD4 + T cells in human peripheral blood by changing the crotonylation modification experiments. Therefore, we speculate that crotonylation of protein may play an important role in the pathogenesis of SLE. The above results will provide new ideas for elucidating the pathogenesis of SLE. 86

2019CSID Poster communication

PO-009 The mechanism of purinergic receptor P2Y6 regulates psoriasis through PI3K/AKT signaling pathway

Peng Xu1 Shi Yuling1 1Department of Dermatology, Tenth People

Objective To explore the role of purine receptor P2Y6 in the development of psoriasis and its mechanism, and to find new potential targets for the treatment of psoriasis. Method The main strategy of is to study the regulation function of the key inflammatory factor IL- 17A/AKT in the pathogenesis of psoriasis, the psoriasis mouse model induced by imiquimod and IL-23 and P2Y6- /- Mice, P2Y6 ligand UDP processing model and other in vivo models and through in vitro cell experiments, RNA-seq and proteomics analysis, in-depth exploration of P2Y6 regulation of IL-17A/AKT-induced skin inflammation, for clinical targets Provide a theoretical basis for treatment. As a result, we found that P2Y6 is highly expressed in human psoriatic lesions relative to normal skin tissue, but in the mouse model, P2Y6 deletion exacerbates imiquimod-induced psoriatic lesions, whereas P2Y6 ligand UDP can attenuate imiquimod-induced psoriatic lesions, indicating that P2Y6 plays a very important role in the pathogenesis of psoriasis. By stimulating HaCaT cell experiments with IL-17, it was found that UDP inhibits IL-17-induced inflammatory responses and AKT phosphorylation. Conclusion The purinergic receptor P2Y6 may inhibit the occurrence of psoriasis induced by imiquimod by regulating IL-17/AKT. The mechanism of purinergic receptor P2Y6 regulates psoriasis through PI3K/AKT signaling pathway.

2019CSID Poster communication

PO-010 miRNA-21 overexpression promotes T follicular helper cells mediated autoimmune response in systemic lupus erythematosus

Xiaofei Gao1 Liu Limin1 Min Xiaoli1 Zhao Ming1 1The Second Xiangya hospital of Central South University

Object Previous studies have reported the increased numbers of circulating T follicular helper (Tfh) cells in patients with systemic lupus erythematosus (SLE), which play an important role in the pathogenesis of SLE. However, the mechanism of abnormal differentiation of Tfh cells in SLE is not yet clear. The purpose of this study was to investigate the role of miR-21 in regulating the differentiation of Tfh cells in murine lupus using miR-21-5p antagomir to silence miR-21. Methods This study was approved by the ethical committee of the Second Xiangya Hospital of Central South University and was performed in compliance with the guide for the care and use of laboratory animals. The MRL/MpJ and MRL/lpr mice were purchased from The Jackson Laboratory and were housed in specific pathogen free condition. The expression levels of miR- 21-5p and other miRNAs were detected by RT-qPCR. Flow cytometry was used to detect the percentage of Tfh cells and B cells. 12-week-old MPL/lpr mice were treated i.v. with either miR- 21-5p antagomir (40 nmol per mouse) or antagomir negative control (40 nmol per mouse) weekly for the first 3 weeks, and then every three weeks, for 12 weeks in a row. Mice were sacrificed for analysis at the end of observed period. Glomerulonephritis within each kidney of MRL/lpr mice was graded on a 0-3 scale, according to the intensity and extent of glomerular lesions. Student’s t-test for equality of means was used to compare values. P-values < 0.05 were considered as significant. Results Compared with even-aged MRL/MpJ mice, the expression level of miR-21-5p was significantly increased in MRL/lpr mice(p＜0.05), and the percentage of Tfh cells was significantly increased in the spleens and draining lymph nodes(dLN) of MRL/lpr mice(p＜0.05). Compared with antagomir negative control, MRL/lpr mice receiving miR-21-5p antagomir had a specifical decrease in the expression of miR-21-5p(p＜0.05), and had no significant differences in the expression of irrelevant miRNA, miR-99b-5p and miR-146a-5p(p=0.28 and p=0.99). At the end of observation period, MRL/lpr mice receiving miR-21-5p antagomir developed less skin lesions than the mice treated with antagomir negative control. Urinalysis showed that MRL/lpr mice treated with miR-21-5p antagomir had a decreased proteinuria level compared with antagomir negative control(p＜0.05). Hematoxylin and eosin (H&E) staining of kidney sections revealed that MRL/lpr mice receiving miR-21-5p antagomir had a marked decrease in pathological lesions of 88

2019CSID Poster communication glomerulus(p ＜ 0.001). Immunofluorescence staining analysis revealed less deposited immunoglobulin G(IgG) and complement 3(C3) in the glomeruli of MRL/lpr mice treated with miR- 21-5p antagomir compared with antagomir negative control. Serum levels of antinuclear antibody(ANA) and anti-nuclear ribonucleoprotein(nRNP) antibody were also significantly decreased in MRL/lpr mice treated with miR-21-5p antagomir(p＜0.05). Flow cytometric analysis showed that the percentages of Tfh cells and B cells were significantly decreased in the spleens and dLN of MRL/lpr mice treated with miR-21-5p antagomir(p＜0.05). Conclusion miR-21 overexpression promotes the development of murine lupus by regulating aberrant differentiation of Tfh cells. miR-21-5p antagomir may be a promising therapeutic strategy for alleviating autoimmune responses in SLE.

PO-011 Mir-144-3p regulates the expression and function of Treg/Th17 cells by targeting Bach2 in psoriasis

Ronghua Li1 Sun Qing1 1Qilu Hospital of Shandong University

Psoriasis is a common immune-mediated chronic inflammatory cutaneous disease. Treg/Th17 immune imbalance has been reported to contribute to the pathogenesis of psoriasis. In this study, we found that Bach2 was downregulated in the peripheral blood CD4+T cells of psoriasis patients compared with healthy controls. Naive CD4+T cells were isolated from human PBMCs and then activated under different polarizing conditions in vitro. To directly determine whether Bach2 regulates Th cell differentiation, we knocked down endogenous Bach2 expression by small interfering RNA (siRNA). The results showed that the decreased expression of Bach2 inhibited Treg differentiation but promoted Th17 differentiation. The percentage of induced Treg cells (CD25+FOXP3+) was decreased after knockdown of Bach2 under Treg polarizing from naive human CD4+T cells, and the mRNA expression of its specific transcription factors head box protein 3 (FOXP3) was also decreased. In contrast, the mRNA expressions of RORγt(retinoic acid-related orphan receptor γt), the specific transcription factors of Th17 was increased, and relevant cytokines IL-17 and IL-22 were also increased under Th17 polarizing from naive human CD4+T cells. Subsequently, we found that miR-144-3p was significantly upregulated in the peripheral blood CD4+T cells of psoriasis patients compared with healthy controls by microRNA microarray. Then, Bach2 was identified as the direct target of miR-144-3p through dual luciferase

2019CSID Poster communication reporter assay. The upregulation miR-144-3p expression inhibited Treg differentiation but promoted Th17 differentiation. On the contrary, the downregulation miR-144-3p expression promoted Treg differentiation but inhibited Th17 differentiation. In vivo, inhibition of miR-144- 3p by intradermal injection of miR-144-3p antagomir blocked the development of psoriasis-like inflammation in an imiquimod-induced mouse model. We further showed that miR-144-3p agomir induces Th17 cell differentiation but inhibits Treg differentiation; and miR-144-3p antagomir induces Treg cell differentiation but inhibits differentiation Th17. Our findings suggest that the high expression of miR-144-3p in peripheral blood of psoriasis may affect the differentiation and function of Treg/Th17 cells by regulating the expression of Bach2, and exhibit a Th17 dominant response, which secretes a large amount of IL-17A, and IL-22, thereby promoting the development of psoriasis.

PO-012 Cutaneous and pulmonary manifestation of Sjögren’s syndrome

QIAN ZHAO1 CAO HUA1 1Rui Jin Hospital, School of Medicine, Shanghai Jiao Tong University

Objective Sjögren’s syndrome (SS) is a heterogeneous autoimmune disease with a spectrum extends from sicca syndrome to systemic involvement (extra-glandular manifestations). Cutaneous and pulmonary manifestations are common in SS. To demonstrate the profile of the two main organ-specific extra-glandular manifestations in SS and further explore their potential clinical significance, the retrospective study was conducted. Methods We assessed 78 patients with SS, including 70 cases of female and 8 cases of male, with a mean age of 57 years at diagnosis and a mean disease duration of 6 years. Demographic data, clinical manifestations and laboratory features were collected. Results 49 (62.8%) patients had cutaneous lesions. The most common types were erythema on the back of hands (41.0%), facial erythema (20.5%), Raynaud phenomenon (14.1%), erythematous macules (16.7%) and lower extremity purpura (10.3%). Serum γ-globulin was significantly increased in the subsets with cutaneous lesions than those without cutaneous lesions (26.93±6.31 vs 22.30±4.12 ， P<0.05). Incidence of interstitial lung disease was significantly higher among patients with erythema on the back of hands (59.4% vs 26.0%, P<0.01) and Raynaud phenomenon (72.7% vs 34.3%, P<0.05) and incidence of lymphoma was

2019CSID Poster communication significantly higher among the patients with lower extremity purpura (25.0% vs 0.0%, P<0.01). Interstitial lung disease (ILD) was the most common pulmonary manifestation in SS patients in our cohort. 31(39.7%) of SS patients developed ILD while only 16 (20.5%) patients have symptoms including non-productive cough, dyspnea and shortness of breath. Presenting ILD manifestations were acute/subacute onset of ILD (n=2), chronic ILD (n=14), and asymptomatic patients exhibiting abnormalities consistent with ILD on PFTs (pulmonary function test) or lung HRCT (n=15). Compared with the SS patients without ILD, SS-ILD patients showed increased levels of neutrophils (63.58±11.58 vs 51.69±10.67, P<0.05), IgG (2070.00±1237.69 vs 1435.73±422.63, P<0.05）and serum γ-globulin (31.48±9.48 vs 21.85±4.94, P<0.01)，while the levels of compliment C4 is lower in SS-ILD group than those without ILD (12.70±6.62 vs 18.50±5.80, P<0.05). The results of PFTs mostly showed restrictive ventilation dysfunction and diffuse dysfunction, while a few cases showed mixed ventilation dysfunction and obstructive ventilation dysfunction. Conclusion The burden of disease in SS is higher than expected due to the development of extra-glandular manifestations. A deeper insight into cutaneous and pulmonary manifestation of SS and the physio-pathological process behind them may influence clinical decision-making. Investigating these manifestations of SS may also provide evidence for the differentiation of SS from other connective tissue disease. For SS patients, cutaneous and pulmonary manifestations and immunological examination should be performed as well.

PO-013 The IgG1 isotype of anti-MDA5 antibody may dominate severity of interstitial lung disease in dermatomyositis

Mengya Chen1 Pan Meng1 Zheng Jie1 Cao Hua1 1Shanghai Ruijin Hospital

Objective To identify anti-MDA5 antibody subtype (IgG, IgA, IgM) and anti-MDA5 IgG subclasses, and to investigate their association with clinical severity. Methods Clinical features, laboratory findings and serum of 36 DM/CADM patients with anti- MDA5 antibody positive were collected and analyzed. Anti-MDA5 IgG was measured by enzyme- linked immunosorbent assay and line-blot immunoassay. Anti-MDA5 subtype (IgG, IgA, IgM) and anti-MDA5 IgG subclasses were measured by enzyme-linked immunosorbent assay. A multiple unpaired t-test was performed to compare levels of anti-MDA5 subtype (IgG, IgA, IgM) and anti-

2019CSID Poster communication

MDA5 IgG subclasses in different groups of patients with DM/CADM. Cumulative survival was analyzed according to classification of ILD or anti-MDA5 IgG subclasses. All data were analyzed using SPSS 23.0 software or GraphPad 6 software. Results In 36 anti-MDA5 Ab positive DM/CADM patients, 12 died of interstitial lung disease and 24 survived till the latest visit. The incidence rate of necrotic ulceration, ulcerative Gottron rash, acute interstitial pneumonia were significantly higher in patients dead than survivors(all P<0.05). Survivors had significantly higher serum LDH and ferritin. However, there was no significant difference in anti-MDA5 IgG. Cut-off value of anti-MDA5 IgG was identified as 50U/ml, with 100% sensitivity and 99.42% specificity. The positive rate of MDA5 anti-IgG, IgA, IgM were 100%, 97%, 0.06%, respectively. The positive rate of anti-MDA5 IgG1, 2, 3, 4 are 72%, 25%, 0, 28%, respectively. Incidence rate of acute interstitial pneumonia, mortality rate and serum ferritin were significantly higher in MDA5 IgG1+ DM/CADM patients (n=26) than MDA5 IgG1- patients (n=10) (P=0.0027, 0.015, 0.0011, respectively). However, There were no significant difference of incidence rate of skin ulceration, acute interstitial pneumonia, prognosis and serum levels of ferritin between patients with MDA5 IgG2+ and MDA5 IgG2-, neither in comparison between patients with MDA5 IgG4+ and MDA5 IgG4-. Till the latest visit, overall survival of patients with MDA5 IgG1+IgG4+ was 37.5% and median survival time was 6 months. The overall survival of patients with MDA5 IgG1+IgG4- and MDA5 IgG1- was 61.1% and 100%, respectively. Log-rank (Mantel-Cox) test of the survival curves showed significant difference, P=0.037. serum ferritin was significantly elevated in MDA5 IgG1+IgG4+ and MDA5 IgG1+IgG4- patients than MDA5 IgG1- patients (both P<0.01). Conclusion Serum levels of MDA5 IgA may be a substitute for anti-MDA5 IgG. MDA5 IgG1 is the principle component of MDA5 IgG subclasses and correlates with AIP and prognosis in patients with DM/CADM, which might participates in the pathogenesis of anti-MDA5 antibody associated ILD.

PO-014 Cutaneous and pulmonary manifestation of Sjogren’s syndrome

Qian Zhao1 Cao Hua1 1Rui Jin Hospital, School of Medicine，Shanghai Jiao Tong University

Objective Sjögren’s syndrome (SS) is a heterogeneous autoimmune disease with a spectrum extends from sicca syndrome to systemic involvement (extra-glandular manifestations).

2019CSID Poster communication

Cutaneous and pulmonary manifestations are common in SS. To demonstrate the profile of the two main organ-specific extra-glandular manifestations in SS and further explore their potential clinical significance, the retrospective study was conducted. Methods We assessed 78 patients with SS, including 70 cases of female and 8 cases of male, with a mean age of 57 years at diagnosis and a mean disease duration of 6 years. Demographic data, clinical manifestations and laboratory features were collected. Results 49 (62.8%) patients had cutaneous lesions. The most common types were erythema on the back of hands (41.0%), facial erythema (20.5%), Raynaud phenomenon (14.1%), erythematous macules (16.7%) and lower extremity purpura (10.3%). Serum γ-globulin was significantly increased in the subsets with cutaneous lesions than those without cutaneous lesions (26.93±6.31 vs 22.30±4.12 ， P<0.05). Incidence of interstitial lung disease was significantly higher among patients with erythema on the back of hands (59.4% vs 26.0%, P<0.01) and Raynaud phenomenon (72.7% vs 34.3%, P<0.05) and incidence of lymphoma was significantly higher among the patients with lower extremity purpura (25.0% vs 0.0%, P<0.01). Interstitial lung disease (ILD) was the most common pulmonary manifestation in SS patients in our cohort. 31(39.7%) of SS patients developed ILD while only 16 (20.5%) patients have symptoms including non-productive cough, dyspnea and shortness of breath. Presenting ILD manifestations were acute/subacute onset of ILD (n=2), chronic ILD (n=14), and asymptomatic patients exhibiting abnormalities consistent with ILD on PFTs (pulmonary function test) or lung HRCT (n=15). Compared with the SS patients without ILD, SS-ILD patients showed increased levels of neutrophils (63.58±11.58 vs 51.69±10.67, P<0.05), IgG (2070.00±1237.69 vs 1435.73±422.63, P<0.05）and serum γ-globulin (31.48±9.48 vs 21.85±4.94, P<0.01)，while the levels of compliment C4 is lower in SS-ILD group than those without ILD (12.70±6.62 vs 18.50±5.80, P<0.05). The results of PFTs mostly showed restrictive ventilation dysfunction and diffuse dysfunction, while a few cases showed mixed ventilation dysfunction and obstructive ventilation dysfunction. Conclusion The burden of disease in SS is higher than expected due to the development of extra-glandular manifestations. A deeper insight into cutaneous and pulmonary manifestation of SS and the physio-pathological process behind them may influence clinical decision-making. Investigating these manifestations of SS may also provide evidence for the differentiation of SS from other connective tissue disease. For SS patients, cutaneous and pulmonary manifestations and immunological examination should be performed as well.

2019CSID Poster communication

PO-015 Effect of DNAJA4 on f-actin in HaCaT cells during hyperthermia

Ruijiao Liu1 Qi Rui-Qun1 1The First Hospital of China Medical University

Background Hyperthermia is an effective treatment against cancer and human papillomavirus (HPV) Infection. Among the most noteworthy changes in heat-shocked cells are induction of heat shock proteins (HSPs) and reorganization of the cytoskeleton. Hyperthermia enhances DNAJA4 expression in human keratinocytes.This project aimed to study the the effects of hyperthermia, DNAJ4 and F-actin. Methods HaCaT cell lines were studied in this research. A 44°C waterbath was used to mimic hyperthermia treatment.IF-staining and Western-blotting were used to study the expression of F- actin and other molecules. Results (1) In HaCaT WT cells, the cells were observed to be scattered with few intercellular connectionsa .Voluminous network of actin filaments and bundles of stress fibers were observed. Actin-rich cell protrusions, several filopodia and lamellipodia were detected.Thirty minutes of 44 ◦C heat treatment resulted in the accumulation of F-actin and an increase in bright F-actin labeling in the center of the cells.We also observed a decrease in cell volume, shrunken and rounded, a decrease in intercellular connections, and an increase in cell membrane protuberances.(2) In HaCaT DNAJ4 cells,Few or no cell protrusions were observed.The aggregation and distribution of cells were observed with tight intercellular connections.Thirty minutes of 44 ◦C heat treatment,Increased membrane projections were observed. Conclusion Actin depolymerization and f-actin reduction were observed after hyperthermia.DNAJ4was observed to promote actin polymerization and stabilize the cytoskeleton heat treatment.

2019CSID Poster communication

PO-016 Profile of BP180 and BP230-specific IgE autoantibodies in bullous pemphigoid

Yen-chi Shih1 Yuan Huijie1 Shen Jia1 Zheng Jie1 Pan Meng1 1Department of Dermatology, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University,

Background Bullous pemphigoid (BP) is an autoimmune blistering disease characterized by autoantibodies against BP180 and BP230. There is emerging evidence that IgE autoantibodies play an important role in the pathogenesis of BP. Objective To determine the rate of anti-BP180 and anti-BP230 IgE in BP, and to evaluate their diagnostic relevance in BP sera. Methods: We collected serum samples from 156 patients who met the clinical and immunologic, and histologic features consistent with BP. In addition, 10 control individuals were included for comparison. We used commercially available IgG enzyme- linked immunosorbent assay (ELISA) to develop IgG and IgE ELISAs for both BP180 and BP230. A receiver operating characteristic (ROC) curve was used to evaluate the ability of the ELISA to detect anti-BP180 and anti-BP230 IgE autoantibodies. Anti-BP180 IgE and anti-BP230 IgE positivity were conducted using the Spearman’s rank correlation test. The results of IgE ELISAs were statistically compared among various ELISAs. Results In 156 BP patients, 96 BP patients with elevated level of total IgE (>165.3IU/ml) and 60 BP patients with normal level of total IgE. IgE autoantibodies to BP180 and BP230 were found in 25 and 36 of 96 BP sera, respectively. And, anti-BP180 IgG and anti-BP230 IgG were detected in 82 and 79 of 96 BP sera, respectively. Anti-BP230 IgE autoantibodies, but not anti-BP180 IgE autoantibodies, correlated with total IgE (R=0.6914�P<0.0001). The level of BP230 IgE was significantly higher than the level of BP180 IgE (P=0.0357). Conclusion The results of this study indicated that most BP patients exhibit elevated IgE levels in the serum. IgE autoantibodies to both BP180 and BP230 can be detected in BP sera. The results of total IgE and anti-BP230 IgE ELISAs are well correlated. In BP patients, the positivity rate of anti-BP230 IgE is higher than anti-BP180 IgE. IgE anti-BP230 autoantibodies seemed to be pathogenic in BP.

2019CSID Poster communication

PO-017 Increased expression of miR-338-3p impairs Treg-mediated immunosuppression in pemphigus vulgaris by targeting RUNX1

Meinian Xu1 Liu Qingxiu1 Li Songshan1 Zhang Wenjing1 Huang Xiaowen1 Han Kai1 Li Changxing1 Zeng Kang1 1Nanfang Hospital, Southern Medical University

Background Pemphigus vulgaris (PV) is a regulatory T cell (Treg)-associated autoimmune disease. MicroRNAs (miRNAs) have frequently emerged as regulators in Treg-mediated immunosuppression in autoimmune diseases. We previously found that miR-338-3p was overexpressed in the peripheral blood mononuclear cells of PV patients, but the specific role of miR-338-3p in Treg-mediated immunosuppression has not yet been explored. Objective To investigate the correlation between miR-338-3p and Treg-mediated immunosuppression in PV. Methods The expression of miR-338-3p and Treg/T helper cell-related genes was evaluated in CD4+ T cells of PV patients and healthy controls by quantitative real-time polymerase chain reaction. Analysis of public microarray data, miRNA transfection, luciferase reporter assays, and flow cytometry were used to explore the role of miR-338-3p in Treg-mediated immunosuppression. Results Increased expression of miR-338-3p and decreased expression of FOXP3 and Runt- related transcription factor 1 (RUNX1) mRNAs were detected in CD4+ T cells of active PV patients compared with those in healthy controls. The miR-338-3p level was positively related to disease severity and negatively correlated with RUNX1 mRNA level. Moreover, there was a significantly positive correlation between the levels of RUNX1 and FOXP3 mRNAs. Bioinformatics prediction revealed that RUNX1, a gene activating FOXP3 expression, was a putative target of miR-338-3p. MiRNA transfection verified that miR-338-3p attenuated FOXP3 expression by targeting RUNX1. Conclusion The expression of miR-338-3p in CD4+ T cells is a sensitive biomarker for PV diagnosis and for therapeutic efficacy monitoring. Excessive expression of miR-338-3p attenuates the expression of FOXP3 by targeting RUNX1, contributing to Treg dysfunction in PV.

2019CSID Poster communication

PO-018 Effects of DOCK8 deficiency on IL-10 producing regulatory B cells

Jinqiu JIANG1 WANG Hua1 1 Children

Background Dedicator of cytokinesis 8 (DOCK8) deficiency manifests a hyper-IgE phenotype, combined immunodeciency and severe atopic dermatitis (AD), which is a good disease model for studying immunological pathogenesis of AD. DOCK8 is a regulating factor of actin cytoskeleton proteins involved in the development and differentiation of B cells. Regulatory B cells (Breg) are potent negative regulators of antigen-specific inflammation and T-cell-dependent autoimmune diseases mainly through producing inhibitory cytokine interleukin-10 (IL-10). The precise signaling mechanisms required for Breg functions remain unknown. We sought to elucidate the effects of DOCK8 deficiency on Breg function in patients and DOCK8KO mice. Methods We measured the percentage and numbers of IL-10+Breg in DOCK8 deficient patients or healthy controls and DOCK8KO and WT mice after sensitization of OVA by flow cytometry. We used DOCK8KO-WT bone marrow chimera mice to decect the defects of Breg was DOCK8 deficient intrinsic, and adoptive transfer of DOCK8-/-CD4+ naïve T cells to CD4KO mice to decect the defects of Breg was caused by DOCK8-/-CD4+T cells. We also detected the restoration of Breg after administration of recombinant IL-21 in DOCK8KO mice. Results DOCK8 deficient patients (n=3) have decreased percentage of IL10+CD19+regulatory B cells compared with healthy controls. In DOCK8KO mice, the percentage and number of IL- 10+CD19+regulatory B cells were reduced compared with WT mice after induced by OVA. In DOCK8KO-WT bone marrow chimera mice, it showed the decreased number of Breg, but for DOCK8KO-μMT (B cell deficient mice) bone marrow chimera mice showed the normal number of Breg. Adoptive transfer of DOCK8-/-CD4+ naïve T cells to CD4KO mice exhibited decreased Breg percentage. Finally, In vitro and in vivo administration of recombinant IL-21could restores the percentage of Breg, it might be caused by LPS-driven, but not IL-21-driven, STAT3 phosphorylation was defective in DOCK8KO mice. Conclusions DOCK8 deficiency causes Breg intrinsic defect, as a result of abnormalities of IL- 21-producing CD4+ T cells in DOCK8 deficiency.

2019CSID Poster communication

PO-019 melanocyte specific antibody in sera of patients with active non- segmental vitiligo

Yu Zhen1 Yao Lei1 Zu Jianjiao1 Li Shanshan1 1The First Hospital of Jilin University

Objective To clarify the role of B cell-based humoral immunity in the pathogenesis of vitiligo, we investigated the positive rate of melanocyte specific antibodies in sera of patients with active non- segmental vitiligo (NSV) and healthy controls. Methods Primary melanocytes were isolated from healthy adults who underwent routine foreskins circumcisions. Sera from 53 active NSV patients without other autoimmune diseases and 33 healthy controls were collected. The proportion of melanocyte specific autoantibodies in the serum of healthy controls and active NSV patients was detected by immunofluorescence. Results In patients with active NSV, the positive rate of melanocyte specific antibody in sera was 46/53, while 2/33 in healthy controls. The positive rate of melanocyte specific antibody in NSV patients was significantly higher than that in healthy controls(P˂0.001). Conclusion Overwhelming higher rate of melanocyte specific antibodies in serum of active NSV patients indicated that humoral immunity is involved in the autoimmune response of vitiligo and immunofluorescence detection of melanocyte autoantibodies can provide a new and feasible diagnostic method for clinical practice. Funds support: Natural Science Foundation of Department of Science and Technology Jilin province (20180101110JC); National Natural Science Foundation of China (81401351); National Natural Science Foundation of China (81773317).

2019CSID Poster communication

PO-020 Do tissue resident memory T cells have the ability to potentially drive psoriasis recurrence?

Ling Chen1 Sun Chaonan2 Shen Zhu3,2 1Department of Dermatology, Daping Hospital, Army Medical University 2School of Medicine, University of Electronic Science and Technology of China 3 Institute of Dermatology and Venereology, Sichuan Academy of Medical Sciences & Sichuan Provincial People

Objectives The major therapeutic challenge of plaque psoriasis is its frequent recurrence, which is preferentially in previously affected areas. Thus, a pathogenic memory has been proposed, however, the nature of such site-specific immuno-memory is not well known. Because tissue resident memory T cells (TRM cells) can localize and survival in peripheral compartments for many months, even years, we speculate that TRM cells may contribute to the recurring pathology of psoriasis. The aim of this study is to investigated whether resolved psoriatic lesions contain TRM cells with the ability to potentially drive psoriasis recurrence. Methods Psoriatic recurrence was investigated by a large-sample questionnaire. RNA-seq analysis was performed among recurrent lesions, resolved areas, and adjacent "appearing" normal skin. CD8+CD69+ TRM cells were evaluated quantitatively, and their function was demonstrated by ex vivo stimulation and re-activate mouse psoriasiform dermatitis. The expression kinetics of CD69 by IL-15 was measured ex vivo at the given time-points by RT-PCR, WB and immunofluorescence staining. IL-15’s effect on CD69 was further confirmed by knockdown and over-expression assays on mRNA and protein levels. Results Over 80% psoriatic patients experienced the recurrence in previously affected areas. We demonstrated dermal CD8+CD69+ TRM cells existed with high numbers in resolved areas, and could secret pathogenic cytokines upon stimulations. IL-15 was secreted by psoriatic keratinocytes under experimental Koebner stimulations (bending & stretching of keratinocyte, wound trauma), and maintained a high level in clinically resolved areas. We demonstrated IL-15 was important for CD69 maintenance, and indispensable for the survival of CD8+CD69+ TRM cells.

Conclusions We demonstrated the vital roles of the immunological memory of CD8+CD69+ TRM cells by IL-15 in psoriatic recurrence. Our results suggest a novel potential therapeutic strategy for decreasing psoriasis recurrence, in which IL-15 antagonist(s) targeting at CD8+CD69+ TRM cells may be an important supplement to routine therapeutic regimens. 99

2019CSID Poster communication

PO-021 Loss of nuclear-localized AIM2 attenuates autoimmunity by impairing Tfh cell differentiation

Haijing Wu1 Deng Yaxiong1 Long Di1 Li Qianwen1 Huang Xin1 Zhao Ming1 Lu Qianjin1 1The Second Xiangya Hospital, Central South University

Absent in melanoma 2 (AIM2) is a well-known component of inflammasomes in innate immune cells. Here, we report our unexpected observation of elevated nuclear-localized AIM2 levels in T follicular helper cells (Tfh) and CD4+ T cells, and demonstrate that AIM2 functions in adaptive immunity by regulating T cell differentiation. Conditional knockout of AIM2 specifically in CD4+ T cells revealed reduced CD4 T cells in murine spleens and lymph nodes, and dampened KLH-induced Tfh cell responsivity. Work in two mouse models showed that AIM2 deficiency ameliorates lupus by reducing Tfh cells. Mechanistically, AIM2 regulates C-Maf and STAT3, thereby modulating IL-21 production, and IL-21 treatment increased AIM2 expression by recruiting the hydroxymethyltransferase enzyme TET2 to the AIM2 promoter. Our study thus reveals an inflammasome-independent function of AIM2 in CD4+ T cells and demonstrates how AIM2 attenuates lupus autoimmunity by inhibiting Tfh cell differentiation, implicating AIM2 as a target in autoimmune disorders.

PO-022 Current insights into autoimmunity activation triggered by oxidative stress in vitiligo

Yinghan Wang1 Li Shuli1 Li Chunying1 1Department of Dermatology, Xijing Hospital, Fourth Military Medical University

Vitiligo is a cutaneous depigmenting disorder resulting from loss of melanocytes that are destroyed by autoreactive CD8+ T cells. It is well defined that intrinsically defective melanocytes are disrupted morphologically and functionally in the context of oxidative stress. Recent discoveries reinforce the importance of oxidative stress as an initiating factor triggering the

100

2019CSID Poster communication melanocyte specific autoimmune responses. Oxidative stress induces the exposure of melanocyte-derived autoantigen, secretion of cytokines and chemokines such as IL-15, CXCL16, and release of damage associated molecular patterns including calreticulin, HMGB1, as illustrated by several studies, which increase the skin infiltration and promote the cytotoxic function of CD8+ T cells. A better understanding of these interactions will serve to integrate a framework of vitiligo pathogenesis and its blockade has favorable potential as a therapeutic approach.

PO-023 evaluation of immunoresponses and cytotoxicity from skin exposure to metallic nanoparticles

Menglei Wang1 1Department of Dermatology, Nanfang Hospital, Southern Medical University

Nanotechnology is an interdisciplinary science that has developed rapidly in recent years. Metallic nanoparticles (NPs) are increasingly utilized in dermatology and cosmetology, because of their unique properties. However, skin exposure to NPs raises concerns regarding their transdermal toxicity. The tight junctions of epithelial cells form the skin barrier, which protects the host against external substances. Recent studies have found that NPs can pass through the skin barrier into deeper layers, indicating that skin exposure is a means for NPs to enter the body. The distribution and interaction of NPs with skin cells may cause toxic side effects. In this review, possible penetration pathways and related toxicity mechanisms are discussed. The limitations of current experimental methods on the penetration and toxic effects of metallic NPs are also described. This study contributes to a better understanding of the risks of topically applied metallic NPs and provides a foundation for future studies.

101

2019CSID Poster communication

PO-024 Epidermal CD147 Promotes Psoriasis through Recruiting Myeloid- Derived Suppressor Cells

Chao Chen1,2,3 Tan Lirong1,2,3 Zhu Wu1,2,3 Lei Li1,2,3 Kuang Yehong1,2,3 Liu Panpan1,2,3 Chen Xiang1,2,3 Peng Cong1,2,3 1Department of Dermatology, Xiangya Hospital, Central South University 2Hunan Key Laboratory of Skin Cancer and Psoriasis, Xiangya Hospital, Central South University 3Hunan Engineering Research Centre of Skin Health and Disease, Xiangya Hospital, Central South University

Objectives Myeloid-derived suppressor cells (MDSCs) are a heterogeneous population of progenitor and immature myeloid cells which are expanded in psoriatic skin lesions and peripheral blood. However, the role of MDSCs in pathogenesis of psoriasis remains unclear. CD147, a psoriatic susceptible gene, is highly expressed in psoriatic skin lesions which can promotes psoriasis. Here, we aim to investigate the roles of CD147 and MDSCs in the pathogenesis of psoriasis. Methods We used transgenic mice with specific deletion or over-expression of CD147 in epidermis and collected skin samples from psoriasis patients and healthy individuals to study the roles of CD147 and MDSCs in the pathogenesis of psoriasis using flow cytometry, qRT-PCR and RNA-Seq technique. We used Imiquimod (IMQ) to induce psoriasis-like mice models. Gemcitabine and anti-IL-21R antibody were applied to deplete MDSCs and neutralize IL-21R in vivo respectively. Results Epidermal CD147 facilitates IMQ-induced skin inflammation through accumulating MDSCs as well as Th17 and Treg cells and promotes IMQ-induced cytokines expression such as S100A8 and S100A9, resulting in the recruitment of MDSCs in skin lesions and spleen. Either genetic specifically knocking-out epidermal CD147 or depleting MDSCs by Gemcitabine significantly suppresses IMQ-mediated psoriatic phenotype as well as Th17 and Treg cells accumulation. Moreover, through RNA-Seq technique we validated some differentially expressed genes on CD4+ T cells of IMQ-induced-MDSCs-depleted mice such as IL-21 and Timd2, which are involved in Th17-cell differentiation or T-cell activation. Neutralizing IL-21R by antibody reduces IMQ-induced epidermal thickening through down-regulating the infiltration of MDSCs and Th17 cells.

102

2019CSID Poster communication

Conclusions Epidermal CD147 mediates MDSCs accumulation exerts essential role for the pathogenesis of psoriasis. IL-21 is a novel potential therapeutic target for psoriasis treatment.

PO-025 Study on the role of AIM2 by regulating B cell differentiation and activation in the pathogenesis of SLE

Ming Yang1 Wu Haijing1 Li Qianwen1 Long Di1 Lu Qianjin1 1Dept. of Dermatology, 2nd Xiangya Hospital,Central South University

Object Exploring the role of AIM2 in the pathogenesis of SLE by regulating the activation and differentiation of B cells Methods (1) The expression levels of AIM2 in each subtype of B cells in human tonsils were detected by flow cytometry.(2) The AIM2 expression level in peripheral blood B cells of SLE patients and normal people was detected by flow cytometry.(3) The phenotypes of B and T cells in CD19creAIM2f/f and Rag2 mouse models were analyzed. Result Experimental studies found that B-cells expressed high levels of AIM2 in human tonsils. Therefore, we further explore the effect of AIM2 on differentiation and activation of B cells. CD19+CD27+ B-cells expressed significantly higher levels of AIM2 compared to CD19+ B-cells in human tonsils. Immunohistochemical analysis revealed that CD19+ B-cells around germinal center expressed high levels of AIM2. Flow cytometry analysis suggested that the expression of AIM2 in peripheral blood B cells of SLE patients was lower than that of normal controls. After stimulating naïve B cells with LPS, a more detailed analysis of different B cells (memory B-cells, plasma B-cells, naïve B-cells) demonstrated that AIM2 was preferentially expressed in naïve B- cells, whereas other B cells expressed lower levels of AIM2 and memory B-cells expressed least. In CD19creAIM2f/f model, the expression of CD3 and CD19 in spleen was down regulated and the activation of T cells was enhanced. In Rag2 mouse model induced by KLH, the expression of GC B cells was down regulated with the induced expression of CD3 and the reduced expression of CD4. Conclusion AIM2 is highly expressed in naive B cells and promotes B cell differentiation. This mechanism may play an important role in the pathogenesis of SLE.

103

2019CSID Poster communication

PO-026 Transcriptome analysis and biomarker identification in CD8+ T cells in patients with vitiligo

Qiancheng Deng1 Xiao Rong1 1Department of Dermatology, The Second Xiangya Hospital, Central South University

Aim Vitiligo is an immune-mediated depigmented skin disease characterized by the autoimmune destruction of melanocytes. Activated CD8+ T cells play important roles in the pathogenesis of vitiligo. However, the triggering factors of CD8+ T cells remain obscure. In this study, we conducted the transcriptome analysis of CD8+ T cells from vitiligo lesional skin to identify differentially expressed genes and uncover potential triggering factors for melanocytes-specific CD8+ T cells in vitiligo. Methods The transcriptome sequencing of CD8+ T cells was performed in lesional skin of patients with vitiligo and normal control by Illumina HiSeq X Ten platforms. GO and KEGG pathway enrichment analysis was used to figure out the relevant functions and pathways of differentially expressed genes. Quantitative RT-PCR, western blotting and Opal IHC were conducted for validation of mRNA and protein level of the differentially expressed genes in CD8+ T cells from lesional skin and peripheral blood of vitiligo patients. DNA methylation level of HIF-1α was further validated by MethylTarget. Results A total of 1147 differentially expressed genes were figured out. 12 KEGG pathways for up-regulated genes and 6 for down-regulated genes were picked out at the top 20 of all significant KEGG pathways. Based on KEGG pathway enrichment analysis and PPI, 16 up- regulated and 23 down-regulated genes were finally identified. 3 genes were figured out by quantitative RT-PCR. The mRNA and protein expression levels of PIK3CB, HIF-1α, F2RL1 were all elevated in CD8+ T cells from peripheral blood in vitiligo. Nevertheless, only HIF-1α and PIK3CB were significantly increased in lesional skin of vitiligo. Results of MethylTarget revealed that two CpG sites of HIF-1α gene were hypomethylated in CD8+ T cells of vitiligo. Conclusion Our study conducted the transcriptome analysis of CD8+ T cells in lesional skin of patients with vitiligo and provided evidence that HIF-1α may act as a novel a biomarker for vitiligo, which possibly involves the functions of melanocytes-specific CD8+ T cells. In addition, we uncovered the potential role of DNA hypomethylation of HIF-1α in the pathogenesis of vitiligo.

104

2019CSID Poster communication

PO-027 Identification of CD4+CD69+ tissue-resident memory T cell in pemphigus lesions

Yaru Zou1 Haiqin Zhu2 Meng Pan1 1Rui Jin Hospital, Shanghai Jiao Tong University School of Medicine 2Rui Jin Hospital North, Shanghai Jiao Tong University School of Medicine

Pemphigus is a group of life-threatening organ-specific autoimmune bullous disease, caused by autoantibodies directed against the desmosomal cadherins (desmoglein 1 and/or desmoglein 3). Clinically, it was observed that the lesions are prone to affect the sebaceous- gland-rich areas and the recurrent lesions are at the same spot. We proposed that the local lesions might have the pathogenic memory in the disease development. In recent years, a newly identified subset of memory T cells, tissue-resident memory T (TRM) cells are characterized gradually, which are non-recirculating memory T cells persisting long life in epithelial tissues, including skin, lung, and gastrointestinal tract, etc. Phenotypically, TRM cells are characterized by the expression of surface markers CD69 and CD103 and by the absence of the lymph node homing receptors CCR7. In our previously study, we discovered that local B cells could be induced to produce antigen-specific antibody. However, the role of T cells remains unclear. In this study, we aimed to investigate the local TRM cells might play the important role in the disease recurrence. We isolated the lymphocytes from the lesions of pemphigus patients by flow cytometry. It was showed that more CD3+T cells were observed, compared to the healthy controls (p>0.05), + + and CD4 CD69 TRM cells were elevated dramatically (p<0.05). We then analyzed the correlation + + between the CD4 CD69 TRM cells and the clinical features from 19 patients. It was showed that + + the PDAI score was positively correlated with the proportion of CD4 CD69 TRM cells (p=0.042, + + r=0.410), however, there were no strong correlations between CD4 CD69 TRM cells and anti- desmoglein antibody titers (Anti-desmoglein 1: p>0.05, r=0.082; Anti-desmoglein 3: p>0.05, + + r=0.1127). It was also observed that the higher number of CD4 CD69 TRM cells related to the + + refractory of the disease. Collectively, our results concluded that CD4 CD69 TRM cell exit in the local lesions in pemphigus. It might play the role in the disease activity and the disease recurrence. It also predicted the disease refractory. However, the further mechanism should be explored deeply.

105

2019CSID Poster communication

PO-028 Neuropeptide CGRP regulates human langerhans cells in vitro

Jie dong1, Xuan zhang1, Yanling he 1 1dermatology department, beijing chaoyang hospital, capital medical university

Back ground Langerhans cells are the most important antigen-presenting cells in the epidermis and play an essential role as skin immune sentinels. Various factors can influence the function of Langerhans cells. Studies showed that some nerve fibers are intimately associated with Langerhans cells in human epidermis. Purpose To determine the effect of calcitonin gene-related peptide (CGRP), a cutaneous nerve neuropeptide,and PDK1/RSK signals on the function of human Langerhans cells. Method Langerhans cells were isolated from human skin by CD1a beads and cultured in vitro, CGRP (10−8 M) ,CGRP8-37 (10−6 M ),BX-795(20umol/L),BI-D1870 (20umol/L) were added and incubated for 24h ,48h or 72h, Cells were then immunostained with anti-CD1a-FITC, anti-CD80- APC,anti-CD86-PE and analysed with flow cytometer. Supernatents were collected and IL-23 cytokine levels were detected by using huaman IL-23 sandwich ELISA kits. Results Human Langerhans cells highly express CD1a and a low level of CD80CD86 but changed with the time. CGRP (10−8 M) can affect the expression of CD1a and CD80CD86 , CGRP can also increase the secretion of IL-23 by Langerhans cells, which can be apparently compromised by CGRP8-37 peptide, an antagonist of CGRP receptor. BX-795 and BI- D1870(PDK1/RSK inhibitors) can affect the expression of CD1a,CD80CD86 and the secreation of IL-23. Conlusion Experimental evidence suggests that Langerhans cells can be isolated in vitro and maintained inactivated. CGRP can affect the immune function of Langerhans cell, PDK1/RSK signals may involved in the process.

106

2019CSID Poster communication

PO-029 Research of neuroimmunomodulation of calcitonin-gene-related peptide to plasmacytoid dendritic cells in psoriasis

Ting Liu1 Zhang Xuan1 Jiang Li2 HE Yanling1 1Department of Dermatology, Beijing Chaoyang Hospital, Capital Medical University 2Department of Dermatology, Zhongguancun Hospital

Background Stress and anxiety is one of the reason of induction and aggravation of psoriasis, suggesting that neuroimmunomodulation may play an important role in this process. Neuropeptides released from nerve endings can act on DCs, which stimulate activation to produce cytokines and present antigens to T cells, thereby activating T cells and secreting cytokines, causing abnormal proliferation and differentiation of keratinocytes, and the production of cytokines in turn promotes the maturation of DCs. The vicious circle of interaction between the three leads to the production of a chronic inflammatory environment of the skin. Neuropeptides are the important cause of this cycle while abnormalities of dendritic cells are the initial and critical factors of the cycle. The most important feature of plasmacytoid dendritic cells (pDC) is that it can secrete a large amount of type I interferon after activation, which is the initial and key factor in the early stage of psoriasis. Calcitonin gene-related peptide (CGRP) is a neuropeptide. It has been shown that the expression of CGRP in skin lesions and plasma of patients with psoriasis is significantly increased, and the number of CGRP-positive nerve fibers in local lesions is also increased. It is suggested that CGRP is involved in neuroimmune regulation during the pathogenesis of psoriasis. Objective 1. Establish a mouse psoriatic-like model induced by imiquimod, and establish a denervation model based on this to study the effect of CGRP on psoriasis-like lesions in mice.2. Using mouse imiquimod model and denervation model to explore the effect of CGRP on pDC in psoriasis-like lesions. Materials and methods 1. To construct a psoriasis-like model induced by imiquimod in BALB/c mice, and a denervation model of mice. Adjust the PASI score for erythema, scale and thickness of skin lesions, and observe the development of skin lesions; After the model, HE staining was performed on the lesion to evaluate the proliferation of epidermal cells, and the denervation model was verified by PGP9.5 using immunohistochemistry.2. The mice were divided into 5 group including normal control, imiquimod, denervation, denervation + CGRP, denervation + CGRP8-37 + CGRP. Observe the changes about phenotype，organization，expression of Ki-67 and CD31 in each group.. 107

2019CSID Poster communication

3. In the above grouping, 440c immunohistochemical staining was used to observe the change of pDC in lesions; RT-qPCR was used to detect the changes of IFN-α mRNA and TNF-α mRNA expression in lesions. The change of IFN-α secretion in lesions was detected by ELISA. Results 1. The PASI score of the modified psoriasis model induced by imiquimod in BALB/c mice peaked on day 5 and decreased after denervating. HE staining of skin lesions showed epidermal hyperkeratosis, acanthosis, dermal papilla capillary tortuation and dilatation, and cell infiltration dominated by superficial dermal lymphocytes, which were consistent with pathological changes of psoriasis. After denervation, epidermal cell proliferation decreased and PGP9.5+ nerve fibers decreased. The expression of Ki-67 and CD31 were increased after CGRP treatment. After denervating and CGRP 8-37 pretreatment, the phenotype of skin lesions in mice was reduced, and the expressions of Ki-67 and CD31 were reduced. 2. The number of pDC increased in the skin lesions of mice in the imiquimod group, decreased after denervation, increased after CGRP injection, and decreased after CGRP8-37 pretreatment. 3. The expression of TNF-α mRNA was decreased in CGRP-treated lesions.The expression level of IFN- mRNA was up-regulated by CGRP, while the up-regulation of CGRP was inhibited by the administration of CGRP 8-37 in advance. The expression of TNF- mRNA decreased after CGRP treatment，while the secretion of IFN- was increased and that of CGRP 8-37 was decreased. Conclusions 1. The establishment of a psoriatic model and a neural model induced by imiquimod in BALB/c mice was successful. Nerve fibers and CGRP promoted the formation of psoriatic lesions in mice, the proliferation of keratinocytes and dermal capillary hyperplasia. 2.CGRP can promote the formation of psoriatic lesions induced by imiquimod in BALB/c mice and increase local pDC infiltration. 3. CGRP can inhibit the expression of TNF-α mRNA in prion-like lesions induced by imiquimod in BALB/c mice, and promote the expression of IFN-α mRNA and the secretion of IFN-α.

108

2019CSID Poster communication

PO-030 Oxidative stress-induced IL-15 trans-presentation in keratinocytes contributes to CD8+ T cells activation via JAK-STAT pathway in vitiligo

Xuguang Chen1 Guo Weinan1 Chang Yuqian1 Wang Gang1 Gao Tianwen1 Li Shuli1 Liu Ling1 Li Chunying1 1Department of Dermatology, Xijing hospital, Fourth Military Medical University, Xi’an, Shaanxi, China

Oxidative stress and effector memory CD8+ T cells have been greatly implicated in vitiligo pathogenesis. However, the crosstalk between these two crucial pathogenic factors has been merely investigated. IL-15 has been regarded as an important cytokine exerting its facilitative effect on memory CD8+ T cells function in various autoimmune diseases. In the present study, we initially discovered that the IL-15 expression was significantly increased in vitiligo epidermis and highly associated with epidermal H2O2 content. In addition, epidermal IL-15 expression was mainly derived from keratinocytes. Then, we showed that oxidative stress promoted IL-15 and IL- 15Rα expression as well as IL-15 trans-presentation by activating NF-κB signaling in keratinocyte. What’s more, the trans-presented IL-15, rather than the secreted one, was accounted for the + potentiation of CD8 TEMs activation. We further investigated the mechanism underlying trans- + presented IL-15 in potentiating CD8 TEMs activation and found that the blockage of IL-15-JAK- STAT signaling could be a potent therapeutic approach. Taken together, our results demonstrate that oxidative stress-induced IL-15 trans-presentation in keratinocyte contributes to the activation + of CD8 TEMs, providing a novel mechanism by which oxidative stress initiates autoimmunity in vitiligo.

PO-031 T cell subsets in different clinical subtypes of psoriasis

Zixin Liu1 1Second Xiangya Hospital and Central South University, Changsha, Hunan, China

Objective To investigate the proportion of Th1, Th17and Treg in peripheral blood of four types of patients with psoriasis.

109

2019CSID Poster communication

Methods 1. Collect venous blood samples and clinical data of patients with psoriasis, including:34 cases of psoriasis vulgaris, 19 cases of erythrodermic psoriasis, 22 cases of arthritic psoriasis, and 16 cases of pustular psoriasis. The collected venous blood was placed in a heparin anticoagulant tube, and peripheral blood mononuclear cells (PBMC) were isolated by density gradient centrifugation. 2. Flow cytometry was used to detect the proportion of Th1, Th17 and Treg cells. The RNA was extracted by Trizol method, and the expression of RORC mRNA was detected by real-time PCR. Results 1. Flow results showed that CD4 + IFN-γ+ T cell in PBMC of patients with psoriasis vulgaris was higher than that of the normal control group (P <0.05). There was no difference in the proportion of CD4 + IFN-γ + T cells between the other three types of psoriasis patients compared with the normal control group (P>0.05). 2. The proportion of CD4+IL-17A+T cells in peripheral blood mononuclear cells of arthritic psoriasis is higher than that of psoriasis vulgaris (P <0.05), The proportion of CD4 + IL-17A + T cells in peripheral blood mononuclear cells of patients with pustular psoriasis was higher than that of psoriasis vulgaris (P < 0.05). 3. The proportion of CD25+FOXP3+T in the peripheral blood of patients with psoriasis vulgaris, erythrodermic psoriasis and pustular psoriasis was significantly lower than that of the normal control group. Conclusion Th1 cells are predominantly elevated in psoriasis vulgaris, whereas Th17 cells are most prominent in pustular psoriasis and arthritic psoriasis.

PO-032 Expression of AIM2 in TFH cells of patients with systemic lupus erythematosus and its regulation on Tfh cell differentiation

Yu feng1 1the second xiangya hospital

Background Systemic lupus erythematosus (SLE) is an autoimmune disease that occurs in women and accumulates multiple systems. Tfh cells serve as a newly discovered subset of T helper cells (CD4+ T cells), which are important supporting roles for B cell maturation and secretion of immunoglobulin (Ig). AIM2 is an inflammatory body. In recent years, several studies have shown that it is significantly increased in a variety of autoimmune diseases, and is related to the severity of the disease.

110

2019CSID Poster communication

Purpose xploring the expression of AIM2 on tfh cells in patients with lupus erythematosus Method 1. Flow cytometry: After seeking patient consent, 30 patients with SLE were collected from peripheral blood (detailed patient information to evaluate sledai), and 20 normal women's peripheral blood were collected as controls. After isolation of PBMC, CD4 and CXCR5 were stained. PD-1, AIM2 was stained after rupture, and the expression of AIM2 in CD4+CXCR5+PD- 1+ (tfh cells) was detected by flow cytometry. 2. After transfection of the plasmid, rt-PCR and flow cytometry were performed: after obtaining the consent of the patient, 30 peripheral blood samples of SLE female patients were collected, and the vector pcDNA3.1(+)-AIM2 was constructed, and the peripheral blood pbmc was isolated and CD4+ was isolated. T cells were transfected with AIM2 overexpression plasmid (with empty plasmid as control) to induce CD4+ T cells to differentiate into tfh, and flow cytometry and rt-pcr were performed 5 days later. Result 1. Flow cytometry to detect the expression of AIM2 in TFH cells. We collected 30 peripheral blood samples from women with lupus erythematosus and 20 normal women as peripheral controls. The expression of AIM2 in peripheral blood isolated from peripheral blood of patients with lupus erythematosus was significantly higher than that of normal. Human, and the expression level of AIM2 was positively correlated with the sledai score. (P=0.034) 2. Flow cytometry was used to detect the effect of AIM2 plasmid transfection on the proportion of Tfh differentiation. CD4+ T cells were isolated from peripheral blood of patients with lupus erythematosus and induced to differentiate into tfh and transfected with empty plasmid and AIM2 overexpression plasmid respectively. Compared with empty plasmid (PCDNA), AIM2 plasmid can significantly increase the proportion of Tfh after transfection (CD4). +PD-1+CXCR5+). After transfection of the AIM2 overexpression plasmid, the expression levels of the tfh markers CD4, CXCR5, and PD-1 were increased. 3.QPCR was used to detect the effect of AIM2 plasmid transfection on Tfh differentiation-related transcription factors. CD4+ T cells were isolated from peripheral blood of patients with lupus erythematosus and induced to differentiate into tfh and transfected with empty plasmid and AIM2 overexpression plasmid respectively. Compared with empty plasmid (PCDNA), AIM2 plasmid can significantly increase the proportion of Tfh after transfection (CD4). +PD-1+CXCR5+). After transfection of the AIM2 overexpression plasmid, the expression levels of the tfh markers CD4, CXCR5, and PD-1 were increased. In conclusion Compared with normal subjects, AIM2 increased expression of TFH cells in patients with lupus erythematosus.The AIM2 plasmid promotes Tfh cell differentiation.

111

2019CSID Poster communication

PO-033 The molecular mechanism of IFI44L abnormal expression in mononuclear cell and its role in pathogenesis of systemic lupus erythematosus

Shuaihantian Luo1 Zhao Ming1 Lu Qianjin1 1Hunan Key Laboratory of Medical Epigenomics

Objective We aimed to explore whether the abnormal expression of IFI44L in monocyte affect the inflammation and participate in the development of SLE. Method At first, we compared the mRNA and protein expression of IFI44L in CD14+ monocyte from SLE patients stimulated by NF-κb, STAT1, STAT3, ERK inhibitors using Real time PCR and western blot. Then, we investigated the effects of IFI44L upregulation/downregulation by transferred plasmid and siRNA. To explore the function of IFI44L affecting T cell differentiation by dendritic cell (DC) from CD14+ monocyte, we deal with DC co-cultured with naive T cells. The proportion of Th1/Th2/Th17 was detected by flow cytometry, the levels of IFN-γ, IL-4 and IL-17 were detected by real-time PCR and ELISA, and the proliferation levels of T cells were detected by CCK-8. Results Both mRNA and protein level of IFI44L were significantly elevated in CD14+ monocyte from SLE patients and those stimulated by ERK inhibitors. After transferred plasmid and siRNA, the immunoactivity changes in DC induced by monocyte differentiation including upregulation of CD80, CD86, CD40, HLA-DR, CD14, CD11c, DC antigen presentation, level of IL-12 in supernatant. After co-cultured with DC derived from CD14+ monocyte transferred plasmid and siRNA and naïve T cells, IFN-γ, IL-4, IL-17 was upregulated in DC transferred plasmid and downregulated in DC transferred siRNA. Cell proliferation level was also changed in the same way. Conclusion ERK pathway inhibit IFI44L expression and immunoactivity of DC differentiated from monocyte changed by alteration of IFI44L expression as well as co-cultured naïve T cells. IFI44L may serve as a mechanistic link between interferon-inducible genes and the pathogenesis of SLE, which may be a new target in diagnosis and treatment of SLE.

112

2019CSID Poster communication

PO-034 A preliminary screening of diagnostic markers for LN through whole blood circRNAs

Yi Zhan1 1The Second Xiangya Hospital, Central South University

Objective The differentially expressed circRNAs were screened in patients with LN. Methods 1. Total RNA in blood of 4 patients with rheumatoid arthritis, 5 normal controls, 5 non- nephrotic SLE patients and 4 lupus nephritis were extracted, and the circRNA expression was analyzed by circRNA microarray chip. 2. Cluster analysis of the expression of these circRNAs, Box Plot compares the intensity distribution of circRNA expression in all samples, the distribution of differential genes in volcano plot analysis, scatter plot to verify the correlation distribution of circRNA expression in each group. 3. The differentially expressed circRNA in microchip data of healthy populations and LN patients, LN and SLE patients, healthy populations and rheumatoid arthritis patients were analyzed and screened. Results 1. By using chip data, 971 circRNAs expression disorders were found in the LN group relative to the healthy control group (|fold change| >2, P < 0.05). There were 323 circRNAs expression disorders in the relatively healthy control group of non-nephrotic SLE patients (|fold change| >2, P < 0.05). There were 1555 circRNAs expression disorders in RA patients group compared with healthy control group (|fold change| >2, P < 0.05). However, in the LN group, there were 611 circRNAs expression disorders (|fold change| >2, P < 0.05) in the non-nephrotic SLE patients. 2. Box Plot, volcanic Plot and scatter Plot verification showed that a large number of differentially expressed genes were found in patients with LN, non-nephrotic SLE patients, patients with rheumatoid arthritis and healthy population. 3. Intersections of differentially expressed circRNAs between patients with LN and healthy control, and between LN and non-nephrotic SLE patients were obtained with 154 circRNAs, then excluding the differentially expressed circRNAs in patients with rheumatoid arthritis compared with healthy people, 6 circRNAs -- circPTTG1IP, circHERC6, circTMCC2, circEPSTI1-1, circEPSTI1-2, and circZNF577 were obtained,. Conclusion There are a large number of differentially expressed circRNAs in peripheral blood cells of patients with LN and patients without nephropathy, among which the changes in the

113

2019CSID Poster communication expression levels of circPTTG1IP, circHERC6, circTMCC2, circEPSTI1-1, circEPSTI1-2 and circZNF577 may be potential molecular markers for the clinical diagnosis of LN.

PO-035 MicroRNA-210 regulates the chemotaxis of keratinocytes to CD4+T lymphocytes

Ruifang Wu1 Zhao Ming1 Su Yuwen1 1Department of Dermatology, Hunan Key Laboratory of Medical Epigenomics, The Second Xiangya Hospital of Central South University,

Objective The crosstalk between keratinocytes and immune cells is the key point in the pathogenesis of psoriasis. It has been proved that keratinocytes in psoriatic skin lesions promote the homing of circulating activated T lymphocytes by secreting large amount of chemokines. However, the underlying molecular mechanism is still unclear. MicroRNAs (miRNAs) are involved in multiple links of psoriasis pathogenesis. Our previous study has confirmed that the expression of miR-210 was elevated in psoriatic skin lesions, especially in keratinocytes. In this study, we will investigate the role of miR-210 in regulating the chemotactic function of keratinocytes. Methods Skin specimens and peripheral blood mononuclear cells (PBMCs) were obtained from 10 patients with PV and 10 age- and sex-matched healthy subjects. mRNA levels were detected by real-time RT-PCR and protein levels were detected by ELISA or western blot. Agomir-210 and antagomir-210 were transfected into normal human epidermal keratinocytes (NHEKs) or HaCaT cells respectively, to regulate miR-210 expression. The chemotaxis of NHEKs to CD4+ T lymphocytes was detected by Trans-well experiment. Results In this study, we found that the mRNA expression of some cytokines, including CCL5, CCL20 and CXCL10 were increased significantly in skin lesions from psoriasis patients compared with normal skin. Simultaneously, the related chemokine receptors CXCR3, CCR6 and CCR5 were increased in CD4+T cells from dermal single-cell suspensions compared with that from PBMCs. Furthermore, we demonstrated that miR-210 overexpression promoted the secretion of CCL20 and CCL5 by NHEKs, enhancing the chemotaxis of NHEKs to CD4+ T lymphocytes. Interestingly, we also found that overexpression of miR-210 in HaCaT cells significantly inhibited the protein expression of FoxO3, a subtype of the forked head transcription factor that decreased in psoriatic skin lesions, indicating that FoxO3 may mediate the regulation of miR-210 on the chemotaxis of keratinocytes.

114

2019CSID Poster communication

Conclusion Our results provide a novel idea that miR-210 may regulate the chemotaxis of keratinocytes to CD4+T cells through repressing FoxO3, which makes for finding new therapeutic targets of psoriasis.

PO-036 The analyses of clinical and immunological characteristics of 62 patients with lupus erythematosus

Min Deng1 Zhou Xingyu1 Zhang Jing1 Li Yaping1 1Department of Dermatology, the Second Xiangya Hospital, Central South University

Objective To analyze the clinical characteristics, laboratory examinations and correlation of these elements in 62 patients with lupus erythematosus from our hospital, and to assess the diagnosis value of immunohistochemical detection of the expression of C3d, C4d, IgG, IgG4 and CD123 in the skin lesions in lupus erythematosus Methods 1.General data, clinical manifestations, laboratory examinations, direct immunofluorescence examination and skin lesion specimens of 62 patients diagnosed as lupus erythematosus were collected. 2. Immunohistochemistry was used to detect the expression of C3d, C4d, IgG, IgG4 and CD123 in skin lesions of lupus erythematosus. Meanwhile, the expressions of CD123 in skin lesions of 10 healthy persons and 15 patients with dermatomyositis were detected by immunohistochemistry. Results 1. The positive rates of fatigue, limb lesions and blood system damage, decreasesof C3 and C4, raisedESR, hematuria, proteinuria, anti-Sm, anti-ribosomal P protein, anti-U1-RNP, anti-histone, anti-nucleosome antibodies in patients with SLE were higher than those in patients with CLE, the difference was statistically significant (P < 0.05). The positive rate of facial lesions in patients with CLE was higher than that of patients with SLE, and the difference was statistically significant (P < 0.05).The incidence of WBC decline, anti-Sm antibody and alopecia in female patients was significantly higher than that of male patients, the difference was statistically significant (P < 0.05). 2. The complement C3 level of blood system damage in patients with lupus erythematosuswas significantly lower than that of the group without blood system damage (P < 0.01); The positive rates of anti-Sm antibody, anti-ribosomal P protein antibody and anti-nucleosome antibody in the

115

2019CSID Poster communication blood system damage group were significantly higher than those of the group without blood system damage (P < 0.05). 3. The positive rate of C3d, C4d or IgG in skin lesions by immunohistochemistry in the diagnosis of lupus erythematosuswas 77.4%. The positive rate of C3d, C4d or IgG detected by immunohistochemistry was higher than that by direct immunofluorescence detection of IgG or C3, and the difference was statistically significant (P < 0.001). 4. The expression level of CD123 in skin lesions of patients with lupus was higher than that of the normal group, and the difference was statistically significant (P < 0.001). The expression level of CD123 in skin lesions of lupus erythematosuspatients was higher than that of the dermatomyositis group, but the difference was not statistically significant (P > 0.05). The sensitivity and specificity of the expression of CD123 in skin lesions by immunohistochemistry were 50% and 80% respectively. Conclusion 1. Women with lupus erythematosusare more likely to have alopecia, WBC decline, and anti-Sm antibody than men. 2. Decreased complement C3, anti-Sm, anti-ribosomal P protein, and anti-nucleosome antibody are associated with blood system damage. 3. Immunohistochemical detection of C3d, C4d or IgG in skin lesions has important diagnostic value for lupus erythematosus, and may replace direct immunofluorescence examination in some cases. 4. Immunohistochemical detection of the expression of CD123 protein in skin lesions in lupus erythematosusis of auxiliary diagnostic value.

PO-037 Increased expression of PPARr induces the differentiation of monocytes into M2-like subset and plays a protective role in SLE

Yu Liu1 1The Second Xiangya Hospital, Central South University

Purpose Systemic Lupus Erythematosus is a kind of autoimmune diseases characterized by the production of autoantibodies and the perpetuated chronic inflammatory cascade, which leads to the damages of multiple target organs, including heart, kidneys and nervous systems. Dysregulated monocytes and the differentiated macrophages will decrease the deletion of autoantigens, present autoantigens and secret proinflammatory cytokines, which play important

116

2019CSID Poster communication roles in the development of SLE. Activated macrophages are divided into two subsets: M1 and M2 subsets. M1 subset promotes the inflammatory reactions and assists to control infections. They can produce ROS, complements, immunoglobulin receptors and proinflammatory cytokines, like IL-1β, IL-6, IL-12, IL-23 and TNF-α. LPS alone or together with Th1 cytokines IFN-γ and GM- CSF can promote the polarization of macrophages towards M1 subsets. M2 subset plays a regulatory role in inflammatory reactions and secrets anti-inflammatory cytokines IL-10 and TGF- β. Th2 cytokines IL-4 and IL-13 can induce the polarization of macrophages towards M2 subset. The balance between M1/M2 subsets determines the fate of organs in inflammation and injuries. After serious infections or inflammatory reactions, macrophages will firstly act as M1 subset and secret cytokines IL-1β, IL-12, IL-23 and TNF-α, to fight against environmental stimuli. However, it will cause tissue damage if macrophages continued to present as M1 cells. Meanwhile, M2 macrophages can secret cytokines IL-10 and TGF-β of high concentration to prohibit inflammatory reactions and promote tissue repair, reconstruction, vascular regeneration and homeostasis. Imbalance between M1/M2 subsets will lead to perpetuated inflammatory reactions and organ damages. SLE is a prominent pathogen-free inflammatory disease. An important theory in its pathogenesis is the imbalance of macrophage M1/M2, which leads to uncontrolled inflammation. The purpose of this study was to investigate the role of PPARr in regulating macrophage polarization and the pathogenesis and development of systemic lupus erythematosus. Methods Collected peripheral blood samples from SLE patients and normal controls, isolated CD14+ monocytes from peripheral blood of SLE patients and normal controls by immunomagnetic beads, detected the expression level of PPARr in CD14+ monocytes by RT- PCR and WesternBlot. Use Pam3CSK4 （ 5ug/ml ） to stimulate monocytes from healthy volunteers, use T0070907 to inhibit PPARr, detected the expression levels of CD80，CCR7，IL- 1b，IL-12 and ARG1 in monocytes through RT-PCR. Results Compared with normal controls, the expression level of PPARr has no significant difference in untreated SLE patients but increased significantly in treated SLE patients. Activation of TLR2 signaling pathway in monocytes can upregulate the expression of PPARr and ARG1, and downregulate the expression of CD80, CCR7, IL-1b, and IL-12, promote the polarization of monocytes towards M2 subsets. When PPARr was inhibited by T0070907, TLR2 activation on monocytes will increase the expression of CD80, CCR7, IL-1b, and IL-12 while decrease the expression of ARG1. Conclusion Elevated expression of PPARr could promote the polarization of monocytes towards M2 subset. Increased expression of PPARr in monocytes played a protective role in SLE patients and could be a promising and potential therapeutic target.

117

2019CSID Poster communication

118

2019CSID Poster communication

PO-038 Bioinformatics Analysis of Gene expression profile of Sjogren's syndrome

junkai guo1 ZHAO Chenglei1 ZHAO Xingwang1 WANG Juan1 Ge Lan1 Song Zhiqiang1 You Yi1 1 Southwest Hospital, Army Military Medical University

Background Sjogren's syndrome (SS) is a chronic autoimmune inflammatory disease.The aim of the study is to identify the key differentially expressed genes(DEGs) and investigate their potential pathways in the molecular process of SS by using bioinformatics methods. Methods Gene expression profile of GSE23117 and GSE127952 were selected from the gene expression Omnibus(GEO), The GEO2R online tool and the Venn diagram software were used to identify DEGs in the salivary glands of the SS patients and healthy control. The Gene ontology(GO) and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway analysis were carried out through the DAVID website. The protein-protein interaction (PPI) network of the DEGs was constructed using the STRING online tool and the Cytoscape software and the module analysis was performed. Results A total of 31 overlapping regions of DEGs were detected in SS specimens. including 28 up-regulated genes and 3 down-regulated genes, which mainly played a role in immune inflammation. KEGG analysis showed that DEGs pathway was related to Cytokine-cytokine receptor interaction, Chemokine signaling pathway, Amoebiasis and Leukocyte transendothelial migration. PPI and module analysis showed that CXCL9, CXCL11, CXCL13, CCR1, CD69, PTPRC, GPR183, MMP9 and IL10 genes were significantly enriched. Conclusion CXCL9, CXCL11, CXCL13, CCR1, CD69, PTPRC, GPR183, MMP9 and IL10 may be related to the occurrence and development of SS, and can be used as potential targets for SS treatment.

119

2019CSID Poster communication

PO-039 Altered expression of miRNA and their potential targets in plasma from patients with non-segmental vitiligo

zixian lei1 kang xiaojing1 1People’s Hospital of Xinjiang Uygur Autonomous Region, Urumqi 830001, Xinjiang, China.

Objective Vitiligo is an acquired cutaneous disease with disfiguring white spots. Autoimmune destruction of melanocytes is considered as main cause in the aetiology of vitiligo. As regulators of gene expression, miRNA have been reported to play vital roles in autoimmune disease, which can be detected in tissues, cells, and body fluids including plasma. However, the etiology and pathogenesis of vitiligo is still obscure. Based on the immunopathology of vitiligo, the purpose of the present study was to analyze the miRNA expression profiling, predict the potential targets, and explore promising novel biomarkers. Methods A total miRNA was isolated from plasma of vitiligo patients (n=25) and sex- age- matched health controls (n=25). Samples were hybridized to a miRNA Array and an immunopathology focused panel of miRNAs separately. Scatter plot, volcano plot, cluster gram, heat map and principal component analysis plots were illustrated. Samples were classified by analysis of unsupervised hierarchical clustering. Quantitative reverse transcription polymerase chain reaction (qRT–PCR) was carried out to verify the data of focused miRNAs. The predictions of potential target genes were calculated by three different databases, TargetScan, miRDB and miRTarBase. Gene ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed to assess the potential functions of predicted target genes of identified miRNAs. The protein-protein interaction network (PPI) was constructed and the module analysis was performed using STRING and Cytoscape. Results Altogether, upregulated miRNAs, including let-7e-5p, let-7g-5p, miR-15b-5p, miR-20a- 5p, miR-223-3p, miR-6089 and miR-6125 in vitiligo were identified. And that the potential functions of the miRNA target genes were explored. The top 30 differential miRNAs target genes and possible molecular functions mainly included cargo loading into vesicle, apoptotic process, endoplasmic reticulum calcium ion concentration, etc. The top 30 of KEGG pathway enrichment analysis mainly included metabolic pathways, mTOR signaling pathway and SNARE interactions in vesicular transport. Cellular response to oxidative stress, cellular response to hydrogen peroxide, AMPK signaling pathway and FoxO signaling pathway were also involved. A network analysis showed a complex regulatory pattern between the differential miRNA and its target genes. 120

2019CSID Poster communication

Conclusions The identified miRNAs and the potential target genes maybe involved in the immune pathogenesis of vitiligo. The results shade light on the understanding of autoimmune aspect of vitiligo.

PO-040 Identification of lncRNA 124090 as a stimulator of CD4+ T cells in systemic lupus erythermatosus via regulating CD40L

haihong qin1 Liu Xiao1 Xu Jinhua1 1Department of Dermatology, Huashan Hospital, Fudan University

Objective The mechanism of CD4+ T cell dysfunction in systemic lupus erythematosus (SLE) has not been fully understood. Increasing evidence showed that long noncoding RNAs (lncRNAs) can regulate immune response and take part in some autoimmune diseases such as SLE. However, little is known about the lncRNA expression and function in CD4+ T of SLE. Here we aimed to detect the profile of lncRNAs expression in lupus CD4+ T cells and explore the mechanism that how lncRNA124090 is involved in the pathogenesis of SLE. Methods The expression levels of lncRNAs and mRNAs in CD4+ T cells from SLE and healthy controls were detected by microarray. 6 differentially expressed lncRNAs were randomly chosen for validation by quantitative PCR (qPCR). Bioinformatics analysis was done to investigate the potential roles of lncRNAs. LncRNA124090 was overexpressed in CD4+T cells via lentivirus transfection. The mRNA levels of lncRNA124090 and CD40L was detected by qRT-PCR. The protein level of CD40L was detected by western-blotting, while the surface expression of CD69, CD40L, and CD23 was measured by flow-cytometry. And the IgG secretion was determined by ELISA. Results A total of 1887 lncRNAs and 3375 mRNAs were aberrantly expressed in CD4+ T cells of SLE compared to that in healthy controls. The expression patterns of 6 chosen lncRNAs were consistent between microarray data and qPCR results. Co-expression network recognized several lncRNAs as core genes including lncRNA124090. LncRNA124090 could upregulate CD40L protein level while exert little influence on CD40L mRNA level. In addition, lncRNA124090 could promote the activation of CD4+ T cells and further lead to the activation of B cells and subsequent secretion of IgG in a CD4+ T cell dependent manner. Conclusion Our results showed that the lncRNAs expression profile is altered in CD4+ T cells of SLE. Among the differentially expressed lncRNAs, lncRNA124090 might contribute to the

121

2019CSID Poster communication pathogenesis of SLE by upregulating CD40L expression and subsequently promoting CD4+ T cells activation and CD4+ T cell dependent B cell activation. This could help us further understand the pathogenesis of SLE and provide a potential target for the lupus treatment.

PO-041 Excessive miR-152-3p results in increased BAFF expression in SLE B-cells by inhibiting the KLF5 expression

Shuangyan Luo1 Lu Qianjin1 1The Second Xiangya Hospital of Central South University

Objectives The increased expression of BAFF in B cells of SLE patients caused B cell hyperstimulation and T cell hyperactivity. This study aimed to investigate the mechanisms that regulate BAFF expression in SLE B cells. Methods The miR-152-3p expression level was determined by RT-qPCR. Expression levels of CD40, CD80, and CD86 were measured by flow cytometric. A luciferase reporter assay was used to confirm that KLF5 is a direct target of miR-152-3p. ChIP-PCR and EMSA analysis were performed to confirm KLF5 directly binding to BAFF promoter. Expression levels of KLF5 and BAFF were measured by RT-qPCR and western blot. IgG concentration was assessed by ELISA. Results The results demonstrated that miR-152-3p expression was significantly increased in SLE B cells compared with normal controls, and we observed significantly increased expression levels of CD19, CD40, CD80, and CD86 in normal B cells transfected with miR-152-3p agomir, and significant decrease in these genes expression after transfected with miR-152-3p antagomir in SLE B cells. We confirmed that KLF5 is a direct target of miR-152-3p, and the up-regulated miR-152-3p leads to decreased KLF5 expression level in SLE B cells. In addition, we also found that KLF5 binds to BAFF promoter and inhibits its expression in B cells. The reduced expression of KLF5 leads to excessive BAFF expression in SLE B cells. Knock-down of miR-152-3p expression inhibited the self-reactivity of SLE B cells ， which can reduce the autoantibody production. Conclusions In SLE B cells, the increased expression of miR-152-3p plays an important role in increasing BAFF expression by inhibiting KLF5 expression. These factors cause B cell self- reactivity and autoantibody production, and participate in the disease process of SLE.

122

2019CSID Poster communication

PO-042 Transcriptome profiles revealed the cytokine stimulus response functions of Long noncoding RNAs in Systemic Lupus Erythematosus

Yi You1 1Southwest Hospital, Army Military Medical University

Background Systemic lupus erythematosus (SLE) is an autoimmune disease whose molecular pathogenesis is not well understood. The regulatory roles of long noncoding RNAs(lncRNAs) in SLE development is emerging. Methods In this study, we obtained the transcriptome profiles (RNA-seq) of peripheral blood mononuclear cells (PMBCs) from SLE patients and normal controls, as well as the tens of published RNA-seq samples. Integration and functional enrichment analysis were performed to systematically study the transcriptional change in SLE patients. Co-expression analysis was used to study the potential inflammatory related functions of lncRNAs. Results Integration analysis of these data revealed the dominant up-regulation of transcripts in SLE patients, including mRNAs and long noncoding RNAs (lncRNAs). Functional enrichment analysis also revealed the highly correlation between the up-regulated transcripts and disease. We then focused on two lncRNAs, AC007278.2 and AC007278.3, with higher expression level in SLE patients. They came from cytokine receptor gene loci in Chr2. Co-expression network revealed these two lncRNAs participated in the innate immune response and inflammatory bowel disease pathways. IL1R1 and IL18RAP were highly correlated with the two lncRNAs. By repressing the expression of AC007278.2, we clearly found it can regulate the expression of inflammatory and cytokine stimulus response related genes in trans-manner, including GNAO1, COL3A1, IL6ST, SKIL, and LIFR. Conclusion In summary, our study indicated the important regulatory role of lncRNAs in SLE pathogenesis and development, especially the two lncRNAs, which could provide novel methods for SLE diagnosis, treatment and drug screening.

123

2019CSID Poster communication

PO-043 Establishment of Discoid Lupus Erythematosus-like Skin Lesions in Mice

ALYA MOHAMMED HALKOM1 1central south university second xiang ya hospital

Discoid lupus erythematosus is a common skin manifestation in cutaneous lupus erythematosus disorders, such as systemic LE and discoid LE. The mechanism by which discoid lupus erythematosus lesions arise is not fully understood, thus the animal model, which provides mimical model of disease process, play important role in LE and medicine research. Hydrocarbon oil, more commonly known as Pristane, is an isoprenoid alkane. Over the past 15 years, it has been found that the inflammatory response to Pristanecauses a lupus-like disease in mice when it injected intraperitoneally.It is found to be responsible in inducing inflammation and enhancing immune responsiveness. It has been reported that occupational exposure to mineral oil can penetrates into the skin through a minute entry wound and rapidly spreads through the tissues lead to rheumatoid arthritis and possibly lupus. Moreover, Photosensitivity is somewhat mysterious but very well known in the skin lesions of systemic lupus erythematosus (SLE) and its subtypes such as discoid LE (DLE), neonatal LE (NLE) and subacute cutaneous LE (SCLE), and is very closely associated with the development of erythema, It has been reported that UVB irradiation accelerate the development of skin lesions and enhanced the intensity of the positive skin lupus band. Objective This study aimed to induce a DLE mouse model which is induced by Pristane combined with UVB. Methods 8 MRL/MPJ mice were randomized to 2 groups, in which group A treated subcutaneously with a single dose (0.4ml) of Pristane and group B treated subcutaneously with a single dose (0.4 ml) of PBS, after three weeks of injection, the mice of bothgroups irradiated with UVB on dorsal skin (160mJ/cm2 UVB irradiation every day for one week). After one month, we examine several autoimmune traits including skin eruptions, hematoxylin-eosin (HE) staining of skin（histopathology）,skin immunoglobulin deposits by direct immunofluorescence (IF) testing. Proteinuria, spleen size, body weight, antinuclear antibody (ANA), and anti-double stranded DNA antibody (ds-DNA) are also detected. Results Erythema skin lesions with scaling, hair loss and crust in the surface appeared in the mice group that treated with Pristane combined with UVB. In this group, Discoid lupus -like changes such as hyperkeratosis, parakeratosis, acanthosis, BMZ thickening, Follicular plugging, 124

2019CSID Poster communication

Mononuclear cell infiltration into the dermis, Vacuolar interface changes, Collagen bundles, fibrosis, vasodilatation, bleeding, or liquefaction-like changes was found and IgG depositions was not clearly observed at the dermo-epidermal junction, there was no difference of serum levels of ds-DNA antibody and ANA between pristane group and PBS group (P> 0.05). In addition, there was no significant difference in the body weight, proteinuria levels and spleen size between pristane group and PBS group (P> 0.05). Conclusion Subcutaneously injection of Pristane combined with UVB are able to induce discoid lupus -like skin lesion in MRL/MPJ Mice.

PO-044 Immune cells and proinflammatory cytokines expression in adult onset still’s disease in skin lesion

Salma Miara1 1Central South University Xiangya Second Hospital, Changsha, China

Adult-onset Still’s Disease is an inflammatory, systemic syndrome in which etiology and pathogenesis remain unclear. At present, AOSD diagnosis can be complex and very challenging in virtue of its miscellaneous clinical features and also based on exclusion of differential diagnoses that includes infectious, inflammatory, and neoplastic disorders. It is typically defined by Still’s triad of a persistent fever, skin rash, arthritis or arthralgia and it occurs worldwide, usually affecting young adults, with the age range from16 to 35 (women usually more often than men, between 60% to 75%). AOSD diagnosis is mostly based on retrospective analysis and observational studies. The aim of the treatment is controlling the symptoms and the development of the disease. The mainstay therapy of AOSD is usually with corticosteroids succeeded by disease modifying antirheumatic drugs (DMARDs) such us hydroxychloroquine, cyclosporine, azathioprine and methotrexate or with the biologic drugs including interleukin (IL-1) antagonists or tumor necrosis factor α(TNF-α) agents which are able to avert AOSD complications along with positive prognosis. Several proinflammatory cytokines have been implicated in the pathogenesis; high levels of interleukin (IL)-1, IL-6, and IL-18; macrophage colony-stimulating factor; interferon-γ; and tumor necrosis factor (TNF-α) have been detected in sera from patients with AOSD. CD4+T lymphocytes help to coordinate the immune response by producing several cytokines to provide help to B lymphocytes, and CD8+T lymphocytes. Cytotoxic cells, which are

125

2019CSID Poster communication

CD8+T cells, are now intensively studied in AOSD due to their important role in the hemophagocytic syndrome and systemic juvenile idiopathic arthritis. IL-1β upregulates cytokines, acute phase proteins, and tissue remodeling enzymes. As a key mediator of innate immunity, itis a potent pyrogen, which facilitates neutrophilic proliferation and diapedesis into inflamed tissues, which are key AOSD manifestations. Of more, it increases platelet production, which results in thrombocytosis, and promotes the production of IL-6, which in turns stimulates hepatocytes to synthesize several acute phase proteins. From all pro-inflammatory mediators implicated in AOSD, Il-18 is recognized as a crucial mediator in the pathogenesis of AOSD. It could markedly promote various inflammatory factors through stimulating IFN-γ, that itself is a dominant inducing mediator for other pro-inflammatory cytokine production along with the expression of transcription factors and adhesion molecules. The pathophysiology of AOSD, a century after its description, remains mysterious. Thus, in this study we focused on identifying new biomarkers, to better understand the pathogenesis of AOSD and provide potential targets for diagnosis and therapies. Part I: Decreased infiltrationof CD4+and CD8+T Cells in Lesions from AOSD Patients Objective To observe the frequency and distribution of CD4+ and CD8+ in AOSD patients skin lesion comparing to DM patients and Healthy controls. Materials and Method The skin tissue of AOSD, DM patients and HC (5 cases each) were collected, the paraffin-embedded sections were done, antigen retrieval, and then the application of resistance Incubation of human anti-CD4 and anti-CD8 Abs with corresponding secondary antibodies and chromogenic reagents, then they had been measured by Perkin Elmer microscope. Results Decreased Infiltration of CD4+ cells in AOSD skin lesion comparing to DM and HCs (n=5, P< 0.05).Decreased infiltration of CD8+ T cells in AOSD skin lesion comparing with DM, and no difference when comparing it to HCs (n=5, P< 0.05). Conclusion Decreased infiltration of CD4+T cell infiltration in AOSD dermis. Part II: Elevated Expression of proinflammatory cytokines in Lesions fromAOSD Patients Objective To observe the expression of pro-inflammatory cytokines in AOSD patients skin comparing to DM patients and Healthy controls. Materials and Method The skin tissue of AOSD, DM patients and HC (5 cases each) were collected, the paraffin-embedded sections were done, antigen retrieval, and then the application of resistance Incubation of human anti-IL-1beta, anti-IL-6, and anti-IL-18 Abs with corresponding secondary antibodies and chromogenic reagents, then they had been measured by Perkin Elmer microscope. Result Increased expression of IL-1beta cytokine in AOSD skin lesioncompared with those in DM patients and Healthy controls. (n=5, P < 0.001)

126

2019CSID Poster communication

· Elevated expression of IL-6 cytokine in AOSD skin lesion compared with those in DM patients and Healthy controls. (n=5, P < 0.001) · Elevated expression of IL-18 cytokine in AOSD skin lesion compared with those in DM patients and Healthy controls. (n=5, P < 0.001) Conclusion Significantly Increased expression of IL-1beta, IL-6 and IL-18 in AOSD skin lesions comparing to DM and HCs skin lesions （P < 0.001）.

PO-045 ATF6-MFN2 axis regulates mitochondrial dynamics to promote melanoma cell survival upon ER stress

Huina Wang1 Guo Weinan1 Gao Tianwen1 Li Chunying1 1Department of Dermatology, Fourth Military Medical University

Purpose Solid tumor microenvironment typically characterizes by hypoxia and deprivation of nutrients, which generally result in severe ER stress. Previous studies have shown that some cancer cells are relatively resistant to ER stress-induced cell death, ensuring the survival and progression of tumor cell under stressful circumstance, but the underlying mechanism is far from understood. Mitochondrial dynamics have been greatly implicated in determining cell fate in various diseases, including cancers. The aim of our current study was to investigate the role and mechanisms of mitochondrail dynamics in the regulation of melanoma cells survival upon ER stress. Methods Flow cytometry was performed to evaluate the cell death of melanoma cells upon ER stress inducers. Quantitative real-time PCR, Western Blot and immunofluorescence were conducted to examine the activation of three UPR pathways, the expression of mitochondrial dynamics related molecules and mitochondrial fusion and fission in melanoma cells upon ER stress. The function of MFN2 in melanoma cells upon ER stress was investigated through Flow cytometry, Cell Counting Kit-8, immunofluorescence, Western Blot and transmission electron microscope. Bioinformatics analysis, Co-IP and Western Blot were conducted to predict and confirm the E3 ligase of MFN2 upon ER stress. Results We first found that exogenous ER stress inducers TM and TG significantly induced melanoma cell death and meanwhile mitochondrial fission. Moreover, the pharmacological inhibition of mitochondrial fission by Mdivi-1 rendered melanoma cells more sensitive to ER stress-induced apoptosis. Further, we found that the down-regulation of MFN2 accounted for ER stress-induced mitochondrial fission, with its protein abundance but not the mRNA level 127

2019CSID Poster communication prominently altered, and the proteasome inhibitor MG132 suppressed the down-regulation of MFN2 under ER stress. More importantly, the knockdown of ATF6, rather than IRE1α or XBP1, rescued ER stress induced down-regulation of MFN2, increase of mitochondrial fission, as well as cell apoptosis. In addition, the up-regulation of E3 ligase March5 upon ER stress is responsible for the degradation of MFN2. Conclusion Our results demonstrated that ATF6-MFN2 axis-mediated mitochondrial dynamics acted as an intrinsic protective signaling to alleviate ER stress-induced cell death, and indicated that the inhibition of mitochondrial fission could be a potent synergic approach for melanoma treatment with ER stress inducer.

PO-046 Expression of HIF-1α, BNIP3 and LC3B in infantile hemangioma tissues

yuan Ding1 Jing lan1 Kang xiaojing1 1Department of Dermatology, Pepole`s Hospital of Xinjiang Uygur Autonomous Region, Urumqi, Xinjiang

Objective To detecte the expression of HIF-1α, BNIP3 and LC3B in infantile hemangioma tissues and to investigat the role of hypoxic-induced autophagy in the occurrence, development and resolution of infantile hemangioma. Methods The infant hemangioma tissue was surgically removed and confirmed in this case from January 2015 to January 2018 in the xinjiang autonomous region people's hospital. 30 cases of proliferative hemangioma and 30 cases of hemangioma in the resolution phase were screened according to pathological characteristics and age.Among them, there were 21 males and 39 females aged from August to 36 months, among which 30 were < 1 year old and 30 were ≥1 year old. The expression of HIF-1α,, BNIP3 and LC3B were detected by immunohistochemical SP method. Results HIF-1α, BNIP3 and LC3B were detected in the vascular endothelial cells of infantile hemangioma tissues in both groups. HIF-1α protein was mainly located in the nucleus and cytoplasm of vascular endothelial cells, and BNIP3 and LC3B were mainly located in the cytoplasm of vascular endothelial cells. The expression levels of HIF-1α, BNIP3 and LC3B in proliferative hemangioma endothelial cells were significantly higher than those in the resolution phase.The positive expression of HIF-1α appears yellow or brown-yellow granules microscopically, and is found in the cytoplasm or nucleus of vascular endothelial cells. The 128

2019CSID Poster communication positive expressions of BNIP3 and LC3B are mostly found in the cytoplasm of vascular endothelial cells. The positive expression of HIF-1α in proliferative hemangioma tissues was significantly higher than that in the resolution phase of hemangioma tissue (figure 1).The positive expression rate was 63.3% and 16.7%, respectively, with statistically significant differences (P < 0.01). The positive expression rate of BNIP3 in the proliferative hemangioma tissue was 50%, and the positive expression rate of BNIP3 in the resolution phase of hemangioma tissue was as high as 13.2% (figure 2), with statistically significant differences (P < 0.05).The positive expression of BNIP3 in the proliferative hemangioma tissues was significantly higher than thatin the resolution phase of hemangioma tissue (figure 3), and the positive expression rates were 43.3% and 6.7%, respectively, with statistically significant differences (P < 0.01). Conclusion Increased hypoxic-induced autophagy regulated by HIF-1α-BNIP3 signaling pathway in proliferative hemangioma endothelial cells may promote the occurrence of infantile hemangioma, while decreased autophagy may promote the regression of hemangioma.

PO-047 Long non-coding RNA expression identified by microarray analysis: the potential candidate biomarkers in human acral lentiginous melanoma

Haoze Shi1 Chen Hao1 1Institute of Dermatology, Chinese Academy of Medical Sciences and Peking Union Medical College, Nanjing, 210042, China.

Aim Melanoma is a rare, but fatal skin tumor, which is consisted of four main types: lentigo maligna melanoma (LMM), superficial spreading melanoma (SSM), nodular melanoma (NM), and acral lentiginous melanoma (ALM). Generally, ALM, which generally affects the palms and soles of patients, has a low incidence in white population, while occurs mainly in non-white races, such as Asian and African, and its proportion can reach to 75% of the total melanoma patients.Patients with ALM usually have a poor prognosis because it’s hard to be identified and tends to have a more advanced clinical stage or a thicker Breslow thickness. Besides, genomic instability and poor response to biological agents in ALM also contribute to its terrible outcome. Unlike BRAF mutation is the most observed aberration in SSM, KIT is the most mutated gene in ALM currently, but was only be found in 15% of patients. Therefore, finding more specific biomarkers for ALM is definitely necessary. Accordingly, to further investigate the role of lncRNAs in pathogenesis of

129

2019CSID Poster communication

ALM, we performed the gene microarray analysis to look for the potential expression patterns of lncRNAs. What’s more, we also randomly selected some lncRNAs, which were significantly higher or lower expressed to further confirm by quantitative real-time reverse transcription PCR (qRT-PCR). Our research perhaps helps to clarify the function of lncRNAs in ALM and provide a precise clue towards its therapeutic response and prognosis. Method By comparing the expression profiles of lncRNAs and mRNAs in ALM and control groups, we found that 4490 lncRNAs and 3915 mRNAs were differentially expressed in our samples. Interestingly, our findings showed no consistence with previous researches of lncRNAs related to melanoma. We attributed this to the unique property of ALM. And the most up-regulated or the most down-regulated lncRNAs and mRNAs may provide clues to clarify the molecular marker and early diagnosis of ALM. The lncRNAs selected for qRT-PCR were randomly chosen. The results of qRT-PCR were consistent with microarrays, and this implied the results of microarray analysis were reliable.We used GO enrichment analysis to identify the function of lncRNAs through the mRNAs expression patterns. Result A total of 4490 lncRNAs, 3915 mRNAs were detected to be differentially expressed in our samples. Among them, 2212 and 2278 lncRNAs were up-regulated and down-regulated respectively. And 1192 and 2723 mRNAs were up-regulated and down-regulated in these six ALM samples compared with adjacent sections, respectively. Furthermore, five randomly selected lncRNAs were validated by quantitative real-time reverse transcription PCR. Besides these, lncRNA and mRNA co-expression network and competing endogenous network analysis were also constructed. Conclusion In summary, this was the first study that revealed the lncRNA expression patterns in ALM with the assistance of microarray analysis. Through relevant analysis, we speculated that tissue development, pigmentation activity, cell adhesion activity, organelle related to melanin formation and channel activity may be involved in the pathogenesis and metastasis of ALM. Moreover, by construct the CNC network and ceRNA network, we suppose that such dysregulated lncRNAs and mRNAs play a role in tumor formation and development. And lncRNAs also act as ceRNAs to disturb the pathogenesis of ALM. These molecules may be the promising therapeutic targets to manage the patients of ALM, and further researches are still needed to explore more precise mechanisms of ALM.

130

2019CSID Poster communication

PO-048 DNA Methylation Inhibitor is a Promising Strategy on K27M-mutant Pediatric High-grade Gliomas

Lian Zhang1 1Department of Dermatology, Hunan Key Laboratory of Medical Epigenomics, Second Xiangya Hospital, Central South University

Pediatric High-grade glioma in children is a devastating disease and the leading cause of pediatric death by brain tumor, which has a 5-year survivor rate is less than 1%. Current standard of care mainly involves surgery and radiation without available chemotherapeutic agents in childhood HGG. Thus, there is an urgent need to develop new and more efficacious therapies for pHGG. Genetic and epigenetic alterations have been widely reported in pHGG, which connecting mutations in chromatin regulation, especially the most common mutations of histone H3 (H3F3A) at amino acid 27 (lysine to methionine (K27M), which highly correlated with tumor aggressiveness and poor survive of patients. This alteration represents an attractive target for diagnostic and treatment purposes. Our results have indicated that the cancer cells with mutations at K27M are extremely sensitivity to DNA hypomethylating agent (HMA) treatment because of its defects in remethylation process and maintaining gene silencing during treatment and result in prolonged anti-proliferation effects including cell inhibition, cell death, and loss of cell aggressiveness. Taken together, these results suggest that K27M-mutant pHGG could be a therapeutic target of HMA and also provide rationale for combination treatments of HMA with immune checkpoint therapies in pHGG patients.

131

2019CSID Poster communication

PO-049 DNA-PKcs mediates an epithelial-mesenchymal transition process promoting cutaneous squamous cell carcinoma invasion and metastasis by targeting the TGF-β1/Smad signaling pathway

Juan Zhang1 Jiang Hui1 Xu Dan1 Wu Wen-Juan1 He Li1 Chen Hong-Duo2 1The First Affiliated Hospital of Kunming Medical University 2No. 1 Hospital of China Medical University

Objective DNA-dependent protein kinase catalytic subunit (DNA-PKcs) has attracted extensive attention in various types of malignant tumors. However, the role of DNA-PKcs in cutaneous squamous cell carcinoma (cSCC) development has not been elucidated. In this study, we investigated the role of DNA-PKcs in cSCC and the molecular mechanisms of TGF-β1-induced cSCC progression mediated by DNA-PKcs. Methods We performed bioinformatic analysis and RT-PCR to examine the DNA-PKcs expression level in cSCC. Then, we downregulated DNA-PKcs using a DNA-PK-specific inhibitor or small interfering RNA (siRNA) to explore the effects of DNA-PKcs on SCL-1 cell migration and invasion. To further investigate the mechanism by which DNA-PKcs promotes cSCC progression, TGF-β1 and the TGF-β receptor (TGF-βR) I/II dual inhibitor LY2109761 were used to examine whether DNA-PKcs participates in TGF-β1/Smad signaling. Results DNA-PKcs expression was upregulated in cSCC. DNA-PK inhibition or expression knockdown resulted in inhibited migration and invasion and altered epithelial-mesenchymal transition (EMT) marker expression patterns in SCL-1 cells. Importantly, TGF-β1 mediated EMT induction in cSCC cells, and DNA-PKcs was identified as a TGF-β1-responsive gene. TGF-β1 promoted DNA-PKcs transcription, and DNA-PKcs enhanced the TGF-β1-induced EMT program involved in cSCC invasion and metastasis by phosphorylating Smad3. Conclusion This study is the first to show that DNA-PKcs mediates EMT to promote cSCC aggressiveness by targeting the TGF-β1/Smad signaling pathway, which provides insight into how DNA-PKcs impacts cSCC progression and identifies a new therapeutic target.

132

2019CSID Poster communication

PO-050 The effect of Chemokines in cutaneous squamous cell carcinoma treated with aminolevulinic acid-photodynamic therapy

Guolong Zhang1 Ji Jie1 Zhu Lude1 Wang Xiuli1 1Institute of Photomedicine, Shanghai Skin Disease Hospital, Tongji University School of Medicine, China

Objective To evaluate whether Chemokine enhances the immune response against cutaneous squamous cell carcinoma (cSCC) in 5-aminolevulinic acid (ALA)-mediated PDT. Methods Microarray analysis was used to select the chemokines involved in cSCC treated with ALA-PDT. The expression and transcriptional activity of CCL8 and CXCL13 were assessed by immunohistochemistry and quantitative realtime polymerase chain reaction. We investigated the effect of ALA-PDT-induced CCL8 expression on the recruitment and polarization of macrophages using immunohistochemistry, western blot and Transwell cell migration assay. The role of CCL8 and CXCL13 in ALA-PDT efficacy was also assessed in vivo. Results Microarray analysis of total 63 chemokines and their receptors showed that the expression of 21 chemokines and 13 receptors were up-regulated in cSCC after ALA-PDT; in particular, CCL8 and CXCL13 was significantly upregulated. We found that ALA-PDT enhanced CCL8 and CXCL13 expression, increased the number of macrophages in tumor. Immunohistochemistry showed that cancer-associatedfibroblasts (CAFs) may be the main source of CXCL13 upregulation in the cSCC microenvironment after ALA-PDT. Furthermore, both CCL8 CXCL13 can enhance the effect of ALA-PDT on cSCC in mice. Conclusions ALA-PDT induces CCL8 and CXCL13 expression and which play important roles in the antitumor effect of ALA-PDT for cSCC.

133

2019CSID Poster communication

PO-051 Prevalence of co-infections with other STIs in patients newly diagnosed with anogenital warts in Guangzhou, China

Liuyuan Wang1 Ynag Bin1 Sze Tso Lai2 Zhao Peizhen1 Ke Wujian1 Zhang Xiaohui1 Chen Zhengyu1 Yang Ligang1 1Dermatology hospital，Southern Medical University 2University of Oslo

Prevalence of co-infecting STIs among patients newly diagnosed with anogenital warts is under-reported. Our objective is to determine the prevalence of six common STIs, C. trachomatis (CT), N. gonorrhoeae (NG), M. genitalium (MG), genital herpes (HSV-2), HIV, and syphilis for patients visiting a sexual health clinic in Guangzhou. Demographics, sexual health and disease histories were collected at patient intake. Patients diagnosed with anogential warts (N=200) were invited to participate. We collected urine samples, and urethral, cervical, and rectal swabs to test for CT, NG, and MG, and blood samples for serological detection of HSV-2, syphilis, and HIV. Overall, 49(24.5%) men(22.22%) and women(27.71%) had a co-infection. All six STIs were present among men: CT(6.84%), NG(3.42%), MG(5.13%), HIV(4.27%), HSV- 2(4.27%), and syphilis(1.71%). Women had fewer STIs, but at higher rates: CT(13.25%), MG(6.02%) and HSV-2(8.43%). Individual men had up to two co-infections, while women had one co-infection. Chlamydia was the most common STI (men: 6.84%, women: 13.25%). Patients aged 18-25 year (35.42%) had the highest prevalence. Although opportunistic screening is often applied for high-risk groups, expansion to patients with anogenital warts in all healthcare settings would improve detection of problematic asymptomatic co-infections, thereby increasing China’s capacity to contribute towards global surveillance systems.

134

2019CSID Poster communication

PO-052 Up-regulated SIRT7 expression contributed to melanoma growth by promoting MITF expression

Shiyu Wang1 Guo Weinan1 Ma Jinyuan1 Wang Huina1 Gao Tianwen1 Li Chunying1 1Department of Dermatology, Xijing Hospital

SIRT7 is a crucial nuclear-located histone deacetylase with great implications in regulating genome stability, RNA metabolism and mitochondrial function, and its dysregulated expression and function are associated with the pathogenesis of multiple cancers. However, the role of SIRT7 in melanoma progression and the underlying mechanism are far from understood. In the present study, we first found that SIRT7 expression was prominently increased in both melanoma cell lines and tissues compared with controls. Moreover, the knockdown of SIRT7 significantly suppressed melanoma cell proliferation and colony formation, as well as potentiated oxidative stress or ER stress-induced cell apoptosis. Forwardly, we showed that SIRT7 positively regulated the expression of MITF, and MITF deficiency reversed the facilitative role of SIRT7 in promoting melanoma cell proliferation. The influence of SIRT7 on MITF expression was associated with its impact on TGF-β-SMAD4 pathway and subsequent mediation of PAX3 transcriptional function. Overall, our data demonstrated that up-regulated SIRT7 expression contributed to melanoma growth by promoting MITF expression, and targeting SIRT7 could be potent therapeutic approach for melanoma therapy.

PO-053 Prevalence of human papillomavirus infection on Patients with Condyloma Acuminatumin

Wen Hu1 Liu Xin-Mei1 Shi Yan1 Kang Xiao-Jing1 1People

Background Condyloma acuminatum (CA) is one of the most widespread sexually transmitted diseases caused by Human papillomavirus (HPV). At present, CA represents a momentous HPV disease burden worldwide. In spite of individuals with CA mainly being infected with low-risk HPV

135

2019CSID Poster communication

(LR-HPV) subtypes, there was an amplified risk of acquiring anal cancer or cervical cancer for them since they were more likely to acquire a high-risk HPV (HR-HPV). Objective To investigate the prevalence of HPV infections and geneotype distribution and the potential risk of CA individuals infected by HR-HPV subtypes in Xinjiang Province between December 2016 to December 2018. Methods A total of 1094 individuals ranging in age from 15 to 80 years were recruited, we used the HPV Genotyping Real-time PCR kit for 23 Types (HybriBio, ChaoZhou, China), included 16 HR-HPV genotypes (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 73 and 82 ) and 7 LR- HPV genotypes(HPV6, 11, 42, 43, 44, 53 and 81). Results The HPV prevalence was 67.46%, the most frequently LR-HPV subtypes were HPV-6, HPV-11, HPV-42, HPV-43, and HR-HPV subtypes were HPV-16 and HPV-58. Overall, 32.91% and 34.55% of Individuals were positive for a single and multiple HPV subtypes infections, respectively. Among the individuals infected with a single HPV subtypes, 26.11% were infected with HR-HPV subtypes, among the HPV infected with multiple HPV subtypes, 18.52% were infected with multiple HR-HR HPV subtypes. The prevalence and subtype distribution of HPV infections exhibited age differences (P=0.012), the peak in the prevalence of HPV infections was observed for patients aged 20-29 years (292/404, 72.28%). Conclusion HPV prevalence varied significantly with age in Xinjiang Province, while had little connection with race and gender. It is necessary to evaluate not only the role of the dominant LR-HPV geneotypes, but aslo probably HR-HPV genotypes which the potential risk in their possible rising incidences In CA.

PO-054 Profile of the China College Student Cohort Study of Skin Diseases in Adolescents

Minxue Shen1 Xiao Yi1 Chen Xiang1 1Xiangya Hospital Central South University

Objectives To investigate the distribution, risk factor and health-related quality of life of skin diseases in China college students. Methods A prospective cohort study was conducted in five comprehensive universities located in different regions of China. The baseline survey was conducted through health examination and on-line questionnaire survey among the first-year college students who were just enrolled to the

136

2019CSID Poster communication universities. Skin diseases were diagnosed by certificated dermatologists in the field survey. Two- level logistic regression model (participants as level-1 units and universities as level-2 units) was used to determine the risk factors of common skin diseases. Effect size was expressed as adjusted odds ratios (aORs). Results In the baseline survey in 2018, a total of 26255 students were enrolled, and 20138 underwent skin examination and completed the questionnaire survey. A total of 10863 (54%) participants were affected by significant skin diseases that may need healthcare. Moderate-to- severe acne vulgaris (10.4%), tinea (8.5%), atopic dermatitis (3.9%), hand eczema (3.6%), rosacea (3.4%), and chronic urticaria (1.9%) were most prevalent skin diseases among adolescents. Socioeconomic status was positively associated with atopic dermatitis (aOR=2.0) and chronic spontaneous urticaria (aOR=1.99), and was inversely associated with tinea (aOR=0.53). Preschool use of antibiotics was associated with higher risks of atopic and allergic diseases such as atopic dermatitis (aOR=1.40), hand eczema (aOR=1.22), history of food/drug allergies (aOR=1.28), chronic urticaria (aOR=1.38), and history of asthma (aOR=1.92) and allergic rhinitis (aOR=1.39). Passive cigarette smoke exposure ≥1 d/wk was associated with higher risks of atopic dermatitis (aOR=1.26) and hand eczema (aOR=1.57). Intake of added sugar from soft drinks ≥100 g/d was associated with higher risk of moderate-to-severe acne vulgaris (aOR=3.12). Intake of red meat ≥4 d/wk was associated with higher risks of atopic dermatitis (aOR=1.29) and chronic urticaria (aOR=1.39). Intake of yoghurt ≥4 d/wk was associated with lower risks of hand eczema (aOR=0.82) and tinea (aOR=0.69). Sedentary behavior ≥3 h/d was associated with higher risk of tinea (aOR=1.54). Overuse of facial cleanser (≥ 2 times/d) was associated with higher risk of acne (aOR=2.09). Sunscreen ≥1 d/wk was associated lower risk of acne (aOR=0.75). In addition, skin diseases such as atopic dermatitis, chronic urticaria, and psoriasis were associated with several patient-reported outcomes in relation to impaired quality of life, including itch, pain, sleep disorder, anxiety, depression, and attention deficit / hyperactivity disorder. Conclusion Skin diseases are prevalent in adolescents, and are associated with impaired quality of life and mental wellbeing. Modifiable risk factors include use of antibiotics, intake of red meat and soft drinks, passive smoke exposure, sedentary behavior, overuse of facial cleanser. Protective factors include intake of yoghurt and sunscreen.

137

2019CSID Poster communication

PO-055 Prevalence of psoriasis and its association with metabolic comorbidities in China: a population-based study

Yi Xiao1 Shen Minxue1 Jing Danrong1 Chen Xiang1 Zhu Wu1 1Xiangya hospital, Central South University

Objectives To report the prevalence and disease burden of psoriasis in China; To examine the association of psoriasis with non-communicable comorbidities. Methods Four independent population-based cohorts in China were cluster-sampled and conducted skin check-ups for all participants during 2016-2018. The diagnosis of psoriasis was evaluated by certificated dermatologists during the field study. Related demographical and clinical data were collected during the skin check-ups. PASI, Dermatology Life Quality Index(DLQI), Health utility by Time-trade-off method(TTO), Willingness-to-pay(WTP) were applied to detect the severity and burden of psoriasis. 1:1 case-control design was conducted to detect the association between psoriasis and comorbidities. The case group was diagnosed psoriasis patients and the control group is gender- and age-matched non-psoriasis participants from clustered cohorts. Demographic data and comorbidities evaluations, such as Framingham risk score(FRS) for cardiovascular disease(CVD) risk; waist circumference(WC), waist-hip-ratio(WHR) and BMI for obesity; PHQ-2&GAD-7 for depression& anxiety screening, were collected and measured. Metabolic-related biomarkers were tested. Various regressions and generalized additive model were used to assess the associations above. Results A total of 59,950 participants were participants and analyzed. The standardized prevalence rate of psoriasis is 0.44% , which is positively related to growing age (P<0.0001) and significantly diverse in different gender (Male/Female prevalence：0.57%, 0.29%，P=0.0007). There is a peak of prevalence after 60 yrs old in female psoriasis patients. DLQI of the hospital patients is significantly higher than DLQI of community patients (P<0.001). The median TTO was 0.9, 0.85 and 0.73 for mild/ moderate/ severe psoriasis, in a dose-response manner. A total of 1,517 psoriasis patients and 1,571 paired non-psoriasis participants were included in the case-control analysis.One-centimeter increment in WC and 0.01 increment in WHR is associated with 1.05 fold and 1.12 fold risk of psoriasis (P<0.001);WHR is positively associated with PASI among late-onset psoriasis (P=0.02).BMI shows a U-type association with psoriasis, where the lowest risk appears near BMI=25kg/m2.Diabetes was 2.04 fold prevalent in psoriasis compared with control (P=0.001), with 2.39 and 1.85 fold increase in early-onset and late-onset psoriasis, respectively. Every 0.01 increment in the FRS for CVD risk is associated with 1.12 fold 138

2019CSID Poster communication risk of psoriasis(P=0.01). Hypertension, dyslipidemia, hyperuricemia and depression was 1.31, 3.22, 1.33 and 1.30 fold prevalent in psoriasis patients compared to controls, respectively (P=0.015;P=0.001;P=0.048;P=0.047). Depression/ anxiety is more prevalent among late-onset psoriasis (OR=1.85,1.47; P=0.012, P=0.033). In all, the OR for psoriasis increases to 8-10 when there are two comorbidities. Conclusions The prevalence of psoriasis has been climbing to 0.44% in 2019 compared to 0.184% in 1984 with a huge gender difference. Several metabolic comorbidities were confirmed with an increased risk of psoriasis. The climbing prevalence of these comorbidities and their male-dominated epidemics in China can be an explanation for our data. WTP and TTO are suggested to detect the burden of psoriasis. Non-communicable comorbidities should be screened and integrated into the routine treatment of psoriasis.

PO-056 Socioeconomic determinants for melanoma-related health literacy and attitude in adolescents: a population-based cross-sectional study

Tianhao Wu1 1Department of Dermatology, Xiangya Hospital, Central South University

Purpose To investigate the association of socioeconomic status (SES) with health literacy of and attitudes towards the nevus and melanoma in Chinese adolescents, and to examine whether health literacy mediated the association of SES with attitude. Methods A multi-center cross-sectional study was conducted in newly enrolled college students. First-year students were recruited from five universities in different regions of China using the cluster sampling method. Health literacy and attitude were measured using a previously validated tool. SES was measured by annual family income and parental highest educational level. Two- level generalized linear model with logarithm link function and Gamma distribution was used to examine the association of SES with health literacy and attitude. Mediation effect model was used to examine the mediation effect of health literacy. Results A total of 21086 questionnaires were collected from college students whose mean age was 18.0 ± 0.8. scores of health literacy and attitude were 9.83 ± 7.46 (total score: 28) and 16.98 ± 2.92 (total score: 20), respectively. Annual family income and parental educational level were positively associated with health literacy and attitude. A mediation model showed that literacy

139

2019CSID Poster communication mediated the association of SES with the attitude towards nevus and melanoma. Health literacy mediated approximately 30–50% of the association of SES with attitude. Conclusions The health literacy of nevus and melanoma in Chinese adolescents is generally insufficient and needs to be improved. Intervention tailored for improving health literacy about nevus and melanoma may improve the general population’s attitude, and further promote health- related behavior to prevent and identify early-stage melanoma, in spite of SES.

PO-057 Night shift work in relation to chronic spontaneous urticaria and effect modification by circadian in workers

Minxue Shen1 Xiao Yi1 Huang Zhijun2 Wu Tangchun3 Tao Juan4 Chen Xiang1 1Xiangya Hospital, Central South University 2The Third Xiangya Hospital, Central South University 3School of Public Health, Tongji Medical College, Huazhong University of Science and Technology 4Union Hospital, Tongji Medical College, Huazhong University of Science and Technology

Objectives Night shift work is an established social and biological stress that has been demonstrated as a risk factor for cardiovascular diseases, mental disorders, and cancers. Night shift work may disturb the circadian clock, which regulates allergic reactions by eosinophils and mast cells. The current study aims to investigate the association of night shift work with chronic spontaneous urticaria (CSU), and effect modification by circadian in a group of workers in China. Methods A cross-sectional survey was conducted in automobile manufacture workers who were participants in the Dongfeng-Tongji Cohort Study and smelting workers who were participants the Hunan Heavy Metal and Health Study. The history and duration of rotating night shift work as exposure variables, as well as excessive daytime sleepiness and dysphylaxia as indicators for circadian dysfunction were measured by questionnaire. CSU was diagnosed by certificated dermatologists in the field survey. Two-level logistic regression model (participants as level-1 units and study sites as level-2 units) was used to determine the associations. Effect size was expressed as adjusted odds ratio (AOR) and its 95% confidence interval (CI). Results A total of 7784 participants with complete information were included in the final analysis. The prevalence of CSU was 1.07% overall; and was 0.79% among workers reported no history of night shift work, and 1.24% among those reported a history of night shift respectively. After adjustments, rotating night shift work was significantly associated with CSU (AOR=1.63; 95% CI:

140

2019CSID Poster communication

1.01–2.63; P=0.048). A 5-year increment in cumulative rotating night shift work was associated with 13% increase in the risk of CSU (aOR=1.13; 95% CI: 1.02–1.25; P=0.020). Excessive daytime sleepiness showed significant modification effect on this association. Among participants who reported no daytime sleepiness, the association of night shift with CSU was not statistically significant (AOR=0.95; 95% CI: 0.53–1.72; P=0.199); in contrast, in participants who reported excessive daytime sleepiness, the effect size of association was larger (AOR=3.39; 95% CI: 1.14–10.12; P=0.028). Conclusion Cumulative rotating night shift work was associated with the risk of CSU in a does- response manner. This association is modified by excessive daytime sleepiness, an indicator of circadian dysfunction.

PO-058 IgA vasculitis (Henoch-Schönlein purpura) and systematic involvement in children: a retrospective study of 241 patients

Liu Yang1 Nie Yingli1 Tu Yating1 Tao Juan1 1Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology

Background IgA vasculitis (IgAV), also known as Henoch-Schönlein purpura (HSP), is the most common vasculitis in children. Renal and gastrointestinal involvement frequently occur in HSP, often result in poor outcome. Objective Aim to analyze the clinical characteristics, laboratory parameters and the risk factors of children HSP with gastrointestinal and renal involvement. Methods: We performed a retrospective analysis of children HSP patients at our institution, between January 2016 and December 2017. Results A total of 241 HSP children were included, whose mean age was 9.4 ± 3.35 years old. Among them, 61.0% (n = 147) of patients revealed signs of gastrointestinal involvement, and 30.7% (n = 74) of patients revealed signs of renal involvement. The average onset age was significantly higher in gastrointestinal involvement group than in non-involvement group (9.84 years old vs 8.72 years old, P = 0.012), the same as white blood cell count (WBC) (10.52×109/L vs 8.23×109/L, P < 0.001), neutrophil granulocyte ratio (NE%) (64.20% vs 53.75%, P < 0.001) and D-dimer (D-D) (2.24 mg/L vs 1.26 mg/L, P = 0.037). Similar differences in the onset age were observed in children with renal involvement (renal involvement group vs non-involvement group:

141

2019CSID Poster communication

10.74 years old vs 8.81 years old, P < 0.001), on the contrary of complement C3 (0.91 g/L vs 0.99 g/L, P = 0.008). In further separate subgroups, the onset age > 7 years old (70.7% vs 55.3%, P = 0.014), WBC > 9.5×109/L (45.6% vs 30.9%, P = 0.023), NE% > 60% (64.6% vs 28.7%, P < 0.001), D-D > 1.5 mg/L (62.5% vs 39.3%, P = 0.039) were found significant difference between the gastrointestinal involvement group and non-involvement group. The onset age > 7 years old (75.7% vs 59.9%, P = 0.018) and C3 < 0.79 g/L (33.3% vs 11.2%, P = 0.001) were found significant difference between the renal involvement group and non-involvement group. Besides, among all patients in our study, the utilization ratio of antibiotics ranked first with a rate of 71.8%, followed by glucocorticoids with a rate of 58.5%, angiotensin converting enzyme inhibitor / angiotensin receptor blocker (ACEI / ARB) at 6.6%, and antiplatelet aggregation / anticoagulation drugs with a rate of 34.4%. In addition, children individuals with gastrointestinal involvement were more likely to have been treated with glucocorticoids therapy (74.1% vs 34.0%, P < 0.001) and hemostatic drugs (12.2% vs 2.1%, P = 0.005) than those non-involvement individuals. Children individuals with renal involvement were more likely to have been treated with ACEI / ARB (18.9% vs 1.2%, P < 0.001) than those non-involvement individuals. Conclusion In the present study, we found that the onset age > 7 years old, WBC > 9.5×109/L, NE% > 60% and D-D > 1.5 mg/L may be risk factors for gastrointestinal involvement of children HSP. The onset age > 7 years old and C3 < 0.79 g/L may be risk factors for renal involvement of children HSP (HSPN). Thus, more attention, timely and effective clinical intervention and prolonged follow-up should be taken to those individuals to reduce complications and improve prognosis. Besides, the total utilization ratio of ACEI / ARB was much lower than the proportion of HSPN, indicating that clinicians should use these drugs reasonably to treat children with HSPN.

PO-059 The study on prevalence and risk factors of acne in Chinese college students

Yan Li1 Zhu Li1 Wang Bingbing1 Tao Juan1 1 Union Hospital, Tongji Medical College, Huazhong University of Science and Technology

Objective To explore the prevalence of acne among Chinese college students, the risk factors of acne among college students, its severity, burden of disease and the socioeconomic effects. Methods Using the cluster sampling method, freshmen enrolled in 2018 of 5 comprehensive universities in China were selected, and all agreed to participate in the health check and online

142

2019CSID Poster communication questionnaire survey. Among the students, freshmen from HUST were selected to conduct further detailed evaluation of patients with moderate to severe acne. Data entry was performed using Epidata 3.1 software, and statistical analysis was performed using SPSS 23.0 statistical software. Results 1. A total of 27,114 students were enrolled in the five universities. A total of 20,138 (75.00%) valid records meeting our criteria were analyzed and the total prevalence of moderate to severe acne was 10.40%. Social demography: The geographical distribution of moderate to severe acne is statistically different（P<0.001）, male predilection is identified（aORfemale 0.47）. BMI is associated with moderate to severe acne（P<0.001）, and the mother's high school education level maybe a risk factor for moderate to severe acne（aOR 1.310，P<0.001）; Lifestyle : The intake of cattle/sheep milk 3-6 times/week（aOR 1.131，P=0.03）, the frequency of pork intake （aOR1-3d/w 1.97，aOR4-6d/w 1.225，P=0.010）maybe two risk factors for moderate to severe acne. Spicy food(aOR:0.855,0.667,0.531, P<0.001) maybe a protective factor for moderate to severe acne, and bowel habits is related to acne(P<0.001); Sunscreen & skin cleaning habits: cleansing frequency 1-2 times per day (aOR 0.496&0.802，P<0.001)maybe a risk factor for moderate to severe acne, sunscreen + physical sunscreen(aOR 0.647，P<0.001), sunscreen frequency more than 3 times a week （aOR 0.649，P=0.001）maybe protective factors; female menstrual habits: menarche age (aOR0.921，P=0.009)may be associated with moderate to severe acne, the prevalence of moderate to severe acne decreased by 8.00% for each additional year. Quality of life: Acne have an impact on the quality of life of patients, and self-care ability is affected（P=0.018）. 2. Among the 7312 freshmen enrolled in HUST, the prevalence of skin diseases was 50.50%, and the prevalence of moderate to severe acne was 9.00%. Poor disease cognition and medical treatment, unregulated treatment among college students are common, and the quality of life in severe acne and in female groups may be affected more than mild acne and male. Conclusion 1. Prevalence rate: The prevalence of moderate to severe acne among Chinese college students is 10.40%. 2.Risk Factors: Mother's high school education level, intake of cattle / goat milk, frequency of pork, cleansing frequency may be risk factors of moderate to severe acne. Eatting spicy, sunscreen + physical sunscreen and sunscreen frequency may be protective factors for moderate to severe acne; Acne prevalence varies geographically, males have significant disease predominance, BMI , bowel habits, menarche age moderate to severe acne, acne self-care ability affected. 3.Diagnosis and Treatment: Acne seriously affects the face of college students, the general diagnosis and treatment of acne are not enough, the course of disease and the severity of acne have no significant correlation, severe acne have a greater impact on the quality of life of patients ,and the impact is greater on women than that of men.

143

2019CSID Poster communication

PO-060 The prevalence of atopic and allergic diseases are associated with parental socioeconomic status in adolescents in China

Yuzhou Huang1 Xiao Yi1 Shen Minxue1 Chen Xiang1 1Department of Dermatology, Xiangya Hospital, Central South University, Changsha, China

Background Socioeconomic status (SES), an indicator of socioeconomic determinants, in studying health disparities across different populations, is often measured according to income, education level and occupation at the individual level, and is determined by diverse economic contexts at the population level. Evidences suggested that in addition to genetic-susceptibility aetiology, atopic and allergic diseases are associated with altered societal, economic and environmental determinants. In past epidemiological studies, the association of atopic and allergic diseases with socioeconomic status has been little studied. Objectives To investigate the prevalence of atopic/allergic diseases and their association with socioeconomic status in adolescents in China. Methods A cross-sectional study in five universities in different regions of China (Changsha, Wuhan, Xiamen, Urumqi, and Hohhot) was conducted. All newly enrolled students underwent questionnaire interviews, clinical examinations and dermatological examination. Diagnosis of skin diseases and enquiry about disease history were performed by certificated dermatologists, during the dermatological examination. Because the participants were newly enrolled college students, parental SES was used to represent the socioeconomic strata of their original families. Parental SES was measured primarily by annual family income. Two-level logistic regression models were used. Adjusted odds ratio (AOR) was presented as the effect size. Results A total of 20138 students consented to participate. Among atopic and allergic diseases, the highest prevalence was allergic rhinitis (11.29%), followed by atopic dermatitis (3.85%), asthma (1.5%), and chronic spontaneous urticaria (0.99%). SES was positively associated with atopic dermatitis (OR=1.98, 95% CI:1.37–2.85), chronic spontaneous urticaria (OR=1.97, 95% CI: 0.93–4.15), allergic rhinitis (OR=2.40, 95% CI: 1.93–2.98), and asthma (OR=4.21, 95% CI: 2.36– 7.52) after adjustments for age, gender, ethnicity and the random effect of study sites. Conclusions The study identifies health disparities in atopic dermatitis, chronic spontaneous urticaria, rhinitis and asthma across adolescents’ parental SES, indicating a need for a deeper understanding of the complex socioeconomic risk factors involved in atopic skin diseases and allergic diseases. Clinical dermatologists, allergists, researchers, and patients should view atopic

144

2019CSID Poster communication diseases from a broader perspective, and allergy prevention and control should be advocated at the macro level.

PO-061 Risk of recurrence for adult-onset Still’s disease: A retrospective study of 56 patients

Sheng Li1 Zheng Siting1 Tang Shunli1 Fang Hong1 Qiao Jianjun1 1Department of Dermatology, the First Affiliated Hospital, College of Medicine, Zhejiang University

Objective Adult-onset Still’s disease (AOSD) is a rare multisystem autoinflammatory disorder characterized by high spiking fever, arthralgia or arthritis, skin rash, leukocytosis, and hyperferritinemia. The prognosis of AOSD is not bad,but the relapse rate is high, from 40% to 50%. Our objectives was to retrospectively analyze the risk of recurrence for AOSD in our institute. Methods Retrospective data of patients diagnosed with AOSD in our institute during 2013-2018 were analyzed. The diagnoses were based on Yamaguchi criteria for AOSD and PRINTO diagnostic criteria for macrophage activation syndrome (MAS). All long-term follow-up data collected from outpatients’ medical reports and phone call. Results In total, 56 patients with AOSD were included in this study. The mean age of the patients was 39.2 ± 14.2 years, 37 (66.1%) was female. Rash was found in 44 (78.6%) patients and 22 (39.3%) with persistent pruritic eruptions. There were 23 (50%) cases complicated with MAS. Twenty-three patients (50%) had experienced at least 1 relapse of AOSD and factors associated with recurrences were increased lactic dehydrogenase (OR = 1.003, P = 0.044), increased creatine kinase (OR = 1.111, P = 0.032) and complicated with MAS (OR = 4.148, P = 0.014). Conclusion AOSD patients with serum elevation of lactic dehydrogenase, creatine kinase and complicated with MAS are more likely to have recurrences.

145

2019CSID Poster communication

PO-062 Intake of preserved foods and preference for salty taste in relation to atopic dermatitis: a population-based cross-sectional study

Yajia Li1 Xiao Yi2 Shen Minxue2 Wu Tangchun3 Chen Xiang2 1Department of Dermatology, Xiangya Hospital, Central South University, Changsha, China 2Xiangya Hospital，CSU 3 School of Public Health, Tongji Medical College, Huazhong University of Science and Technology

Background Intake of preserved foods and salty food are associated with increased risk of cardiovascular diseases and cancers. High-salt diet has been also demonstrated to promote the

TH2 cell differentiation in mice. However, epidemiologic evidence regarding the associations of intake of high-salt food in China (such as pickles, preserved foods) and the preference for salty taste with atopic dermatitis (AD) has not been elucidated yet. Objectives The study aims to determine the association of AD with intake of preserved foods and salty taste preference. Methods This is a cross-sectional study. A total of 10003 rural residents were recruited from communities or villages in Shiyan, Changsha, Changde, Hengyang, Zhuzhou, and Xiangxi Autonomous Region. Two-level logistic regression models with adjustments for age, gender, annual household income and frequency of common food intake were used to determine the associations. Adjusted odds ratios (aORs) were presented as the effect size. Results The prevalence of AD was significantly higher in participants who consumed preserved foods ≥1 time/week (3.0%) than those who consumed <1 time/week (2.3%). The prevalence of AD in participants who reported a moderate-to-strong preference for salty taste was significantly higher (2.4%) than those reporting a slight preference for salty taste (1.3%). After adjustment for confounding factors, intake of preserved foods (aOR=1.35; 95% CI: 1.05%–1.74%; P=0.018) and preference for salty taste (aOR=1.80; 95% CI 0.93–3.47; P=0.080) were significantly associated with a higher risk of AD. Conclusions Intake of preserved foods and preference for salty taste are associated with increased risk of AD in Chinese rural residents.

146

2019CSID Poster communication

PO-063 Cumulative lifetime arsenic exposure is associated with chronic pruritus

Xiaoyan Huang1 Xiao Yi1 Huang Zhijun2 Shen Minxue1 Chen Xiang1 1Xiangya Hospital, Central South University, Changsha, China 2The Third Xiangya Hospital, Central South University, Changsha, China

Background Chronic arsenic exposure is associated with skin lesions, diagnosed as arsenic- related skin lesions. However, the association of arsenic with pruritus has not been systematically investigated. Objectives Our study aimed to investigate the association of arsenic exposure with pruritus and to elucidate the pathogenesis among a population under lifetime arsenic exposure. Methods A cross-sectional study was conducted in Shimen, China from November 2016 to January 2017. Participants were recruited through health examination. All participants received face-to-face questionnaires interview and health examination performed by physicians and dermatologists. Blood, urine, and hair samples were collected. Numerical rating scale (NRS) was used to record the current itching intensity. Serum pruritus biomarkers including β-endorphin, histamine, substance P, nerve growth factor, 5-hydroxytryptamine, IgE, interleukin-31, enndothelin-1, gastrin releasing peptide were measured by ELISA in patients with severe itching (NRS≥7), mild itching (NRS<3) and normal controls. MicroRNA-21, microRNA-155, microRNA- 191 and microRNA-29a were measured in plasma, to mediate the association under chronic arsenic exposure. Generalized additive model, linear model, logistic model and Spearman correlation analysis were applied in appropriate situations. Results A total of 1092 participants were recruited and analyzed. Recent arsenic exposure in terms of hair arsenic showed a dose-response relationship with pruritus intensity, especially when arsenic concentration exceeded 1 μg/g. The dose-response relationship was of greater magnitude among those with arsenic-related skin lesions. Proximity measurement of previous arsenic exposure (arsenic-related skin lesions, village, and history of occupational arsenic exposure) were also significantly associated with itching intensity. Adjustments for potential confounders did not significantly alter the association of arsenic with itching. Age showed an inverted U-shape association with pruritus, and the effect peaked among those born in 1950s. Serum β-endorphin levels were markedly increased in severe itching group than mild itching and the normal, and showed a dose-respond manner with intensity of itching. No other biomarkers levels were higher in Shimen itching groups, and there were no correlations between other 147

2019CSID Poster communication biomarkers and the severity of pruritus. MicroRNA-21 levels were markedly increased in severe itching group than mild itching and the normal, and showed a dose-respond manner with intensity of itching. No other microRNAs showed the dose-respond association with pruritus. β-endorphin was positively associated with itching, and microRNA-21 was positively with β-endorphin. Conclusion Hair arsenic concentration is associated with the intensity of itching after cumulative lifetime exposure. Previous external exposure, early-life exposure, and the presence of arsenic- related skin lesions are independent risk factors for chronic pruritus. β-endorphin and microRNA- 21 were higher in itching patients and showed a dose-respond manner with intensity of itching. β- endorphin and microRNA-21 may act in the pathogenesis of arsenic related itching.

PO-064 Tinea nigra by Hortaea werneckii：Report of four cases in Hainan (China) and a review of Chinese literature

Jiejie Lu1 Zheng Wen'ai2 Tang Xiaozheng2 Li Wen1 Wu Weiwei1 1Department of Dermatology, the Fifth Peoples Hospital of Hainan Province 2Department of Laboratory Medicine, the Fifth Peoples Hospital of Hainan Province

Background Tinea nigra is a superficial mycosis caused by the dematiaceous fungus Hortaea werneckii, which was mostly observed in tropical zone. As an asymptomatic fungal infection, tinea nigra was easily overlooked. Objective The present report described epidemiology, clinical and therapeutic aspects of four confirmed cases with tinea nigra in Hainan Province of China during 2018. The epidemiology, clinical and therapeutic aspects of tinea nigra from China were analyzed retrospectively. Methods Four cases of tinea nigra were diagnosed at the Department of Dermatology, the Fifth People’s Hospital of Hainan Province, according to clinical manifestation, KOH microscopic examination, fungal culture and molecule biology method. A review of Chinese literature on the epidemiology and clinical aspects of the mycosis was presented. Results In this report, tinea nigra was more prevalent among children (there children and one adult) from 1 year to 30 years of age. All four patients had one macules, which located on palms of hands. The four obtained isolates were identified as Hortaea werneckii with the help of fungal culture and PCR analysis of rDNA ITS. All patients cured with topical treatment of ketoconazole, or terbinafine cream for 2-4 weeks.

148

2019CSID Poster communication

Conclusions We propose that tinea nigra is under-reported and widely misdiagnosed. Most of the patients in China are children which come from south of China. The lesions clear within 2-4 weeks after treatment with topical antifungal agents or keratolytic ointments.

PO-065 Analysis of cases managed by dermatological service in the Chinese Peacekeeping Level 1+ hospital in Lebanon

Xingwang Wang1 Yang Huilan1 1General Hospital of Southern Theatre

Objective For the purpose of accomplishing peacekeeping mission in Lebanon,China has deployed a Level 1+ Peacekeeping hospital due to the new MOU.The aim of this study is to analyze and review the skin diseases managed by Chinese dermatology service so as to figure out the latest prevalence of different types of skin diseases in this mission area. Method Patients registered and treated by dermatology service of Chinese Peacekeeping Level 1+hospital from Jan 2018 to May 2019 were included. A comparison analysis was made with data published by other peacekeeping medical facilities.Data was assessed by software SPSS-25. Result A total of 549 patients were included(87.4%men,with an average age of 35 years old),consisting of 399 military personnel and 150 civilians. Dermatitis and eczema(27.1%)were the most common category,followed by cutaneous mycoses(13.8%)and disorders of skin appendages(10.6%),among these categories, unspecified dermatitis (9.3%), acne vulgaris(6.6%), tinea corporis(5.3%),folliculitis(5.1%),tinea pedis(4.7%) were the top 5 most common reasons for dermatological consultation. Conclusions Skin diseases are influenced by multiple factors including climate, psychology and occupation,etc.To get a better brief understanding of the disease types profile in mission area is beneficial for peacekeeping doctors to make more accurate diagnosis,as well as to prepare more comprehensive medicines during the pre-deployment period.Dermatology service is lacked in basic medical troops,more efficient and convenient ways of consultation such as teledermatology should be addressed high importance in the future peacekeeping operations.

149

2019CSID Poster communication

PO-066 Severe cutaneous adverse reactions (SCAR): A single-center retrospective study of 173 patients in China

Xu Zhongyi1 Jie Shen2 Yiwen Yang1 Ruoyue Yuan1 Leihong Xiang1 Chengfeng Zhang1 1Department of Dermatology, Huashan Hospital, Fudan University 2Department of Cancer Prevention, Fudan University Shanghai Cancer Center

Background Severe cutaneous adverse reactions (SCAR) to drugs are a crucial public health issue and the use of systemic corticosteroids in SCAR has been controversial. Objective To analyze clinical features, causative drugs, treatment, outcomes and prognostic factors of SCAR in the case-series of 173 patients, and add more information to the debate of using systemic corticosteroids in SCAR management. Methods A retrospective study of 173 SCAR patients diagnosed with drug reaction with eosinophilia and systemic symptoms (DRESS), Stevens-Johnson syndrome/ toxic epidermal necrolysis (SJS/TEN) or acute generalized exanthematous pustulosis (AGEP) at a tertiary care institution in China between January 2014 and December 2017 was conducted. Results Of 173 patients, allopurinol, carbamazepine and antibiotics are the most frequently implicated drugs for DRESS (40%), SJS/TEN (26%) and AGEP (40%) respectively. Moreover, there is a strongly negative correlation between early corticosteroids use and the progression (P=0.000) and severity (P=0.01) of skin lesions. However, there is no association between early corticosteroids use and the mortality of SCAR [Odds Ratio: 1.01, 95% Confidence Interval: (0.95,1.08)]. In addition, lymphadenopathy, eosinophilia and interval from onset to corticosteroids treatment were correlated with SCAR prognosis. Conclusion Prompt short-course systemic corticosteroids use is associated with early-stage skin lesions remission without influencing the disease mortality. Lymphadenopathy and eosinophilia were the independent poor prognostic factors of SCAR.

150

2019CSID Poster communication

PO-067 Fusidic acid minimize the risk of inflammation and postinflammatory hyper-pigmentation after ablative fractional CO2 laser resurfacing in Chinese: A randomized, controlled trial

Min Wei1 Wang Baoxi1 1Plastic Surgery Hospital, Chinese Academy of Medical Sciences, Peking Union Medical College

Background Side effects such as postinflammatory hyperpigmentation(PIH) and inflammation challenge the treatment of ablative fractional CO2 laser for patients suffered from acne scars. Objective To evaluate the efficacy and safety of postoperative utilization of fusidic acid cream comparing with erythromycin eye ointment for patients of atrophy acne scars treated with ablative fractional CO2 laser(ablative Fr CO2). Methods Sixty Chinese patients fulfilled criterion of the study design were recruited and randomly assigned to the experimental group and controlled group, respectively using fusidic acid cream and erythromycin eye ointment postoperatively for 7days.All patients were instructed with the same way of postoperative care and asked to visit three times after therapy at 4 ,8,12 weeks.No patients dropped the study.The results including PIH, inflammation , erythema, crusting ,scaling were assessed by facial examination, photographs and questionnaires.PIH was evaluated by HASI score and a five-point scale grading system. Results Postoperative erythema at 2-3 months, crusting at 5-7days ,scaling at 7-14 days , and PIH were observed in both of the groups. However, the mean HASI score and severity of PIH in fusidic acid group were lower than the erythromycin group at 8 weeks and 12 weeks, with a statistically significance (P＜0.05).In erythromycin group,2 patients developed abscesses and papules ,whereas no inflammation was observed in fusidic acid group. Conclusion Fusidic acid cream could be a common treatment measure after the ablative FrCO2 therapy for the reduction of postoperative inflammation and PIH.

151

2019CSID Poster communication

PO-068 A comparative study of mini punch grafting with suction blister epidermal grafting in the treatment of stable vitiligo

Xiaolan Ding1 Zhao Mingfu1 Li Man1 Du Juan1 1Department of Dermatology, Peking University People’s Hospital

Background Surgical modalities have become the most important treatment for stable vitiligo. Mini punch grafting (MPG) and suction blister epidermal grafting (SBEG) are both effective methods for stable vitiligo, but there is a lack of comparison between these two procedures. Objective The purpose of this study was to compare the efficacy and safety of MPG and SBEG in stable vitiligo. Methods 23 patients with stable vitiligo were selected in this study. A single white patch larger than 2 cm2 from each patient was divided into two halves, one half was treated by MPG, while the other half was treated by SBEG (blister or dermabrasion for recipient site) followed by narrowband UVB(NB-UVB) irradiation twice a week. The repigmentation rate, relative melanin index (RMI) and relative erythema index (REI) were measured in a 3-month follow up period. Result All patients enrolled completed this 3-month trial. The repigmentation rate of grafts was 98.7% in MPG, while 98% in SBEG (blister for recipient site) and 99.3% in SBEG (dermabrasion for recipient site), with no statistical significance. The RMI and REI at different time point in MPG had no statistical difference when compared with SBEG. Cobblestone appearance was the predominant complication in SBEG both in donor sites and recipient site. For MPG, superficial scar occurred in 2 cases in recipient sites and no obvious side effects in donor sites. Conclusion Both procedures are effective for stable vitiligo, while MPG is much easier, faster with less side effects in donor site, but the depth for recipient sites should be taken into consideration.

152

2019CSID Poster communication

PO-069 Long-pulsed 1064-nm Nd:YAG laser versus cryotherapy with liquid nitrogen for the treatment of cutaneous warts: a randomised controlled trial

Jianjun Liu1 Lu Shichao1 1306 Hospital of PLA

Objective To compare the efficacy and safety of long-pulsed 1064-nm neodymium-doped yttrium aluminum garnet (LP-Nd:YAG) laser versus those of cryotherapy with liquid nitrogen for the treatment of cutaneous warts. Design A single-centre, two-arm randomised controlled trial. Setting Dermatology department of the 306 Hospital of PLA in Beijing, China. Participants Overall, 150 adult patients (≥18 years) who had common warts (largest diameter ≥1 cm or the number of warts ≥5) or who had plantar, periungual, or mosaic warts were included in the study and 121 completed the study. Interventions Participants were randomly allocated to receive LP-Nd:YAG laser or cryotherapy every 3–4 weeks (maximum of four sessions). Main outcome measures The primary outcome was the cure rate at 16 weeks since treatment initiation. Secondary outcomes included the cure rate at 6 months and recurrence rate at 12 months since treatment initiation and treatment-related adverse reactions. Results The cure rate at 16 weeks was significantly higher in the LP-Nd:YAG laser group (40/57, 70.2%) than in the cryotherapy group (35/64, 54.7%) (hazard ratio (HR), 1.59; 95% confidence interval (CI), 1.01 to 2.51; P=0.045). The between-group difference in cure rate tended to persist up to 6 months (77.2% for laser and 67.2% for cryotherapy; HR, 1.47; P=0.076), and this study found no difference in the recurrence rate at 12 months (P=1.000). Pre-specified subgroup analysis showed that the superiority of LP-Nd:YAG laser tended to be more pronounced in the treatment of warts caused by HPV 2/27/57 (HR, 2.14; 95% CI, 1.10 to 4.18) than in the treatment of warts caused by other HPV types (HR, 1.02; 95% CI, 0.48 to 2.14) (P for interaction=0.15). Further post-hoc analyses revealed that the difference in therapeutic effects between the treatments was particularly pronounced in the three subgroups of HPV 2/27/57-induced warts: periungual/mosaic warts (HR, 4.95), warts with a duration of >1 year (HR, 4.19), and warts previously treated with cryotherapy (HR, 6.08), but not in the their counterpart subgroups (HR, 1.24, 1.33, and 1.07, respectively); the corresponding P values for interaction tests were 0.04,

153

2019CSID Poster communication

0.01, and 0.07, respectively. Local adverse events were more frequent in the LP-Nd:YAG laser group; however, all are non-serious and the majority required no medical treatments. Conclusions Compared to cryotherapy, LP-Nd:YAG laser was more effective in treating cutaneous warts, particularly the relatively recalcitrant warts caused by HPV 2/27/57.

PO-070 Prevalence of and Risk Factors for Neurosyphilis in Syphilitic Patients with Persistently Positive RPR Tests

Rui Wang1 Wang Fei2 1Zhongda Hospital, School of Medicine, Southeast University 2Department of Dermatology, Zhongda Hospital, School of Medicine, Southeast University

Objective To understand the incidence of neurosyphilis and related influencing factors in syphilitic patients with persistently positive RPR tests, and to provide evidence for the early diagnosis and treatment of neurosyphilis. Methods This study was retrospectively analyzed for syphilitic patients with persistently positive RPR tests who diagnosed and(or) treated in our hospital from November 2014 to January 2019. 1. Clinical data collection The patients' gender, age, first clinical manifestations for syphilis, disease period, previous treatment of syphilis, the duration of positive RPR, etc. 2. Laboratory examination Blood tests: RPR and TPPA, T cell subsets, anti-nuclear antibody series, IgG, albumin, HIV antibody test, etc. Cerebrospinal fluid examination: cerebrospinal fluid routine tests, IgG, cerebrospinal fluid biochemistry, RPR and. TPPA. 3. Imaging examination CT, MR, MRA, etc. 4. Analysis of high risk factors of neurosyphilis Univariate and multivariate methods were used to analyze the risk factors of neurosyphilis and the risk factors of symptomatic neurosyphilis, such as the duration of positive RPR, initial RPR titers, age, gender and so on. 5. Case analysis and discussion of neurosyphilis Results 1.45 patients were enrolled in the study with slightly more men than women, the average age is 41.87±13.89 years old. The average duration of syphilis was 28.27±26.94 months, the longest was 10 years, and the shortest was 6 months. In the history of visit prostitutes, there are 24.44% patients recognized the history of visit prostitutes, and 57.78% patients are unknown.

154

2019CSID Poster communication

2. Syphilitic patients with persistently positive RPR tests their initial RPR titers are mainly concentrated between 1:8-1:32.After treatment, the RPR titers were mainly concentrated at about 1:8. Their CD3+ cell count and CD4+ cell count were significantly lower than the healthy control group(P＜0.01) . Among the 45 patients, in cerebrospinal fluid examination, there were 10 patients (22.22%) with abnormal white blood cells count, 15 patients (33.33%) with abnormal IgG index, and 22 patients (48.89%) with abnormal syphilis serum test. 3. Neurosyphilis patients were mainly male, older than non-neurosyphilis patients, and the continuous positive serum RPR titer was higher than that of non-neurosyphilis patients (P < 0.05).The CD4+ and CD3+ cell counts were significantly lower than those in the non-neurosyphilis group (P < 0.01).The age of symptomatic neurosyphilis was higher than that of asymptomatic neurosyphilis. 4.The results of imaging mainly showed the brain atrophy, multiple ischemic stenosis, brain parenchymal ischemia, cerebral hemorrhage and other imaging findings. Conclusions 1. Patients with persistent positive RPR were in the state of immunosuppression, especially those with neurosyphilis. 2. The incidence of neurosyphilis was higher in syphilitic patients with continuous higher serum RPR titer after treatment. 3. Neurosyphilis can occur in any period of syphilis, with a variety of clinical and imaging manifestations. Early diagnosis and standard treatment can achieve good therapeutic effects.

PO-071 Effects of Camouflage on the Life Quality of Patients With Vitiligo

Zhubiao Ye1 Zhang Shaolong1 Chang Yuqian1 Gao Tianwen1 Li Chunying1 1Department of Dermatology of Xijing Hospital, Fourth Military Medical University, Xi’an, Shaanxi, China

Background Vitiligo is an acquired disorder of cutaneous depigmentation that negatively affects patients’ self-esteem and quality of life. While there are numerous treatment options for vitiligo, most of these need a long time to produce good cosmetic results. Cosmetic camouflage is indispensable for patients with vitiligo and can result in an improvement of their quality of life. However, few studies have investigated its benefit for vitiligo patients in China. Objective To analyze the therapeutic effect on patients with vitiligo under camouflage treatment and lessons.

155

2019CSID Poster communication

Patients and Methods In this clinical trial, 160 patients with exposed parts of vitiligo were randomly divided into 2 groups: treated with camouflage and the routine treatment of vitiligo (case) and normal treatment only (control). All patients completed the Chinese version of the vitiligo life quality index, (VLQI-C) questionnaire. Efficacy was assessed by the scores of VLQI-C and Vitiligo Area Scoring Index scores (VASI), and the levels of CXCL10 and IFN-γ which are biomarkers in monitoring vitiligo activity at time intervals of 1, 4, 8, and 24 weeks after treatment. Results Baseline VLQI-C scores revealed no difference between these two groups. camouflage improved the scores of VLQI-C and VASI when compared with those without camouflage after 4 weeks intervention, and the ameliorative effect continued to 8 and 24 weeks. Furthermore, serum CXCL10 and IFN-γ levels were reduced more compared with the control group. Conclusions These data supported the idea that camouflage for patients with vitiligo not only covers the white patches but also improves their quality of life and curative effect. Cosmetic camouflage was well tolerated and patients with pigmentary anomalies were more likely to continue using the products.

PO-072 Symptoms, sleep disorder, mental wellbeing, and health utilities in relation to non-infectious skin diseases in college students in China

Duling Cao1 Yi Xiao1 Shen Minxue1 Chen Xiang1 1Department of Dermatology,Xiangya Hospital,Central South University

Objective The study aims to investigate and compare the symptoms of itching, pain, anxiety, depression, sleep quality, health utilities in correlation to non-infectious skin diseases in college students in China. Methods Five universities from Changsha, Wuhan, Xiamen, Urumqi and Hohhot were sampled in this cross-sectional study. Questionnaire was used to obtain the demographic information and to measure the patient-reported outcomes. Skin diseases were diagnosed and evaluated by dermatologists during the field survey. Numeric Rating Scale (NRS), 2-item Patient Health Questionnaires-2 (PHQ-2), 2-item Generalized Anxiety Disorder (GAD-2), Pittsburgh Sleep Quality Index (PSQI), and EuroQol Five-Dimensions (EQ-5D) were used to measure the symptoms of itching, pain, depression, anxiety, sleep quality, and health-related quality of life, respectively. Mixed linear model and generalized linear model were used to generate adjusted

156

2019CSID Poster communication estimates of the effect size. Demographic variables were adjusted in the models, and the effect size is expressed as mean difference or adjusted odds ratio (aOR) with 95% confidence interval (CI). Results A total of 19819 subjects were included in the final analysis after excluding participants with systemic diseases or infectious skin diseases, or having missed information on key variables. The mean scores of itching NRS, pain NRS, GAD-2, PHQ-9 and PSQI in participants with many of the skin diseases were significantly higher than those in health control (P<0.001). Psoriasis, chronic spontaneous urticaria (CSU), and atopic dermatitis (AD) and were associated with the highest risks of moderate-to-severe itch (psoriasis: aOR=6.80; AD: aOR=4.41; CSU: aOR=3.64) and pain (psoriasis: aOR=6.45; AD: aOR=2.59). AD and CSU were associated with the highest risks of sleep disorder (AD: aOR=2.03; CSU: aOR=1.79). Psoriasis, CSU and AD were associated with increased risks of anxiety (psoriasis: aOR=2.97; CSU: aOR=1.75; AD: aOR=1.74) and depression (CSU: aOR=1.90; AD: aOR=1.65). Health utilities were close between health control and those with skin diseases owing to the limited sensitivity of EQ-5D in the measurement of burden of skin disease. Conclusions Among college students in China, non-infectious diseases are associated with more severe symptoms of itching, pain, anxiety, and depression, as well as more impaired sleep quality.

PO-073 Patient-reported outcomes in relation to arsenic-related skin lesions in China

Yi Xiao1 Huang Xiaoyan1 Shen Minxue1 Chen Xiang1 1Xiangya Hospital, Central South University

Background Previous studies confirmed that chronic arsenic exposure can lead to pigmentary changes and hyperkeratosis. However, skin health-related quality of life (HRQoL) in people under arsenic exposure remains underappreciated. Our study aimed to investigate several patient- reported outcomes in a population under chronic arsenic exposure. Methods A cross-sectional study was conducted in communities under lifetime arsenic exposure. Three locations in Shimen, China were investigated. Skin examinations were performed by dermatologists. PROs included HRQoL, itch, sleep quality, and symptoms of anxiety and depression. The Dermatology Life Quality Index (DLQI) was used to measured skin HRQoL. The

157

2019CSID Poster communication intensity of itching was measured by a numerical rating scale (NRS). Sleep disturbance was measured by Pittsburgh Sleep Quality Index (PSQI). Anxiety and depression were measured by two-item Generalized Anxiety Disorder (GAD-2) and Patient Health Questionnaire (PHQ-2), respectively. Results A total of 464 participants with arsenic-related skin lesions completed the DLQI assessment. Pigmentary changes and arsenical keratosis were not associated with the patient- reported outcomes except PHQ-2. Hair arsenic exceeding 1 μg/g was associated with higher itch NRS and DLQI (P<0.05). Itch NRS (adjusted β=0.80, 95% CI: 0.70–0.90, P<0.01) and hair arsenic concentration (adjusted β=0.12, 95% CI: 0.01–0.24, P<0.05) were independently associated the DLQI. Conclusions HRQoL, sleep quality and mental wellbeing are impaired in residents under chronic arsenic exposure. Itching and hair arsenic are independent risk factors for impaired HRQoL.

PO-074 A Systematic Review and Meta-Analysis of Utility-Based Quality of Life in Chronic Spontaneous Urticaria

Yan Yuan1 Shen Mingxue1 Xiao Yi1 Chen Xiang1 1Xiangya Hospital, Central South University

Background Chronic Spontaneous Urticaria (CSU) is a common condition to treat. Health related burden analysis of health care often include patient preferences for health outcomes from the use of health utilities. Objectives To determine the pooled estimates of health utilities mapping from health-related quality of life (HRQoL) measures for patients with CSU. Methods We conducted a systematic review and meta-analysis of health utilities for patients with CSU. HRQOL scores reported with the EQ-5D, SF-6D, SF-12, SF-36 instruments were converted to utilities using published mapping algorithms. Meta-analysis was used to calculate mean utilities. Meta-regression was used to examine the effects of gender. Results We identified 12 studies reporting 17 utility estimates. From meta-analyses, the mean utility estimate for CSU was 0.65 [95% confidence interval (CI): 0.64–0.66]; the I2 statistics and Cochran’s Q test was 0.0%. We performed subgroup analyses by utility elicitation instrument. The mean utility estimate which converted from SF-36 or SF-12 questionnaires was 0.67 (95% CI:

158

2019CSID Poster communication

0.31–1.03), the mean utility estimate from ED-5D directly was 0.73 (95% CI: 0.57–0.90), and the SF-6D utility was 0.65 (95% CI: 0.64–0.66). According to the meta-regression, higher proportion of female patients was associated with lower utility estimates. Conclusions These findings provide evidence-based utility estimates to inform Health related burden analysis of CSU.

PO-075 Deep learning-based, computer-aided classifier developed with dermoscopic images shows comparable performance to 164 dermatologists in cutaneous disease diagnosis in the Chinese population

Jie Liu1 Wang Shiqi1 Zhang Xinyuan2 Tao Cui2 Zhu Chenyu1 Shu Chang1 Jin Hongzhong1 1Department of Dermatology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College 2School of Biomedical Informatics, The University of Texas Health Science Center at Houston

Background Skin diseases are often mis-diagnosed in China, due to lack of well-trained dermatologists. A deep learning-based diagnosis supporting system can facilitate overcoming these challenges. Objective To identify whether deep learning can be used to classify skin tumors and psoriasis for the Chinese population with a modest number of dermoscopic images. Methods We developed a convolutional neural network (CNN) based on two datasets of dermoscopic images. Dataset I consisted of 7,192 images for a multi-class model to differentiate three most common skin tumors and other diseases. Dataset II consisted of 3,115 images for a two-class model to classify psoriasis from other inflammatory diseases. We compared the performance of CNN with 164 dermatologists. Results The classification accuracies of the multi and two-class models were 81.49% ± 0.88% and 77.02% ± 1.81% respectively. In the comparation, the accuracies of the CNN multi and two- class models were 80.00% and 75.00%; the dermatologists achieved overall accuracies of 79.35% and 85.06%, respectively. There was no significant difference (p=0.924 and 0.171) between them. Conclusions The CNN developed with relatively small numbers of images can classify common skin tumors and psoriasis as accurately as 164 board-certified dermatologists.

159

2019CSID Poster communication

PO-076 Extensive Connective Tissue Nevus or Segmental Stiff Skin Syndrome: Analysis of Two Cases

Qiang Zhao1 Geng Songmei1 1The Second Affilicated Hospital Of Xi

Background Stiff skin syndrome (SSS) is a rare, noninflammatory, fibrotic skin disease with abnormal proliferation of collagen, often affecting limb mobility. Segmental stiff skin syndrome has been referred to as new subtype of SSS. However, the similarity and relationship between segmental SSS and extensive connective tissue nevus (ECTN) should be addressed. Objectives We aim to compare the clinical and histopathological features of segmental SSS with ECTN to address whether SSS is on the same spectrum as CTN Methods The clinical and histopathological features of two cases diagnosed as segmental SSS were analyzed and compared with five previously published cases of ECTN. The related literature was reviewed. Results Segmental SSS manifests as multiple hard plaques and nodules similar to ECTN. Common histopathology features are also shared between Segmental SSS and ECTN. Conclusions We propose that SSS may be a severe type of CTN, with segmental SSS located in the middle of the spectrum between CTN and SSS.

PO-077 Aesthetic Facial Reconstruction after removal of basal cell carcinoma by Using a“fish mouth flap”

Siqi Fu1 Long Hai1 Lu Qianjin1 1Second Xiangya Hospital

Background Basal cell carcinoma (BCC) is a slow-growing, locally invasive, malignant skin tumor. Surgical removal of tumor is the mainstay of treatment for BCC. Repair of facial buccal region BCCs must take into consideration both cosmetic and functional outcomes.

160

2019CSID Poster communication

Objective To evaluate the effectiveness of the “fish mouth flap” in the repair of BCCs in the facial buccal region. Methods & Materials From July 2013 to October 2017 our center treated 25 patients (13 male and 12 female, mean age 67 years) with BCCs in the facial buccal region which size from 1.0cm×0.8cm to 3.5cm×2.0cm. The tumors were removed with 0.3-1.0 cm extended resection, and reconstructed with a “fish mouth flap” . Results All flaps survived after operation and followed up from 6 months to 4 years. Results showed adequate flap color and texture, inconspicuous scarring, with no deformation of the lower eyelid and nose. Conclusion Overall, this method is simple to carry out, but provides a good esthetic and functional repair with adequate flap blood supply, minimal postoperative scarring, making this a promising way to repair skin defects in the facial buccal region.

PO-078 Preliminary study of urinary extracellular vesicle microRNAs as diagnostic markers for lupus nephritis

Ying Liu1 Lu Qianjin1 1The 2nd Xiangya Hospital, Central South University

The invasiveness and potential risks of kidney biopsy limit its frequent use. Therefore, screening for non-invasive diagnostic markers has important clinical significance for lupus nephritis(LN). Extracellular vesicles (EVs) can be released by virtually any type of cells into various body fluids, such as urine and incorporate a variety of biologically active molecules, including microRNA (miRNA)). Researchers demonstrate that urinary EVs contain cell-specific markers of every part of the nephron. Therefore, urinary EV miRNAs are widely used to develop biomarkers related to kidney diseases. The purpose of this study was to investigate the role of urinary EV miRNAs as biomarkers for the diagnosis of LN activity and proliferative LN. Firstly, we performed microarray analysis of miRNAs in three active lupus nephritis (AN), three active non-renal (ANR) SLE patients and three healthy controls (HC), which revealed disregulated levels of miRNAs among the groups. Furthermore, we randomly selected miR-4644, miR-1202 and miR-1207-5p for verifying the microarray results in 41 AN, 37 ANR SLE patients and 45 HC by RT-qPCR, then found that all three miRNAs were significantly up-regulated in AN.

161

2019CSID Poster communication

Through the receiver operating characteristic curve (ROC), it was found that miR-4644, miR-1202 and miR-1207-5p had a degree of evaluation value for SLE renal activity in this validation cohort. A further assessment of the evaluation value of miR-1202 for renal activity in 58 AN and 53 ANR SLE patients was found to be as specific as 100%, while the sensitivity was only 24.1%. In addition, miR-4644, miR-1202 and miR-1207-5p had significant correlations with several clinical indicators. Secondly, we used microarray to detect the expression levels of miRNAs in the kidney tissues of five proliferative lupus nephritis (Pro), five non-proliferative lupus nephritis (non-pro) patients and five HC. A large number of differentially expressed miRNAs among the groups were found, especially in the Pro compared to the non-Pro and HC. Based on this result, we hypothesized that the levels of urinary EV miRNAs could reflect the expression levels of miRNAs in kidney tissue, and further verified these differentially expressed miRNAs in 33 Pro, 17 non-pro patients and 20 HC by RT-qPCR. The levels of let-7a-5p and miR-451a were found to be significantly up-regulated in the Pro. In addition, we also added 24 cases of mixed lupus nephritis (Mix) and 36 cases of kidney disease controls (DC), found that the levels of let-7a-5p and miR- 451a were not significantly different between the Pro and the Mix, but were significantly different with the DC. Through ROC, it was found that let-7a-5p and miR-451a had high diagnostic values for the Pro. In addition, the levels of let-7a-5p and miR-451a were both significantly associated with 24-hour urine protein, and the level of miR-451a was also significantly associated with activity index (AI). This study provided a reliable and practical method for timely and clinically safe diagnosis of lupus nephritis.

PO-079 Clinical characteristics and endotype of elderly patients with atopic dermatitis

Shangshang Wang1 1huashan hospital

Objective Collect the elderly patients with atopic dermatitis（AD） and compare with children and adults patients, study their clinical and endotype characteristics, explore the pathogenesis of AD in the elderly.

162

2019CSID Poster communication

Methods 356 patients with atopic dermatitis were collected according to Hanifin-Rajka criteria, a unified questionnaire was used to investigate the clinical epidemiology of the patients. 220 patients and 60 age-and gender-matched healthy controls were examined for eosinophil count in peripheral blood, serum total IgE, specific IgE, cytokines such as IL-1beta, CD25/IL-2Ralpha, IL-4, IL-6, IL-10, IL-13, IL-17, IL-22, IL-23, IL-31, IL-33, IFN-gamma, TSLP and TARC. The expression levels of IFN-gamma, IL-4, IL-17A and IL-22 in skin lesions of 18 patients with atopic dermatitis were detected and compared with 12 healthy controls. Results (1) The clinical characteristics of elderly patients with atopic dermatitis were different from those of children and adults. The proportion of male patients and AOAD were increased significantly, while the proportion of urban/rural and the incidence of atopic diseases were reduced. In elderly patients with atopic dermatitis, facial and neck lesions decreased, trunk lesions increased, while skin lesions shifted from flexion to extension of limbs,hand lesions shifted from dorsum to palm. The proportion of AD-specific skin lesions such as cheilitis, periorbit halo and breast eczema decreased significantly in elderly patients with atopic dermatitis, while the proportion of prurigo eczema increased. (2) The serum total IgE, specific IgE and eosinophil count in elderly patients with atopic dermatitis decreased significantly, and the serum total IgE gradually decreased with the increase of age. The most common specific allergens in elderly patients were dust mites, cat hair, dog hair, Chinese sycamore, etc. The positive rate of food allergens was lower. (3) The expression of Th2 (IL-4, IL-13, TARC), Th17 (IL-17A, IL-23), Th22 (IL-6, IL-22), Treg (CD25/IL-2Ralpha, IL-10) cytokines and inflammatory factors TSLP, IL31, IL33 in the serum of atopic dermatitis patients increased significantly, while the expression of Th1 cytokines (IL-1beta, IFNgam) did not change. The levels of IL-4, TARC, TSLP were positively correlated with SCORAD scores. (4) The expression of IL-6, IL-17A and IL-22 in elderly patients with atopic dermatitis were significantly higher than that in children. The expression of IL-17A and IL-22 were also higher than that in adults and tends to increase with age. (5) The expression levels of IFN-gamma, IL-4, IL-17A and IL-22 in skin lesions of patients with atopic dermatitis were higher than those of healthy controls; the expression levels of IL-4 in elderly patients were lower than those in childhood patients, while IL-17A and IL-22 were higher. Conclusions Elderly patients with AD have relatively characteristic clinical and endotype characteristics. Th17 and Th22 inflammation have more obvious pathogenic mechanism in elderly patients.

163

2019CSID Poster communication

PO-080 First of phytopathogenic fungus Pallidocercospora crystallina- caused localized subcutaneous phaeohyphomycosis in a patient with a homozygous missense CARD9 mutation

Zhenlai Zhu1 Guo Yanyang1 Gao Jixin1 Zhang Chen1 Wang Gang1 Ma Cuiling1 Fu Meng1 1Xijing Hospital, Fourth Military Medical University

Purpose In the past decade, an increasing number of otherwise healthy individuals suffered from invasive fungal infections due to inherited CARD9 mutations. Herein, we present a patient with a homozygous CARD9 mutation who was suffering from localized subcutaneous phaeohyphomycosis caused by the phytopathogenic fungus Pallidocercospora crystallina which has not been reported to cause infections in humans. Methods The medical history of our patient was collected. P. crystallina was isolated from the biopsied tissue. To characterize this novel pathogen, the morphology was analyzed, whole- genome sequencing was performed, and the in vivo immune response was explored in mice. Whole-exome sequencing was carried out with samples from the patient's family. Finally, the expression and function of mutated CARD9 were investigated. Results A dark red plaque was on the patient's left cheek for 16 years and was diagnosed as phaeohyphomycosis due to a P. crystallina infection. Whole-genome sequencing suggested that that this strain had a lower pathogenicity. The in vivo immune response in immunocompetent or immunocompromised mice indicated that P. crystallina could be eradicated within a few weeks. Whole-exome sequencing revealed a homozygous missense mutation in CARD9 (c.1118G>C p.R373P). The mRNA and protein expression levels were similar among cells carrying homozygous (C/C), heterozygous (G/C) and wild-type (G/G) CARD9 alleles. Compared to PBMCs or neutrophils with heterozygous or wild-type CARD9 alleles, however, PBMCs or neutrophils with homozygous CARD9 alleles showed impaired anti-P. crystallina effects. Conclusion Localized subcutaneous phaeohyphomycosis caused by P. crystallina was reported in a patient with a homozygousCARD9 mutation. Physicians should be aware of the possibility of a CARD9 mutation in seemingly healthy patients with unexplainable phaeohyphomycosis.

164

2019CSID Poster communication

PO-081 Evaluation of the efficacy of 5-aminolevulinic acid photodynamic therapy in the treatment of vulvar lichen sclerosus

Zhijia Li1 Kang Zeng1 1Department of Dermatology and Venereology, Nanfang Hospital, Southern Medical University

Objective The purpose of this study was to evaluate the effects of 5-aminolevulinic acidphotodynamic therapy (ALA-PDT) on the improvement of symptoms and recurrence rate in patients with vulvar lichen sclerosus (VLS), and to observe its side effects. Methods The symptom scores before and after PDT in 14 enrolled patients with VLS were analyzed retrospectively. All patients were followed up for at least 6 months to evaluate the recurrence rate after PDT. Patients were treated with PDT only during the study period. During the PDT treatment, 20% ALA solution was covered over lesions and marginal areas for 3h, and then 635nm red light of 80 J/cm2 at 80 mW/cm2 was used to irradiate above areas for 30 minutes. Results In this study, the effective rate of PDT was 92.86%, and two patients recurred at 6 months after PDT. After PDT, the total subjective score (TSS), total objective score (TOS), Dermatological Life Quality Index (DQLI) score and Female Sexual Function Index (FSFI) score changed from 11.64, 4.71, 13.5 and 8.5 at baseline to 5.57, 2.43, 6.57 and 17.67, respectively. The difference was statistically significant (P<0.05). Most of the patients had mild local toxicity to PDT. Conclusion PDT is a safe and effective method for the treatment of VLS, and the therapeutic effects can maintain at least 3 months. The therapeutic effects may reduced during the period of 3 to 6 months after PDT.

165

2019CSID Poster communication

PO-082 Environmental conditions influencing pathogenic phenotype and genotype of Cryptococcus neoformans isolates in China

Yiwu Yu1 1Department of Dermatology, Tongji Hospital, Tongji University School of Medicine

The fungus Cryptococcus neoformans is considered the leading cause of death in AIDS patients. Despite a few molecular epidemiology studies, the relationship between environmental conditions and genotype-phenotype correlations remains unknown. In this study, we analyzed 70 C. neoformans isolates from China, which consist of 24 strains from HIV-infected patients, 39 from HIV-uninfected patients and 7 from natural environment, to determine whether environmental conditions have an effect on the genotype and pathogenic phenotype of C. neoformans isolates. The 70 C. neoformans strains were simply stratified into three groups (Non- HIV, HIV and Environmental Groups) according to their host origins and Multi-Locus Sequence Typing (MLST) was performed to genotype these cryptococcal isolates. Only one sequence type (ST5) were found in all 24 isolates of HIV group, however, the other two groups displayed more diverse in sequence types, as we identified three STs (ST2, ST5 and ST359) in the Non-HIV group and another three STs (ST2, ST5 and ST39) in the Environmental group, raising the possibility that environmental conditions may influence genotype of Cryptococcal isolates. Moreover, both in vitro and in vivo assays for characterizing the pathogenic phenotypes of these isolates suggested genotypic and phenotypic correlations. Compared to those from HIV-infected patients, strains isolated from the HIV-uninfected patients exhibited a strong increase in virulence, as we observed enhanced capsule production, melanin synthesis and mortality in a mouse model of cryptococcosis. Finally, pathogenic phenotypes of clinical isolates appear to be associated with the CD4 counts of patients, supporting an impact of environmental condition on disease outcome. Taken together, our results suggest the presence of the relationship between genotype- environment interaction and correlation to describe evolution of the pathogenic phenotypes under different environmental conditions.

166

2019CSID Poster communication

PO-083 Sensitivities of periodic acid Schiff staining, Grocott’s sliver staining and calcofluor white staining in the diagnosis of human sporotrichosis

Sha Lv1 Li Fuqiu1 1TheSecond Hospital of Jilin University

Aim This study aimed to investigate the sensitivity of periodic acid Schiff (PAS) staining, Grocott’s sliver staining (GSS ) and calcofluor white (CFW) staining in the diagnosis of sporotrichosis. Mothods The paraffin embedded tissues (n=100) which were diagnosed with sporotrichosis by fungal culture were subjected to PAS, GSS and CFW staining, and the detection rate of sporotrichosis was determined. Results The study showed that the sensitivity of PAS, GSS and CFW staining was 31%, 40% and 74%, respectively, in the diagnosis of sporotrichosis. Conclusions CFW staining has a high sensitivity in the diagnosis of sporotrichosis, and sections are easily observed and can be repeatedly stained after CFW staining. For patients suspected with sporotrichosis, CFW staining may be employed for the early diagnosis before the fungal culture.

PO-084 Susceptibility Testing of Clinical Isolates of Sporothrix globosa in Shandong China

Fangfang Bao1 Pan Qing1 Liu Hong1 Zhang Furen1 1Shandong Provincial Hospital for Skin Diseases & Shandong Provincial Institute of Dermatology and Venereology, Shandong First Medical University & Shandong Academy of Medical Sciences

Objective Compare the differences of antifungal activity in vitro between yeast and mycelial phase of Sporothrix globosa isolated from Shandong China. Methods The in vitro sensitivity of mycelium phase and yeast phase of Sporothrix globosa to anidulafungin, micafungin, caspofungin, 5-flucytosine, posaconazole, voriconazole, itraconazole, fluconazole, and amphotericin B was tested by Sensititre™ YeastOne™. The minimum inhibitory concentration (MIC) values of mycelium phase and yeast phase were calculated. SPSS 19.0 167

2019CSID Poster communication software was used to conduct non-parametric rank sum test for MIC values, and P< 0.05 was considered statistically significant. Results The mycelium phase and yeast phase were the most sensitive to terbinafine, followed by itraconazole, and the least sensitive to fluconazole. The yeast phase of the same strain was more sensitive to terbifenafine, itraconazole, voriconazole, posaconazole, micafen, arnifene and 5-fluorouracil, compared with the mycelium（P＜0.05）. However, fluconazole and amphotericin B had no significant difference in mycelium phase and yeast phase. Conclusions Itraconazole is the most active antifungal agent in vitro against S. globosa. The yeast phase of the same strain is more sensitive than that of the mycelium.

PO-085 An Sample To Answer Molecular Diagnostic System For Fungal Infection

shaohan xu1 lishu lin1 jun Lin2 lijin zheng3 yifeng shen3 1The First Affiliated Hospital of Fujian Medical University, Fuzhou, China 2 Fuzhou University, Fuzhou, China 3 Merlin (Xiamen) Biomedical Co., Ltd, Xiamen, China

Fungal infection can cause serious superficial mycoses and invasive fungal disease. Superficial mycoses are the fungal infections of the outermost keratinized layers of the skin or hair shaft, resulting in essentially no pathological changes. Trichophyton rubrum is an important pathogen for superficial mycoses, which can invade skin, nail. Real-time PCR is an effective way to detect microorganism including fungi. But current commercial product is either too expensive or too difficult to operate. We report an integrated sample to answer molecular diagnostic system “Aquilla” for fungal infection, which is very friendly for clinicians. We developed a special disposable cassette and fully automated instrument, the cassette is a closed cylinder (66mm height, 55mm diameter), with micro pipetting arm and reagent tubes build in. Magnetic beads DNA extraction reagents were loaded in DNA extraction tube, real-time PCR reagents for Trichophyton rubrum were freeze dried in the PCR tube. The cassette can be stored at 2-30°C for 12 months. The instrument has pipetting module, heating module, magnetic separation module and real-time PCR module, one 10.1-inch touch screen with analysis software based on Android OS was built in the instrument. The Aquilla system can complete DNA extraction and real-time PCR automatedly in about 60 minutes, clinicians just need to press start button after add sample in. Escherichia coli containing

168

2019CSID Poster communication

Trichophyton rubrum 28SrRNA plasmid was detected, the sensitivity is 103 cells/mL and no unspecific amplification was found. 47 nail samples were detected, 95.74% in accordance with culture (P≤0.05). The results showed that compared with current central lab molecular diagnostic system Aquilla system is easy to operate and low cost while providing accurate results, which has great value in the detection of deep fungal infection.

PO-086 Salidroside inhibits MAPK, NF-κB and STAT3 pathways against oxidative stress in psoriasis via activating SIRT1

Fengli Xu1 Xu Jixiang1 Xiong Xia1 Deng Yongqiong1 1Department of Dermatology, The First Affiliated Hospital of Southwest Medical University

Oxidative stress has always been thought to contribute much to the pathogenesis of psoriasis. High levels of ROS are produced in oxidative stress, leading the releasing of inflammatory mediators, cytokines and growth factors and eventually inducing the angiogenesis and excessive proliferation of keratinocytes. SIRT1, a member of the sirtuin family, which has been studied in the role of anti-oxidant property in psoriasis. The activation of SIRT1 inhibits MAPK, NF-κB and STAT3 pathways which involved in oxidative stress of psoriasis down- regulating the expression of inflammatory factors, and further suppressing inflammation, hyperproliferation of keratinocytes as well as angiogenesis. It has been demonstrated that salidroside exerts anti-oxidant and anti-inflammatory effects by activating SIRT1, which suggested its potential treatment for psoriasis.

169

2019CSID Poster communication

PO-087 Clinicopathological analysis of primary cutaneous CD4+ small/medium pleomorphic T-cell lymphoproliferative disorder: A retrospective study of 19 patients

Haoze Shi1 Zhang Jing2 Xiong Jingshu1 Gan Lu1 Jiang Yiqun1 Xu Xiulian1 Zhang Wei1 Zeng Xuesi1 Sun Jianfang1 Chen Hao1 1Institute of Dermatology, Chinese Academy of Medical Sciences and Peking Union Medical College 2 Central Theater General Hospital of Chinese People

Background Primary cutaneous CD4+ small/medium pleomorphic T-cell lymphoproliferative disorder (CD4+ PCSM-LPD) has been defined as a kind of lymphoproliferative disorder with indolent clinical course and excellent prognosis, yet, until now, a precise diagnosis is still hard to reach. Objective To analyze the clinical, histopathological and immunohistochemical characteristics and prognosis condition of CD4+ PCSM-LPD. And also to find some new points related to its differential diagnosis and prognosis. Methods A retrospective analysis of 19 patients including 13 female and 6 male with CD4+ PCSM-LPD was performed to analyze its clinicopathological features. Results The age of patients ranged from 5 years to 79 years. The average and median age at diagnosis were 43.89 and 43 years respectively. Two patients had multiple lesions and others were presented with a solitary asymptomatic lesion. Besides general features including diffuse or nodular dermal lymphoid infiltrate composed of small to medium-sized lymphocytes with mild to moderate atypia, unusual phenomenon of pilotropism were observed in three cases. Immunohistochemically, in addition to express CD3 and CD4, the tumor cells are positive for CD8, CD20 and CD30 to some extent. For follicular helper T-cells markers, although CXCL-13 was negative in all cases, PD-1 (11/19), BCL-6 (10/19) and CD10 (10/19) expressions were observed in most cases. Nearly all patients got an excellent prognosis. Conclusions Clinicopathological, immunohistochemistrical features of CD4+ PCSM-LPD are complex. And the biggest challenge lies in aspects like how to identify such disease accurately.

170

2019CSID Poster communication

PO-088 The Efficacy of Polycomponent Hyaluronic Acid-based Formulations on Skin Rejuvenation through Various Transdermal Delivery Methods

Daniel Meng-Yen Hsieh1 1Peking University First Hospital

Objective To compare and investigate the efficacy of polycomponent non-cross-linked hyaluronic acid formulations on skin rejuvenation through different transdermal delivery methods, such as intradermal micro-injections, microneedle roller and combination therapy. Methods In human study, 31 subjects received 3 treatments of microneedle roller delivery of non-cross-linked hyaluronic acid (MNR-NCLHA), administered 2 weeks apart and were followed up at baseline, Day 28 and Day 56 for clinical evaluations. Another group of 20 subjects underwent 3 sessions of combination therapy, MNR- NCLHA and intradermal micro-injections of NCLHA (IMJ-NCLHA), spaced 4 weeks apart and were followed up baseline, Day 28, Day 56 and Day 84. In animal study, twenty-one C57 mice were randomly divided into three groups (Group A, Group B, Group C) and received 3 sessions of treatments one week apart. In Group A, the left dorsal skin (group AL) received IMJ-NCLHA and the right dorsal skin (group AR) received a combination therapy of MNR-NCLHA and IMJ-NCLHA. In Group B, the left dorsal skin (group BL) received MNR-NCLHA and the right dorsal skin (group BR) received microneedle roller delivery of normal saline (MNR-NS). In Group C, the left dorsal skin (group CL) received intradermal micro-injections of normal saline (IMJ-NS) and the right dorsal skin (group CR) was taken as blank control. All mice were followed up for four weeks and biophysical parameters such as stratum corneum hydration, trans-epidermal water loss(TEWL) and skin elasticity were measured prior to each treatment at baseline, Day 1, Day 7, Day 14 and Day 28. Skin biopsies were obtained from the dorsal skin on Day 28 for histological analysis. Results In human studies, among patients that received MNR-NCLHA,theerythema value significantly decreased on Day 28 (P<0.05); skin gloss measurements significantly increased on Day 28 and Day 56 compared to baseline (P<0.05); skin elasticity showed no significant changes(P>0.05). Among patients that received a combination therapy of MNR-NCLHA and IMJ- NCLHA, the erythema value significantly decreased after the first treatment session (Day 28)

171

2019CSID Poster communication compared to baseline(P<0.001) and the effects continued 4 weeks after the third treatment session (Day 84, P<0.001); skin gloss significantly improved after the first treatment session compared to baseline (P<0.05); stratum corneum hydration significantly increased after the first treatment session compared to baseline(P<0.05) and the effects continued 4 weeks after the third treatment session(P<0.05); other biophysical parameters such asskin elasticity and TEWL improved after treatments but were not statistically significant. In animal study, the stratum corneum hydration showed significant increase (P<0.05) on Day 28 compared to baseline for groups AR and BL. The other sides showed no statistically significant changes (P>0.05). TEWL significantly decreased (P<0.05) for groups AL, AR, BL and CR on Day 28. Skin elasticity significantly increased for groups AL, AR and BL on Day 28. Histological analysis showed morphological improvements of the epidermis, increase in dermal thickness, collagen and elastin after treatments with polycomponent NCLHA formulations. Conclusion The study showed positive differences in several skin biophysical parameters after treatments with polycomponent NCLHA formulations through different transdermal delivery methods. Clinical improvements in skin hydration, erythema value and skin gloss, coupled with histological analysis showing synthesis of collagen and elastic fibers, suggest that mesotherapy bio-revitalization may be effective for skin rejuvenation.

PO-089 Clinical characteristics and Pathogenic Roles of IL-5 and IgE in Patients with Nonbullous Pemphigoid

Wei Wu1 Song Zhiqi1 1DaLian Medical University

Background Bullous pemphigoid (BP) is a subepidermal autoimmune bullous disease that typically presents with tense bullae and severe pruritus. However, more than 20% of patients with BP do not present with typical skin blistering, but with a pruritic nonbullous variant consisting of erythematous urticarial plaques, eczematous lesions, papules and nodules, or only excoriations, which is a subtype termed nonbullous pemphigoid. Objective To investigate the clinical characteristics of nonbullous pemphigoid so that to strengthen the awareness of such atypical variant hoping to be conducive to raise the early diagnosis rate. To preliminary explore the possible pathogenic mechanisms of nonbullous pemphigoid that may contribute to the obvious differences from the presentation of BP.

172

2019CSID Poster communication

Methods Disease activity was measured according to the Bullous Pemphigoid Disease Activity Index (BPDAI).Serum samples from 2 cohorts of patents: patients with BP and patients with nonbullous pemphigoid, were assayed respectively for IL-5 and anti-BP180-NC16A IgE antibodies reactivity with ELISA and their correlation with the clinical disease activity were assessed separately. Results 1. Of the 12 patients with nonbullous pemphigoid, 6 were males (50%) and 6 were females (50%) with mean age of 77.08±4.76 years. Of the16 patients with BP, 7 were males(43.8%) and 9 were females (56.2%) with mean age of 77.50±9.35 years. 8 of 12 patents (83.3%) in cohort of nonbullous pemphigoid had eosinophilia, while it was 9 of 16 patents (56.3%) in cohort of BP. 2. Serum level of anti-BP180-NC16A IgE antibodies correlates with disease activity in patients with nonbullous pemphigoid (r = 0.879, p = 0.049) but not in patients with BP. 3. Serum level of IL-5 correlates with disease activity in patients with nonbullous pemphigoid (r = 0.595, p = 0.041) but not in patients with BP. 4. Level of eosinophils in peripheral blood correlates with disease activity in patients with nonbullous pemphigoid (r = 0.691, p = 0.013) but not in patients with BP. 5. Serum level of IL-5 correlates with the level of eosinophils in peripheral blood in patients with nonbullous pemphigoid (r = 0.757, p = 0.004) but not in patients with BP. 6. Serum level of anti-BP180-NC16A IgE antibodies correlates with the level of eosinophils in peripheral blood in patients with nonbullous pemphigoid (r = 0.944, p = 0.016) but not in patients with BP. Conclusion Nonbullous pemphigoid is an underdiagnosed variant of pemphigoid that most often does not evolve to bullous lesions. Greater awareness among physicians is needed to avoid delay in diagnosis. Our data give evidence for a pivotal role of IL-5 and anti-BP180-NC16A IgE antibodies in the pathophysiology of nonbullous pemphigoid.

173

2019CSID Poster communication

PO-090 The expression of GATA3、E-cadherin and β-catenin in extramammary paget’s disease

Yuanyuan Chai1 1Zhongda Hispital, Southeast University

Objective To detect the expression of GATA3, E-cadherin and β-catenin in the pathological tissues of patients with EMPD, and analyze the clinical significance and relationship of GATA3, E- cadherin and β-catenin in the pathogenesis and metastasis of EMPD, and provide new tumor markers for the diagnosis and prognosis of EMPD. Methods This study analyzes 33 patients with primary EMPD who were diagnosed by pathological examination at the ZhongDa Hospital Southeast University, Nanjing Drum Tower Hospital and Wuxi Xishan People's Hospital from January 2010 to October 2018. 1. Immunohistochemistry: Immunohistochemical method was used to detect the expression of GATA3, E-cadherin and β-catenin in the pathological tissues from 33 cases of extramammary Paget's disease and 25 cases of normal foreskin skin of healthy men. 2. Statistical analysis: Combined with clinical and pathology, the data were analyzed by statistical methods using SPSS19.0 software. It was considered that P<0.05 was statistically significant. Results Immunohistochemistry 1 The expression of GATA3 in EMPD The positive expression of GATA3 was mainly located in the nucleus. 33 cases were positively expressed in EMPD group, among which the high expression rate was 78.8% (26/33). In the normal control group, 21 cases were positive and 4 cases were negative, and the high expression rate was 12%. 3/25). The difference in expression was statistically significant (P < 0.05). There was no significant correlation between the expression of GATA3 and age, gender, dermal infiltration and lymph node metastasis in patients with EMPD (P>0.05). 2 The expression of E-cadherin in EMPD The positive expression of E-cadherin was mainly located on the cell membrane. In the EMPD group, 29 cases were positive, 4 cases were negative, of which the high expression rate was 36.4% (12/33). In the normal control group, 25 cases were positive, and the high expression rate was 100%. The difference in expression between the two was statistically significant (P<0.05). The expression of E-cadherin was not significantly correlated with age, gender and

174

2019CSID Poster communication lymph node metastasis of EMPD patients (P>0.05), but was significantly correlated with dermal invasion of EMPD (P<0.05). 3 The expression of β-catenin in EMPD The positive expression of β-catenin was mainly located on the cell membrane. In the EMPD group, 27 cases were positive, 6 cases were negative, of which the high expression rate was 57.5% (19/33); the normal control group was positive in 25 cases, and the high expression rate was 100%. The expression between the two groups was statistically significant (P< 0.05). There was no significant correlation between the expression of β-catenin and age, gender, dermal infiltration and lymph node metastasis in patients with EMPD (P>0.05). 4 Correlation between E-cadherin and β-catenin expression in EMPD The expression of E-cadherin and β-catenin was positively correlated in the pathological tissues of patients with EMPD (r=0.490, P< 0.01). Conclusion 1. GATA3 is highly expressed in tumor tissues of patients with primary EMPD and may be used as one of the sensitive tumor markers of EMPD for the auxiliary diagnosis of EMPD. 2. E-cadherin expression in tumor tissues of patients with invasive EMPD is significantly decreased, suggesting that it can be used as a prognostic indicator to evaluate whether tumor metastasis occurs.

PO-091 Dermoscopy and pathology relationship in seborrheic keratosis

Xiangjie An1 Gao Yaoying Tao Juan 1Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology

Background Making a definitive diagnosis of seborrheic keratosis (SK) can be challenging for the naked eye due to its wide variation in clinical features. Dermoscopy, as a non-invasive diagnostic method, avoids unnecessary biopsies. However, there are still some cases of skin cancers that mimic SK or when skin cancers arise in association with SK. Even under dermoscopy, the conditions of “false-positive” and “false-negative” tumors do exist. False-positive diagnosis usually leads to unnecessary excisions. False-negative diagnosis is much more dangerous, as it might result in overlooking a cancer, with severe undesirable consequences for the patient and the physician.

175

2019CSID Poster communication

Objective To evaluate the relationship between dermoscopic patterns and the histopathological structures in a series of 50 cases. Method A consecutive series of 50 cases were prospectively included. All the lesions were imaged with dermoscopy, analysed for dermoscopic patterns and features. An independent blinded histopathological diagnosis as well as dermoscopic diagnosis was made for each lesion. Result In the 50 pathology-proven cases, 36 cases (72%) were diagnosed as SK clinically and 46 cases (92%) were diagnosed with SK by dermoscopy. Dermoscopy could improve the diagnostic accuracy of seborrheic keratosis by 20%. Most cases of SK exhibit the typical dermoscopic findings of fissures and ridges, hairpin vessels with white halo, comedo-like openings, and milia-like cysts. Histopathologically, these dermoscopic characteristics correspond to papillomatous surface of the epidermis, enlarged capillaries of the dermal papillae, pseudohorn cysts in the epidermis opened to the surface of the lesion and intraepidermal cysts, respectively. The reasons for misdiagnose cases are ulceration after the fiction and highly melanin of the lesion. However, due to limited cases, Irritated type and lichen planus-like keratosis type were not included in this study. Conclusion Dermoscopy could improve the diagnostic accuracy of seborrheic keratosis. Hyperkeratotic pattern, acanthotic pattern and reticulated pattern under dermoscopy correlate to hyperkeratosis/ papillomatous type, acanthotic and adenoid type and plat type in pathology, respectively. Large numbers of cases should be recruited in the following research.

PO-092 Evaluation of human papillomavirus DNA detection-guided aminolaevulinic acid-mediated photodynamic therapy for the treatment of condyloma acuminate

JingYing Wang1 Li Songshan1 Li Junpeng1 Zeng Kang1 1Nanfang Hospital, Southern Medical University

Objective Aminolaevulinic acid-mediated photodynamic therapy (ALA-PDT) is used to treat condyloma acuminata (CA), yielding a high clearance rate and low recurrence rate. Consecutive human papillomavirus (HPV) DNA detection can be used to dynamically monitor the therapeutic efficiency of PDT. Here, we aimed to evaluate the efficacy of ALA-PDT in the context of different HPV infection states using HPV DNA detection as an indicator of the treatment endpoint in patients with CA

176

2019CSID Poster communication

Methods One hundred thirty-eight patients with HPV infection and visible anogenital warts were enrolled. Microwave or radiofrequency was used to remove visible lesions before PDT. HPV DNA detection was performed using real-time polymerase chain reaction before each PDT session and at follow-up. Treatment was halted after the patient showed two negative results for HPV DNA detection in a row. Results In the 138 patients enrolled in the study, HPV-6 was the most prevalent type of low-risk (LR)-HPV infection, followed by HPV-11. HPV-52, HPV-16, and HPV-58 were three of the most common types of high-risk (HR)-HPV infection. The perianal area was the most susceptible infection site followed by the penis, vulva, and cervix. In 72 individuals who completed treatment, multi-site HPV infected patients required more sessions of PDT than single-site infected patients to reach the endpoint of treatment. Compared with patients with only external CA, individuals with internal CA required more sessions to eliminate HPV infection. The total number of PDT sessions performed in the multi-type HPV-infected group was significantly higher than that in the single- type infected group. Patients with non-HR-HPV infection required fewer PDT sessions than those with HR-HPV infection by the end of treatment. Sixty-nine patients were followed-up for at least 6 months, only 2.9% of whom showed recurrence. Conclusions Combined ALA-PDT and HPV DNA detection was an effective strategy for the treatment of CA. Ending ALA-PDT after obtaining two consecutive negative results of HPV DNA detection could achieve a lower recurrence rate than that in patients who only accepted three or six sessions of PDT, regardless of the results of HPV DNA detection. Patients with multi-site and multi-type HPV infection required more PDT sessions to eliminate the virus, particularly those suffering from internal CA or HR-HPV infection.

PO-093 The combined effect of Anti-acne Oil-control Essence with traditional medicine in the treatment of facial acne vulgaris.

Huiwen Yu1 Bai Bingxue1 1The 2nd affiliated hospital of Harbin Medical University Objective Acne is a common chronic skin disease and treatment for facial acne has yet to be studied. And no single treatment is satisfactory. The aim of this study is to analyze the combined effect of Anti-acne Oil-control Essence with traditional medicine in the treatment of facial acne vulgaris. Methods A total of 86 patients with acne were included in this study. They were divided into two groups: experimental group (43 cases, traditional treatment combined with the application of Anti-acne Oil-control Essence) and control group 177

2019CSID Poster communication

(43 cases, traditional treatment). Effect was measured by recording subject clinical scores ,adverse effects and patients' satisfaction. Results The total effective rate of the experimental group was 76.74% higher than that of the control group (P < 0.05).The recurrence rate of the experimental group was 11.63%, significantly lower than that of the control group after 2 months of treatment (P < 0.05).In addition, the total satisfaction of the experimental group was slightly higher (88.37%) than that of the control group (76.70%), with no significant difference (P >0.05). Conclusion Anti-acne Oil-control Essence combined with traditional medicine appears to be effective in the treatment of facial acne vulgaris.

PO-094 Retrospective analysis of ten papulopustular rosacea cases treated with oral minocycline and supramolecular salicylic acid 30% chemical peels

Lian Wang1 Jiang Xian1 1West China Hospital, Sichuan University

Papulopustular rosacea (PPR) is characterized by central facial erythema, transient papules and/or pustules, with or without telangiectases. The treatment for PPR is challenge due to the unclear and complex pathogenesis. A retrospective study of PPR patients treated with oral minocycline and supramolecular salicylic acid 30% chemical peels were enrolled between June 2018 to December 2018. All patients were treated with 50 mg minocycline twice a day and supramolecular salicylic acid 30% twice a month. Ten patients were enrolled and they all had received the therapy for 12 weeks. A significant reduction of rosacea severity was observed at Investigator Severity Assessement (ISA) after treatment, mean from 3.4±0.7 at baseline to 2.5±0.9 at 4 weeks(p＝0.019), to 2±0.8 at 8 weeks(p＝0.001), to 1.2±0.8 at 12 weeks(p<0.001). After 12 weeks, 2 people (20%) received “complete response,” 4 people (40%) received “excellent response,” and 4 people(40%) received “moderate response”. No adverse reactions were observed during each patient’s visit. In conclusion, the combination treatment of minocycline and supramolecular salicylic acid 30% is an effective therapy for PPR.

178

2019CSID Poster communication

PO-095 Cutaneous Rosai-Dorfman Disease:a report of fifteen cases from China and a review of the literature

Lihong Zhao1 Shang Qian1 Geng Songmei1 1Northwest Hospital, Xi

Background Rosai-Dorfman disease is a rare benign proliferative disorder of histiocytes,which is characterized by overproduction and accumulation of histiocytes within lymph node sinuses and many other extranodal sites, including skin, oral ,respiratory tract,etc. Cutaneous Rosai-Dorfman disease (CRDD) is rare and sometimes is misdiagnosed as Kimura’s disease or pseudolymphoma. Observation We analzed 15 cases diagnosed as CRDD from our department to explore their clinical pathological features of. Of our 15 cases, including 9 men and 6 women, presented with red plaques, papules, nodules and acne-like lessions,affected face, head, trunk and arm. Histopathological examination of the skin lesions showed that all 15 cases demonstrated diffused mixed infiltration of lymphocytes, histocytes and sparse plasmocytes, 13 cases showed diagnostic feature of emperipolesis with histiocytes phagocytosed inflammatory cells. Two cases demonstrated mild eosinophilic granulocytes infiltration. Positive immunohistology staining for S100 and CD68 and negative for CD1a and Langerin confirmed the diagnosis of CRDD. Key message CRDD is rare and difficult to diagnose only based on clinical features, Histopathological findings of S100 positive histocytes and emperipolesis surport the correct diagmosis of CRDD.Differential diagnosis should be identified with infectious granuloma,reticulo- histiocytosis, Langerhans cell histiocytosis and malignant histiocytosis. Though CRDD usually develops slowly and has good prognosis, long-term follow-up is necessary to avoid system damage.

179

2019CSID Poster communication

PO-096 Association between SNPs of FLG gene and the AD in Yanbian Chinese Koreans

Meilan NAN1 JIN Zhehu1 1Departmentof Dermatology,Affiliated Hospital,Yanbian University,Yanji

Objective To investigate the association between single nucleotide polymorphisms (SNPs) of the gene of filaggrin(FLG) and atopic dermatitis(AD) in Yanbian Korean Chinese populations. Methods The project was designed as a case-control study. A total of 70 subjects withAD,and 90 control subjects with were involved in this study. The genotypes and alleles of SNPs rs11584340and rs3126085 were determined by the method of Polymerase Chain Reaction Sequence Method.The distribution of allele and genotype frequencies were determined to screen dangerous haplotype. Results The sample balance test:AD and the normal group,the genotype and allele frequencies of 2SNP rs11584340（G）,rs3126085(G) conformed to Hardy-Weinberg equilibrium and showed no significant difference (p>0.05);analysis of the genotype and allele frequencies of FLG gene 2SNPs distribution between AD and controls case:In Yanbian Korean Chinese population,both allele and genotype frequency of rs11584340 and rs3126085 showed no significant difference between patiens with AD and healthy control group (p>0.05);clinical biochemistry indicator:In Yanbian Korean Chinese population,the level of serum IgE and IL-13 in AD was significantly higher than in control group (p<0.01);analysis of linkage disequilibrium: rs11584340 was strong linkage disequilibrium with rs3126085 (D￠=1.000,r2=0.836). Conclusions rs11584340 was strong linkage disequilibrium with rs3126085;the polymorphism of rs11584340 and rs3126085 is not associated with susceptibility of AD in Yanbian Korean Chinese population.

180

2019CSID Poster communication

PO-097 The study of reflection confocal microscopy combined with dermatoscopy in the monitoring of therapeutic response in psoriasis vulgaris

Xing Fan1 1Institute of Dermatology, Anhui Medical University; Department of Dermatology, The First Affiliated Hospital of Anhui Medical University

Objective To investigate the clinical and epidermal features of psoriasis vulgaris before and after treatment by combined using both reflectance confocal microscopy (RCM) and dermoscopy techniques. Methods Twenty-seven patients were collected and examined before and after treatment by RCM and dermoscopy simultaneously and the clinical and imaginative features of two groups were compared. Results According to the value of L (local psoriasis severity index, LPSI decline rate), 11 cases of clinical skin lesions subsided (L=1), 12 cases of skin lesions improved (0

181

2019CSID Poster communication

PO-098 Correlation of Analysis between 5-hydroxymethylcytosine and Mycosis Fungoides

Lihong Zhao1 Geng Songmei1 1Northwest Hospital, Xi

Background Mycosis fungoides (MF) is the most common type of cutaneous T-cell lymphoma, which is often misdiagnosed as benign inflammatory dermatoses (BID) due to the variety of skin lesions. In recent years, the study of epigenetics has been a hot topic, and with further study of the important content of epigenetics ---- methylation, 5-hydroxymethylcytosine (5-hmC), as an important intermediate product of DNA demethylation, has gradually become a new research hotspot. Many studies have shown that 5-hmC is lowly expressed in variety of tumors, such as acute myeloid leukemia, liver cancer, breast cancer, rectal cancer, melanoma, systemic lymphoma. A study showed low expression of 5-hmC in CD30+ anaplastic large cell lymphoma, but there are few study about 5-hmC in cutaneous T-cell lymphoma, and whether 5-hmC is an important epigenetic regulatory molecule for MF occurrence is not clear. Objective To detect the expression of 5-hmC in MF (including patients after treatment of acitretin combined with UVB and interferon-α), normal skin, lichen planus and psoriasis and exploring the relationship between 5-hmC and MF and whether 5-hmC could be a biomarker to diagnose MF and evaluate the efficiency. Methods Immunohistochemistry was used to detect the expression of 5-hmC in 30 cases of MF, 12 cases of normal skin tissue,16 cases of psoriasis, and 15 cases of lichen planus. 6 cases of patch stage or plaque stage of MF were treated with acitretin combined with UVB and interferon- α, and the expression of 5-hmC was detected by immunohistochemistry before and after treatment. Image Pro Plus6.0 software was used to analyse the immunohistochemical results:we used the mean of integrated opticdensity (IOD) to represent the expressed levels of the tissues, and took the mean（±s ）of each group as a result. Results 1. The expression of 5-hmC in normal skin，lichen planus，psoriasis and mycosis fungoides (MF) tissues 1) The mean of IOD of 5-hmC in lymphocytes of normal skin, lichen planus, psoriasis and MF were 6.18±2.37, 7.97±2.82 and 6.66±1.57, all were higher than MF, which was 4.69±1.76, the difference was statistically significant (P < 0.05). The mean of IOD of 5-hmC in lymphocytes in MF of patch stage was 5.84±1.08,in MF of plaque stage was 5.58±1.39, were higher than MF of

182

2019CSID Poster communication tumor stage,which was 3.29±1.30, the difference was statistically significant (P < 0.05).The difference between patch stage and tumor stage of MF had no statistical significance (P > 0.05). 2) 5-hmC was not expressed in MF cells, pautrier microabscesses and clumps of lymphocytes infiltrating the epidermës. 2. The expression level of 5-hmC in MF before and after treatment with acitretin combined with UVB and interferon-α The mean of IOD of 5-hmC in dermal lymphocytes of six cases of MF was 3.10±1.77 before treatment, and was 7.96±3.10 after treatment, and the mean of IOD of 5-hmC was higher after treatment than before treatment.The difference was statistically significant (P < 0.05). Conclusion 1. The expression of 5-hmC in lymphocytes infiltrating epidermis and during MF of tumor stage had decreased, suggesting that the abnormal DNA demethylation of 5-hmC involved in the malignant transformation of T cells in MF and could be a potential marker to diagnose MF and to assess the development and poor prognosis. 2. 5-hmC could be a potential therapeutic target of MF and be a potential marker to evaluate the treatment of MF, but we need further exploration.

PO-099 Retrospective study of 213 cases of Stevens–Johnson syndrome and toxic epidermal necrolysis from China

Lu YANG1 SHOU Yan-hong1 YANG Yong-sheng1 LI Feng1 ZHU Xiao-hua1 XU Jin-hua1 1Department of Dermatology, Huashan Hospital Affiliated with Fudan University

Background Stevens–Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are rare but severe adverse drug reactions with high mortality. The rational use of corticosteroid and the control of complications, especially infection, remain to be clarified. Methods A retrospective study was performed among 213 patients with SJS/TEN who were hospitalized in our department between 2008 and 2018, to investigate the causative agents, clinical characteristics, complications, and prognoses in the treatment of SJS and TEN mainly by combination therapy of corticosteroid and intravenous immunoglobulin (IVIG). Results The causative drugs of SJS/TEN in these patients mainly consisted of antibiotics (61/213, 28.6%), anticonvulsants (52/213, 24.4%), and nonsteroidal anti-inflammation drugs (24/213, 11.3%), among which carbamazepine was the most frequently administered drug (39/213, 18.3%). There were significant differences in the maximum dosage, time to corticosteroid

183

2019CSID Poster communication tapering, and the total dosage of corticosteroid between the SJS group and the TEN group, as well as among the three groups (P = 0.000), whereas in the initial dose of corticosteroid was not statistically significant among the three groups (P = 0.277). In a series of 213 cases, 18.4 cases (8.6%) were expected to die based on the score for the toxic epidermal necrolysis (SCORTEN) system, whereas eight deaths (3.8%) were observed; the difference was not statistically significant (P = 0.067; SMR = 0.43, 95% CI: 0.06, 0.48). The most common complications were electrolyte disturbance (174/213, 81.7%), drug-induced liver injury (64/213, 30.0%), infection (53/213, 24.9%), and fasting blood sugar above 10 mmol/L (33/213, 15.5%). Respiratory system (22/213, 10.3%) and wound (11/213, 5.2%) were the most common sites of infection. Multivariate logistic regression analysis indicated that the maximum blood sugar (≥10 mmol/L), the time to corticosteroid tapering (≥12 d), the maximum dosage of corticosteroid (≥1.5 mg/kg/d), and the total body surface area (TBSA) (≥10%) were defined as the most relevant factors of the infection. Conclusion The mortality of patients in this study was lower than that predicted by SCORTEN, although there was no significant difference between them. Hyperglycemia, high-dose corticosteroid, and the TBSA were closely related to the infections of patients with SJS/TEN.

PO-100 Constipation of the elderly with abnormal skin barrier function

li ye1 Lv Chengzhi2 wang zhen3 Wen Si1 Yang Bin1 Man Maoqiang1 1 Dermatology Hospital of southern University 2Dalian Dermatology Hospital 3Shenyang No 7 Hospital

Objective To investigate whether constipation in the elderly is accompanied by changes in epidermal function. Methods A total of 415 elderly people over the age of 65 were enrolled, including 366 females and 149 males with an average age of 76.72 ± 0.43 years. The elderly are divided into constipation, stomach problems and normal groups. The transepidermal water loss rate and the stratum corneum water content of the forearm flexion side of each group were measured by GPskin; the skin surface pH was measured with a portable pH meter. At the same time, the blood pressure and body mass index (BMI) of the elderly were measured. As a result, there was no significant difference in BMI and blood pressure between the constipation and the elderly without constipation; the elderly with constipation had a 14% lower

184

2019CSID Poster communication water content in the stratum corneum than those without constipation; the transdermal loss rate of the constipation elderly was significantly lower than that of the non-constipation (p <0.05), and its pH was significantly higher than that of non-constipents (p<0.05). In addition, the recovery rate of the permeability barrier of the elderly with constipation was significantly reduced (p<0.01). However, in the elderly with stomach disease, the water content of the stratum corneum, the transepidermal water loss rate and the pH of the skin surface are not significantly different from those of the elderly without stomach. Conclusion The elderly with constipation are associated with abnormal function of the epidermal permeability barrier. While treating constipation in the elderly, attention should be paid to improving the function of the epidermis.

PO-101 Neither Barrier Status nor LAST Scores Predict Positive Patch Test Reactions to Skin Care Products

dan liu1 Huang Li-ning1 Wang Xiaohua1 Wen Si1 Gong Can-yi1 Wang Hui1 Man Mao-Qiang1 Yang Bin1 1Dermatology Hospital of Southern Medical University

Background Adverse cutaneous reactions to skin care products (SCP) are becoming increasingly common, and may be indicative of sensitive skin and/or defective permeability barrier function. Objective To assess whether transepidermal water loss rates and/or lactic acid sting test (LAST) scores can predict cutaneous reactions to skin care products in normal Chinese females. Methods Skin patch test reactions to nine (9) skin care products were assessed in 65 normal Chinese females. Correlations of cutaneous reactions to a panel of nine foreign and domestic SCP with alterations in permeability barrier function, stratum corneum (SC) hydration, and/or LAST scores were analyzed. Results Among these 65 subjects, 24 (37%) displayed positive reactions to one or more SCP. However, the occurrence of positive reactions to patch tests did not correlate with abnormalities in permeability barrier function or SC hydration, or LAST scores. Finally, positive patch test reactions were not associated with either the origin (domestic or foreign) or market price of the SCP.

185

2019CSID Poster communication

Conclusions Though a substantial proportion of normal female subjects display adverse reactions to SCP, this problem cannot be attributed to differences in the qualities of their epidermal permeability barriers, and therefore these reactions more likely reflect the potential toxicity of the SCP themselves.

PO-102 Expression and correlation of interleukin-36γ, Claudin-1 and Claudin-7 in psoriasis

Yunlei Pan1 Tang Shunli1 Xu Lina1 Zheng Siting1 Qiao Jianjun1 Fang Hong1 1The First Affiliated Hospital of Zhejiang University

Background and aims To investigate the expression of IL-36γ, claudin-1 and claudin-7 in psoriasis lesions, and study their correlations in it. Methods 42 patients as psoriasis group with 15 persons as control group were included in this study. The expression of IL-36γ, claudin-1 and claudin-7 were detected by immunohistochemistry. Results The expression level of IL-36γ in the psoriasis group was markedly higher than that in the control group(P=0.022). The expression levels of claudin-1 and claudin-7 in the psoriasis group were lower compared to control group(P=0.001, 0.001 for claudin-1 and claudin-7 respectively). The expression level of IL-36γ was negatively correlated with that of claudin-1(r=- 0.344, P=0.025) and claudin-7(r=-0.320, P=0.039). Conclusion IL-36γ expression increased in psoriasis skin lesions and it was correlated with down-regulation of claudin proteins expression in the lesions.

186

2019CSID Poster communication

PO-103 Noninvasive proteome-wide quantification of skin barrier-related proteins using label-free LC-MS/MS analysis

Mengting Liu1,2 Zhang Jing1,2 Wang Yaochi1,2 Xin Cong1,2 Ma Jie1,2 Xu Shuangjun1,2 Wang Xiaomeng1,2 Gao Jinping1,2 Zhang Xuejun1,2 Yang Sen1,2 1Institute of Dermatology and Department of Dermatology, The First Affiliated Hospital, Anhui Medical University, Hefei, China; 2Key Laboratory of Dermatology, Anhui Medical University, Ministry of Education, China, Hefei, China

Purpose Many epidermal proteins are closely related to skin barrier function, the abnormalities of which can lead to specific skin diseases. These proteins must be quantified to further investigate changes in the skin barrier between healthy and disease states. However, the non-invasive and proteome-wide quantification of skin proteins without any labeling steps remains a challenge. Methods We used 3M medical adhesive tapes to obtain skin samples from the volunteers. Proteins were extracted from fresh skin samples and digested with trypsin. Each tryptic peptide was analyzed in three replicates using a liquid chromatography with tandem mass spectrometry (LC-MS/MS) analysis and the label-free quantification. Results The data were searched against the Human Universal Protein Resource (UniProt) to match with known proteins. With this method, we quantified 1157 skin proteins. Among them, 50 skin barrier-related proteins were identified in the three replicate analyses of all samples with no significant differences in abundance in the three replicate analyses of each sample. We then divided the 50 skin barrier-related proteins into 12 groups according to their specific properties. Conclusions This study explored a simple and efficient method to quantify skin proteins. The results provide an objective scale for future studies on monitoring changes in skin protein levels in skin aging and skin diseases, and provide insights into the diagnosis, prognosis and the development of new targeted therapies for various skin barrier-related diseases in the future.

187

2019CSID Poster communication

PO-104 Some new enlightenments about psoriasis pathology from clinical sample mRNA-sequence analysis

Zengyang Yu1,2 Shi Yuling1,2 1Department of Dermatology, Shanghai Tenth People 2Institute of Psoriasis, Tongji University School of Medicine, Shanghai 200072, China

Psoriasis was generally considered as autoimmune diseases which are triggered by unknown factors, yet. More and more clinical observations point to the correlation of psoriasis with metabolic syndrome and comorbidity risk factors of metabolic syndrome leading to psoriasis development. Therefore, a comprehensive analysis of epidermal transcription variance from healthy skins to psoriasis-unaffected skins to psoriasis lesions are helpful to discern initially reasons behind psoriasis representations. In this program, 9513 differentially expressed (DE) mRNAs are identified in the comparison of NN with PS, 5383 DE_mRNAs are identified in the comparison of PN with NN, 4946 DE_mRNAs are identified in the comparison of PN with PS. Top 10 ranked GO terms in each category (molecular function, cellular components, biological process) are enriched. In comparison of PN vs NN, mostly molecular functions are related to keratinocyte development and differentiation. In the comparison of PS vs NN, a significant variance is the up regulation of CD4 and CD8 T cell function. In addition, anti- keratinocytes apoptotic are appeared in all the three comparisons. We may dedicate that keratinocyte itself may be initial reasons that brings psoriatic changes of healthy skins and activation of keratinocytes is uncontrolled throughout the psoriatic pathology. T cell activation may be just a subsequent reactions of keratinocyte function changes instead of the original factors. Frequently appeared GO terms in cellular component are keratinocyte cornification and extracellular related. In GO terms of biological process, fatty acid metabolism disorder are the most significant changes of psoriasis patients compared to healthy people. Some oxidative disorders and upregulation of chemotaxis can be found in PS lesions, these changes may be the subsequent effects of lesion formation. When moves to KEGG results, we can find PPAR signaling pathways are occurred throughout the 3 comparisons. Downregulation of fatty acid metabolic pathways takes up mostly KEGG terms in PN vs NN, combining with previous GO analysis may imply us the potential links of fatty acid metabolic dysfunction to keratinocytes homeostasis changes. While in PS vs NN, with exception of energy and fatty acid metabolic pathways, immune and inflammation pathways

188

2019CSID Poster communication begin taking up a considerable part, which is in accordance with GO analysis that adaptive immunity is secondary factor to psoriasis. In comparison of PS vs PN, we can find inflammation pathways, especially IL-17 signaling pathway, which are generally considered playing vital roles in psoriasis, however, may be a very downstream signal. In addition, downregulation of cell-cell junction and upregulation of microbial infection in PS may be attribute to the existence of skin lesions. Comprehensive analysis of GO and KEGG information in a chronological sequence of psoriasis development (from NN to PN to PS), we may dedicate that metabolic disorder may be initial factors triggering keratinocytes homeostasis changes and then recruits T cell related immune activation and lesion formation and subsequently elevation of antibacterial performance.

PO-105 Effect of PSENEN knockdown on γ-secretase in HaCaT cell and changes in related signaling pathways

Peng jun Zhou1 Xiao Xuemin1 Lin Lihang1 1 Fujian Medical University union hospital

Backgrounds Acne Inversa (AI) is a chronic inflammatory skin disease of the hair follicle- sebaceous gland-apocrine sweat gland unit. Skin lesions can represent abscesses,sinuses and scar ,which affect patients' quality of life seriously. In 2010, Wang et al. first discovered that the mutation of γ-secretase gene was associated with the onset of AI, which was subsequently confirmed in different countries. γ-secretase is a hotspot of familial AI, which consists of four components: presenilin (PS), nicastrin (NCT), and anterior pharynx defective-1(APH1), presenilin enhancer-2 (PEN2). PSENEN gene mutations are found in many diseases, such as AI, Dowling- Degos disease (DDD), familial acne, Alzheimer's disease, but the role of PSENEN gene in skin diseases is still not clear. Objectives The aim of this study was to investigate the effects of PSENEN knockdown on γ- secretase in keratinocytes and changes in related signaling pathways, as well as on the biological formation of keratinocytes such as proliferation, differentiation and apoptosis. At the same time, to explore the pathogenesis and therapeutic targets of AI PSENEN gene mutation patients, trying to find a unique molecular mechanism that different from Alzheimer's. Methods（1）Design three siRNA sequences specifically knocking down PSENEN, and divide the cultured human immortalized keratinocyte cell line (HaCaT cells) into experimental group (PSENEN-siRNA), negative control group (m-siRNA), blank control group (Add equal amount of

189

2019CSID Poster communication transfection reagent), verify the interference efficiency by real-time quantitative PCR and Western blotting, and construct a PSENEN knockdown model of HaCaT cells.（2）Whole transcriptome sequencing was used to detect the difference expression of mRNA in PSENEN knockdown HaCaT cells. The effects of PSENEN on cells were analyzed by GO analysis and KEGG analysis. （3）Real-time quantitative PCR and Western blotting was used to verify the different signaling pathway, the effect on γ-secretase function and the genes related to proliferation and differentiation. CCK-8 was used to detect cell proliferation and flow cytometry for apoptosis, in the aspect of cell behavioral changes. Results（1）The expression of PEN2 mRNA and protein in HaCaT cells was down-regulated by PSENEN for 72h (p< 0.05)so that the PSENEN knockdown cell model was successfully constructed. Compared with the control ， γ-secretase components changed with imNCT increased, mNCT decreased, PS1-CTF decreased, and PS1 increased (p < 0.05), while the APH1a remained unchanged in the experimental group. （2）Transcriptome sequencing results showed that most of the differential biological functions of the mRNA were related to metabolism. Most of the molecular functions were related to the intermolecular binding. In KEGG analysis (2 fold difference, p< 0.05)，the expression of the EGFR, VEGFR,mTOR signaling pathway is elevated, while decreased in the expression of insulin, m-TOR and metabolic signaling pathways. The metabolic pathways of carbohydrates, lipids and amino acids in the metabolic pathways all decreased, especially decreased in glucose metabolism . （3）There was no significant difference in Ki67 mRNA and protein levels ,CCK-8 and apoptotic. The expression of EGFR mRNA and protein were increased (p < 0.05), but the PI3K-AKT-mTOR signaling pathway related protein was not statistically significant. Conclusions（1）The PSENEN knockdown of HaCaT cells decreased the expression of PEN2 protein resulting in the γ-secretase NCT maturation disorder and PS1 phosphorylation disorder. （2）PSENEN knockdown caused a decrease in cellular metabolic levels and elevation of the EGFR signaling pathway.

190

2019CSID Poster communication

PO-106 Screening differentially expressed genes of GJB6 mutant by gene chip

Keying Guo1 Zhang Li1 Wu Wangli2 1Shandong Provincial Hospital affiliated to Shandong University 2Weihai Municipal Hospital

Objective Hidrotic ectodermal dysplasia (HED) or Clouston syndrome is a rare autosomal dominant disorder. It is characterized by the triad of nail dystrophy, alopecia and palmoplantar hyperkeratosis. At present, there is little research on the pathogenesis of HED, and the pathological process of clinical phenotype, which is the function of Cx30, is a huge challenge in this field. HED is caused by mutations in the human GJB6 gene which encodes connexin30(Cx30)．In order to screen the differentially expressed genes in HaCaT cell line stably expressing human GJB6 gene by gene chip and explore the possible signal pathway and mechanism of the mutant gene. Methods To construct lentiviral vector containing human GJB6 gene mutation (G11R) stably expressing by Tet-on system on HaCaT cell lines. After extraction of total RNA and quality control, the RNA was processed for fluorescent labeling, hybridization, washing, scanning and signal digitizing. Then the differentially expressed genes were screened by using Affymetrix microarray chip. Then the screened gene were analyzed on expression and function by IPA (Ingenuity Pathway Analysis), the differentially expressed genes with higher correlation were validated by using the WES Simple Western technology. Results The result of total RNA quality identification showed that all samples were high-quality. (RIN> = 9.3, 28S / 18S> = 1.5, A260 / A280 were between 1.99 and 2.06). Microarray analysis revealed that the OE group (target group) and the NC group (negative control) were differentially expressed, of which 546 genes significantly up-regulated and 926 genes significantly down- regulated (p<0.05 and differences were more than 2 times). The differentially expressed genes were rich in many diseases and functions, in which the apoptosis, cell differentiation, epithelial cell differentiation, dermal cell differentiation, epidermal cell differentiation, epithelial tissue differentiation and neoplasia of epithelial tissue may be closely related to the function of GJB6 gene. WES Simple Western analysis revealed that MKI67 was down-regulated by 73.65%, the PLK1 was down-regulated by 48.41% and the BCL2L11 was up-regulated by 147.21%, which were consistent with the results of chip screening.

191

2019CSID Poster communication

Conclusions Microarray analysis can screen the differentially expressed genes in GJB6 gene rapidly and efficiently, which play an important role by regulating multiple signaling pathways. Its final goal is to lay a solid theoretical foundation for further study of the pathogenesis of HED.

PO-107 Alternative polyadenylation mediated 3'UTR shortening regulates human keratinocytes differentiation

Xuefei Li1 Lin Jinxia1 Hu Yongfei1 Zhou Jiajian1 1Southern Medical University Dermatology Hospital

Background Aberrant differentiation of keratinocytes (KC) is a primary feature of psoriasis, but the molecular mechanism of post-transcriptional regulation during KC differentiation and proliferation remains mostly unknown. Alternative polyadenylation (APA) plays an important role in regulation of gene expression, mRNA stability, translation efficiency, transport and subcellular localization. Therefore, we proposed that APA might regulate the differentiation of KC through 3'UTR length shortening, which is essential for the regulatory pathway of miRNA. Method To address this notion, we first identified miRNA-3'UTR length shortened isoforms by PAS-seq, then established the regulatory network comprised by PAS-seq and the predictions of miRNA and APA binding during KC differentiation. Additionally, we identified the regulatory network and network regulation loops that influence the proliferation and differentiation of KC by integrative network analysis. Result The APA level of 335 genes show a gradual decrease during KC differentiation. Particularly, GO enrichment analysis of those genes are enriched in skin development and cell proliferation. Therefore, reducing the utilization of long 3'UTR may play an essential role in the process of proliferation and differentiation in KC. Additionally, we found most of 335 genes are regulated by miRNA (such as miR-212 and miR-224) through miRanda prediction. Furthermore, our analysis demonstrated that APA-mediated 3'UTR length shortening also observed in skin biopsy from psoriatic patients, indicating the important role of APA in pathogenesis of psoriasis. In summary, our results suggested that APA might regulate the differentiation of KC through 3'UTR length shortening, which is essential for the regulatory pathway of miRNA. Conclusion APA mediated 3'UTR length shortening might fine-tune miRNA-3’UTR regulatory network across the differentiation of KC. Thus, we provide insights into the study of APA dynamics in skin diseases and accelerate the development of a new therapeutic strategy.

192

2019CSID Poster communication

PO-108 Analysis between OSMR Gene Mutation and Clinical Phenotype of 174 Cases of Primary Cutaneous Amyloidosis

Yuling Zhang1,2 Yang Chao2 Lv Ping2 Xue Ruzeng2 Wu Fangfang2 Yang Bing1,2 1Department of Dermatology, Guangdong Provincial Dermatology Hospital，Clinical School of Anhui Medical University, Guangzhou 510091, China 2 Department of Dermatology, Guangdong Dermatology Hospital, Guangzhou 510091,China

Objective To investigate the associations among OSMR gene and Clinical phenotype in patients with primary cutaneous amyloidosis (PCA). Methods The peripheral blood samples of 174 patients and 52 normal controls were collected for the Sanger sequencing of exons 11~15 of OSMR gene, and the clinical data were analyzed. Results Among 174 patients of PCA, 35.63% had family history, 64.37% had no family history, the average age of onset was 31 ± 12.69 years old, and the peak age of onset was 20~29 years old (31.03%). The proportion of men and women in lichen amyloidosis (LA) (75/56) and macular amyloidosis (MA) (16/27) had statistical difference (χ2 = 4.44, P = 3.5×10-2 ). Patients with LA were more likely to have pruritus than those with MA (χ2 = 5.73, P = 1.6×10-2 ). Among 174 PCA patients, 36.78% of PCA patients had OSMR gene mutation, 84.38% were OSMR gene p.Gly513Asp mutation site. Compared with the onset age of PCA patients without OSMR gene mutation (32.63 ± 13.50), the onset age of PCA patients with OSMR gene mutation (28.58 ± 10.90) was younger ( t = -2.042, P = 4.30×10-2 ). The family history (χ2 = 16.03, P < 1.00×10-3), gender (χ2 = 4.15, P = 4.20×10-2 ), lesion range (χ2 = 5.95, P = 1.50×10-2) were found to be significantly different by comparing the clinical data between OSMR mutations (including p.Gly513Asp homozygous site, p.Gly513Asp heterozygous site, etc.) and without OSMR mutations of PCA patients. The family history (χ2 = 10.63, P = 1.00×10-3), gender (χ2 = 5.40, P = 0.02), lesion range (χ2 = 7.49, P = 6.00×10-3) were found to be significantly different by comparing the clinical data with OSMR mutation at p.Gly513Asp site (p.Gly513Asp homozygous site and p.Gly513Asp heterozygous site) and without OSMR mutation of PCA patients. There was no significant difference in clinical typing (lichen amyloidosis and macular amyloidosis) and pruritus rate between OSMR gene mutation and non-OSMR gene mutation of PCA patients (P > 0.05).

193

2019CSID Poster communication

Conclusion OSMR gene mutation (p. Gly513Asp homozygous site mutation) was correlated with family history, gender, lesion range and age of onset of PCA.

PO-109 Mannose-Binding Lectin (MBL) and MBL-associated serine protease-2 (MASP-2) genotypes and serum levels in patients with sporotrichosis

Fangfang Bao1 Fu Xi'an1 Yu Gongqi1 Wang Zhenzhen1 Liu Hong1 Zhang Furen1 1Shandong Provincial Hospital for Skin Diseases & Shandong Provincial Institute of Dermatology and Venereology, Shandong First Medical University & Shandong Academy of Medical Sciences

MBL and MASP-2 are important proteins in the lectin pathway of the immune system. MBL and MASP2 deficiency have been reported to be responsible for various fungal infections. We investigated the association of MBL and MASP2 variants with sporotrichosis in a Chinese population and revealed one rare heterozygous mutation in a disseminated cutaneous patient without immunosuppressive condition (p.156_159dupCHNH). We also found that sporotrichosis patients had decreased levels of MBL and MASP-2 in their serum samples compared to controls. Our findings linked, for the first time, MASP2 deficiencies with susceptibility to Sporothrix.

PO-110 HLA associations and autoimmune blistering disease: Generality and Heterogeneity

yonghu sun1 Liu Hong1 Zhang Furen1 1Shandong Provincial Institute of Dermatology & Venereology & Provincial Hospital for Skin Diseases, Shandong First Medical University & Shandong Academy of Medical Sciences

Background Autoimmune blistering diseases (AIBDs) are a group of rare acquired blistering skin diseases, which are divided into five major subtypes based on the clinical appearance and pathology: pemphigus diseases, bullous pemphigoid (BP), epidermolysis bullosa acquisita (EBA), dermatitis herpetiformis (DH) and Linear IgA bullous dermatosis (LigA). Current understanding has been greatly increased by genetic investigations mainly focus on the HLA in various

194

2019CSID Poster communication populations. We have conducted the HLA association studies on different subtypes of AIBDs in Chinese population by using Next-generation (NGS) based HLA typing methods. Objective Upon these data, we aimed to investigate the generality and heterogeneity in different disease subtype and population. Materials and Method A total number of 369 pemphigus (210 PV and 159 PF), 575 BPs, 36 DHs, 33 LigAs, 17 EBAs and 976 healthy controls were inrolled in the study. Genome-wide association studies were performed in the pemphigus and BPs. Associations study of HLA were conducted on the results of NGS based HLA typing. Results We have identified different associations for subtypes of AIBDs. For pemphigus, we confirmed HLA-DQB1*05:03 to be the strongest association with PV and PF. In addition, HLA- DRB1*14 was demonstrated to be a second independent variants for PV, while HLA-DRB1*04:06 was demonstrated to be the second independent signal for PF. For pemphigoid, HLA- DQB1*03:01 were confirmed to be the strongest association, especially for the BP180-positive group. For DH, HLA-B*08:01 and HLA-DRB1*03:01 were confirmed to be independent associations. None significant HLA associations were identified for EBA and LigA. Population heterogeneity analysis revealed effect of HLA associations on different subtype of AIBDs, especially for DH. Conclusions The investigation of AIBD subtypes advanced the understanding the genetics of AIBD susceptibility and offers molecular insight into the pathophysiological mechanisms.

PO-111 DNA Methylation affects the efficacy of acitretin in the treatment of psoriasis vulgaris

Yan Lu1 Zhai rui1 Kuang yehong1 Zhu wu1 1Institute of medical science, Xiangya Hospital, Central South University, Changsha, Hunan, China.

Psoriasis is a genetic-mediated immune chronic inflammatory dermatosis. Acitretin is the most commonly systemic therapy for psoriasis in China. However, Its efficacy has individual differences. Several studies have reported that DNA methylation influenced the development of psoriasis, but there is no report that DNA methylation affects the efficacy of Acitretin in the treatment of psoriasis. In this study, we used the DNA methylation sequencing technology to explore the correlation between DNA methylation levels and the efficacy of Acitretin treated for psoriasis, we found 589 differentially methylated regions involving 28 genes, and almost all of 195

2019CSID Poster communication these differential methylated regions are hypermethylated in patients who respond to acitretin in patients, then we enriched the 28 genes to further sequence to verify these genes and we found that the methylation sites of 3 genes, ADGRG6, ELOVL2, STX5, were correlated with the efficacy of Acitretin. There there genes may be a meaningful target for the treatment of psoriasis and worthy of further research.

PO-112 The preliminary study on the Pathologic Mechanism of Acne inversa Caused by NCSTN Gene-Notch signaling pathway

Zhang Yuanyuan1 Zhang Wanlu1 He Yanyan1 Xu Haoxiang1 Li Chengrang1 1Institute of Dermatology, Chinese Academy of Medical Sciences and Peking Union Medical College

Objective Acne inversa (AI; OMIM 142690), also known as Hidradenitis suppurativa (HS), is a chronic, relapsing, inflammatory, follicular skin disease, which is characterized by painful subcutaneous nodules and abscesses, with sinus and scar formation in the apocrine gland– bearing regions. The previous study revealed that mutations in the γ-secretase subunit, nicastrin (NCSTN), presenilin enhancer 2 (PSENEN), and presenilin-1 (PSEN1), were associated with familial AI patients. NCSTN is the most prevalent mutation be found in in γ-secretase. However, the pathogenesis mechanism underlying NCSTN mutations in AI patients remains unclear. In this study, a lentiviral vector-mediated RNA interference technique was used to construct a stable NCSTN gene silenced HaCaT cell model. The mRNA expression profile of interference group and the negative control group was obtained through sequencing. Bioinformatics analyses including identification of dysregulated genes and biological function enrichment were performed, aiming to screened differentially expressed signaling pathways and molecules involved in cell proliferation, inflammatory and differentiation. Moreover, Real-Time PCR and Western blotting were used to detect the expression of target genes. Our study preliminary exploration of the possible mechanism of NCSTN gene mutation in cell proliferation, inflammatory and differentiation, provide valuable information for the exploration of pathogenesis mechanism of AI. Methods 1. We Infected human immortal keratinocyte cell line HaCaT with a lentivirus-mediated short hairpin RNA (shRNA) expression plasmid targeting the NCSTN gene. These cells were divided into negative control group (NC group) and interference group (ShRNA group). The

196

2019CSID Poster communication transfection efficiency was detected by flow cytometry. The silence efficiency of NCSTN was detected by Real-Time PCR and Western blotting. 2. RNA sequencing was used to detect the gene expression of HaCaT cells with stable silencing of NCSTN gene. Then we screened changed signaling pathways and molecules associated cell proliferation, differentiation and inflammatory by bioinformatics. 3. Real-Time PCR and Western blotting were used to detect the expression of the four subunits of γ-secretase and the change of Notch-Hes signaling pathway. 4. The expression of IL-36 cytokines (IL-36α、IL-36β、IL-36γ、IL-36Ra) and NF-κB pathway were detected through Real-Time PCR and Western blotting. 5. CCK-8 was used to detect cell proliferation, and Real-Time PCR and Western blotting were used to detect the expression of cytokeratins （CK1、CK5、CK7、CK10、CK14、CK16、 CK17、CK18、CK19、CK20） and other differentiation factors (IVL、LOR). Results1. After lenti-virus infected HaCaT cells, the transfection efficiency of NC group and ShRNA group was greater than 90% by flow cytometry. Compared with NC group, the expression of NCSTN gene mRNA and protein in the interference group was significantly decreased. 2. RNA sequencing revealed differential expression of multiple genes and altered signaling pathways. We selected Notch-Hes signaling pathway, IL-36 molecule and proliferation differentiation factor as targets of interest by bioinformatics. 3. After the stable silence of NCSTN gene, the expression of NCSTN subunit, PSENEN subunit and PS1-CTF were significantly decreased compared with the control group, while the full length of PSEN subunit and APH1A subunit were unchanged. The corresponding expression of Notch3 and Hes1 was decreased. 4. The levels of IL-36α and IL-36β were significantly increased, while the levels of IL-36γ were not significantly changed, and the level of IL-36Ra was significantly decreased. There was no change in the expression of the NF-κB pathway. 5. The results of CCK8 showed that the keratinocytes were proliferated actively in the interference group compared with the control group. The expression of cytokeratin CK16 and CK19 and terminal differentiation factor IVL were all significantly decreased, and the cells were abnormally differentiated. Conclusion 1. Human immortal keratinocyte model HaCaT with stable silencing of NCSTN gene was successfully constructed. 2. RNA sequencing screened that the Notch signaling pathway was down-regulated, and IL-36 molecules and proliferation and differentiation factors changed after the NCSTN gene silenced. 3. There was an imbalance of IL-36 cytokines after in the keratinocyte cells after NCSTN gene interference. The downstream NF-κB pathway is not activated.

197

2019CSID Poster communication

4. The keratinocytes showed hyperproliferation and abnormal differentiation after NCSTN gene was silenced.

PO-113 Middle of the Breasts Pigmentation in a pedigree with POFUT1- related Dowling-Degos Disease, expansion of the phenotype

Yingda Wu1 Li Chengrang1 1Institute of Dermatology, Chinese Academy of Medical Sciences and Peking Union Medical College

Objective Dowling-Degos disease (DDD [MIM: 179850, 615327 and 615674]), also called reticulate pigmented anomaly of the flexures (RPAF), is characterized by post-pubertal reticulate hyperpigmentation, particularly affecting the flexural areas and other great skin folds. As a rare autosomal dominant disorder, DDD-related genes include in KRT5, POFUT1 and POGLUT1 genes. We report a 37-year-old woman characterized by reticulated brown-black pigmented macules of 17 years’ duration. Notably, this report is the first to find the middle of the breasts as a clinical feature of DDD. Though middle of the breasts means a reticulate area, but it is still not found before yet. Family study unveiled that her paternal grandfather, father and two aunts suffer similar condition. We want to clarify and analysis the gene mutation in this DDD-related family. Methods Clinical data and blood samples of the family were collected. Potential mutation of the DDD-related genes were scanned in the patient by PCR amplification and direct sequencing. The coding sequences of the POFUT1 were also screened in 100 normal controls. Results The family’s DDD related genes（KRT5, POFUT1 and POGLUT1）coding sequence and exon-intron junction analysis by Sanger sequencing revealed a heterozygous nonsense codon mutation c. 945T>G (p. Y315X) variant in exon 6 of the POFUT1. This mutation was not detected in unaffected family members and 100 normal individuals. The nonsense mutation c. 945T>G results in the premature termination of O-fucosyltransferase-1’s polymerization. This variant was not present in the dbSNP nor the HGMD. Conclusion In conclusion, we report a DDD family with a novel gene mutation and first find a new clinical feature involving in the middle of breast areas, which enrich phenotype, gene mutation database and contribute to genetic counseling from patients’ family.

198

2019CSID Poster communication

PO-114 Role of Super Enhancers in Regulating IRF7 in CD4+ T Cells of Patients with Systemic Lupus Erythematosus

Yuwei Li1 1The 2nd Xiangya Hospital

Systemic lupus erythematosus (SLE) is an autoimmune disease with multiple organ damage. Numerous studies have demonstrated that immune dysfunction of CD4+ T cells is the key mechanism leading to the pathogenesis of systemic lupus erythematosus. However, the molecular mechanism of the immune dysfunction of CD4+ T cells remains unknown. Enhancers are a class of cis-acting elements that can regulate transcription. With the significant development of next-generation sequencing, enhancer-related research as well as the other DNA-sequence- related research have become an important topic in exploring the pathogenesis of diseases. In recent years, the super enhancer, which regulates more transcription than average enhancers do, has been demonstrated a significant factor in the development of most diseases by regulating gene expression. Interferon regulatory factor 7 (IRF7) is an important molecule that regulates the type I interferon pathway, which is closely associated with SLE. Chromatin accessibility, which equals to chromatin openness, means the unwinding of the densely folded three-dimensional structure of the tightly bound DNA sequence with histones facilitates the binding and interaction between transcription factors. It has been a new approach to study gene transcription and transcriptional regulation by locating open areas and openness on chromatin. Our research for the first time identified and screened out the potential super-enhancers involved in the development of SLE, the genes and key transcription factors that regulated IRF7 gene expression through ChIP-seq, RNA-seq bioinformatics analysis methods. Additionally, we also preliminarily studied the role of transcription factor HIF-1a in regulating the activity of super enhancer and IRF 7 gene expression. We also explore the chromatin accessibility of this super-enhanced region. With those achievements, we laid a solid foundation for further research of the epigenetic mechanism of SLE. Objective 1. To identify SLE related super enhancer. To find out the potential genes differentially expressed in CD4+ T cells from SLE patients and potential biological processes involved in the development of SLE. To find out the super-enhancers and target genes involved in the development of SLE, and then identify key transcription factors which regulated the expression of target gene. 2. To preliminary reveal that the transcription factor Hif-1a regulates the super-enhancer activity associated with the pathogenesis of SLE and the expression of IRF7. 199

2019CSID Poster communication

3. To explore the chromatin accessibility status of super-enhancer regions of peripheral blood CD4+ T cells in patients with systemic lupus erythematosus. Methods 1. Peripheral blood was obtained from 12 patients with SLE, including 6 with renal damage, 6 with no renal damage. CD4+ T cells were isolated. After DNA extraction from cells, DNA was cross-linked with formaldehyde, and immunoprecipitated with H3K27ac antibody, followed by precipitation, decrosslinking and purification of DNA for high-throughput sequencing. SLE-related super enhancers were identified by ROSE (Rank Ordering of Super-Enhancer) algorithm, Gene ontology (GO) analysis, Kyoto gene and genome encyclopedia Bioinformatics analysis (Kyoto Encyclopedia of Genes and Genomes, KEGG) pathway analysis. 2. Total RNA was extracted from CD4+ T cells from a subset of the 12 SLE patients and another eight peripheral blood samples of healthy human by Trizol reagent. After reverse-transference, cDNA was constructed for high-throughput sequencing, the genes with significant differential expression were screened, and the differentially expressed genes related to immunity were screened by bioinformatics analysis such as GO and KEGG. 3. Made conjoint analysis for the super enhancers and the genes with significant differential expression. And then screened super-enhancers and related genes that may be involved in the development of SLE. Made Motif analysis by Homer to find the key transcription factors. And then predicted the Transcription factor Binding Site(TFBS) by MatInspector. 4. Total RNA was extracted from CD4+ T cells from a subset of the 23 SLE patients and 20 peripheral blood samples of healthy human by Trizol reagent. Detected the expression of the related gene and transcription factor by RT-PCR. 5. Constructed the dual luciferase reporter gene plasmid and overexpression plasmid of transcription factor we selected, and then verified the relationship of SE-related gene and transcription factor through the dual luciferase reporter gene system and revealed that Hif-1a regulated the expression of IRF7 through experiments of overexpression and suppression. 6. The CD4+T cells were isolated from the SLE peripheral blood of 4 SLE patients in the first step and from 4 healthy controls to explore the chromatin accessibility status of super-enhancer regions in CD4+T cells from systemic lupus erythematosus patients by ATAC-seq. Results 1. Identified 3259 super enhancers in CD4+T cell from the peripheral blood of SLE patients by employing the ROSE algorithm. According to the venn intersection analysis, 199 super-enhancers were found in 6 SLE without renal damage, and 259 super-enhancers were found in 6 SLE with renal damage, and 125 super enhancers were found in 12 SLE samples. 2. According to the RNA-seq and differentially expressed genes screening, of which the Screening requirements are fold change is more than 1.5 and the P value is no more than 0.05, we found 559 up-regulated genes and 131 down-regulated genes in 6 SLE patients without renal damage compared with healthy control. we found 394 up-regulated genes and 87 down-regulated

200

2019CSID Poster communication genes in 6 SLE patients with renal damage. And 10 up-regulated genes and 15 down-regulated genes were found in 6 SLE patients with renal damage compared with SLE patients without renal damage. Among others, 368 common genes including 308 up-regulated genes and 60 down- regulated genes were screened in SLE patients whether they have renal damage. The majority of these genes enrich in immune related function and pathway. 3. We found the expression of Interferon I pathway related gene IRF7 were increased in CD4+T cell of SLE patients compared with healthy control by high-throughput sequencing technology. There was a super enhancer between the 14904bp upstream to 30664bp downstream from the Transcription Start Site of IRF7. Several important transcription factor binding Motif were found by Homer analysis, such as Hif-1a, TEAD2, TFAP2B, ZNF669. And then we predicted the Hif-1a binding site in IRF7-related super enhancer, which is GGGAGGGCACGT in Chr11：620404- 620415. 4. Compared with the healthy control, the expression of Hif-1a was downregulated significantly in CD4+ T cells from SLE patients(P ＜ 0.01), and the expression of IRF7 was up regulated significantly in CD4+ T cells from SLE patients(P＜0.001). 5. Compared with the control group, cells co-transfected with Binding site 1 reporter plasmid and overexpression plasmid of hif-1a showed significantly decreased luciferase activity(P＜0.05). Compared with the cells transfected pENTER plasmid, cells transfected overexpression plasmid of hif-1a showed decreased expression of IRF7(P＜0.05). Compared with the cells transfected control siRNA, cells transfected siRNA-Hif-1a showed significant increase expression of IRF7(P＜ 0.01). 6. Compared with the healthy control, 602 genes with different chromatin accessibility were found in SLE, including 165 genes with increased chromatin accessibility and 437 genes with decreased chromatin accessibility. The chromatin accessibility of the IRF7-associated super- enhancer region in CD4+ T cells was significantly reduced in SLE patients（P＜0.05）. Conclusion 1. A large number of super enhancers are distributed in the CD4+ T cell genome from peripheral blood of SLE patients, and these super enhancers may contribute to the regulation of transcription of genes involved in the pathogenesis of SLE. 2. Hif-1a can inhibit the expression of IRF7, a gene associated with systemic lupus erythematosus, by binding to the IRF7-related super enhancer. 3. The chromatin accessibility of the IRF7 associated super enhancer region was significantly reduced in CD4+ T cells of SLE patients.

201

2019CSID Poster communication

PO-115 A novel frameshift mutation of the PSENEN gene discovered in a Chinese family with Dowling-Degos disease

Xinhong Ge1 Chen Yuanhaoqi1 1 General Hospital of Ningxia Medical University. Yinchuan Ningxia

Object Reticular pigmented anomaly of the flexures, or Dowling-Degos disease (DDD), is a type of rare autosomal-dominant genodermatosis characterized by reticular hyperpigmentation of the flexures, seriously affect the appearance of the patients. The pathogenesis is unclear and there is no effective treatment. To clarify the pathogenic gene of DDD, the research team collected the first family of DDD in Ningxia of China. Method Peripheral blood and photos of the family with DDD were Collected, HE stain and ultrastructure change were observed, exome sequencing analyses were performed. Result The family included 64 individuals (11 affected and 53 unaffected). The proband was a 44-year-old woman who first noticed hyperpigmentation on her abdomen, perineum, groin, axillae and thighs at age 18. The hyperpigmentation progressively increased, and gradually spread over other parts of her body. Physical examination showed dark brown macules on her axillae, groin, perineum and crissum. In addition, there were some pitted scars on the perioral area and comedones on the nose, face, neck and chest . Skin biopsies were performed from the comedonal lesions on her neck and pigmented lesions on her right ankle respectively. A dilated hair follicle with follicular plugging was observed in comedonal lesions. Hyperpigmented lesions showed hyperkeratosis, irregular elongated thin branching rete ridges growing down into the dermis with increased basal melanin pigmentation. Electron microscopy revealed a large number of melanosomes in the melanocytes with zonal distribution In addition to the typical DDD symptoms, all patients were accompanied by comedones. The proband’s father had a history of cutaneous squamous cell carcinoma. The whole exon sequencing showed that c.168_169delTG of PSENEN gene was the causative mutation of this pedigree and the KRT5 , POFUT1 and POGLUT1 gene were normal in this family. Conclusion DDD patients can accompanied by spotty blackhead acne nevi. c.168_169delTG of PSENEN gene was a new causative mutation of DDD. The result emphasizes the genetic heterogeneity of DDD and will be conducive to the further understanding the clinical features correlations and to the pathogenesis of this disease.

202

2019CSID Poster communication

PO-116 A new risk polymorphism rs10403848 of CARD8 significantly associated with psoriasis vulgaris in northeastern China

Pei Yu1 Li Yuzhen1 1Second Affiliated Hospital of Harbin Medical University

Caspase recruitment domain family member 8 (CARD8) is an adaptor molecule that negatively regulates nuclear factor-κB (NF-κB) activation, interleukin (IL)-1β secretion and apoptosis. These play important roles in the pathogenesis of psoriasis. Genetic variants of CARD8 have been associated with an increased risk of several inflammatory diseases and psoriasis in Europe. However, nothing is known about the association of the polymorphisms of CARD8 and psoriasis vulgaris (PsV) in the Han population of northeastern China. To investigate the potential association between them, we designed a case-control study to genotype four selected single nucleotide polymorphisms (SNPs) using the improved multiplex ligation reaction (iMLDR) method. Model-based single SNP frequentist-test and haplotype association studies were performed to assess the association between SNPs and PsV. The results showed that the intron SNP rs10403848 was significantly associated with PsV (additive model p=0.0418, p’=0.0411, and statistical power 0.1902; heterozygous model p=0.0164, p’=0.0159, and statistical power 0.9406). A potential risk locus of non-synonymous SNP rs2043211 found in the European population did not show a significant association in our study. We found that the polymorphism rs10403848 in CARD8 is significantly associated with PsV risk in the Han population of northeastern China. CARD8 may be involved in PsV in this population, as in the European population, but a different genetic process should be considered for the heterogeneity of risk loci.

203

2019CSID Poster communication

PO-117 ATAC-Seq analysis reveals a widespread increase of chromatin accessibility in psoriasis

Lili Tang1 Zhou Fusheng1 1Institution of dermatology, Anhui Medical Univrsity

Background Recent studies have revealed that epigenetics could modulate gene expression in psoriasis. However, the extent to which epigenetic changes regulate psoriasis progression is unclear. Chromatin accessible region (CAR), closely related to GWAS signal, DNA methylation and transcription factors, is an important target for regulating gene expression. Objectives Here we globally profile chromatin accessibility using the assay for transposase accessible chromatin using sequencing (ATAC-seq) in psoriasis cases and controls to explore the mechanisms of non-coding regulatory elements in psoriasis. Methods We performed comparative analysis of chromatin accessibility in 55 skin tissues ( including 19 PP, 15PN and 21 NN) by ATAC-Seq to detect genomic chromatin accessibility. Coupled with our previous whole genome, DNA methylome and transcriptome data from the same batch of samples, we aim to reveal the role of the CARs and further explore the data to find disease-associated transcription factors. Cell culture, RNA-sequencing, protein imprinting, psoriasis mouse model were performed to delineate functions of the transcription factors. Results We identified 365,537 open chromatin peaks. The significant peaks were predominately more accessible in PP compared to both PN and NN samples. Among the peaks with FDR < 0.01 in PP vs. PN and PP vs. NN, a total of 20,527 peaks were shared. The (PP vs. PN) log2FC and (PP vs. NN) log2FC were significantly correlated (Pearson’s r = 0.8, P-values < 2.2E-16). With a cut-off of FDR < 0.01 and |log2FC| > 1, 4,915 peaks are shared significantly in both PP vs. PN and PP vs. NN comparisons. Among 1,844 differentially CARs, 1192 showed higher accessibility activity, while 652 weaker. Genes with significant high CAR activity include PTPN1, S100A family and GSTM1. And the S100A family genes are located in the epidermal differentiation complex (EDC) region. Genes located in close proximity to the CARs were significantly enriched in responses to interferon-gamma, myeloid cell differentiation and defense response to protozoan. There’re 58 (out of the total of 426) psoriasis related CpGs located inside the shared Peaks, which is a strong enrichment (13.6%) as the 20,527 peaks represent only 0.44% of human genome. In-depth analysis of the motif structure of psoriasis-specific CARs revealed that FRA1 gene was the most abundant transcription factor (P = E-174). RT-PCR of normal and skin lesions showed that FRA1 gene was highly expressed in the lesions by immunohistochemistry and

204

2019CSID Poster communication immunofluorescence analysis (P=0.035), which was consistent with the results previously reported by gene expression chip (P = 1.82E-25). Conclusions Global increases in chromatin accessibility occur in psoriasis. Ps-specific-CARs are enriched in IFN-gamma, cell proliferation and other signaling pathways. Genes associated with DARs show alteration in methylaton and SNPs. FRA1 is a key transcription factor in the pathogenesis of psoriasis, and is partially responsible for the observed increase in chromatin accessibility. Our study elucidate of the relationship between CARs and genetics, epigenetics and transcription factors, providing evidence for revealing the pathogenesis of psoriasis and discovering drug targets.

PO-118 The Effect of 4-hydroxyphenyl-Retinamide on Expression of Type I Pro-collagen , MMP-1 and Signaling Pathway PI3K/Akt in Keloid Fibroblasts

Chenglong JIN1 JIN Zhehu1 1Departmentof Dermatology，Affiliated Hospital，Yanbian University

Objective To investigate the effect of 4-hydroxyphenyl-retinamide on expression of type I pro- collagen and MMP-1 and signaling pathway PI3K/Akt in keloid fibroblasts. Methods Comparative the expression of type I pro-collagen and MMP-1 proteins，effecting of 4- HPR therapy with western blot in human keloid fibroblasts. The expression of related proteins was observed by 4-HPR combined with TGF-β1 ， PD98059 ， SP600125 ， SB203580 and LY294002 in keloid fibroblasts. Results Compared with the control group，expression of type I pro-collagen protein decreased and MMP-1 increased of keloid fibroblastsand in the 4-HPR group，and its role showed as 4- HPR dependent of concentration. The expression of type I pro-collagen in 4-HPR+TGF-β1 group was significantly lower than that in TGF-β1 group.However，that did not have any influenceon the expression of Phospho-Smad2and Phospho-Smad3 proteinsin keloid fibroblasts. The expression of type I pro-collagen in LY294002 group was significantly lower than that in control group，and MMP-1significantly increased. However，the expression of type I pro-collagen and MMP-1 protein did not change significantly compared with the control groupin PD98059 ， SP600125 and SB203580 group.4-HPR can effectively inhibit the expression of Phospho-Akt protein.

205

2019CSID Poster communication

Conclusion The data indicated that 4-HPRcould suppress PI3K/Akt signal transduction pathway，which results in decreased expression of type Ipro-collagen and increased MMP-1 proteins in human keloid fibroblasts.

PO-119 Genomic DNA methylation in different HLA genotypes of psoriasis

Lili Tang1 1Institution of dermatology, Anhui Medical University

Objectives We aim to investigate the whole-genome epigenetic differences between HLA carrier and HLA non-carriers and to clarify whether DNA methylation are associated with GWAS SNPs. Methods We performed HLA imputation to get landscape of variants in this region, and then explore methylation difference on genome wide and find significant signals between individuals with and without HLA-C*0602. Methylation was compared between positive HLA-C*0602 group (42 cases) and negative HLA-C*0602 group(72 cases). The samples were subgrouped based on their HLA-C06:02 alleles(72 aa, 40 aA, 2 AA) with minor allele frequency 19.3%. Eight methylation loci were further selected for validation in additional 100 cases. For differentially methylated genes, GO and KEGG were used to annotate gene functions. Results A total of 144 significant methylation siteswere identified between positive and negative HLA-C*0602 group (corrected P<1.0E-08). We impute 29,948 variants based on the constructed HLA reference panels. After filtering MAF<0.01, geno<0.95 and hwe <0.001, we finally obtained 22,131 variants, including 21,281 SNPs, 655 amino acids, and 195 alleles. Significant methylation differences were detected at 4,321 sites (811 hyper-, 3510 hypomethylated). Mean differences of ≥ 10% were found at 2,611 of these sites (500 hyper-, 2111 hypomethylated). The percentage of hypomethylated CpG sites within gene bodies was 31% for hypo- and 24% for hypermethylated sites. Among sites hypomethylated in patients 50% were CpG islands and among hypermethylated sites 49% represented CpG islands. The cg02607779 (KLF7, P=0.001), cg06936779 (PIP5K1A, P=0.002), cg03860400 (BTBD10, P=0.017) and cg26112390 (GOLGA2, P=0.019) were identified and validated to be the significant CpGs contributed to different HLA-C*0602 groups. Pathway analysis identified enriched viral protein interaction with cytokine and cytokine receptor,

206

2019CSID Poster communication chemokine signalling pathway and cytokine-cytokine receptor interaction and salmonella infection. Conclusions This study performed the first whole-genome study on methylation differences between psoriatic individuals with and without HLA-C*0602, and found the key methylation loci which may contribute to the status of HLA-C*0602 carrying. Methylation loci located in gene body and CpG island are more likely to affect the methylation level in HLA-C*0602 carriers. This integrated analysis shed light on novel insights into the pathogenic mechanisms of genomic methylation in different HLA genotypes of psoriasis.

PO-120 Identification of the TMEM232 gene associated with atopic dermatitis through targeted capture sequencing and HaCaT cells experiment

Fengli Xiao1 Zheng Jie1 Cai Xinying1 Zheng Xiaodong1 1Departent of Dermatology of First Affiliated Hospital, Institute of Dermatology, Anhui Medical University, Hefei, Anhui, China

Background Atopic dermatitis (AD) is a common and complex skin disorder, and the 5q22.1 region was associated with AD in our previous study. Object To identify the susceptibility gene for AD in the 5q22.1 region, we conducted a targeted capture sequencing and HaCaT cell transfection experiment. Methods The genotyping data of four SNPs and six deletions from 3055 Chinese Hans AD patients and 4346 controls were analysed. Haplotypes were reconstructed by PHASE v 2.1. The samples with the top associated haplotype were selected to perform targeted capture sequencing. A transfection experiment of HaCaT cells was conducted to study gene function. SPSS 13.0 software was used for statistical analysis. Results A total of 60 haplotypes were found, and the H15 haplotype had the strongest association with AD (P = 2.72×10−10, OR = 0.14, 95% CI = 0.07- 0.28). No cosegregation mutation sites were found in the sequencing analysis of 16 samples. A gene level loss-of-function variant enrichment test indicated that TMEM232 was statistically significant (P = 7.33×10−5, OR = 0.33, 95% CI = 0.19 - 0.58). The HaCaT cell transfection experiment indicated that the cell viability in the pCMV6-Entry-TMEM232 (TMEM232) group was lower than in the pCMV6-Entry (Vect) group and in the no DNA transfection (Con) group (all P < 0.05). Furthermore, after Ca2+

207

2019CSID Poster communication stimulation, the expression of INV and LOR was significantly inhibited in the TMEM232 group compared to the other group (all P < 0.05). Conclution Our findings confirmed that the TMEM232 gene is associated with AD, and overexpression of TMEM232 inhibits proliferation and differentiation of HaCaT cells in vitro. TMEM232 may play a role in AD.

PO-121 Novel EDA mutation in Chinese Han families with hypohidrotic ectodermal dysplasia and genotype–phenotype correlation analysis

Yang Han1 Gao Min1 1Institute of Dermatology and Department of Dermatology of First Affiliated Hospital, Hefei, China

Objectives This study aimed to investigate the genetic causes of two hypohidrotic ectodermal dysplasia (HED) families and elucidate the molecular pathogenesis in Chinese Han HED patients. Methods Whole-exome sequencing was used to screen HED-related genes in two family members. Sanger sequencing was used to confirm the mutations. Bioinformatics analysis was performed for the mutations. We reviewed the HED-related articles in PubMed. χ2-tests and Fisher’s test were used to analyse the genotype–phenotype correlations. Results (1) Whole-exome sequencing identified two EDA missense mutations, c.1127 C>T (p.T376M; NM_001005609) and c.1133 C>T (p.T378M; NM_001399.4), in family 1 and one EDA nonframeshift deletion mutation c.648 _683delACCTGGTCCTCCAGGTCCTCCTGGTCCTC AAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609) in family 2. Sanger sequencing was performed to validate the mutations. ANNOVAR annotation indicated that c.1127 C>T was a damaging mutation. (2) For the review of published papers, we summarized 68 novel mutations related to HED; 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P=0.021). Conclusion This study identified three EDA gene mutations in two Chinese Han HED families and laid a foundation for gene diagnosis and genetic counselling.

208

2019CSID Poster communication

PO-122 Decreased Hematopoietic Progenitor Kinase 1 Leads to Autoimmunity in Tfh Cells from Systemic Lupus Erythematosus Patients

Qing Zhang1 Zhang Huilin1 Lu Qianjin1 1Second Xiangya Hospital, Central South University

Backgroud T follicular helper cells (Tfh cells) are a newly discovered subset of CD4+ T cells, which play a mainly role in inducing B cells to produce antibody. Tfh cells are over activated in systemic lupus erythematosus (SLE) patients, consequently bring about immune damages. Hematopoietic progenitor kinase 1 (HPK1) can inhibit T cell-mediated immune responses, but the role that HPK1 plays in Tfh cells from SLE patients remain elusive. The aim of this study is to investigate whether HPK1 plays roles in SLE Tfh cells. Methods Naive CD4+ T cells and B cells were isolated from healthy controls and SLE patients. Then Naive CD4+ T cells were induced to differentiate into Tfh cells by stimulating with anti-CD3 antibody, anti-CD28 antibody, IL-6, IL-12, IL-21, and TGF-β. HPK1 mRNA and protein levels in Tfh cells were determined by real-time RT-PCR and western blotting. Detection of IL-21, CXCL13, IFNγ, IL-17A, IgM, IgG1, IgG2a, IgG2b and IgG3 levels were performed by ELISA. Tfh cells proliferations were analyzed with MTT assay. Results We identified HPK1 mRNA and protein levels were significantly decreased in Tfh cells from patients with SLE. Moreover, HPK1 mRNA levels were found to negatively correlated with SLE disease activity as measured by SLE Disease Activity Index (SLEDAI). Down-regulation of HPK1 in healthy Tfh cells significantly accelerated Tfh cells proliferation and productions of IL-21, CXCL13, IFNγ, IgG1, IgG2a, IgG2b, and IgG3. There were no marked changes in IL-17A and IgM amounts. Consistent with these findings, overexpressing HPK1 in SLE Tfh cells caused significant decrease in Tfh cells proliferation and productions of IL-21, CXCL13, IFNγ, IgG1, IgG2a, IgG2b, and IgG3. And there were no significant alters in IL-17A and IgM levels. Conclusion Our results show for the first time that inhibited expression of HPK1 in SLE Tfh cells contributes to Tfh cells overactivation and B cells overstimulation, which lead to the development of SLE at last.

209

2019CSID Poster communication

PO-123 Relationship between downregulated expression of IKBKE mRNA in peripheral blood mononuclear cells and the pathogenesis of systemic lupus erythematosus

Tingting Zhu1 Qian Danfeng1 Hong Jiaqi1 Hong Xiaojie1 Liu Yaoguang1 Chen Min1 Meng Ziyuan1 Zheng Lijun1 Liu Lu1 Zhang Xuejun1 1Institute of Dermatology and Department of Dermatology, the First Affiliated Hospital, Anhui Medical University, Hefei, Anhui, China

Objective The polymorphism of IKBKE has been proven to be associated with systemic lupus erythematosus (SLE) in a genome-wide association study (GWAS) conducted by our group. In this study, we performed a gene expression study to explore whether expression levels of IKBKE contribute to the pathogenesis of SLE. Methods We investigated IKBKE mRNA expression levels in peripheral blood mononuclear cells (PBMCs) from 135 SLE patients and 130 healthy controls using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). Then, we studied the correlation between IKBKE expression level and clinical manifestations and laboratory test parameters in the patients, respectively. In addition, we detected the regulatory effect of SNPs on gene expression by expression quantitative trait loci (eQTL) study. Results The expression levels of IKBKE mRNA in patients with SLE were significantly decreased compared with those in normal controls (P < 0.0001). In SLE patients with vasculitis involved, the expression levels of IKBKE were also significantly decreased compared with other patients in this study (P = 0.0084), otherwise, in patients with oral ulcer affected, the expression levels of IKBKE were extremely increased compared with other patients (P = 0.004). The expression levels of IKBKE were lower in patients with elevated CRP than others with normal CRP level (P = 0.034). The functional annotation and biological insights also indicate that rs2297550maybeinvolved in the pathophysiology of SLE, possibly by regulating IKBKE gene expression in immune cells. Conclusions Our studies might help to improve our understanding of the disease mechanisms and identify some novel specific targets of drug development and clinical intervention in SLE. However, current research has some limitations. we need further studies of more rigorous experiments with large sample sizes.

210

2019CSID Poster communication

PO-124 Differential expression profile of Long non-coding RNA in severe acne and its ceRNA network constructed

Wenjuan Wu1 Yang Xiao1 He Li1 1First Affiliated Hospital of Kunming Medical University, Institute of Dermatology & Venereology of Yunnan province

Background Acne is a common chronic inflammatory skin disease involving hair-follicles and sebaceous glands. It is acknowledged that long non-coding RNAs (lncRNAs) play an important role in several skin diseases, such as malignant melanomas, atopic dermatitis, psoriasis and so on. However, the potential role of lncRNA in pathogenesis of severe acne remains unclear. Objective To investigate differential expression proﬁle of lncRNAs and its potential mechanisms in severe acne. Methods High-throughput RNA sequencing technology and bio-informatics analysis were applied to detective differential expression profile of lncRNAs, miRNAs and mRNAs from 5 severe acne lesions and 7 healthy volunteers. GO and KEGG pathway were employed in the gene enrichment analysis. TargetScan and miRanda software were used to predict miRNA binding sites and targeted prediction of deferentially expressed lncRNA. All of data were integrated to build a lncRNA-miRNA-mRNA network. Results The RNA-seq data showed that 1185 lncRNAs including 419 up-regulated and 766 down-regulated were differential expressed in severe acne samples compared with healthy controls (P < 0.05, FC > 1.5). GO and KEGG analysis indicated that differential expression of lncRNAs primarily referred inflammatory responses, apoptotic process, metabolic process, immune responses, regulation of cell differentiation and signal transduction. Additionally, in all of 45 miRNAs candidates with aberrant expression which consisted of 19 miRNAs showing up- regulated trend, whereas 26 miRNAs displaying down-regulated tendency. LncRNA-miRNA- mRNA network illustrate that lncRNAs act as competing endogenous RNA on target gene expression which may related with cytokine secretion, cell proliferation, apoptotic process, immune response, and signal transduction. Conclusions Our study demonstrated that lncRNAs differentially expressed in severe acne, they may be involved in the pathogenesis of severe acne. LncRNAs could be used as biomarkers to diagnosis or offered a new target treatment of severe acne.

211

2019CSID Poster communication

PO-125 KRT16 Mutation Carriers with Co-manifestation of focal palmoplantar keratoderma and pachyonychia congenital

Yingda Wu1 Li Chengrang1 1Institute of Dermatology, Chinese Academy of Medical Sciences and Peking Union Medical College

Objective Palmoplantar keratoderma (PPK) is a common hereditary cutaneous disorder characterized by marked hyperkeratosis on the surface of palms and soles. PPK has been classified into diffuse, focal, and punctate forms according to the pattern of hyperkeratosis on the palms and soles. Thereinto, focal palmoplantar keratoderma (PPK) is characterized by hyperkeratotic patches usually appearing at weight‐bearing areas. Focal PPKs are usually caused by mutations in KRT6c or KRT16. Pachyonychia congenita (PC) is an autosomal dominant genodermatosis with the main clinical features of hypertrophic nail dystrophy, painful and highly debilitating plantar keratoderma, oral leukokeratosis, and a variety of epidermal cysts. We report a 35-year-old man characterized by focal palmoplantar keratoderma and pachyonychia congenita and want to clarify and analysis the gene mutation in co-manifestion family. Methods Clinical data and blood samples of the family were collected. Potential mutation of the PPK-related genes were scanned in the patient by PCR amplification and direct sequencing. The coding sequences of the KRT16 were also screened in 100 normal controls. Results The family’s PPK-related genes coding sequence and exon-intron junction analysis by Sanger sequencing revealed a heterozygous missense codon mutation c.1259T>C (p.Leu420Pro) variant in exon 6 of the KRT16. This mutation was not detected in unaffected family members and 100 normal individuals. This variant was not present in the found in ExAC nor 1000G. Conclusion In conclusion, we find the new KRT16 gene variant (c.1259T>C) is probably responsible for the disease in the family and contribute to genetic counseling from patients’ family.

212

2019CSID Poster communication

PO-126 Novel mutation in the NF1 gene identified in a Chinese pedigree of neurofibromatosis type 1 combined with a rare comorbidity

Yuanjing Zhang1 Lili Tang1 Xuejun Zhang1 1Department of Dermatology, The First Affiliated Hospital of Anhui Medical University, and Key Laboratory of Dermatology (Anhui Medical University), Ministry of Education, Hefei, China & Key Laboratory of Major Autoimmune Diseases, Anhui Province, Hefei 230022, China.

Object A number of NF1-like disorders present with highly overlapping clinical manifestations and complicated genetic heterogeneity, highlighting the importance of genetic diagnosis. Here, we reported a genetic study in a case with steatocystoma multiplex (SM) and neurofibromatosis type 1 (NF1) characterized by multiple café-au-lait spots within a NF1 Chinese pedigree to provide theoretical basis for the NF1 genetic diagnosis. Methods Peripheral blood samples were collected from this Chinese NF1 pedigree within 10 individuals. Only proband was clinically diagnosed in a rare condition with coexistence of SM and NF1. The proband and his grandfather were selected to conduct the whole-exome sequencing. Screening for disease-associated deleterious mutations was then made, with emphases on the reported NF1 (NF1) and SM (KRT17) gene and confirmed by Sanger sequencing in other samples of the family. Results Here, we present a patient with extremely rare phenotype mixed by NF1 and SM in a NF1 pedigree and identified a novel mutation in the NF1 gene, c. G730A, p. (Glu244Lys). However, no pathogenic mutation in KRT17 gene was identified to be responsible for the development of SM. Conclusions This is the first report of a co-occurrence of NF1 which is characterized by multiple café-au-lait spots and SM. Our data support the correlation of a novel missense substitution within the NF1 gene. This finding will enrich the mutation spectrum of NF1 and may have relevant implications for patients and genetic counseling. But no evidence support the co- occurrence of NF1 and SM could be determined by genetic changes.

213

2019CSID Poster communication

PO-127 Progranulin promotes bleomycin-induced skin sclerosis by enhancing TGF- β/Smad3 signaling through up-regulation of TGF-β type I receptor

Ting Yang1 Zhang Xuemei1 Huang Kun2 1Key Laboratory of Diagnostic Medicine designated by the Ministry of Education, Chongqing Medical University, Chongqing, China 2Department of Dermatology, The First Affiliated Hospital of Chongqing Medical University, Chongqing, China

Progranulin (PGRN) is an autocrine growth factor with numerous physiological and pathologic roles. Previous reports demonstrated PGRNcould increase dermal fibroblasts in wound healing and activate cancer-associated fibroblasts in some cancers. Because systemic sclerosis(SSc) is a prototypical fibrosis-related disorder, here, the aim was to clarify the role and mechanism of PGRN in bleomycin (BLM)-induced model of SSc for the first time. It was observed that the serum PGRN levels were increased in SSc patients compared with healthy controls. Immunohistology and quantitative RT-PCR demonstrated that PGRN was also elevated in the lesion from the mice model of BLM-induced dermal fibrosis. In addition, in BLM-treated mice, PGRN deficiency not only attenuated dermal fibrosis but also decreased the differentiation of myofibroblasts. The reduced progression of skin sclerosis in PGRN-deficient mice was associated with down-regulation of transforming growth factor (TGF)-β receptor I (TβR I) and decreased level of p-Smad3, with correspondingly impaired expression of its downstream target gene connective tissue growth factor (CTGF) in skin lesion. In contrast, exogenous PGRN significantly increased the level of TβR I and p-Smad3 in cultured mouse fibroblasts. This study demonstrates that PGRN plays a promoting role in the development of dermal fibrosis through the activation of the TGF-β/Smad3 signaling via up-regulation of TβR I. PGRN may be a new therapeutic target in SSc.

214

2019CSID Poster communication

PO-128 The Effects of Thalidomide on histamine-induced Human dermal Fibroblasts: at Cell Proliferation, Collagen I mRNA

LiHua Zhang1 Bai YanZhi1 Li YuPing1 Li SuYue1 1Department of Dermatology.The Second Hospital of Hebei Medical Uniersity

Objective To explore the effects of thalidomide on histamine-inducedfibroblast， including cell proliferation ,the expressions on COL-I mRNA. Methods 1 Human dermal fibroblasts were cultured primarily. Cells were identified with detecting the vimentin expression by the dye of immunohistochemistry. Selecting the fourth passages of human dermal fibroblasts for experiments. 2 CCK-8 test for normal human dermal fibroblasts proliferation Fibroblasts cells were plated at a same density in 96-well plates when they had been digested, and each groups were provided 5 sample sizes. The cells were treated with different concentrations of thalidomide for 24h (0, 10-3,10-4, 10-5 mol/L),and the viability at wave length of 560nm was analyzed with CCK-8 assay .. 3 Experimental group and CCK-8 test for histamine-induced human dermal fibroblasts proliferation Experiment was consisted of four groups:control group(K), thalidomide -treated group(S), histamine-treated group(Z), histamine and thalidomide treatde group(Z+S).Fibroblasts cells were platedin 96-well plates at a same density, which concentration is 2×104/ml and each hole was filled whith 200ul. GroupZ+S and Z were treated with 200ul-100UM histamine while groupK and S were treated with onlyDMEM.After 48 hours culture, the four groups’ nutrient medium were gave up.GroupS and Z+S were treated with 10-5 mol/L thalidomide while the other groups were added only DMEM, and each groups were provided 5 sample sizes for another 24 hours culture.Then cell viability was measured using the CCK-8 assay. The expressions of CoL-ImRNA was tested by realtime fluorescence quantitative PCR (SYBR Green I) Following with the same grouping method above,3 samples were provided by each groups. All samples were cultivated in 25ml culture flasks respectively. The total RNA was extracted from cells, then COL-ImRNA wastested with realtime fluorescence quantitative PCR. Results 1 The results of CCK-8

215

2019CSID Poster communication

1.1 The results of CCK-8 in normal human dermal fibroblasts.Among the groups, 10-3,10- 4mol/L groups showed that cells could be inhibited(P<0.05), however, no significant difference between 10-5mol/L group and the control group was found (P>0.05). 1.2 The results of CCK-8 in 100UM histaminehistamine-induced human dermal fibroblasts proliferation. GroupZ’s OD was higher than groupK’s ,there were statistically difference(P<0.05), groupZ+S’s OD was lower than groupZ’s ,there were statistically difference(P<0.05). 2 The expressions on CoL-ImRNA with effection of thalidomide in 100UM histamine- induced human dermal fibroblasts The CoL-ImRNA RQ datas of groupK,S,Z,Z+S were not all equal(P=0.000). GroupS’s RQ was lower than groupK’s and there were statistically difference(P<0.05).GroupZ’s RQ was higher than groupK’s and there were statistically difference(P<0.05).GroupZ+S’s OD was lower than groupZ’s and there were statistically difference(P<0.05). Conclusions 1 Proliferation of fibroblasts and the mRNA expressions of CoL- I were enhancedby histamine in Concentration of 100um. 2 The mRNA expressions of CoL-I were inhibited by 10-5 mol/L-thlidomide obviously on human dermal fibroblasts enhanced by 100um-histamine.

PO-129 The function and molecular mechanisms of miRs-103/107 in regulating autophagy in the epidermis

Sijia Wang1 Zeng Kang1 Peng Han2 Aya Kobeissi 2 Dong Ying3 Kaplan Nihal2 Yang Wending2 He Congcong2 1Nanfang Hospital, Southern Medical University 2Northwestern University 3 the First Affiliated Hospital, Chinese PLA General Hospital

Purpose In our previous studies, we have shown that microRNAs-103 and 107(miRs-103/107) positively regulate end-stage autophagy via ensuring dynamin activity in cultured human limbal epithelial keratinocytes. Most work in end-stage autophagy has been conducted using in vitro model systems. However, in vivo regulation of end-stage autophagy in epidermis remains unknown.

216

2019CSID Poster communication

Methods We used antagomirs to subcutaneously knock-down miR-107 in the mouse skin; conversely, we delivered miR-107 mimic subcutaneously via in vivo transfection to increase this miRNA. Results We found that antagomir-107 treatment in epidermis: (i) depleted endogenous miR-107; (ii) increased GFP-LC3 puncta in epidermal basal layers of GFP-LC3 transgenic mice, indicative of an accumulation of autophagosomes; (iii) inhibited LC3 turnover and increased p62, suggesting an inhibition of autophagy flux; and (iv) increased phosphorylated dynamin (p- dynamin, an inactive form), a key enzyme in end-stage autophagy. Conversely, miR-107 mimic treatment in mouse epidermis: (i) increased miR-107; (ii) decreased GFP-LC3 puncta in epidermal basal layers of GFP-LC3 transgenic mice; (iii) increased LC3 turnover and inhibited p62; and (iv) diminished p-dynamin, indicative of activation of this enzyme. In human epidermal keratinocytes, antagos-103/107 lead to the formation of large vacuoles in the cells and an increase in p-dynamin, which can be rescued by inhibition of PKC pathway. Conclusion Collectively, these results suggest that the miRs-103/107 family have a critical role in regulating end-stage autophagy in mouse epidermis via PLD1/2 / PKC / dynamin pathway.

PO-130 Candida albicans cell wall mannoprotein synergizes with lipopolysaccharide to affect RAW264.7 proliferation, phagocytosis and apoptosis

xingxing bie1 zhang shuguang1 Luo Xue2 Qi Rui-Qun1,3 1The First Hospital of China Medical University 2The 202 Hospital of the People 3NHC/Ministry of Education/Liaoning Province Key Laboratory of Immunodermatology（China Medical University）

With the widespread use of invasive surgery, immunosuppressive therapy and broad- spectrum antibiotics, there has resulted a corresponding increase in severe systemic infections as produced by Candida albicans, as it combines with bacterial infections. Such infections often result in high rates of mortality. In this report, we examined the effects of the c. albicans cell wall mannoprotein (MP) on macrophage immunity. The MTS assay was used to detect cell proliferation activity and neutral red staining to observe cell phagocytosis. The Griess method was used to detect NO secretion in culture supernatants and apoptosis of macrophages were

217

2019CSID Poster communication determined with use of FITC-Annexin V and PI staining. mRNA and protein expressions of JAK2, STAT3, IL-1β, IL-6, TNF-α and iNOS in RAW264.7 cells were determined with use of RT-PCR and western blot. MP significantly promoted the proliferation of RAW264.7 cells, inhibited their phagocytic capacity, but exerted no significant effects on apoptosis of macrophages. In addition, MP not only up-regulated the expression of cytokines, but also the expressions of p-stat3 and p- jak2. Interestingly, when MP was combined with lipopolysaccharide (LPS) a markedly accentuated release of inflammatory cytokines was observed. MP promotes macrophage inflammation induced by LPS and participates in the inflammatory response. One of the potential mechanisms of this effect involves MP activation of the JAK2/STAT3 signaling pathway in RAW264.7 cells, which enables macrophages to transform from M0 to M1 and promote the occurrence of inflammation.

PO-131 Experimental Atopic Dermatitis is Dependent on the TWEAK/Fn14 Signaling Pathway

Yumin Xia1 Liu Qilu1 Wang Huixia1 Wang Xiaoyu1 Xiao Shengxiang1 1The Second Affiliated Hospital of Xi

Objective Tumor necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK) acts through its receptor fibroblast growth factor inducible 14 (Fn14), and participates in skin inflammation. Both TWEAK and Fn14 are highly expressed in skin lesions of patients with atopic dermatitis. The purpose of this study was to further explore the effect of Fn14 inhibition on experimental atopic dermatitis. Methods Experimental atopic dermatitis was induced in the wild-type and Fn14-knockout BALB/c mice. The effect of TWEAK/Fn14 interaction on keratinocytes was studied in an in vitro model of atopic dermatitis. Results Fn14 deficiency ameliorates skin lesions in murine model, accompanied by less infiltration of inflammatory cell and lower local levels of proinflammatory cytokines, including TWEAK, TNF-α, and interleukin (IL)-17. Fn14 deficiency also attenuates the upregulation of TNFR1 in skin lesions of atopic dermatitis. Moreover, topical TWEAK exacerbates skin lesion in the wild-type but not in the Fn14-knockout mice. In vitro, TWEAK enhances the expressions of IL- 17, IL-18, and interferon-γ in keratinocytes under atopic dermatitis-like inflammation.

218

2019CSID Poster communication

Conclusions Fn14 deficiency protects mice from experimental atopic dermatitis, involving the attenuation of inflammatory responses and keratinocyte apoptosis. In the context of atopic dermatitis-like inflammation, TWEAK modulates keratinocytes via a TNFR1-mediated pathway.

PO-132 The synergism of IL-17 and TLR3 signaling: A potential role in injury-amplified psoriatic inflammation

Ning Yu1,2 Ding Yangfeng1,2 Shi Yuling3,2 1Shanghai Skin Disease Hospital 2Institute of Psoriasis, Tongji University School of Medicine 3Department of dermatology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine

Aim Skin injury can trigger formation of new lesions in psoriasis (Koebner phenomenon). The mechanisms through which injury exacerbates psoriasis are unclear. During wound repair, epidermal keratinocytes are activated and produce abundant IL-36g, further promoting the skin inflammation. IL-17A is the cornerstone cytokine in the pathogenesis of psoriasis. We sought to investigate the effects of IL-17A on injury-induced keratinocyte activation and IL-36g production. Methods Normal human epidermal keratinocytes (NHEKs) were stimulated with supernatant from necrotic keratinocytes in the presence of RNase or DNase. IL-36g mRNA was measured by real-time RT-PCT. Expression of TLR3 was knocked down by siRNA. Protein expression of TLR3 was assessed using Western blot. NHEKs were stimulated with supernatant from necrotic keratinocytes for 24 h after TLR3 silencing. IL-36g mRNA and protein were quantified by real-time RT-PCR and ELISA. mRNA of proinflammatory mediators (CCL20, CXCL8, DEFB4, LCN2, CXCL10, and S100A7) was measured by real-time RT-PCR. NHEKs were treated with poly(I:C) and IL-17A. IkBz mRNA and protein were measured by real-time RT-PCR and western blot. NHEKs were stimulated with poly(I:C) and IL-17A after IkBz silencing. IL-36g protein secretion was analyzed by ELISA. mRNA of proinflammatory mediators was measured by real-time RT- PCR. The intracellular phosphorylation state of NF-kB p65 (pp65), p38 MAPK (pp38) and JNK (pJNK) by phospho-flow cytometry. p38 MAPK inhibitor SB203580, NF-kB inhibitor BAY 11-7082, and JNK inhibitor SP600125 adopted to explore the upstream regulators of dsRNA/IL-17A- induced IkBz.

219

2019CSID Poster communication

Results We demonstrated that dsRNA released from necrotic keratinocytes induced the expression of IL-36g. Silencing of TLR3 by siRNA decreased the IL-36g induction by necrotic keratinocyte supernatant. Co-stimulation with dsRNA and IL-17A synergistically increased the expression of IL-36g and other proinflammatory mediators (CCL20, CXCL8, DEFB4, and LCN2) in keratinocytes. The synergistic effects were not dependent on TLR3 upregulation, TNF receptor signaling and mRNA stabilization. Co-stimulation with dsRNA and IL-17A resulted in an accumulation of IkBz. The synergistic upregulation of IL-36g and proinflammatory mediators were inhibited by IkBz siRNA. Co-stimulation with IL-17A and poly(I:C) markedly activated the p38 MAPK and NF-kB pathway, compared with poly(I:C). Blockade of p38 MAPK and NF-kB suppressed dsRNA/IL-17A-mediated IkBz and IL-36g induction. Conclusion These findings demonstrated that IL-17A synergistically enhanced the dsRNA- mediated IL-36g production through a p38 MAPK, NF-kB, and IkBz -dependent mechanism.

PO-133 Anti-apoptotic effect on keratinocytes of IL-22 in psoriasis by mediating Bcl-xL/Bax in the presence of TNF-α and IFN-γ

Yan Zhou1 Han Dan1 1The First Affiliated Hospital of Xi

Objective To investigate the function of IL-22 in apoptosis of psoriasis. Methods We examined IL-22 protein expression in serums using enzyme linked immunosorbent assay (ELISA); IL-22/IL-22R/IL-22BP and apoptosis-related genes in lesions using Quantitative Real-time PCR (RT-qPCR); IL-22R1 in lesions using Immunohistochemistry (IHC) of psoriatic patients. Next, we assessed the psoriasis severity index scores (PSI) and the expression levels of IL-22 and the receptors in lesions with Pearson correlation analysis. Finally, we observed proliferation by MTT, apoptosis effects by flow cytometry and apoptosis-related genes change by RT-qPCR and Western blotting in normal human epidermal keratinocytes (NHEK) treated with IL- 22. Results Compared with healthy controls, the expression levels of IL-22/IL-22R1 was highly upregulated in lesional skin and IL-22 was elevated in serum of psoriatic patients while IL-22BP was not changed. Besides, positive correlations between expression levels of IL-22/IL-22R1 and thickness of lesions of psoriasis. These results suggest that IL-22 may positively regulates abnormal hyperplasia in psoriasis. Additionally, we observed proliferation treated with IL-22 alone

220

2019CSID Poster communication and anti-apoptosis effects in normal human epidermal keratinocytes (NHEK) in the presence of TNF-α and IFN-γ treated with IL-22. Furthermore, IL-22 could upregulate the level of Bcl-xL and downregulate the level of Bax when co-stimulated with TNF-α and IFN-γ in NHEK. IL-22BP could counteract the effects of IL-22. Conclusions In summary, these results suggest IL-22 plays a key role for anti-apoptosis in keratinocytes and IL-22BP contributes to development and maintenance of epidermal apoptosis in psoriasis.

PO-134 Serum Amyloid A, an acute phase protein, induces a psoriatic phenotype in keratinocytes

Ning Yu1 1Shanghai Skin Disease Hospital, Institute of Psoriasis, Tongji University

Objectives Serum amyloid A (SAA), an acute phase protein, is highly expressed in psoriatic lesions but its function is not fully understood. The aim of this study was to explore its role in activation of keratinocytes. Materials and methods Real-time PCR and immunofluorescence were performed to examine SAA expression in imiquimod (IMQ)-induced psoriasis-like mice. In vivo function of SAA was examined by treating psoriasis-like mice with SAA neutralising antibody. Cell viability was monitored using the CCK-8 assay. Real-time PCR was performed to determine expression of genes associated with differentiation and inflammation. Ki67+ percentage and immunological markers were analysed by flow cytometry. Involvement of formyl peptide receptor-like 1 (FPRL1) in SAA signal transduction was determined by RNA interference. Binding of SAA and FPRL1 was examined by co-immunoprecipitaion. Western blotting was conducted to assess phosphorylation of downstream signalling molecules. Results SAA was highly expressed in skin lesions of IMQ-treated psoriasis-like mice and neutralising SAA attenuated epidermal hyperplasia and inflammation. SAA in vitro promoted keratinocyte proliferation and expression of immunological mediators, while inhibiting differentiation. Effects of SAA on keratinocyte proliferation and inflammation were mediated by FPRL1, as well as activation of the PI3K/Akt pathway. Conclusions These observations indicate that SAA/FPRL1 contributed to pathogenesis of psoriasis by promoting keratinocyte proliferation and inflammation, thus providing a potential therapeutic target for disease therapy. 221

2019CSID Poster communication

PO-135 Short-term exposure to Western diet induces spontaneous Th1/Th17-dominant psoriasiform dermatitis

Zhenrui Shi1,2 Wu Xuesong1 Yu Sebastian3 Hwang Samuel1 1University of California, Davis, United States 2Sun Yat-sen Memorial Hospital, Sun Yat-sen University, China 3Kaohsiung Medical University Hospital, Kaohsiung Medical University, Kaohsiung

Background A Western diet (WD) characterized by its high fat and simple sugar content is thought to predispose individuals to inflammatory skin diseases such as psoriasis through the development of obesity. However, this belief is being challenged by emerging data suggesting that dietary components, rather than obesity itself, may exacerbate psoriasis. Objective We sought to determine if exposure to WD increases susceptibility to psoriasiform dermatitis without the need for concurrent obesity and to elucidate mechanisms through which diet contributes to the development of skin inflammation in a mice model that is induced by short- term feeding with WD. Methods After weaning, mice were fed a WD or an otherwise nutritionally matched, control diet (CD) for 1 month. Skin inflammation was evaluated by ear thickness, histologic analysis, quantitative real-time PCR and flow cytometry. Results Short-term feeding for as little as 4 weeks with a diet analogous to the WD in wide-type mice led to spontaneous, clinically and histologically documented skin and joint inflammation before the occurrence of obesity. Exposure to WD promoted accumulation of IL-17A-producing γδ-low (GDL) T cells and led to a Th1/Th17 dominant response in the skin. TCRδ-deficient and chemokine receptor 6 (CCR6)-deficient mice on WD showed reduced skin inflammation with suppressed IL-17A expression. γδ T cells from WD-fed mice exhibited higher IL-23R expression and an increased potential to produce IL-17A after IL-23 stimulation. Conclusion Our data describes a spontaneous model to understand the role of dietary influences in regulating inflammatory susceptibility in the skin and joints. The regulation of IL-23 pathways may be key to the development of WD-associated psoriasiform dermatitis and joint inflammation. This work demonstrates that diet alone can induce a psoriasis-like condition in both joints and skin of mice, emphasizing the role of dietary influencs in psoriasis susceptibility in humans.

222

2019CSID Poster communication

PO-136 The transcriptional profile of macrophage in response to mycobacterium leprae sonicate stimulation

hong liu1 Mi Zihao1 Yu Yueqian1 Wang Zhenzhen1 Zhang Furen1 1Provincial Hospital For skin diseases, Affiliated to Shandong First Medical University

Objectives To investigated the immune response of THP-1 derived macrophage stimulated with Mycobacterium leprae sonicate (MLS) to verify the genetical associations of leprosy susceptibility genes. Methods We sequenced the expression of mRNA, long non-coding RNA (lncRNA) and microRNA of THP-1 derived macrophage. And compared the RNAome of MLS stimulated macrophages with unstimulated macrophages. Results In total, 133 mRNAs, 28 lncRNAs and 4 microRNAs were observed to be significantly differentially expressed in MLS stimulated macrophage. KEGG pathway enrichment of differentially expressed mRNA and lncRNA both demonstrated that TNF signaling, NF-κB signaling, cytokine-cytokine receptor interaction, chemokine signaling, NOD-like receptor signaling and TLR signaling pathway were involved in the immune response. The inflammation mediator miR-146 and miR-122 which can regulate interferons signaling pathway were also found to be up regulated in the MLS stimulated macrophage. Conclusions Our in vitro transcriptional profile further confirmed the involvement of these immune pathways that genetically associated with leprosy, providing an in vitro disease model for further leprosy pathogenesis studies.

223

2019CSID Poster communication

PO-137 miRNA-146a regulates CD11c+CD11bhi myeloid DC development and controls Th1/Th17 differentiation mediated by TLR9 ligand CpG-ODN activated DCs

Yingping XU1 Zhang Jun1 Mi Qingsheng2 1Dematology Hospital of Nanfang Medical University 2Institute of Dermatology and Immunology of Heryford Hospital System

Objective To study the role of miR-146a in regulating TLR9-mediated DCs function in vivo using miR-146a knockout (miR-146aKO) mice. Materials and Methods In the case of TLR ligands treated or not, miR146a expression of BMDCs was tested by RT-PCR and the phenotype of DCs were analyzed using flow cytometry; the function of DCs from miR-146aKO and wild type (WT) mice activated with TLR9 agonist were tested by analyzing CD4+ T cell proliferation and differentiation; splenic DCs population from miR- 146aKO and WT mice were analyzed by FACS. Bone marrow chimeras was used to test the effect of miR-146a on the development and function of DCs in a cell autonomous fashion. Results We observed a strong induction of miR-146a expression in BMDCs activated by TLR9 ligand CpG-ODN, and DCs from miR-146aKO mice significantly enhanced Th1/Th17 differentiation upon CpG-ODN stimulation compared to that of WT mice. The splenic cDC, especially CD11c+CD11bhi subset, was dramatically reduced in miR-146aKO mice compared to WT mice. Bone marrow transferring experiments indicated that functional changes of CpG-ODN- mediated cDCs and reduced splenic cDCs in miR-146aKO mice were cell-intrinsic. Conclusions miR-146a plays a critical role in the maintenance of immune balance by regulating the development and function of cDCs during microbial infection.

224

2019CSID Poster communication

PO-138 Neutrophil extracellular traps exacerbate psoriasis via activating AIM2 inflammasome of keratinocyte

Xu Yuan1 Wang Gang1 1Xijing Hospital, Fourth Military Medical University

Background Neutrophil extracellular trap (NET), a novel structure formed by a new cell death pathway called NETosis, is consist of DNA, citrullinated histones, proteases and various cytokines. In addition to antimicrobial function, it plays an intriguing role in exacerbating autoimmune diseases including Systemic Lupus Erythematosus (SLE), Inflammatory Bowel Disease (IBD), gout and psoriasis. However, the mechanism behind this phenomenon is still unclear. Objective This study aimed to assess if NETs can activate AIM2 inflammasome in keratinocyte and uncover the mechanism of AIM2 involved in the development of psoriasis. Methods Neutrophils from psoriasis vulgaris patients were isolated, and NETs were induced, extracted and quantified. Normal human keratinocytes were seeded and stimulated with NETs extraction, PBS or dsDNA for 48 hours. The activation of AIM2 inflammasome, production and secretion of downstream cytokines were measured by western blot analysis, ELISA and immunofluorescence microscopy. Wild type C57 mice were pre-injected by saline or Cl-amidine 4 hours before treated by imiquimod or vesline. Psoriasis-like symptoms were analysed by direct observation and HE stainning. Results Compared with control group, our study shows that AIM2 inflammasome were significantly increased after stimulated by NET, as well as downstream cleaved-caspase-1 and mature-IL-1β. The levels of these indexes collapsed after interfering with the expression of AIM2 inflammasome. In addition, the above-mentioned phenomena, verified by mouse model, suggest that the elimination of NETs is capable of inhibiting the activation of inflammasome and reducing the secretion of IL-1βas well as alleviating psoriasis-like symptoms. Furthermore, we observed that increased expression of AIM2 exacerbates the production and secretion of cytokines via activation of NOD signaling pathway by XIAP (X-linked Inhibitor of apoptosis protein)-RIP2 (receptor-interacting protein kinase 2) interation. Conclusions Collectively, these results further reveal a novel role of NETs in shaping the autoinflammatory response of psoriasis, as an inflammasome activator and consequently exacerbates psoriasis symptom by NOD signaling pathway.

225

2019CSID Poster communication

PO-139 Whole genome sequencing of Chinese Treponema pallidum subsp. pallidum isolates：an improved method for sequencing directly from clinical specimens.

Wentao Chen1 Jonathan Parr2 Hu Yongfei1 Ke Wujian1 Yang Bin1 Jonathan James2 Zheng Heping1 1Dermatology hospital of Southern Medical University 2University of North Carolina at Chapel hill

Treponema pallidum subsp. pallidum (TPA) cause the sexually transmitted disease syphilis. Due to the absence of in vitro well-cultured models and the constraints of its rabbit propagation, the genomic insight to fully comprehend TPA was still absent. Sequencing TPA directly from the clinical specimen using a special capture strategy has been reporting previously, but the constraint associated with a low number of treponema in the clinical specimen is still present. In the present study, an improved method of special capture strategy associated with whole genome amplification was described and used successfully for whole-genome sequencing of 6 Chinese TPA isolates, which suffered freeze-dry and long-term shipment. We first sequenced TPA directly from patients’ specimens in China. A genome of Nichols-like strain from the clinical specimen in China was reported first, while most strains reported recently were SS14-like strains. Our funding provides a suitable approach to sequence tiny DNA of TPA in clinical specimens and to understand the global genomic diversity of TPA.

PO-140 TRPM2-dependent autophagy inhibition exacerbates oxidative stress-induced CXCL16 secretion by keratinocytes

Pan Kang1 Li Shuli1 Wang Gang1 Gao Tianwen1 Li Chunying1 1Xijing hospital, Fourth Military Medical University, 127 Changle Western Road, Xi’an, Shaanxi, China

Objective Oxidative stress promotes the migration of CD8+ T cells to epidermis by promoting the chemokine CXCL16 secrete from keratinocytes, which then lead to epidermal cells destruction.

226

2019CSID Poster communication

Autophagy is an essential catabolic degradation process for cell homeostasis, it acts as an important cellular antioxidant pathway to relieve oxidative stress. We aimed to explore whether autophagy play a critical role in oxidative stress-induced CXCL16 secretion by keratinocytes.

Methods We treated human keratinocytes cell line HaCaT with H2O2 to construct oxidative stress model of keratinocytes, and pretreated HaCaT with autophagy inhibitor chloroquine(CQ), autophagy activator rapamycin(RAP), TRPM2 inhibitor or TRPM2 siRNA, then we detected the the level of CXCL16 by ELISA, the expression of LC3, the number of LC3 puncta and autophagosome were detected by Western Blot, Laser confocal microscopy and Transmission electron microscopy respectively.

Results We initially found that 500 µM H2O2 promoted the secretion of CXCL16, accompanied by a decrease in the expression of LC3II, an autophagic marker, and a decrease in the number of

LC3 puncta and autophagosome, suggesting that 500 µM H2O2 actually inhibit autophagy.

Furthermore, CQ aggravated H2O2-induced CXCL16 secretion, while RAP alleviated H2O2- induced CXCL16 secretion. More importantly, we found that TRPM2 inhibitor or knockdown of

TRPM2 ameliorated H2O2-induced autophagy disorder and inhibited CXCL16 secretion. Conclusion Our study demonstrated that TRPM2 mediates autophagy inhibition under oxidative stress accelerated CXCL16 secretion in keratinocytes.

PO-141 MiR-101-3p down-regulates TLR2 expression, leading to reduction in cytokine production by T. pallidum-stimulated macrophages

Tao Huang1 Yang Jieyi1 Yang Bin1 Zheng Heping1 1Research Center

Treponema pallidum (Tp) infection induced immune responses can cause tissue damage. But the underlying mechanisms by which T. pallidum infection induces immune response is unclear. Recent studies suggest a regulatory role of MicroRNAs (miRNAs) in host immunity. We assessed here whether miRNA also plays a regulatory role in immune response to Tp infection in vitro. Our results showed that miR-101-3p were significantly higher in PBMCs of patients with primary syphilis and syphilis at serofast state, while TLR2 were higher in untreated patients in comparison to healthy controls. In vitro, stimulation of THP-1 cells with Tp increased miR-101-3p expression. Moreover, miR-101-3p lowered expression levels of TLR2 mRNA and protein in THP- 1 cells, via binding to the 3’UTR of TLR2. Likewise, miR-101-3p inhibited production of pro-

227

2019CSID Poster communication inflammatory cytokines, including IL1β, IL6 and IL12, in macrophages stimulated with Tp. Furthermore, the levels of IL1β and IL6 mRNA were down-regulated by transfection of macrophages with TLR2-specific siRNA. Conversely, overexpression of TLR2 up-regulated cytokine expression. Finally, among subtypes of syphilis, patients with secondary syphilis exhibited the highest levels of plasma IL6, which negatively correlated with miR-101-3p. In conclusion, Tp. infection can upregulate miR-101-3p expression, which in turn, inhibitsTLR2 signaling pathway, leading to reduction in cytokine production.

PO-142 MP participates in the inflammatory response by promoting LPS- induced macrophage inflammatory response

Xingxing Bie1 Zhang Shuguang1 Qi Rui-Qun1 Luo Xue2 1The First Hospital of China Medical University 2The 202 Hospital of the People

Background In recent years, the infection of candida albicans has increased by more than 20 times due to the widespread use of immunosuppressant, broad-spectrum antibiotics and antitumor drugs. Candida albicans infection is not only difficult to diagnose, but also has a high mortality rate. In this report, we examined the effects of the C. albicans cell wall mannoprotein (MP) on macrophage immunity. Methods The MTS assay was used to detect cell proliferation activity and neutral red staining to observe cell phagocytosis. The Griess method was used to detect NO secretion in culture supernatants and apoptosis of macrophages were determined with use of FITC-Annexin V and PI staining. mRNA and protein expressions of JAK2, STAT3, IL-1β, IL-6, TNF-α and iNOS in RAW264.7 cells were determined with use of RT-PCR and western blot. Results MP significantly promoted the proliferation of RAW264.7 cells, inhibited their phagocytic capacity, but exerted no significant effects on apoptosis of macrophages. In addition, MP not only up-regulated the expression of cytokines, but also the expressions of p-stat3 and p-jak2. Interestingly, when MP was combined with lipopolysaccharide (LPS) a markedly accentuated release of inflammatory cytokines was observed. Conclusion MP participates in the inflammatory response by promoting LPS-induced macrophage inflammatory response. The JAK2/STAT3 signaling pathway is one of the important signaling pathways for MP to participate in LPS-induced macrophage inflammatory response. Our

228

2019CSID Poster communication study also found that MP participates in LPS-induced inflammation by promoting the transformation of RAW264.7 from M0 to M1.

PO-143 Effect of activation of PPARγ pathway on Chlamydia trachomatis infection

Xueying Yu1 Zheng Heping2 Xue Yaohua2 1Anhui Medical University 2Dermatology Hospital of Southern Medical University

Objective Host-directed therapy (HDT) is a new direction for the treatment of microbial infections. The drug interferes with the growth and development of pathogens in cells by targeting the host. Studies have shown that the growth of Chlamydia trachomatis depends on the MAPK/ERK signaling pathway of the host. Inhibition of Erk1/2 can inhibit Chlamydia trachomatis infection, and PPARγ is a downstream signal molecule of MAPK/ERK. Inhibition of Erk1/2 can reduce the expression of PPARγ.The expression of PPARγ is inhibited when Chlamydia trachomatis infect. To investigate whether activation of PPARγ can inhibit infection by Chlamydia trachomatis. Methods HeLa cells were infected with D-type Chlamydia trachomatis with MOI=0.15, centrifuged at 1500r/min for 1h, placed at 37°C and 5% CO2 incubator for 1h. They were divided into 3 groups: negative control group, positive control group and rosiglitazone treatment (addition of PPARγ agonist rosiglitazone 50umol/L); the three groups were cultured in 37 ° C, 5% CO2 incubator for 48h. The size and numbers of inclusion were applied to determine the pathogen infectivity using the monoclonal fluorescent antibody staining. The aberrant bodies of Chlamydia trachomatis in the inclusion body was observed by electron microscopy. At the same time, the primary infection of Chlamydia trachomatis were collected from the positive control and rosiglitazone treatment group, and the new monolayer HeLa cells were infected and counted after 72 hours of culture. The titer of chlamydial infection of the progeny was evaluated. Results Immunofluorescence staining showed that the positive control infection rate was 12.33±0.78% (mean ± SEM), the inclusion body area was 388.1 ± 14.65 um2 (mean ± SEM), and the infection rate of rosiglitazone treatment group was 6.508±0.62%. 244.0± 8.370 um2; the infection rate of Chlamydia trachomatis and the area of inclusion body were significantly lower in the treatment group than in the positive control group. The difference between the two groups was statistically significant (p<0.05). Electron microscopic observation was performed 48 hours

229

2019CSID Poster communication after Chlamydia trachomatis infection. Typical RB and EB forms of inclusions were observed in chlamydial-infected cells, with a large number of typical EBs. The inclusions in the rosiglitazone treatment group became smaller and contained irregular RBs; the positive control of the progeny chlamydia infection titer was 3× 105IFU/ml, the rosiglitazone treatment group was 700IFU/ml, and the difference between the two groups was statistically significant(p<0.05). Conclusion The activation of PPARγ pathway can inhibit the growth of Chlamydia trachomatis.

PO-144 Depression mediated Melanin-Concentrating Hormone triggers NLRP3 inflammasome activation via immunometabolism pathway in psoriasis

Jie Lei1 Chen Jiaoling1 Dang Erle1 Zhang Chen1 1Xijing hospital

Objective To reveal the potential mechanism of how psychiatric disorder mediated MCH impact on psoriasis pathogenesis. Methods Psoriasis patients with depression disorder serum were collected with control serum from 2016~2018. Using ELISA and Western Blot to detect MCH system expression and the relationship with depression and PASI. Depression disorder mice model were used to clarify the role of MCH system and the data analyzed with mouse inflammasome PCR array. Furthermore, MCH regulating energy metabolism through MCH receptor1 by detecting ATP consumption, glucose uptake, ROS and MS analysis the glucose pathway on HaCat and primer Keratinocyte cell line. Further, we using molecular biology methods to screening the pathway to active NLRP3 inflmmasome and stimulated inflammatory factors. Finally, IMQ-mouse model was used to conferm the effect of MCH on Keratinocyte. Results MCH higher expressed on psoriatic serum and positively correlation with PASI, meanwhile, MCHR1 expressed on psoriasis lesions skin and up regulated by inflammatory factors stimulation whereas non-expression on healthy keratinocyte. In Depressive disorder mice, MCH was high expressed. The IMQ induced depressive disorder mice showed higher inflammatory cell infiltration, but psoriatic phenotype alleviated by treating with the MCHR1 antagonist-ATC0175. MCH system was found to promote glycolysis process on HaCat and primer keratinocyte cells by up regulated glucose, generated ATP and ROS. Meanwhile, The pathway screening shows the up-regulated p-PKM2 is the vital factor to mediated NLRP3

230

2019CSID Poster communication inflammasome activation. Furthermore, Hsp90AB1 expression was increased to stabilize Hif-1α deubiquitination level which is the key factor to trigger glycolysis process. Finally, we used IMQ mice model to confirm that the function of MCH as a pro-inflammatory factor that facilitates psoriasis development. Conclusion Mental factor related neuropeptide-MCH promote keratinocyte glycolysis process and further active NLRP3 inlfmmasome via Hif-1α/PKM2 pathway.

PO-145 IL-17 promotes positive feedback of inflammation of psoriasis keratinocytes by inhibiting the expression of NFKBIA

Ping Xia1 1Wuhan No.1 hospital

Objective To investigate the potential mechanism of positive feedback to IL-17 of psoriasis keratinocytes. Methods The expression of IL-17 and NFKBIA in psoriasis samples were detected by qRT-PCR. The expression of NFKBIA in human keratinocytes after treatment with different concentrations of IL-17 for 24h and 48h were detected by qRT-PCR. The expression of NFKBIA protein in keratinocytes after treatment with 100ng/ml IL-17 for 0min、10min、20min、30min and 60min were detected by Western blot. The expression of CCL20、IL-8、defensin and S100A7 of keratinocytes after treatment with 100 ng/mL IL-17 for 24h and 48h were detected by qRT-PCR. The expression of CCL20, IL-8 in keratinocytes after treatment with NFKBIA phosphorylation inhibitor and IL-17 for 24h were detected by qRT-PCR. Results The expression of IL-17 was increased while expression of NFKBIA was decreased in psoriasis samples. The expression of NFKBIA mRNA was no changed in the human keratinocytes after treatment with different concentrations of IL-17 for 24h, but upregulated for 48h, which was no related with the concentration of IL-17. But the expression of NFKBIA protein was decreased in the keratinocytes treated by IL-17 at the time of 30min and 60min. The expression of CCL20、IL-8、defensin and S100A7 were increased after the treatment with 100ng/ml IL-17 for 24h, and even higher after treatment for 48h. The expression of CCL20, IL-8 in keratinocytes after treatment with NFKBIA phosphorylation inhibitor and IL-17 were obviously decreased.

231

2019CSID Poster communication

Conclusion The positive feedback of keratinocytes to IL-17 in psoriasis may be related with the downregulated expression of NFKBIA.

PO-146 Dynamic cytokine profiles combined with ELISPOT assay are useful in immunologically confirming the dapsone hypersensitivity syndrome

Lele Sun1 You Jiabao1 Zhao Qing1 Zhang Hui1 Huai Pengcheng1 Yu Gongqi1 Wang Zhenzhen1 Mi Zihao1 Liu Hong1 Zhang Furen1 1Shandong Provincial Institute of Dermatology and Veneurology & Provincial Hospital for Skin Diseases, Shandong First Medical University & Shandong Academy of Medical Science

Background Dapsone hypersensitivity syndrome (DHS) is induced by drug-specific T cells. The specific dynamic cytokine profiles of DHS are unknown and the diagnosis of DHS in clinical practice remains a challenge. Objective To investigate the DHS specific dynamic cytokine profiles, and evaluate whether employing various cytokines could improve the sensitivity of enzyme-linked immunospot (ELISPOT) assay in diagnosis of DHS. Methods Eight types of cytokine levels (IFN-γ, IL-4, IL-5, IL-10, IL-13, IL-17A, IL-22 and TNF-α) in DHS patients and dapsone tolerant patients carrying HLA-B*13:01 were analyzed using electrochemiluminescense (ECL) on a platform from MesoScale Discovery (MSD). The performance of a modified ELISPOT assay in immunologically confirming DHS was evaluated in 16 DHS patients, four dapsone tolerant patients and six healthy donors. Results Dynamic cytokine profiles showed that IFN-γ, IL-5, IL-13 and TNF-α were specifically up- regulated expression in DHS. In 16 patients with DHS, 8 (50%) patients were positive on IFN-γ ELISpot and 11 (68.8%) patients were positive on IL-5 ELISpot, and when combination of IFN-γ and IL-5 ELISpot, the sensitivity increased to 75% (12/16) with the specifity of 100%. Conclusions We emphasized that dynamic cytokine profiles combined with ELISPOT assay is an attractive technique to identify a drug hypersensitivity reaction (DHR).

232

2019CSID Poster communication

PO-147 Nest-PCR improves the detection rate of non-tuberculosis Mycobacterium infection in the skin samples of clinical infective granuloma

Qing Pan1,2 Bao Fangfang1,2 Sun Lele1,2 Wang Chuan1,2 Mi Zihao1,2 Wang Zhenzhen1,2 Liu Hong1,2 Zhang Furen1,2 1Shandong Provincial Institute of Dermatology and Veneurology & Provincial Hospital for Skin Diseases 2Shandong First Medical University & Shandong Academy of Medical Science

Background In the past few years, the prevalence of non-tuberculosis mycobacterium (NTM) infection has been on the rise. Clinical manifestations of mycobacterium tuberculosis infection are very similar to those of non-mycobacterium tuberculosis infection. Therefore, the identification of NTM has attracted much attention. Objectives In clinic, molecular biology technology has been applied more and more in the detection of non-tuberculosis mycobacterium (NTM). The detection method has obvious advantages, fast, accurate and high sensitivity. The aim of this study was to evaluate the detection rate of NTM by different methods:PCR、Nest-PCR、culture. Methods We have collected a total of 41 clinical tissues with infectious granuloma , referred to the Shandong Provincial Hospital of Dermatology, China,during 2018 to April 2019, were investigated. The three methods of PCR, Nest-PCR and culture were used to detect NTM in 41 samples at the same time, and the detection rate was compared. The 16S rRNA, hsp65, rpoB and rRNA 16S-23S genes were sequenced by PCR to identify NTM. The 16S rDNA gene was amplified by Nest-PCR. And the acidic Roche Medium was used to culture these tissue samples. In this study, Nest-PCR and PCR were used to detect the DNA samples of M. marinum colonies 10-fold serial diluted continuously in gradient to evaluate their sensitivity. Results The results showed that 1 case was positive identified by PCR, and it was M. marinum. But, there were 13 samples were NTM positive by Nest-PCR. Meanwhile, Roche solid medium was used to culture these tissue samples, and the results were positive in 8 cases. The positive rate of culture method was higher than that of PCR, but the culture time was long and lasted at least 7 days. And the positive rate of Nest-PCR was higher than that of PCR and culture. Nest- PCR was more sensitive than PCR.

233

2019CSID Poster communication

Conclusions Nest-PCR has the advantages of rapid, sensitive and accurate, and it is expected to be widely used in clinical NTM detection. It can be combined with culture methods to better assist clinical diagnosis and treatment.

PO-148 Changes in intestinal microflora are closely related to the development of psoriasis vulgaris

Ling Chen1 Sun Chaonan2 Shen Zhu3,2 1Department of Dermatology, Daping Hospital, Army Medical University 2 School of Medicine, University of Electronic Science and Technology of China 3 Institute of Dermatology and Venereology, Sichuan Academy of Medical Sciences & Sichuan Provincial People

Objectives Previous studies have shown that intestinal microflora disorder is closely related to the occurrence and / or development of systemic chronic low-grade inflammation, including insulin resistance and chronic fatigue syndrome. Our earlier epidemiological survey showed that, compared to the general population, psoriasis patients had higher frequency of abdominal distension, constipation, and lower abdominal discomfort. The aim of this study is to determine the relationship between the changes of the intestinal microflora and the development of psoriasis vulgaris. Methods The intestinal microflora is more complex, and many microbes in the fecal sample are difficult to cultivate normally. We extracted the genomic DNA of the stool samples from patients with psoriasis, and constructed small-fragment library for cluster analysis according to regional characteristics of 16S rDNA. We analyzed the diversity of the intestinal microflora from the samples before and after the treatment through species annotation, abundance analysis and diversity analysis. The effects of changes in intestinal microflora on the skin lesion of psoriatic mouse model have also been investigated. Results We showed that the intestinal microflora in patients with psoriasis vulgaris have been changed before and after treatment. Our results suggest the changes in intestinal microflora play vital roles in the development of psoriasis mouse model. Conclusions Our preliminary study showed that changes in intestinal microflora are closely related to the development of psoriasis vulgaris. Altered intestinal microflora may be involved in

234

2019CSID Poster communication the regulation of the development of psoriasis by affecting the chronic inflammatory response. However, further studies are needed for the specific mechanisms.

PO-149 Synergistic Activity of Chlorhexidine Combined with Bifonazole against Candida species

Jinqing Zhang1 Zhang Di1 He Yanling1 1Department of dermatology, Beijing Chao-Yang Hospital, Capital Medical University Beijing

Objectives To test the antifungal activity of the sterilizing agent chlorhexidine(CHX) alone or in combination with the antifungal agent bifonazole (BFZ) against 17 clinical isolates of Candida spp.. Methods A standardized broth microdilution method and a disk diffusion test were used. Results We found that the minimal inhibitory concentrations (MICs) for CHX alone against Candida spp. was over 16 μg/mL. however, a strong synergistic interaction was observed for combinations of CHX with BFZ against Candida spp.(fractional inhibitory concentration index(FICI) <0.5) . In addition, the inhibition zone diameters of CHX combined with BFZ were all larger than CHX or BFZ alone, respectively. Conclusion The combination of CHX with BFZ showed synergistic activity in vitro against all Candida isolates.

PO-150 The role of B cell subsets gated by CD24/CD38 in patients with syphilis infection

Jun Zhang1 Huang Tao1 Chen Wentao1 Zheng Heping1 1Southern Medical University, Dermatology hospital

Syphilis is one of the most common sexually transmitted disease caused by Treponema pallidum subsp. pallidum (T. pallidum)1. It is associated with high morbidity. As we know, B cells mainly participate in humoral immunity and play an important role in the clearance of T. pallidum

235

2019CSID Poster communication by secreting antibodies. Nowadays, diagnosis of syphilis relies on serological testing for antibodies induced by treponemal (i.e., Tp47k, Tp17k)2 and nontreponemal (i.e., lecithin, cholesterol, cardiolipin) antigens. However, it is poorly known the role of B cell subpopulations in syphilis infection. Emerging studies demonstrate that a subset of B cells has immunosuppressive functions, which is referred to as regulatory B cells (Bregs)3. More and more studies have focused on Bregs in autoimmune and infectious disease in humans. In rheumatoid arthritis, CD19+ CD24hi CD38hi Bregs (immature B cells) primarily produced IL-10 to suppress helper T (Th) 1 and Th17-cell differentiation while inducing regulatory T (Treg) cells conversion4. In chronic HBV infection, CD19+ CD24hi CD38hi Bregs restricted the secretion of cytokines from CD4+ T cells and induced the production of Tregs5. These studies highlighted the importance of Bregs in immune response. However, to our knowledge, researches paying attention to Bregs in syphilis are still limited. To evaluate the role of B cells in syphilis, peripheral blood from 51 syphilis patients and 16 healthy volunteers were collected. The cells were stained with anti-CD19, anti-CD24 and anti- CD38 antibodies. B cell subsets were gated as shown in Figure 1A. The results showed that total CD19+ B cells had no significant difference between syphilis patients and healthy controls (Data not shown). However, both mature CD19+ CD24int CD38int cells (35.57% ± 2.94%) and CD19+ CD24hi CD38hi Bregs (1.78% ± 0.36%) from untreated syphilis patients were significantly decreased compared to that of controls (46.64% ± 1.98%, p < 0.01 and 2.92% ± 0.41%, p < 0.05) (Fig. 1B). Thus, subtypes of B cells in syphilis patients without treatment were impaired. For the patients after treatment, the frequencies of mature CD19+ CD24int CD38int subpopulation were significantly decreased in serofast (31.44% ± 2.88%) compared with control (46.64% ± 1.98%, p < 0.001) and serological cure (42.36% ± 3.44%, p < 0.05) (Fig. 1C). These data suggested that mature CD19+ CD24int CD38int cells were altered in serofast patients, which in contrast were rescued in serological cure. Moreover, the proportions of CD19+ CD24hi CD38hi Bregs were dramatically decreased in serofast (1.05% ± 0.16%) and serological cure (1.62% ± 0.35%) compared to that of control (2.92% ± 0.41%, p < 0.001 vs p < 0.05) (Fig. 1C). These above results demonstrated CD19+ CD24hi CD38hi Bregs were damaged in syphilis subjects even after treatment. In summary, B cell subsets were dramatically changed in syphilis patients, which indicated that humoral immune response played a vital role in syphilis. Further investigations of Bregs and mature B cells involved in syphilis may provide new therapy strategies.

236

2019CSID Poster communication

PO-151 Tranilast can alleviate melanocytes injury by inhibiting the release of IL-1β in keratinocytes under oxidative stress

sen guo1 kang pan1 li shuli1 wang gang1 li chunying1 1Department of Dermatology, Xijing hospital, Fourth Military Medical University

Objective The release of IL-1β by keratinocytes can cause melanocyte damage. Our previous studies found that oxidative stress promotes the activation of NFRP3 inflammasome in keratinocytes and promotes IL-1β release. Previous studies have found that tranilast inhibits NLRP3 oligomerzation. We investigated whether tranilast can protect melanocyte damage under oxidative stress by inhibiting the activation of NLRP3 inflammasome in keratinocytes. Methods Human keratinocytes cell line HaCaT were pretreated with tranilast for 24h, followed by the stimulation of H2O2 for 24h, subsequently, normal human melanocytes cell line PIG1 were incubated with corresponding HaCaT supernatants. Then we detected NLRP3 oligomers by SDD- PAGE, NLRP3 inflammasome-related indicators, apoptosis-related indicators and melanin synthesis-related indicators were detected by qRT-PCR, Western blotting and Flow Cytometry, the production of IL-1β was detected by ELISA, Caspase1 enzyme activity and tyrosinase activity were detected by corresponding kits, respectively.

Results We initially found that tranilast inhibited H2O2-induced NLRP3 oligomers formation, cleaved-caspase1 and cleaved-IL-1β upregulation, accompanied by a decrease in the caspase1 enzyme activity and IL-1β releasion in HaCaT, suggesting that tranilast actually inhibit activation of NLRP3 inflammasome induced by H2O2 in HaCaT. Furthermore, incubation with the corresponding HaCaT cell supernatant reduced the apoptosis rate of PIG1 cells in the tranilast group compared with the H2O2 group. Conclusion Our study demonstrated that tranilast can inhibit the release of IL-1β by inhibiting the activation of NLRP3 inflammasome in keratinocytes under oxidative stress, thereby alleviated the apoptosis and the disorder of melanogenesis in melanocyte induced by IL-1β.

237

2019CSID Poster communication

PO-152 Interleukin-18 exacerbates skin inflammation and affects microabscesses and scale formation in a mouse model of imiquimod-induced psoriasis

Xueli Niu1 1China Medical University

Background As a potent pro-inflammatory cytokine of the interleukin (IL)-1 family, IL-18 was elevated in early active and progressive plaque-type psoriatic lesions and that serum or plasma levels of IL-18 correlated with the Psoriasis Area and Severity Index (PASI). Although results from previous studies have established that IL-18 may aggravate psoriatic inflammation, the mechanisms of this process remain unknown. In this study, IL-18 knock out (KO) mice and wild- type (WT) mice were used to investigate the effects of IL-18 within a mouse model of psoriasis. Methods WT and IL-18 KO mice were divided into four groups, including imiquimod (IMQ)- treated IL-18 KO group (n=11) and WT group (n=13) as well as their respectively gene-matched control mice (receiving vaseline; n=12). PASI scores were used to evaluate psoriatic lesions in IMQ-treated mice. Pathological features and dermal cellular infiltration were investigated by hematoxylin and eosin staining. The levels of psoriasis-related cytokines including IL-23, IL-17, IL-12, IL-1b, IFNg, IL-15, IL-27, and IL-4 were tested by real-time polymerase chain reaction (PCR). The protein level of IL-1b, IL-27, CXCL1, and Ly6g were investigated by immunohistochemistry (IHC). Results Acanthosis (98.46±14.12 vs. 222.68±71.10mm, P<0.01) and dermal cell infiltration (572.25±47.45 vs. 762.47±59.59 cells/field, P<0.01) were significantly milder in IMQ-induced IL- 18 KO mice compared with that in WT mice. IMQ-inducedIL-18 KO mice manifested larger areas of Munro microabscesses (11,467.83±5112.09 vs. 4093.19±2591.88mm2, P<0.01) andscales (100,935.24±41,167.77 vs. 41,604.41±14,184.10mm2, P<0.01) as compared with WT mice. In skin lesions of IL-18 KO mice, the expressions of IL-1b, IL-4, and IL-27 were all significantly upregulated but IL-17 was decreased. Histologically, strong positive signals of Ly6g were observed within the epidermis of IL-18 KO mice but expressions of CXCL1 were decreased. Conclusions IL-18 may exacerbate prominent inflammation and influence pathological features in IMQ-induced mouse model of psoriasis. IL-18 may upregulate pro-inflammatory cytokines and reduce protective cytokines, thus aggravating psoriatic inflammation. In addition, IL-18 may be involved in the formation of Munro microabscesses and scales.

238

2019CSID Poster communication

PO-153 Comprehensive analysis of ceRNA expression profiles in patients with cryptococcosis

Lei Zhang1 Zhang Keming1 Liao Wanqing1 Pan Weihua1 1Shanghai Changzheng Hospital

Background Cryptococcosis is a common systemic fungal disease caused primarily by Cryptococcus neoformans. At present, the systematic changes in the level of the host gene transcriptome during cryptococcal infection are still unclear. Method After isolation of peripheral blood mononuclear cells from patients with cryptococcal meningitis, high-throughput microarray technique was used to identify and differentially express lncRNA and mRNA expression profiles; GO and KEGG were used to enrich the pathways of differential genes; The lncRNA and mRNA co-expression network were analyzed . The differentially expressed lncRNA and mRNA were verified by real-time fluorescent quantitative PCR and the cis and trans regulatory methods and related genes of differential lncRNA were also analyzed. Result With fold change>=2, p<0.05 as a cut-off value, a total of 325 mRNAs (201 up-regulated, 124 down-regulated) and 497 lncRNAs (263 up-regulated, 234 down-regulated) were found in patients with cryptococcal meningitis. The first three GOs involved in differentially expressed mRNA are: arachidonic acid binding, activin receptor binding and replication protection complex; the first three involved KEGG are: asthma, folate carbon pool and allograft rejection reaction. Most of the differentially expressed lncRNA types are intergenic lncRNAs. A total of 305 co- expression relationships were found between 108 lncRNAs and 87 mRNAs. Real-time quantitative PCR confirmed that lncRNA-DPY19L1P1 was significantly increased in patients with cryptococcal meningitis, and its expression showed a downward trend after antifungal treatment. The cis and trans target genes of DPY19L1P1 are mainly involved in immune-related responses such as interleukin signaling pathway. Conclusion This study was the first to systematically analyze the differential expression profiles of lncRNAs and mRNAs in patients with cryptococcal meningitis. It was found that DPY19L1P1 may be involved in disease progression.

239

2019CSID Poster communication

PO-154 Proteomic analysis on the regulation of DOPA-melanin synthesis in Talaromyces marneffei

Xiaoyue He1,2 Liu Donghua2 Chen Qicong3 1Suining Central Hospital,Suining,Sichuan,China. 2First Affiliated Hospital,Guangxi Medical University, Nanning, Guangxi,China. 3Medicine South China University of Technology Guangzhou, Guangzhou, Guangdong,China.

Background Yeast form of T.marneffei can produce DOPA-melanin which perform an important role in the pathogen surviving in macrophage. So far, the proteomic associated with melanin synthesis remain unclearly in T.marneffei. Methods The whole yeast cell proteins were extracted from T.marneffei cultured with or without L-DOPA. Using two-dimensional gel electrophoresis combined with MALDI-TOF mass spectrometry, distinguished proteins were identified between T.marneffei cultured with or without L-DOPA. Furthermore, geldanamycin were used to assess the inhibition effect on T.marneffei melanin production in vitro. Results 16 distinguished proteins were identified in DOPA-melanized yeast cells, as well as 15 triple-up-expressed proteins and 7 triple-down-expressed proteins in comparison with non DOPA- melanized yeast cells. Of note, proteins differentially expressed proteins were predominantly heat shock proteins. HSP90/60/70 genes expressions increased significantly demonstrated by RT- qPCR, which was consistent with the proteomics changes. GO analysis showed that the majority of differentially expressed proteins including HSPs, especially HSP90 were found enriched in stress response, cellular process, protein folding, stimuli response and biological process. KEGG pathway analysis showed that proteins were enriched predominantly in phagosome. Geldanamycin inhibited the brown-black pigment production of T.marneffei yeast grown on brain heart infusion agar, as well as the inhibition effect was observed by transmission electron microscope. Conclusions The results demonstrates that HSPs paly an essential role in T.marneffei DOPA- melanin synthesis pathway.

240

2019CSID Poster communication

PO-155 GlgA plays a role in the induction of hydrosalpinx by Chlamydia muridarum

Yuanjun Liu1 hu chunmin1 wu haoqing1 1Tianjin Medical University General Hospital

Objectives To explore the effect of GlgA deficiency on the pathogenicity of C. muridarum in genital tract. Materials and Methods Balb/c mice were intravaginally inoculated with wild-type C. muridarum, plasmid-free C. muridarum and GlgA-deficient C. muridarum, the genital tract tissue was isolated to assess the severity of hydrosalpinx and the level of oviduct dilatation and inflammatory infiltration on the 60th day after infection. Collect mouse vaginal exfoliated cells with swabs to evaluated the growth of C. muridarum in the lower genital tract of mouse. The glycogen storage capacity and in vitro infection ability of different C. muridarum were analyzed by periodic acid– schiff (PAS) staining and reinfection assays. In addition, to compare inflammatory reaction and ascending infection induced by these strains, tissue homogenate was used to determine 23 cytokines and the contents of different C. muridarum. Results GlgA-deficient C. muridarum induced reduction of hydrosalpinx and attenuates the extent of oviduct dilatation in mouse, reduced the growth and proliferation in the mouse lower genital tract. Meanwhile, GlgA point mutations at different sites can reduced the glycogen storage capacity and in vitro infectivity of C. muridarum in different degree. Cytokines detection indicate that GlgA-deficient affect inflammatory reaction and ascending infection of C. muridarum. Conclusion GlgA has a certain effect on the pathogenic process of C. muridarum

241

2019CSID Poster communication

PO-156 The inhibitor tofacitinib impacts human dendritic cell differentiation and prevents polarization of macrophages into a regulatory M2 phenotype

Bin Zhang1 Stalder Romaine2 Costantino Brembilla Nicolo2 Jean Wrobel Ludovic2 Boehncke Wolf-Henning3 1Beijing Children’s Hospital, Capital Medical University (National Center for Children 2Centre Médical Universitaire, Université de Genève 3University Hospitals of Geneva

Introduction Several cytokines signaling via JAK proteins have been implicated in the pathogenesis of immune-mediated inflammatory diseases, including psoriasis and rheumatoid arthritis (RA). Tofacitinib is a small-molecule inhibitor of JAK; it is approved for the treatment of RA and has demonstrated good efficacy in psoriasis in phase III clinical trials. In this work, we analyzed the in vitro effects of tofacitinib on the functions of human macrophages and dendritic cells. Material and Methods Monocytes were isolated from peripheral blood mononuclear cells of 15 healthy donors and differentiated into immature DC (iDCs) in the presence of IL-4 and GM-CSF, or into M0 macrophages upon M-CSF stimulation. M0 macrophages were further polarized into inflammatory M1 or regulatory M2 macrophages via LPS and IFNs or IL-4 stimulation, respectively. LPS was used as a general trigger of activation. Tofacitinib was added at a nontoxic dose of 10 mM. mRNA levels of cytokines and surface markers were profiled by qPCR, and arginase and iNOS protein expression were investigated by immunohistological analysis. Results When assessing the effects of tofacitinib on monocyte-derived DCs, we observed reduced differentiation of monocytes into immature DCs (iDCs), as evidenced by the loss of CD209 and CD80. Morphological assessment of iDCs differentiated in the presence of tofacitinib suggested a switch toward an M1-like macrophage phenotype. This was further supported by expression of M1-like molecules, such as iNOS, as well as cytokines characteristically expressed by M1 cells, including IL-12 and IL-23. Of note, arginase and CD200R, molecules typically expressed by M2 cells, were absent on tofacitinib-treated iDCs. Furthermore, tofacitinib partially affected the ability of normally differentiated iDCs to respond to maturation stimuli such as LPS and IFNg, resulting in the up-regulation of IL-23 and the down-regulation of IL-12. When investigating macrophage development, we found that tofacitinib inhibited the ability of monocytes to differentiate and polarize into regulatory M2 macrophages, while rather enhancing the ability to 242

2019CSID Poster communication develop into inflammatory M1-like macrophages, as evidenced by decreased expression of the M2 marker CD200R and enhanced production of IL-12 and IL-23 cytokines. Conclusions Tofacitinib impacts the differentiation of DCs and macrophages, and it particularly favors generation of M1-like pro-inflammatory macrophages.

PO-157 Cell wall mannoprotein of Candida albicans polarizes macrophages and affects proliferation and apoptosis through activation of the Akt signal pathway

Hanghang Jiang1 Qi Ruiqun2 Gao Xinghua2 Han Xiuping1 1Shenjing Hospital of China Medical University 2The First Hospital of China Medical University

Candida albicans is a commensal fungus that associates with human hosts. Under normal circumstances this interaction does not produce any severe life-threatening disease, as macrophages of the innate immune system will result in its clearance. However, disorders may arise in immunosuppressed individuals. To understand the bioactivity of Candida albicans cell wall polysaccharides, which represent an important component of its function, mannoprotein from this fungus was extracted, purified and analyzed. Mannoprotein with α-(1,2) and α-(1,6) linkages was investigated with use of HPLC and NMR. Co-incubation of mannoprotein with macrophages resulted in a mannoprotein with the potential to polarize macrophages to M1 and promote phagocytosis/microbial killing ability thus increasing the clearance of pathogens through Akt2. Moreover, mannoprotein within the cell wall promoted cell proliferation and inhibited apoptosis by activation of the Akt signaling pathway. Collectively, α-(1,6)(1,2)-mannoprotein, one of the five polysaccharides extracted from the cell wall of Candida albicans, demonstrates immune- enhancing effects by activation of the Akt signaling pathway. These findings provide important new insights into the biological effects of polysaccharides on macrophages. Such information can then serve as the foundation for the development of novel anti-fungal medications.

243

2019CSID Poster communication

PO-158 The anti-inflammatory effects of Ho-1 in atopic dermatitis

Huiwen Yu1 Wang Suhong1 Bai Bingxue1 1The 2nd affiliated hospital of Harbin Medical University

Background Atopic dermatitis (AD) is a chronic inflammatory skin disease accompanied by severe itching, which affect the quality of life of patients seriously. The pathogenesis of AD is not yet clear. Skin barrier dysfunction and immunological abnormalities are considered to be the main factors in the pathogenesis of AD. The aim of this study is to investigate the role of HO-1 in atopic dermatitis. Method The anti-inflammatory effects of Ho-1 were explored in Hacat cells by evaluating the effect of HO-1 on the expression and secretion of cytokines such as IL-4, IL-10 and TNF-α by RT- PCR. Results 1) Quantitative RT-PCR results showed that HO-1 induced by hemin inhibited TNF- α secretion while enhanced IL-10 secretion in HaCaT cells(P<0.05).2) No expression of IL-4 mRNA was detected in each group of HaCaT cells. Conclusions The results of this experiment suggest that HO-1 can protect the atopic dermatitis by regulating the expression of inflammatory cytokines associated with atopic dermatitis.

PO-159 Juxtaposition of IL-1β and IFN-γ expression and apoptosis of keratinocytes in adult-onset still’s disease

Shijia Rao1 Li Qianwen1 Wu Haijing1 Zhao Ming1 Wang Alun2 Zhang Guiying1 Li Ji Lu Lixia Shi Wei Lu Qianjin1 1The Second Xiangya Hospital, Central South University 2Tulane University School of Medicine

Background Atypical persistent skin eruptions (APSEs) have been documented as a new manifestation of AOSD in recent years, with a unique pathological feature that necrotic keratinocytes in the upper third of the epidermis, but the mechanism is yet to be elucidated.

244

2019CSID Poster communication

Objective: To explore the potential mechanism of the unique pathological phenomenon of APSEs. Methods Clinical and pathological data of 26 AOSD patients with APSEs and 6 with ESEs have been reviewed. 14 APSEs and 6 ESEs biopsies are selected for multi-spectrum immunohistochemistry with 5 disease control and 5 healthy controls. Results The unique pathological manifestation was presented in all APSEs patients but could hardly be found in ESEs patients. Besides CD11b+ and CD68+ cells, there were more CD4+ T- cells infiltrate in the dermis of APSEs than in ESEs. IL-1β and IFN-γ were specifically expressed in the upper third of the epidermis, juxtaposition to the loci of the necrotic keratinocytes. Limitations: Small sample size, simple experiment design Conclusion Our findings depict important cellular and molecular derangements related to the APSEs-specific pathological phenomena and help to understand the pathogenesis of dyskeratosis in the epidermis. The findings could also pave a way to explore an effective intervention to this potential life-threatening disorder.

PO-160 HSV-2-encoded miRNA-H4 regulates cell cycle progression and Act D-induced apoptosis in HeLa cells by targeting CDKL2 and CDKN2A

Yang Zhao1 Yang Huilan1 1General Hospital of Southern Theatre Command of PLA

Background MicroRNAs (miRNAs) encoded by latency-associated transcript (LAT) are associated with both latent and acute stages of herpes simplex virus 2 (HSV-2) infection. Objective To explore potential cellular targets of HSV-2 encoded miRNAs and demonstrate their potential biological functions. Methods miRNA-H4-5p and miRNA-H4-3p were ectopically expressed in HeLa cells to examine their effect on cell cycle and cell apoptosis, then bioinformatics analysis, luciferase report assay, quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay and Western blot assay were performed to indentify the possible target genes of the miRNAs, and the function of these target genes. Moreover, in HeLa cells infected with HSV-2, qRT-PCR and Western blot were performed to determine the regulation effect of miRNAs on their target genes. Results miRNA-H4-5p and miRNA-H4-3p were ectopically expressed in HeLa cells, results showed that miRNA-H4-5p could reverse apoptosis induced by actinomycin D (ActD) and

245

2019CSID Poster communication promote cell cycle progression, but miRNA-H4-3p had no such obvious functions. Then bioinformatics analysis, luciferase report assay, quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay and Western blot assay demonstrated that miRNA-H4-5p could bind to 3’-untranslated region (UTR) of cyclin-dependent kinase inhibitor 2A (CDKN2A) and cyclin-dependent kinase-like 2 (CDKL2) to negatively regulate their expression, and we verified these two targeted genes were associated with cell apoptosis and cell cycle. Moreover, in HeLa cells infected with HSV-2, we detected the significantly reduced expression of CDKN2A and CDKL2, and demonstrated the negative regulation effect of miRNA-H4-5p on these two target genes. Conclusion Our findings show that viral miRNAs play a vital role in regulating the expression of the host’s cellular genes that participate in cell apoptosis and progression to reshape cellular environment in response to HSV-2 infection, providing further information on the roles of encoded herpesvirus miRNAs in pathogen-host interaction.

PO-161 Study On the Relationship Between Varicella Zoster Virus (VZV) Infection and Autophagy

Yang Zhao1 Yang Huilan1 1 General Hospital of Southern Theatre Command of PLA

Background Varicella-zoster virus (VZV) infection can cause chickenpox and herpes zoster, in the human body VZV can attack skin, nerves and lymphocytes. Both varicella and herpes zoster are common clinical diseases. The complications of varicella and herpes zoster associated pain are very difficult in clinical practice, causing serious psychological and physiological burden on patients, the mechanism of VZV infection is still unclear. Autophagy is an intracellular degradation pathway, studies have shown that autophagy can defend against pathogen infection, while many pathogens, including several human herpes viruses, have evolved multiple mechanisms to evade, inhibit, and even utilize autophagy. Signal transducers and activators of transcription 3 ( STAT3) play an important role in in regulating autophagy, and as transcription factors can regulate the replication and transmission of virus. Objective To study the relationship between VZV infection and autophagy, and the regulatory effect of STAT3 signaling pathway on autophagy and virus replication in VZV infection.

246

2019CSID Poster communication

Methods 1. Detection autophagy level in T lymphocytes and skin tissues of herpes zoster patients: flow cytometry was used to detect the expressions of autophagy protein LC3B, Beclin-1 and p62 in CD4+T lymphocytes of peripheral blood of herpes zoster patients; Obtained the Samples from the skin lesions of herpes zoster patients, the expression of autophagy-related proteins in the skin tissue was detected by immunohistochemistry, and the formation of autophagosomes in the skin tissue was observed by transmission electron microscopy. 2. To clarify the correlation between VZV infection and autophagy: in SHSY5Y cells infected by VZV, MDC fluorescence staining was used to observe autophagosomes, and western-blot was used to detect the expressions of autophagy proteins LC3B-Ⅱ, Beclin-1 and p62. After treating infected cells with autophagy inducer trehalose or autophagy inhibitor 3-MA, the titer of VZV was detected, the expression of VZV glycoprotein E (gE) was detected by western-blot, and the DNA copy value of VZV was detected by q-PCR. 3. To explore the regulatory effect of STAT3 on autophagy and virus replication in VZV infection: the expression and phosphorylation of STAT3 and its downstream factor BNIP3 in VZV-infected- SHSY5Y cells were detected by western-blot. Changes in autophagy protein and VZV replication were detected while STAT3 pathway blocked by S3I-201. Trehalose, an autophagy inducer, was applied in the STAT3 pathway blocked by s3i-201. and then detect the changes on autophagy protein and VZV replication. Results 1. the expression level of autophagy protein LC3B and beclin-1 in peripheral blood CD4+T cells and skin tissue of patients with herpes zoster were significantly increased (all P < 0.05), and the expression level of p62 was significantly decreased (P < 0.05), indicating that VZV infection can induce autophagy and autophagy flow is unobstructed. 2. The autophagy level in SHSY5Y cells infected with VZV was significantly increased. After the induction/inhibition of autophagy, the viral titer was significantly increased/decreased, the VZV DNA copy value was significantly increased/decreased, and the expression of VZV gE was significantly increased/decreased (all P < 0.05). Autophagy level was positively correlated with VZV replication level. 3. In SHSY5Y cells infected with VZV, the expression and phosphorylation of STAT3 , as well as the expression of its downstream factor BNIP3, were significantly increased. When STAT3 was inhibited, the autophagy level of the cells was significantly decreased, and the replication of VZV was weakened, while autophagy inducer trehalose can, reverse this decline ( P < 0.05). Conclusion This study confirmed that after VZV infection, the level of autophagy increased in T lymphocytes, skin tissue and neurons, and confirmed that the occurrence of autophagy had a positive effect on virus replication. It also confirmed that the activation of the STAT3-BNIP3 pathway could regulate VZV replication by positively regulating the expression of autophagy in VZV infection. To explore the role of autophagy and its regulatory pathways in viral infectious

247

2019CSID Poster communication diseases will provide theoretical basis for improving the immune escape mechanism of viruses and formulating new antiviral programs in clinical practice.

PO-162 Disordered cutaneous microbiota in Systemic Lupus Erythematosus

Cancan Huang1 1The 2nd Xiangya Hospital

The correlation between systemic lupus erythematosus (SLE) and microbiota colonization has been receiving much attention during recent years. We compared the cutaneous bacterial spectrum of 69 SLE patients, 49 healthy controls and 20 DM patients for a better understanding of cutaneous microbial structure and composition. We observed decreasing diversity in community richness and evenness and greater heterogeneity in SLE and DM patients. Staphylococcus taxa, specifically, Staphylococcus aureus, Staphylococcus epidermis and Staphylococcus hominis were enriched in SLE lesional skin, while Rhodococcus, Cutibacterium were decreased in SLE. Based on results of KW test、ROC curve and Lefse analysis, it was identified that Staphylococcus taxa might serve as potential markers for disease status. Picrust predicted Staphylococcus aureus infection pathway were significantly enriched in SLE patients and shows strong correlation with genus Staphylococcus. The composition and function shifts of cutaneous microbiota in SLE indicate the microbial dysbiosis might be associated with the pathogenesis of SLE, which may provide potentially reliable biomarkers or therapeutic targets for the future translational research.

PO-163 Methods of Diagnosis in Neonatal Scabies: a Case Series

Yingda Wu1 Li Chengrang1 1Institute of Dermatology, Chinese Academy of Medical Sciences and Peking Union Medical College

Objective Scabies, as a global health issue, is a relatively common infestation with 455 million annual incident cases. Prevalence varies widely among different geographic regions and mainly

248

2019CSID Poster communication centralizes in poor conditions. Diagnosis depends on history and physical examination- widespread itching that is worse at night, as well as other family members with similar symptoms. As the clinical manifestations of scabies infestation vary according to age and babies are vulnerable to be infected from their parents or babysitters, making the diagnosis in neonatal scabies rather complicated. Skin scraping is universally known as a gold standard to examines the specimen for scabies mites, eggs, or feces. And sites on the palms, soles, or torso may prove to be more available in infants. But infested infants are usually fussy, irritable and restless, so it’s not easy to make them submissive in the process of skin scrapping, which may predictably cause secondary injury to the neonates. In some articles, the adhesive tape test may be a more secure and easy choice and is shown to be useful in diagnosis of neonatal scabies especially among palms and soles and some thin skin, which are also features of neonatal scabies. To find the best method to diagnose the neonatal scabies, we try to compare the positve rate of different methods. Methods 1. We collected several different suspected scabies under 1 year old and record their characteristic features in manifestation. 2. Skin scrapping and the adhesive tape were respectively taken in the selected infants and record their results. 3. We treat the suspected infants with antiscabietic agents and observe the prognosis. Results We summarize nine cases of infants with pruritic eruption and deduce their distribution to find that the most characteristic feature of neonatal scabies is the multiple small erythematous papulopustulovesicular rash in palms and soles (palmprint and wrist crease in particular), and often excoriated with scab on the top as well as the erythema and papules in abdomen. Simultaneously, when their close contacts emerge the papulopustulovesicular rash in wrist crease, peripheral umbilicus or sides and webs of the fingers may benefit the challenging diagnosis. Disappointedly, we proceed the adhesive tape test with several times and no positive results. At the same time, a sulfur ointment (5%-10%) proved effectively without obvious side effects. Conlusion Scabies is a public health problem that requires proper management to control spread and popularize patient education. It’s necessary for practitoners to recognize the different morphology and clinical pattern accurately in neonatal scabies. Actually, neither skin scrapping nor adhesive tape test can absolutely detect the existence of mites, eggs, or scybala. Therefore, it’s crucial for many practitioners to diagnose empirically with the characteristic distribution and morphology of lesions and the patient's history (eg, pruritus in close contacts), and to treat even if neither mite nor products could be found. But due to burrows are difficult to find in reality, and the contact history of similar pruritus can also be found in other diseases, such as papular urticaria, so it’s crucial to make the most characteristic feature of neonatal scabies clear. Sometimes,

249

2019CSID Poster communication tentative antiscabietic agents treatment may be profitable. Simultaneous treatment of close contacts is needed to reduce the risk of scabies transmission and recurrence of scabies in patients receiving treatment.

PO-164 The role of S100A8/A9, a DAMP-mediated inflammation in atopic dermatitis

Shan Jin1 Zhu Lianhua1 Jin Zhehu1 1Yanbian University Hospital

S100A8/A9 (Calgranulin A/B, Calprotectin), a heterodimer of two calcium-binding proteins has emerged as an important pro-inflammatory mediator, so called “damage-associated molecular pattern (DAMP)” molecule in acute and chronic inflammation. Recently, it was reported that T cells and keratinocytes are stimulated by S100A8/A9 and involved in the development of autoimmune cutaneous diseases. In atopic dermatitis (AD), T cells and keratinocytes interact with each other and have major roles in the pathogenesis. In this study, we assessed S100A8/A9 expression in T lymphocytes from patients with AD and healthy controls (HCs), as well as in normal human keratinocytes (NHKs). Extrinsic AD patients, intrinsic AD patients, and HCs were enrolled in this study. T cells were isolated from peripheral blood mononuclear cells (PBMCs) using negative selection with CD14, CD16, CD19, CD36, and CD56 immunomagnetic beads. NHKs were treated with Th2 cytokines (IL-4, IL-13), Th17 cytokines (IL-17A, IL-22), lipopolysaccharide, and Dermatophagoides farinae (D. farinae) extract. The expressions of S100A8/A9 were assessed using Western blotting, immunofluorescence, and RT-PCR. S100A8/A9 levels were significantly higher in T lymphocytes from PBMCs of AD patients than HCs. Immunofluorescence also confirmed S100A8/A9 positive T cell infiltration in the dermis of lesional skin from AD patients. In NHKs, IL-17A and D. farina extract upregulated expression of S100A8/A9 while IL-4 and IL-13 did not significantly affect. The upregulation of S100A8/A9 by Th17 cytokine and house dust mite was also observed in the supernatants of NHKs. In addition to our previous results that cytoplasmic S100A8/A9 were detected in HaCaT cells and keratinocytes, highly expressed S100A8/A9 in T lymphocytes in patients with AD and supernatants from keratinocytes suggests a role of S100A8/A9 in the pathogenesis of AD. This also suggests a possible link between keratinocytes and T cells through DAMP-mediated inflammation in atopic dermatitis.

250

2019CSID Poster communication

251

2019CSID Poster communication

PO-165 Differential gene expression in HaCaT cells may account for the various clinical presentation caused by anthropophilic and geophilic dermatophytes infections

Weiwei Deng1 Liang Panpan1 Chen Jian1 1The Third Affiliated Hospital of Sun Yat-Sen university, China

Purpose Despite the worldwide prevalence of dermatophyte infections, only a few genes are reported to be related to dermatophyte infections. According to their behavior, dermatophytes were classified as anthropophilic, zoophilic and geophilic dermatophytes. The mechanism by which different ecological dermatophytes cause different inflammatory reactions remains unclear. Methods Therefore, we infected HaCaT cells with anthropophilic and geophilic dermatophytes to mimic various ecological dermatophyte infections. RNA-sequencing (RNA-seq) was employed to identify the change in the gene expression of HaCaT cells. To verify the expression of differentially expressed genes (DEGs), we selected 18 genes to conduct qPCR experiments. In addition, immunoblotting was conducted to validate key genes from the MAPK signaling pathway. Results After HaCaT cells were infected with the anthropophilic Trichophyton rubrum (T. rubrum) and the geophilic Microsporum gypseum (M. gypseum), 118 and 619 differentially expressed genes were identified in HaCaT cells respectively. In this screen, upregulated DEGs held a clear majority. These genes may provide a clue as to how keratinocytes respond to anthropophilic and geophilic dermatophytes. Strangely, the DEGs of the immune system process were mainly enriched in HaCaT cells in response to M. gypseum exposure, JUN and IL-6 had the maximum degrees in the PPI network. While steroid biosynthesis, terpenoid backbone biosynthesis and metabolic pathways were only enriched in HaCaT cells cocultured with T. rubrum and SQLE had the maximum degree in the PPI network. We also found that JUN may play a critical role in keratinocytes infected with M. gypseum. Conclusion Differential gene expression in HaCaT cells may account for the various clinical presentation caused by anthropophilic and geophilic dermatophytes infections.

252

2019CSID Poster communication

PO-166 TNF-α and IFN-γ induce ROS /RIP3/MLKL dependent Necroptosis in HaCaT cells

Yanhong Shou1 Yang Yongsheng1 Yang Lu1 1 Department of Dermatology, Huashan Hospital, Fudan University

Objectives Necroptosis is a form of programmed cell death, which is caspase-independent. The molecular events of necroptosis involved in keratinocytes have not been studied sufficiently. This study aims to investigate the mechanism of necroptosis in HaCaT cells induced by tumor necrosis factor-α (TNF-α) and interferon (IFN-γ). Methods HaCaT cells were pretreated with benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone (zVAD) and/or necrostatin 1 (Nec), and subsequently treated with TNF-α and IFN-γ. The MTT assay was performed to evaluate cell viability, and flow cytometry was used to detect necrosis and apoptosis rate. The mRNA levels of receptor interaction protein kinase 3 (RIP3) and mixed lineage kinase domain-like protein (MLKL) were determined by RT-PCR, while RIP3, MLKL, phosphorylated RIP3 (pRIP3), phosphorylated MLKL (pMLKL) protein levels were analyzed by western blot. Reactive oxygen species (ROS) levels were measured using 2',7'-dichlorofluorescin. Additionally, caspase 8 short hairpin RNA (shRNA) and ROS scavenger NAC were used to investigate the effects of caspase 8 and ROS, respectively. Results With caspase 8 inhibition, TNF-α and IFN-γincreased the percentage of necroptotic cells, and Nec was effective at protecting HaCaT cells from death. Furthermore, TNF-α and IFN- γincreased the expression of pRIP3, MLKL and pMLKL, with a burst of ROS generation while Nec decreased them, and ROS scavenger NAC decreased the expression of pRIP3, pMLKL and MLKL. Conclusion These results suggest that TNF-α - and IFN-γ- driven necroptosis is accompanied by a strong burst of ROS generation in HaCaT cells when caspase 8 is inhibited, and ROS enhance RIP3/MLKL dependent necroptosis.

253

2019CSID Poster communication

PO-167 Species Distinction in the Trichophyton rubrum Complex

Huilin Su1,2 Xu Jinhua2 Zhu Min2 1Department of Dermatology, The First Affiliated Hospital of Zhongshan University 2Department of Dermatology, Huashan Hospital, Fudan University

The Trichophyton rubrum species complex comprises commonly encountered dermatophytic fungi with a worldwide distribution. The members of the complex usually have distinct phenotypes in culture and cause different clinical symptoms, despite high genome similarity. In order to better delimit the species within the complex, molecular, phenotypic, and physiological characteristics were combined to reestablish a natural species concept. Three groups, T. rubrum, T. soudanense, and T. violaceum, could be distinguished based on the sequence of the internal transcribed spacer (ITS) ribosomal DNA barcode gene. On average, strains within each group were similar by colony appearance, microscopy, and physiology, but strains between groups showed significant differences. Trichophyton rubrum strains had higher keratinase activity, whereas T. violaceum strains tended to be more lipophilic; however, none of the phenotypic features were diagnostic. The results of matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) and amplified fragment length polymorphism (AFLP) were partially consistent with the ITS data but failed to distinguish the species unambiguously. Despite their close similarity, T. violaceum, T. soudanense, and T. rubrum can be regarded as independent species with distinct geographical distributions and clinical predilections. Trichophyton soudanense is pheno- and genotypically intermediate between T. rubrum and T. violaceum. For routine diagnostics, ITS sequencing is recommended.

254

2019CSID Poster communication

PO-168 Quantitative Analysis of the Global Proteome in peripheral Blood Mononuclear Cells from Patients with New-Onset Psoriasis

Yu Li1 Hongmei Wang2 1Tianjin University of Traditional Chinese Medicine 2Tianjin Academy of Traditional Chinese Medical Affiliated Hospital

Background Psoriasis is a chronic inflammatory skin disease caused by immunocompetent cells in the context of a genetically susceptible background. The activation of T cells and other immune cells and the subsequent immune inflammatory response are considered to play a key role in the pathogenesis of psoriasis. Therefore, peripheral blood mononuclear cells (PBMCs) are an important sample source for studying the pathogenic mechanisms of psoriasis. Proteomic research is a powerful approach used to understand complex biological systems and determine relationships between proteins, their function, and protein-protein interactions. Aim To explore the proteomic signature of peripheral blood mononuclear cells and the role of key signaling pathways proteins in the pathogenesis of psoriasis. Methods a quantitative analysis of their global proteome was conducted in samples from Chinese patients with new-onset psoriasis (n=31) and healthy controls (n=32) using an integrated quantitative approach with tandem mass tag labeling and LC-MS/MS. Protein annotation, unsupervised hierarchical clustering, functional classification, functional enrichment and cluster, and protein-protein interaction analyses were performed. Western blotting was used to detect proteins expression of the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) signaling pathway and oxidative phosphorylation. Result 1. A total of 5178 proteins were identified, of which 4404 proteins were quantified. The fold-change cutoff was set at 1.2 (patients vs controls); 335 proteins were upregulated, and 107 proteins were downregulated. The bioinformatics analysis indicated that the differentially expressed proteins were involved in processes related to the activation of immune cells including the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) signaling pathway, oxidative phosphorylation (mitochondrial respiratory chain and ROS production), cellular energy metabolism and proliferation. Of the 14 different signaling pathway entries revealed by the KEGG pathway enrichment and protein-interaction network analysis, the NF-κB pathway and oxidative phosphorylation were two most relevant pathways associated with activated PBMCs in psoriasis. 2.Western blotting verified and identified five proteins in NF-κ B signaling pathway (three upregulated proteins (IKKβ, p50, p65) and two phosphorylated proteins (p-IKKα, p-p65). the WB 255

2019CSID Poster communication results of NF-κB signaling pathway proteins levels was as same as our quantitative analysis of the global proteome. Levels of IKKβ, p50, and p65 in PBMCs of psoriatic patients were significantly higher than healthy controls. p-IKKα and p-p65 were also significantly increased in patients, which indicates the activation of the NF-κB signaling pathway in new-onset psoriasis. 3.Western blotting verified and identified five proteins in oxidative phosphorylation (four upregulated proteins (ND6, SDHB, COX4I1, UQCRC1)). Interestingly, the WB results of oxidative phosphorylation was quite different from our quantitative analysis. Levels of intracellular ROS production proteins, ND6, SDHB and COX4I1 in PBMCs from psoriasis patients were significantly lower than that from the controls, while UQCRC1 showed no significant change. Which indicates the function of the mitochondrial respiratory chain, thereby causing oxidative stress that may contribute to the onset of psoriasis. Conclusion our quantitative proteomic study provides a comprehensive proteomic signature for PBMCs from patients with new-onset psoriasis. By referring to previous studies, we confirmed that the NF-κB signaling pathway and oxidative phosphorylation in PBMCs is involved the pathogenesis of psoriasis, and it may represent a therapeutic target. Functional clustering analysis also indicated that the immune eﬀector cells in PBMCs from new-onset psoriasis patients were activated. Prospect Many proteins identified in this study have never been associated with psoriasis, and future studies are needed to analyze and verify these changes and determine their significance in the diagnosis and treatment of psoriasis.

PO-169 Involvement of PHF20 in inflammatory responses in psoriasis: Effects on NF- B signaling pathway

Zhengjun Li1 Mu Zhen2 Sun Qing1 1Qilu Hospital of Shandong University, Ji nan, Shandong 2The second affiliated hospital of shandong first medical university,Tai

Background Psoriasis is a one of the most common chronic skin diseases, which affects 0.6-4.8% of the general population. Plant homeodomain finger protein 20 (PHF20) was identified as a novel regulator a novel regulator of NF-κB activation. NF-κB is a crucial mediator involved in the pathogenesis of psoriasis. Objectives In the present study, we aimed to investigate the effect of PHF20 on psoriasis in imiquimod (IMQ) psoriasis-like lesions in mice and inflammation in keratinocyte cells. 256

2019CSID Poster communication

Methods Immunohistochemistry and western-blot were performed to evaluate PHF20 levels in psoriasis lesion skin. For microRNA (miR) specific for PHF20, target sequences were designed using Invitrogen’s RNAi Designer. Nuclear expression of PHF20 was evaluated by immunofluoresence. Q-PCR analysis was used to determination the expression cytokines and chemokines. Luciferase assays were performed to determine NF-κB transcriptional activity. Results The expression of PHF20 was significantly increased in psoriasis lesion skin. And, PHF20 mainly located in the nucleus of keratinocytes. Knockdown of PHF20 reduced imiquimod mediated k16 and k6 expression in keratinocytes. Moreover, PHF20 modulated cytokines and chemokines expression upon imiquimod treatment in keratinocytes, knockdown of PHF20 significantly inhibited the imiquimod-induced s100A8/A9 expression. Next, we investigated role of PHF20 in NF-κB transcriptional activity. Knockdown of PHF20 significantly reduced NF-κB transcriptional activity, and also diminished imiquimod induced expression of both XIAP and A20. Finally, we found that PI3K/AKT pathway was involved in imiquimod mediated PHF20 expression in keratinocytes. Conclusion These results demonstrated PHF20 was involved in imiquimod induced activation of NF-κB pathway in psoriasis. Knockdown of PHF20 exerted potent anti-inflammatory effects by influencing a variety of inflammatory cytokines. The data demonstrate that PHF20 may serve as potential therapeutic option for patients with psoriasis.

PO-170 Comparative Genome and Transcriptome Study of the Gene Expression Difference Between Pathogenic and Environmental Strains of Prototheca zopfii

xuanhao zeng1 1huashan hospital, Fudan university

Prototheca zopfii commonly exists in the environment, and causes invasive infections (protothecosis) in humans. The morbidity of protothecosis has increased rapidly in recent years, especially in systemic infections of patients with an impaired immune system. The infection in immunocompromised patients has a poor prognosis due to limited understanding of the pathogenesis of the disease, as most previous studies mainly focused on classification and recognition of pathogenic strains. In this study, we constructed the genome and transcriptome of two pathogenic strains and one environmental strain, by next generation sequencing methods. Based on our preliminary gene expression findings, genes in P. zopfii pathogenic strains are 257

2019CSID Poster communication significantly up-regulated in metabolism in peroxisome, such as glyoxylate cycle, which may improve the organism's resistance to the harsh environment in phagolysosome of macrophage and its ability to survive in an anaerobic environment. We also found some significant up- regulated genes, which are related to adherence and penetration in dermatophytes, and we speculate that this may enhance the virulence capacity of pathogenic strains. Finally, the genomes and transcriptomes of P. zopfii described here provide some base for further studies on the pathogenesis of this organism.

PO-171 Thimerosal induces skin pseudo-allergic reaction via Mas-related G- protein coupled receptor B2

Bin Peng1 Che Delu Hao Yong1,2 Zheng Yi1 He Langchong Geng Songmei1 1The Second Hospital Affiliated to Xi 2The Second Affiliated Hospital of Baotou Medical College

Background Thimerosal has been used as a preservative in many products which may cause contact dermatitis. It is the second most common allergen in positive patch test reactions, though being a clinical irrelevant allergen. Thimerosal-induced contact dermatitis is generally considered to be a delayed-type hypersensitivity reaction, but it is difficult to explain the fact that most patients develop an allergic reaction upon first encounter with thimerosal. Recent studies have demonstrated the association between Mas-related G protein coupled receptor X2 (MRGPRX2) and pseudo-allergic reactions which occur at the first contact with stimulation. This suggests the possibility that thimerosal may cause contact dermatitis via MRGPRX2 mediated mechanism. Objectives To investigate the role of Mas-related G-protein coupled receptor B2 (MrgprB2)/MRGPRX2 in contact dermatitis induced by thimerosal. Methods Thimerosal induced pseudo-allergic reactions via MrgprB2/ MRGPRX2 were investigated using a novel skin pseudo-allergic reaction mouse model, footpad swelling and extravasation assays in vivo and mast cell degranulation assay in vitro. Results Thimerosal induced contact dermatitis in dorsal skin and footpad swelling in wild-type mice, but had no significant effect in MrgprB2-knockout mice. Thimerosal-induced dermatitis is characterized by infiltration of inflammatory cells and elevation of serum histamine and inflammatory cytokines, rather than elevation of serum IgE level. Thimerosal increased the

258

2019CSID Poster communication intracellular Ca2+ concentration in HEK293 cells overexpressing MrgprB2/MRGPRX2. Downregulation of MRGPRX2 resulted in the reduced degranulation of LAD2 human mast cells. Conclusions MrgprB2 mediates thimerosal-induced mast cell degranulation and pseudo-allergic reaction in mice. MRGPRX2 may be a key contributor to human contact dermatitis.

PO-172 Imiquimod related dermatitis is induced by mast cells degranulation via Mas-related G protein-coupled receptor B2

Yong Hao1,2 Peng Bin1 Che Delu Zheng Yi1 He Langchong Geng Songmei1 1Northwest Hospital, The second affiliated hospital of Xi 2The Second Affiliated Hospital of Baotou Medical College

Imiquimod (IMQ) is a common drug in skin disease treatment. However, the side effects of IMQ occurred frequently, which manifested as erythema, itch, and pain, while the mechanism has not been fully understood. Mast cells have been found at the lesion after IMQ treatment, and MRGPRX2 on mast cells has been proved to induce pseudo-allergic reaction in chronic urticaria, contact dermatitis, and other skin diseases. Whether IMQ related dermatitis is mediated by mast cell degranulation via MrgprB2/MRGPRX2 need to be addressed. We obtained H&E and immunofluorescence staining to observe changes of histopathology and degranulation of mast cells in IMQ dermatitis mouse model. Mice hindpaw swelling, enzyme-linked immunosorbent assays and degranulation assays were performed to measure allergic mediators both in vivo and in vitro. The results suggested that IMQ could activate mast cells degranulation in an IgE- independent way in IMQ related dermatitis. IMQ also promoted the infiltration of inflammatory cells, released inflammatory related factors, and eventually caused pseudo-allergic reaction. This may be the underlying mechanism by which IMQ causes cutaneous side effects. Our study helps to elucidate the mechanism of IMQ in regulating the immunity and provides a new possible therapeutic target for the prevention of its side effects.

259

2019CSID Poster communication

PO-173 QingRe ChuShi decoction attenuates atopic dermatitis-like inflammation induced by DNCB in BALB/c mouse through JNK/P38 MAPK signal pathway

Yujiao Meng1 Yu Liu1,2 Jianning Guo1,2 Xiaoyao Guo1 Lu Zhang1 Tingting Di1 Jingxia Zhao1 Yan Wang1 Ping Li1,2 1Beijing Hospital of Traditional Chinese Medicine, Capital Medical University, Beijing Institute of Traditional Chinese Medicine 2Beijing University of Chinese Medicine

Objective To observe the inflammatory regulation of QingRe ChuShi decoction on dinitrochlorobenzene (DNCB)-induced atopic dermatitis-like model on BALB/c mouse. Methods 60 BALB/c mice were randomly divided into normal control group, model group, positive control group (Prednisolone) group, and high, medium, low dose groups of QingRe ChuShi decoction, with 10 rats in each group. The characteristics and behavioral manifestations of skin lesions in atopic dermatitis mice were observed. HE and toluidine blue staining were used for pathological analysis of skin lesions; serum IgE levels were detected by ELISA; interleukin-4, IL-5 and thymic stromal lymphopoietin (TSLP) mRNA relative expression were detected by RT- PCR.Western Blot assay for JNK, p-JNK, P38, p-P38 protein expression levels in lesions. Results The mice in the model group showed increased scratching behavior (P<0.01), and the lesions showed erythema, edema, erosion, scarring and elevated serum IgE (P<0.01). QingRe ChuShi decoction effectively relieved the skin lesions in mice, including reduced the number of scratches (P<0.05), decreased SCORAD scores (P<0.05), reduced erythema, edema, erosion and decreased IgE levels (P<0.05). Epidermal thickness was decreased compared with the model group, as well as the number of mast cells decreased (P<0.05). The expression levels of inflammatory factors including IL-4, IL-5 and TSLP were decreased. The phosphorylation levels of JNK and P38 were decreased, and the levels of p-JNK and p-P38 protein were down- regulated. Conclusion QingRe ChuShi decoction can inhibit the inflammatory reaction of atopic dermatitis- like lesions in BALB/c mice induced by DNCB. The protective effect may be related to inhibiting the activation of JNK/P38 MAPK signaling pathway. At the same time, the high dose group is better than the medium and low doses.

260

2019CSID Poster communication

PO-174 Plasma exosomal miR-375-3p regulates ferroptosis in keratinocytes by targeting GPX4 in SJS/TEN

Chen Zhang1 Wang Gang1 Fu Meng1 1Xijing Hospital./China&Xi

Objective Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are life- threatening, cutaneous adverse drug reactions that are accompanied by keratinocyte cell death. Ferroptosis is a recently recognized form of regulated cell death driven by lipid-based reactive oxygen species (ROS) accumulation. However, the molecular mechanisms of ferroptosis regulation are still largely unknown in SJS/TEN. Exosomes are nanometre-sized vesicles with a lipid bilayer membrane and present in body fluids, containing functional proteins, mRNAs and miRNAs. Nevertheless, the potential roles of plasma exosomes and the underlying mechanisms in SJS/TEN have yet to be explored. Method Exosomes were isolated and characterized from plasma of SJS/TEN patients. Deep sequencing analysis were performed to identify pathogenic miRNAs. The candidate exosomal miRNAs were confirmed with qRT-PCR and in situ hybridization. Transfection of siRNA or miRNA mimics into keratinocytes, the results were conducted by western blot, immunofluorescence and immunohistochemistry. Results We uncovers that exosomes isolated from plasma of SJS/TEN patients showed the expected size between 30 and 150nm. Then, exosomes were shown to be positive for exosomal markers CD9, CD63 and TSG101. MiR-375-3p level was the markedly upregulated in SJS/TEN patients and was positively correlated with clinical features. Then, plasma derived exosomes from patients were internalized by human primary keratinocytes and promoted malondialdehyde (MDA) and lipid ROS accumulation and ferroptotic cell death. Additionally, ectopic expression of miR- 375-3p suppressed glutathione peroxidase 4 (GPX4), an enzyme converts lipid hydroperoxides to lipid alcohols, resulting in increased ferroptotic cell death. Importantly, knockdown of miR-375-3p inhibited ferroptosis, which completely prevented SJS/TEN-like responses in a mouse model of SJS/TEN. Conclusions GPX4 downregulated by the overexpressed miR-375-3p mediates keratinocyte ferroptosis in SJS/TEN patients. Circulating exosomal miR-375-3p might be used as a potential disease marker for the diagnosis of SJS/TEN.

261

2019CSID Poster communication

PO-175 Acitretin inhibits IL-17A-induced IL-36 expression in keratinocytes by down-regulating IκBζ

ZhiQiang Yin1 1Dematology, First Affiliated Hospital of Nanjing Medical University

Backgroud IL-36 plays a critical role in aggravating psoriatic inflammation and IL-17A can upregulate IL-36 expression in keratinocytes. IL36 is obviously elevated in generalized pustular psoriasis (GPP) compared to psoriasis vulgaris (PV) and considered as a key driver of GPP. IκBζ (encoded by NFKBIZ) is a key transcriptional regulator of IL-36/IL-17A-driven psoriasis-related gene expression. It is well known that acitretin brings about a rapid and significant effect on the treatment of GPP, whereas the therapeutic mechanism of acitretin in GPP has not been fully clarified. Objectives We conducted this study to investigate whether acitretin interferes IL-36 expression in keratinocytes after IL-17A stimulation. Methods We used 100ng/ml IL-17A and/or various doses of acitretin (0,0.1,1,10μmol/l) to treat cultured HaCaT cells. We performed Real-time quantitative PCR and ELISA to detect gene and protein expression of IL-36 cytokines, real-time quantitative PCR and Western blot to examine IκBζ. Imiquimod-induced psoriasis-like mouse model was established to evaluate effect of gastrointestinal administrated acitretin. Immunohistochemistry was conducted for effect assessment. Results Acitretin significantly down-regulated expression of IL-36β and IL-36γ induced by IL-17A stimulation at both gene and protein levels in HaCaT cells. In Imiquimod+acitretin group, the skin lesion severity was slightly relieved, however, immunohistochemistry showed IL-36β and IL-36γ expression in keratinocytes were significantly declined in comparison with Imiquimod group. IL- 17A stimulation induced significantly NFKBIZ and IκBζ expression in HaCaT cells, which could be inhibited by acitretin. Couclusion Acitretin inhibits IL-36 expression induced by IL-17A stimulation in keratinocytes by down-regulating IκBζ, which reveals a new mechanism of the notable therapeutic action of acitretin on GPP.

262

2019CSID Poster communication

PO-176 Alpha-7 nicotinic acetylcholine receptor agonist alleviates psoriasis- like inflammation through inhibition of the STAT3 signaling pathway

Yiwen Chen 1 Su Ting1 Su Zhonglan1 1The First Affiliated Hospital of Nanjing Medical University

Objective Psoriasis is a chronic and recurrent inflammatory skin disease with reduced quality of life. Evidence has indicated that vagal nerve stimulation can attenuate systemic inflammation through the “cholinergic anti-inflammatory pathway” with alpha-7 nicotinic acetylcholine receptor (α7nAchR) being an essential regulator. In this study, we aimed to examine whether activation of α7nAchR might alleviate psoriasis-like inflammation. Methods We first investigated the expression of α7nAchR in human and mouse skin. Then imiquimod (IMQ)-induced psoriatic mice model were established and treated with PNU-282987, a specific agonist of α7nAchR. In addition, we examined the effect of PNU in TNF-α stimulated HaCaT cells. Results Human and mice skin expressed α7nAchR at the mRNA and protein levels. The specific agonist of α7nAchR, PNU could attenuate the inflammatory reaction induced by IMQ and TNF-α in vivo and in vitro, respectively, via decreased expression of inflammatory factors(IL-1β, IL-6 and TNF-α). Proliferation and abnormal differentiation of keratinocytes were inhibited. In this process, phosphorylation of STAT3 was surppressed. Conclusion Activation of α7nAchR may demonstrate a potential for future clinical application for psoriasis treatment.

263

2019CSID Poster communication

PO-177 Effect of chlorogenic acid on skin lesions induced by imiquimod in mice with psoriasis

Jianning Guo1,2 Ping Li1,2 Jingxia Zhao1 Tingting Di1 Lu Zhang1 Yujiao Meng1,2 Cong Qi1 Yu Liu1,2 Xiaoyao Guo1 Yan Wang1 1Beijing Hospital of Traditional Chinese Medicine Affiliated to Capital Medical University, Beijing institute of traditional Chinese medicine, Beijing key laboratory of clinical basic research on psoriasis 2Beijing university of traditional Chinese medicine

Objective To observe the effect of chlorogenic acid on skin lesions induced by imiquimod in mice with psoriasis. Methods 45 male BALB/c mice were randomly divided into Control group (C), Model group (M), Methotrexate group (MTX), high-chlorogenic acid group (CAH) and low-dose group (CAL).After the skin was removed from the back of each group, 5% imiquimod cream was applied to the back of the other groups for 6 days, except the blank group, to induce the psoriasis like model. The Psoriasis area and severity index (PASI) was used for scoring. Open-field and elevated cross maze experiments were used to test the behavioral differences of mice in each group. Morphological changes of skin lesions were observed by HE staining and epidermal thickness was measured. The expression of proliferating nuclear antigen (PCNA) in skin lesions was detected by immunohistochemistry. The expression of Neurokinin 1 receptor (NK1R) in skin lesions was detected by immunofluorescence assay. Substance (SP) and NK1R protein expressions in skin lesions were detected by Western blot. Results Compared with model group mice, chlorogenic acid in each dose group and methotrexate group obviously improved in mice back skin lesions, PASI score and the thickness of epidermis were significantly lower, number of PCNA positive cells decreased significantly, the central road, central time, into the central frequency and OT % has a rising trend. The expression of NK1R was decreased in skin lesions, and the expression of NK1R and SP protein was also decreased. Conclusion Chlorogenic acid can alleviate the pathological changes induced by imiquimod- induced psoriasis mice, reduce the expression of neurotransmitters, and improve the anxiety behavior of psoriasis mice.

264

2019CSID Poster communication

PO-178 Caffeic acid phenethyl ester(CAPE) inhibits keloid fibroblast proliferation, migration and collagen synthesis via the TGF-β/Smad signaling pathways

Chuying LI1 JIN Meitong1 LUO Yinli1 PI Longquan1 JIN Zhehu1 1Yanbian University Affiliated Hospital

Background & Objective Caffeic acid phenethyl ester (CAPE), a naturally occurring bioactive compound, displays anti-inflammatory, anti-carcinogenic, and anti-fibrotic effects. However, the effect of CAPE on keloid is unknown. Herein, we investigated the inhibitory effect of CAPE on human keloid fibroblasts (KFs) in vitro, and further explored the associated molecular and cellular mechanisms. Methods KFs were treated with TGF-β1 with or without CAPE. Cell viability assay, quantitative polymerase chain reaction, cell migration assay, western blot analysis and immunofluorescence staining were performed. Results CAPE markedly inhibited KFs proliferation, migration and collagen production enhanced by TGF-β1. The increase in TGF-β receptor I and II expression in TGF-β1-treated KFs was suppressed by CAPE treatment. TGF-β1 increased the phosphorylation of Smad2/3 in KFs, and this enhancing effect was abrogated by CAPE. Conclusion These results indicate that CAPE effectively inhibits the TGF-β/Smad signalling pathway in KFs by downregulation of TGF-β receptors.

265

2019CSID Poster communication

PO-179 Dapsone‐ and nitroso dapsone‐specific activation of T cells from hypersensitive patients expressing the risk allele HLA‐B*13:01

Qing Zhao1,2,3 Alhilali Khetam3 Alzahrani Abdulaziz3 Almutairi Mubarak3 Liu Hong1 Sun Yonghu1 Meng Xiaoli3 Gibson Andrew3 Ogese Monday3 Zhang Furen1,2 Naisbitt Dean3 1Shandong Provincial Institute of Dermatology and Venerology & Provincial Hospital for Skin Diseases, Shandong First Medical University & Shandong Academy of Medical Science 2Shandong Provincial Hospital for Skin Disease, Shandong University 3MRC Centre for Drug Safety Science, Department of Molecular and Clinical Pharmacology, The University of Liverpool

Background Research into drug hypersensitivity associated with the expression of specific HLA alleles has focussed on the interaction between parent drug and the HLA with no attention given to reactive metabolites. For this reason, we have studied HLA-B*13:01-linked dapsone hypersensitivity to (a) explore whether the parent drug and/or nitroso metabolite activate T cells and (b) determine whether HLA-B*13:01 is involved in the response. Methods Peripheral blood mononuclear cells (PBMC) from six patients were cultured with dapsone and nitroso dapsone, and proliferative responses and IFN-γ release were measured. Dapsone- and nitroso dapsone- specific T-cell clones were generated and phenotype, function, HLA allele restriction, and cross-reactivity assessed. Dapsone intermediates were characterized by mass spectrometry. Results Peripheral blood mononuclear cells from six patients and cloned T cells proliferated and secreted Th1/2/22 cytokines when stimulated with dapsone (clones: n=395; 80% CD4+CXCR3hiCCR4hi, 20% CD8+CXCR3hiCCR4hiCCR6hiCCR9hiCCR10hi) and nitroso dapsone (clones: n = 399; 78% CD4+, 22% CD8+ with same chemokine receptor profile). CD4+ and CD8+ clones were HLA class II and class I restricted, respectively, and displayed three patterns of reactivity: compound specific, weakly cross-reactive, and strongly cross-reactive. Nitroso dapsone formed dimers in culture and was reduced to dapsone, providing a rationale for the cross-reactivity. T-cell responses to nitroso dapsone were dependent on the formation of a cysteine-modified protein adduct, while dapsone interacted in a labile manner with antigen- presenting cells. CD8+ clones displayed an HLA-B*13:01-restricted pattern of activation. Conclusion These studies describe the phenotype and function of dapsone- and nitroso dapsone- responsive CD4+ and CD8+ T cells from hypersensitive patients. Discovery of HLA-

266

2019CSID Poster communication

B*13:01-restricted CD8+ T-cell responses indicates that drugs and their reactive metabolites participate in HLA allele-linked forms of hypersensitivity.

PO-180 Antifungal activity in vitro and mechanism of clioquinol

Zimeng You1 Ran Xin1 Zhang Chaoliang2 Dai Yaling3 Lei Song4 Ran Yuping1 1Department of Dermatovenereology, West China Hospital, Sichuan University 2State Key Laboratory of Oral Diseases, West China Stomatology Hospital, Sichuan University 3Department of Laboratory Medicine, West China Hospital, Sichuan University 4Department of Pathology, West China Hospital, Sichuan University

Objective To study the antifungal activity and spectrum of clioquinol (CQ) compared with other common antifungal pharmaceuticals and seek for the mechanism. Methods Modified agar diffusion assay and broth microdilution method were used to study the antifungal activity and spectrum of 3% CQ cream and active pharmaceutical ingredients of CQ respectively. Fluorescence, scanning electron and transmission electron microscope were used to observe the morphology changes of Candida albicans, Candida tropicalis, Candida guilliermondi and Malassezia furfur after treated with CQ. Meantime we used RNA-sequencing, ergosterol and sorbitol binding assays, hyphae and biofilm formation assay to seek for the antifungal mechanism of CQ. Results CQ can inhibit the growth of most species of common pathogenic fungi, including Candida spp, Dermatophytes, Fusarium, Trichoderma, Aspergillus and Malassezi spp. The antifungal activity of CQ was stronger than other common drugs in parts of species. After treated with CQ, reduction of hyphae formation and budded spores rate, rupture and fissures of some sores, cell wall intensity change were observed in yeast. CQ can not act on cell wall or disrupt cell membrane directly, while it can in inhibit the formation of hyphae and biofilm. RNA-sequencing showed the antifungal activity of CQ may be related to ion homeostasis, energy, amino acid, fatty acid and sterol metabolism. Conclusion Clioquinol may inhibit the fungal growth through disrupting yeast-hyphae conversion, inhibiting biofilm, interrupting energy metabolism and metal homeostasis.

267

2019CSID Poster communication

PO-181 Abnormal expression of BAFF in systemic lupus erythematosus and preparation of recombinant human BAFF protein

Yongjian Chen1 Wu Haijing1 Lu Qianjin1 1dept. Of Dermatology, The Second Xiangya Hospital Of Central South University

B-cell activating factor (BAFF), an autocrine cytokine predominantly produced by monocytes and dendritic cells in addition to T cells, has been proven to play a crucial role in lupus, for example, by promoting proliferation, differentiation and survival of B cells. However, the functional mechanism of BAFF in B cells has not been fully elucidated, and the expression level of BAFF in inflammatory sites has not been reported so far. The clinical efficacy of the monoclonal antibody belimumab developed for BAFF is not significant. In order to explain the above scientific problems, the expression levels of BAFF and its receptors in skin lesions, PBMCs and serum of SLE patients were detected by flow cytometry, ELISA, polychromatic pathological section system and antibody formulations and detection methods independently developed by the laboratory; the rapid construction of recombinant plasmid, the construction of prokaryotic and eukaryotic protein expression system, as well as eukaryotic protein suspension expression system were preliminarily explored, providing important theoretical and experimental basis for studying the biological structure and function of BAFF protein and revealing its unknown function and molecular mechanism in other systems; the recombinant human BAFF protein has been successfully prepared, which provides raw materials and experimental basis for the preparation of anti-BAFF monoclonal antibodies and the further development of SLE targeted therapeutic drugs.

PO-182 Study on the inhibitory effects of 4-HPR on the proliferation of human keloid fibroblasts under the different carriers.

Zhouna LI1 JIN Zhehu1 1Yanbian University Affiliated University

268

2019CSID Poster communication

Objective explore the inhibition effects of 4-HPR（4-HPR）on keloid fibroblast proliferation under different carriers. Method Prepare the 4-HPR liposome solution and 4-HPR microbubbles ,in vitro culture of human skin keloid fibroblasts was conducted. The experiment was divided into blank controller, 4- HPR solution group, 4-HPR liposome solution group, and 4-HPR microbubbles group. MTT method was used to calculate the inhibition effects of the various group’s cell proliferations, flow cytometry (FCM) was used to calculate the apoptosis effect . The cells’ drug intakes of the coumarin 6 were observed by LSCM. Result the 4-HPR liposome solution and 4-HPR microbubbles were successfully prepared. The morphologies and structures were observed under the Transmission Electron Microscopy (SEM) and they featured uniformed sizes and rounded out-appearances; after they were sealed for storage under 4C for 30d, they were precipitated without deposits and featured high stability. it was revealed by MTT detection that 4-HPR iposome solution had proliferation inhibition effects on human skin keloid fibroblasts within the concentration scope of 1~80 μmol/L, and presented a positive correlation with the drug concentrations (r=0.633,P<0.01). In the results of the inhibition of the proliferations of the keloid fibroblasts which were subject to the ultrasonic and non- ultrasonic processing under different carriers, the comparisons of the 4-HPR micro-bubble group with the 4-HRP solution and 4-HPR lipidosome group both featured statistical significance (P<0.01). Flow cytometry detections of the 4-HPR lipidosome group and the 4-HPR micro bubble group indicated the apoptosis rates of the keloid fibroblasts were(21.81±3.73)% and (39.79±1.61)%. which were both substantially increased in contrast to the (6.18±0.61)% in the controls. Conclusion the 4-HPR microbubbles were successfully prepared，4-HPR had inhibition effects on the proliferation of keloid fibroblasts under different carriers ， among which the 4-HPR microbubbles in combination with ultrasonic irradiation features the strongest inhibition effect.

PO-183 Inhibitory Effects of 4-HPR-loaded Lipsomes on Melanoma in Vitro

Aili Cui1 1Yanbian university hospital

Objectives To explore the inhibitory effects of 4-HPR-L on A375 and B16F10 melanoma cells.

269

2019CSID Poster communication

Methods 4-HPR-loaded liposomes (4-HPR-L) was prepared by using film evaporation method. A375 and B16F10 cells were cultured in vitro and divided into blank group（only cells and fresh medium）、4-HPR group and 4-HPR liposomes (4-HPR-L) group（added at the same concentration of 4-HPR and 4-HPR-L）. Cell apoptosis was detected by Hoechst33258 staining and flow cytometry. Cell migration ability was detected bywound healing assay. Laser scanning confocalmicroscope was used to observe the liposome entry.Statistical analysis was performed using SPSS 22.0 software. Data comparison was performed by one-way analysis of variance (ANOVA), and significant differences between groups were analyzed by t test. Results Both 4-HPR and 4-HPR-L groups had dose-dependent, the viability of cells in 0.1、 1、 15 、 30 、 50、 70 μg/mL ， 4-HPR group of A375 cell administered for 48 h were （ 94.3 ± 1.4 ） % 、（91.7 ± 2.5 ） % 、（84.4 ± 2.5% ）、（78.8 ± 2.1 ） % 、（59.0± 1.1 ） % 、（ 42.8 ± 2.0 ） %, respectively, 4-HPR-L group were （ 86.0 ± 0.2 ） % 、（76.5 ± 0.6 ） % 、（ 60.9 ± 1.5 ） % 、（49.0 ± 0.5 ） % 、（32.9 ± 0.2 ） % 、（18.9 ± 0.5 ） %, respectively ，（t=8.019、8.298、11.455、19.978、33.672、16.314， P ＜ 0.01)； the viability of cells at the same concentration, 4-HPR group of B16F10 cell administered for 48 h were （95.4 ± 1.9）%、（90.5 ± 2.6）%、（77.0 ± 0.8%）、（64.4 ± 3.5）%、（59.1 ± 2.9）%、（49.9± 1.9）%, respectively, 4-HPR-L group were （88.4 ± 2.0）%、（80.9 ± 3.4）%、（60.9 ± 2.2）%、（51.5± 2.9）%、（41.1 ± 1.2）%、（33.5 ± 2.4）%, respectively，（t=3.573、3.153、9.953、 4.019、8.097、7.53， P ＜ 0.05), and compared with 4-HPR at the same concentration, 4-HPR- L showed higher cell proliferation inhibition rate (. Hoechst 33258 result showed 4- HPR induced tumor cell apoptosis effectively, flow cytometry showed that the apoptosis rates of A375 and B16F10 cells in the 4-HPR-L groups were （ 51.32 ± 3.19 ） % and （ 36.46 ± 3.57 ） % ， , respectively, compared with the 4-HPR groups (20.34 ± 3.46)% and (12.16 ± 2.73), had significant differences (t=11.412 、 9.372 ， P ＜ 0.01). Cell wound healing assay 4- HPR-Lcould effectively inhibited tumor cell migration. Confocal cellular uptake assay demonstrated that 4-HPR-L could rapidly successfully internalized into both A375 and B16F10 cells. Conclusion 4-HPR-L could enter A375 cells and B16F10 cells better, inhibit the proliferation and induce apoptosis of cells effectively.

270

2019CSID Poster communication

PO-184 α-Solanine induced Apoptosis in Malignant Melanoma A375 Cells and Its Mechanism

Mingyuan Ren 1 Zhang Guoqiang2 1Affiliated Hospital of Hebei University of Engineering 2The First Hospital of Hebei Medical University

Objective Malignant melanoma is the most malignant tumor in human skin cancer, which has high metastasis rate and high mortality but poor prognosis. Therefore, looking for some safe and effective drugs has become a research hotspot at home and abroad. Scholars have been committed to the development of highly efficient and sensitive anti-cancer drugs. At present, Chinese herbal medicine is a new breakthrough in the field of cancer research. Solanine is one of the main steroidal glycoalkaloid in potato. In recent years, It has been found that solanine has antimicrobial and antitumor effects, to which many scholars have paid attention. At present, Studies have shown that solanine possesses an anti-tumor property on many cells, but there are very few study on melanoma cells. Through the treatment of different solanine concentrations on melanoma A375 cells, this research mainly focuses on the effect of solanine on A375 cell proliferation, apoptosis and apoptosis related proteins, in order to investigate the antitumor mechanism of solanine, and to provide experimental and theoretical basis for its further clinical application. Methods 1 Cell culture. The melanoma A375 cells were cultured in DMEM medium containing 10% fetal bovine serum, placed on the incubator of 37℃and 5% CO2. 2 Inhibitory effect of solanine on the proliferation of melanoma A375 cells detected by CCK8. The experiment was divided into blank control group (only medium without cell without drug), negative control group (culture medium containing cell without drug) and experimental groups (culture medium containing cell with drug of the following concentrations: 4.6 μmol/L, 9.2 μmol/L, 13.8 μmol/L, 18.4 μmol/L, 23.0 μmol/L), each group of 6 holes. The proliferation of the A375 cells were tested by CCK8 after different concentrations of drug effected 24h, 48h and 72h. Inhibition rates of the corresponding concentration and IC50 were calculated after the A375 cells groomed 24h, 48h and 72h with different concentrations of solanine.3 The changes in apoptosis morphology of A375 cells with different concentrations of solanine were observed under an inverted optical microscope and fluorescence microscope. The experiment was divided into negative control group (solanine was 0 μmol/L) and experimental groups (9.2 μmol/L, 13.8 μmol/L, 18.4 μmol/L of solanine).4 The expression of apoptosis-related genes(Caspase-3, Bcl-2 and Bax) in mRNA 271

2019CSID Poster communication were detected by RT-qPCR. 5 The expression of apoptosis-related proteins (Caspase-3, Bcl-2 and Bax) were investigated by Western blot.6 The data was presented as mean ±SD. Statistical significance was evaluated by One-way ANOVA among groups with SPSS16.0 software. P <0.05 was considered statistically significant. Results 1 Cells without solanine grew in diamond shape with uniform size, regular morphology, well adherence and strong proliferation;2 CCK8 showed that different concentrations (4.6 μmol/L, 9.2 μmol/L, 13.8 μmol/L, 18.4 μmol/L, 23.0 μmol/L) of solanine in A375 cells for 24 hours, the cell inhibition rates were respectively(2±2.4)% ,(11.4±1. 4)% ,(36.6±1.8)%, (63.7±0.3)% and (68.4 ±1.4)%. e control group had regular and clear morphology, uniform size, full cytoplasm, strong shading, well adherence and strong proliferation. In the experimental group (9.2 μmol/L, 13.8 μmol/L, 18.4 μmol/L)cells morphology changed, with smaller size, irregular contour, cell shrinkage, losing and malapposition. Suspension cells increased. DAPI staining results sThere was no significant difference between the negative control group and the experimental group with 4.6 μmol/L, and there was significant difference among the rest(P<0.05). For 48 hours, the cell inhibition rates were respectively (7.6±3.0)%, (15.3 ±2.8)%, (60.9 ±3.4)%, (76.6 ±2.9)% and (78.6 ±3.8)%. There was no significant difference between the concentration of 18.4μmol/L and 23μmol/L, and there was significant difference among the rest(P<0.05). For 72 hours, the cell inhibition rates were respectively (16.3±1.4)%, (28.7±3.7)%, (64.8±4.4)%, (95.8±1.2)%,(101.1±4.5)% . There was no significant difference between the concentration of 18.4 μmol/L and 23.0 μmol/L, and there was significant difference among the rest(P<0.05) . Different concentrations of solanine in A375 cells for 24h, 48h and 72h, the IC50 were 16.2μmol/L,12.9μmol/L,11.8μmol/ L.Therefore, we selected 9.2 μmol/L, 13.8 μmol/L, 18.4 μmol/L of solanine in A375 cells for 24 hours for subsequent experiments;3 Under the inverted microscope, the cells in thhowed the control group cells with the same size and uniform distribution of nuclei, while the experimental group presented nuclear pyknosis, nuclear edge set and apoptotic bodies formation ;4 RT-qPCR showed different concentrations of solanine in A375 cells for 24 hours, the expression amount of gene Bax were respectively 1.370±0.335, 1.721±0.711, 2.371±0.494, the negative control group was 1.064±0.516, there was no significant difference between the 9.2 μmol/L,13.8 μmol/L and 18.4 groups(P>0.05), and there was significant difference among the rest(P<0.05)；the expression amount of gene Caspase-3 were respectively 1.346±0.289, 1.619±0.299, 2.338±0.033, the negative control group was 1.018±0.267, there was no significant difference between the the negative control group, 9.2 μmol/L and 13.8 μmol/L groups (P>0.05), and there was significant difference among the rest(P<0.05); the expression amount of gene Bcl-2 were respectively 0.975±0.109, 0.705±0.228, 0.360±0.110, the negative control group was 1.007±0.166, there was significant difference between 18.4 μmol/L and the negative control groups, 9.2 μmol/L and 18.4 μmol/L

272

2019CSID Poster communication groups(P<0.05), and there was no difference among the rest(P>0.05);5 Western blot showed different concentrations of solanine in A375 cells for 24 hours, the expression amount of protein Bax were respectively 0.543±0.049, 0.824±0.059, 0.857±0.046, the negative control group was 0.440±0.039, there was no significant difference between the 13.8 μmol/L and 18.4 groups (P>0.05), and there was significant difference among the rest(P<0.05) ; the expression amount of protein Caspase-3 were respectively 0.409±0.050，0.526±0.029，0.613±0.050，the negative control group was 0.403 ±0.037，there was no significant difference between the the negative control group and 9.2 μmol/L(P>0.05), and there was significant difference among the rest(P<0.05) ； the expression amount of protein Bcl-2 were respectively 0.275±0.026 ， 0.145±0.018 ， 0.045±0.018 ， the negative control group was 0.254±0.021 ， there was no significant difference between the the negative control group and 9.2 μmol/L(P>0.05), and there was significant difference among the rest(P<0.05). Conclusions 1 In a certain range, solanine has significantly inhibitory effect on melanoma A375 cells proliferation in a time and dose dependent manner.2 In a certain range, solanine can induce the apoptosis of melanoma A375 cells. The higher the concentration is, the more significant inducing apoptosis effects it has.3 Solanine induced to the apoptosis of melanoma cells A375 may relate to mitochondrial apoptosis pathways. It activates caspase-3 by down-regulating the ratio of Bcl-2 to Bax.

PO-185 The derivative of acetyl-11-keto-β-boswellic acid modulates TH17/Treg polarization via binding ACC1

Jing BAI1, Zhenyao XU2, Qianqian YIN1, Hong ZHOU1, Fangzhou LOU1, Zhikai WANG1, Yuanyuan GAO1, Wei CAI1, Yang SUN1, Liman NIU1, Hong WANG1, Yongjian Zhang3 and Honglin WANG1,2,* 1Shanghai Institute of Immunology, Institute of Medical Sciences, Shanghai Jiao Tong University School of Medicine, Shanghai, 200025, China 2Institute of Translational Medicine, Shanghai Institute of Immunology Center for Microbiota & Immune Related Diseases, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 201600, China 3School of Chemistry and Chemical Engineering, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240, China

273

2019CSID Poster communication

Purpose Psoriasis is a chronic inflammatory skin disease with TH17 being implicated as the pathogenesis. The importance of targeting IL-23/TH17 axis in psoriasis has been proved by the great clinical success of monoclonal antibodies that block IL-17A, the primary cytokine of TH17 cells. In this paper, we synthesized a series of derivatives of acetyl-11-keto-β-boswellic acid (AKBA) to improve the hydrophobicity. High hydrophobicity enhances the skin penetration when the compound is topically used to treat the skin lesion. The purpose of this study is to elucidate the primary target and molecular mechanism underlying the small molecular compound. Methods To explore the targets and molecular mechanism of the most promising compound 3-o- α-cyclohexanoyl-11-keto-β-boswellic acid (CKBA), we performed affinity purification, enzyme activity assay, TH17 cell differentiation, RNA sequencing, and imiquimod (IMQ) induced mouse model of psoriasis. Results Target identification of CKBA showed it interacted with acetyl-CoA carboxylase 1 (ACC1) and inhibit the enzymatic activity. The inhibition of ACC1 decreased the formation of TH17 cells and promoted the development of anti-inflammatory Foxp3+ regulatory T (Treg) cells. In vivo, topical administration of CKBA attenuated imiquimod induced mouse model of psoriasis and decreased the protein level of IL-17 in a dose-dependent manner. Conclusion Our results indicate clinical potential of CKBA for the treatment of autoimmune diseases with dependence on IL-17, such as psoriasis.

PO-186 Exosome-mediated miR-769-5p transfer plays a role in ultraviolet radiation-induced bystander effect by targeting TGFBR1

Weiwei Ma1 Zhou Bingrong1 1Department of Dermatology, the First Affiliated Hospital of Nanjing Medical University

Background UV-radiation induced bystander effects (UV-RIBEs) refer to besides causing the direct damage of irradiated cells, ultraviolet irradiation also inducing similar damage of adjacent unirradiated cells. Signals such as cytokines, reactive oxygen species, nitric oxide and even microRNAs (miRNAs) can mediate the intercellular communication. Some studies have shown that exosomes isolated from ultraviolet irradiated cell culture media can mediate UV- RIBEs. However, the mechanism has not been expounded in details. Aim To investigate the role of exosome-encapsulated miRNA-769-5p in the UV-RIBEs.

274

2019CSID Poster communication

Methods UV-irradiated human dermal fibroblasts (UVA irradiation for 20 J/cm2 and UVB irradiation for 60 mJ/cm2 per time) were cultured for 24 hours with exosome-free serum medium. Exosomes were extracted from the cell culture supernatant. The exosomes were visualized with Transmission electron microscopy (TEM) and analyzed with Nanoparticle Tracking Analysis (NTA) and Western Blotting (WB). After the normal human dernal fibroblasts were co-cultured with exosomes for 48 hours. Cell counting CCK-8 was performed for detecting the cell proliferation, reactive oxygen species (ROS) kit combined with flow cytometry for the detection of oxidative damage of bystander cells, and the mitochondrial membrane potential detection kit for detecting early apoptosis. Then, miR-769-5p mimic/miR-769-5p inhibitor was used to up-regulate/down-regulate the expression of miR-769-5p in exosomes, and the effect of exosomes on co-cultured cells was observed to verify the function of exosome-mediated miR- 769-5p in UV-RIBEs. Results Exosomes isolated from irradiated conditioned medium could induce bystander effects including the reduce the cell proliferation rate, stimulating oxidative damage and apoptosis of the cells. miR-769-5p, which is up-regulated as a result of miR-769-5p mimic transfection or irradiation, can be transferred from donor or irradiated cells into extracellular medium and subsequently get access to the recipient or bystander cells through exosomes to induce bystander effects as above. Similarly, using miR-769-5p inhibitor inhibiting the expression of miR- 769-5p in advance can offset the bystander effects to some extent, increasing the cell proliferation rate, reducing oxidative damage and apoptosis of the cells. Finally, the target gene TGFBR1 of miR-769-5p was found with the dual luciferase reporter assay, which demonstrated that exosome-mediated miR-769-5p transfer played a role in UV-RIBEs of human dermal fibroblasts by targeting TGFBR1. Conclusion The exosome-mediated UV-RIBEs is associated with miR-769-5p encapsulated by targeting TGFBR1. These findings provide new insights into the functions of miRNAs, the development of UV protection and the treatment of UV-related diseases.

PO-187 Melanocyte migration induced by repeated exposures to UVB requires activation of the p53/miR-211/MMP9 axis

Tiechi Lei1 1Renmin Hospital of Wuhan University

275

2019CSID Poster communication

Objective Vitiligo is an acquired depigmented disorder of the skin that is characterized by the destruction of melanocytes resulting in achromic macules. Although UVB-based phototherapy has been clinically proven to be an effective therapeutic option in the treatment of vitiligo, the mechanism by which how UVB induces repigmentation in vitiligo has not been clearly elucidated. In this study, we examined the role of p53/miR-211/MMP9 in regulating melanocyte migration upon exposure to UVB. Methods Primary human epidermal melanocytes treated with different physiological doses of UVB were collected to measure the mRNA and protein levels of p53/TRPM1/miR-211 / MMP-9 using qPCR and western blotting assay. Transwell with collagen IV-coated membrane inserts were used to detect the melanocytes migration ability. Furthermore, we added 0.2 nmol GM6001 (matrix metalloproteinases inhibitor) into the lower chambers with the supernatants of untreated or treated melanocytes to observe the melanocytes migration. The protein levels of MMP-9 were measured by immunofluorescent staining. miR-211 mimics targeted MMP-9 and lentivirus p53- GFP were used to transfect into melanocytes at 48h or 72h, respectively, and then cells were harvested and detected the changes of p53/miR-211/MMP9 axis. Results Melanocytes exposed to a different single dose or mutiple dose of UVB irradiation have a significant increase in p53 and MMP-9 in mRNA and protein levels. Transwell results demonstrated that the migration ability of melanocytes transfected with lentivirus-p53-GFP was significantly increased as compared with controls. Cells transfected with hsa-miR211 mimic showed the decreased migration ability than those in the controls. Conclusion Our results indicate that the p53/miR-211/MMP9 axis plays an essential role in facilitating melanocyte migration upon exposure UVB irradiation, which may serve as a promising target for promoting repigmentation outcomes in vitiligo. (This study was supported by a funding from National Natural Science Foundation of China, #81573028).

PO-188 Paeoniflorin protects human dermal fibroblasts against UVA radiation induced oxidative injury through the Nrf2/HO-1 pathway

Yansong Lu1 1Department of Dermatology, The First Affiliated Hospital of China Medical University, China Medical University, Shenyang, China

276

2019CSID Poster communication

Background Ultraviolet (UV) light is one of the most harmful environmental factors that contribute to skin damage. UV induces the genera-tion of reactive oxygen species (ROS), resulting in oxidative stress and damage to cell which induced photodamage and skin cancer. Paeoniflorin (PF) is a novel natural antioxidant, which is isolated from peony root. Objective This study was designed to confirm the protective effect of Paeoniflorin (PF) against UV-induced oxidative injury in human dermal fibroblasts and to elucidate the underlying mechanisms. Methods Human foreskin fibroblast-derived cells were treated with PF (400 μM) for 24 h prior to UVA (22.5 J/cm2) exposure, and assayed the anti-oxidative stressing effects of PF. Results We found PF pretreatment substantially ameliorated UVA -induced cytotoxicity, and inhibited intracellular ROS production in fibroblasts. Preincubation of fibroblasts with PF before UVA-radiation resulted in significant inhibition of apoptosis. The PF-mediated anti-antioxidant properties are associated with increased nuclear translocation of Nrf2. Activation of Nrf2 signaling is accompanied with induction of HO-1 expressions in PF-treated fibroblasts. Silencing of Nrf2 signaling with siRNA showed no anti-antioxidant effects of PF against UVA-induced ROS production, and significantly reversed the protective effects of PF against UVA-induced growth inhibition in fibroblasts. It is suggesting that the PF protected human dermal fibroblasts against UVA-induced oxidative stress injury through the Nrf2/HO-1 pathway Conclusion: PF treatment diminished UVA-induced oxidative stress injury through the Nrf2/HO-1 pathway in fibroblasts.

PO-189 Perifosine sensitizes UVB-induced apoptosis in skin cells: New implication of skin cancer prevention?

Haiqing Wang1 Ji Chao1 Cheng Bo1 1The First Affiliated Hospital of Fujian Medical University

We demonstrate here that a relative low dose of perifosine significantly enhanced UVB- induced apoptosis in skin cells (keratinocytes and fibroblasts), associated with a significant increase of reactive oxygen species (ROS) and ceramide production as well as multiple perturbations of diverse cell signaling pathways, shifting to a significant pro-apoptosis outcomes. Perifosine inhibited UVB-induced pro-survival Akt/mammalian target of rapamycin (mTOR) and ERK activation, while facilitating pro-apoptotic AMP-activated protein kinas (AMPK), c-Jun-NH2-

277

2019CSID Poster communication kinase (JNK), and p53 activation; these signaling changes together promoted a striking increase in skin cell apoptosis and a significantly reduced amount of DNA damages. Our results suggest that perifosine may represent a novel skin cancer prevention strategy.

PO-190 The effect of low-level laser therapy (650 nm) on the gene expression in the human hair follicle ex vivo

Jinran Lin1 Liu Qingmei1 Yang Kai2 Bai Yanshuang2 Wu Wenyu1 Xu Jinhua1 1Huashan Hospital Fudan University 2Jing

Background Low-level laser therapy (LLLT) has been cleared by FDA as a new treatment for androgenetic alopecia (AGA). However, it has not been elucidated how LLLT promotes hair growth. Objectives To assess the potential hair growth effect of LLLT on human hair follicles. Methods Human hair follicles were obtained from patients with AGA. Human hair follicles were then cultured. Follicles were irradiated by the LLLT device (650nm,5mW) for 5min, 10min. The immunofluorescence and RT-qPCR method were used for the analysis of gene expression. Results Human hair follicles ex vivo growed in 5min group better than 10min group. Immunofluorescence results showed that Ki67 expression in 5min group was significantly higher than which in 10 min group. The ration of anagen/catagen in 5min group was significantly higher than the control after 9-day ex vivo culture. RNAseq analysis demonstrated that the gene expression of FGF7, IGF1, VEGF, Wnt10a, Noggin and Lef1 were significantly upregulated. Conclusion LLLT could stimulate the growth of human hair follicles ex vivo, and increase the expression of genes involved in the anagen induction and catagen inhibition.

PO-191 Aberrant hTERT promoter methylation predicts prognosis in Chinese patients with acral and mucosal melanoma

Xiaojing Kang1 Xu Haixia1 Wang Weijia1 Zhao Juan1 Li Tingting1 Liang Junqin1 1People’s Hospital of Xinjiang Uyghur Autonomous Region, Urumqi, Xinjiang

278

2019CSID Poster communication

Objective To evaluate the methylation level of hTERT promoter region CpG island (CGIs) and its prognostic impact in Chinese patients with acral and mucosal melanoma. Methods Bioinformatics software was used to analyze hTERT gene promoter. Fresh frozen tissues were taken from 14 patients with melanoma (6 acral melanoma and 8 mucosal melanoma and 14 pigmented nevus control subjects(14 acral pigmented nevus). Bisulfite sequencing PCR (BSP) combined TA clone sequencing was used to assess the methylation of hTERT promoter CGIs. The relative expression level of hTERT mRNA was measured by quantitative real-time polymerase chain reaction (qRT-PCR). Results CGIs-1 (-1392–-1098 bp), CGIs-2 (-945–-669 bp), and CGIs-3 (-445–-48 bp) were selected for our study. Our results indicated that the methylation level of hTERT promotor CGIs in melanoma is greater than pigmented nevus (CGIs-1: 69.2±18.7% vs 46.8±20.4%, CGIs-2: 73.8±14.7% vs 55.6±16.0%, CGIs-3: 5.8±2.2% vs 2.2±1.3%, P<.05). The relative expression level of hTERT in melanoma is greater than in pigmented nevus (50.39±9.16 vs 26.10±7.25, t=7.778, P<.001). Linear regression analysis showed that the methylation level of the hTERT gene promoter of melanoma was positively correlated with the relative expression level of hTERT mRNA (R2=.490, F=13.478, P=.003). Combined with the analysis of clinicopathological features, the methylation level of CGIs-2 in melanoma with lymph node metastasis was greater than in melanoma without lymph node metastasis, and the methylation level of CGIs-2 increased with TNM staging. Conclusion CGIs-2 methylation level is associated with the relative expression level of hTERT mRNA, lymph node metastasis and TNM staging, suggesting that CGIs-2 hypermethylation may be used to evaluate the prognosis in Chinese patients with acral and mucosal melanoma. Abbreviations hTERT=human telomerase reverse transcriptase, CGIs=CpG island, BSP= bisulfite sequencing PCR.

PO-192 Studies on HSV infection of melanocytes

Yuxin Feng1 1The First Hospital of China Medical University

Objective: To explore the effect of HSV on normal melanocytes.

Materials and Methods In this study, first, we examined a series of morphological changes caused by Herpes Simplex Virus Type 1 infection of melanocytes, including the changes in the

279

2019CSID Poster communication morphology of melanocytes, the number and length of dendrites. Secondly, by melanin content assay and tyrosinase activity assay, we also examined the effect of Herpes Simplex Virus Type 1 on the melanin synthesis and tyrosinase activity. RT-PCR and Western-Blot detect the level of MITF, TYR, GP-100 and a series of changes of vitiligo related signal molecules. Results When HSV-1 was infected for 48h and 72h, PIG1 cells are reduced in size and rounded. The length and number of dendrites in PIG1 cells decreased. The melanin content and the activity of tyrosinase in PIG1 infected with HSV-1 for 72h was lower than that in the control group. The levels of MITF, TYR, GP-100, NRF2, HO-1 and NQO-1 were decreased in the herpes simplex infection group. Conclusion Herpes Simplex Virus Type 1 can infect normal melanocytes and may induce vitiligo.

PO-193 ATP-citrate lyase epigenetically potentiates oxidative phosphorylation to promote melanoma growth and MAPK inhibition adaptive resistance

Weinan Guo1 Ma Jinyuan1 Yang Yuqi1 Guo Sen1 Yi Xiuli1 Wang Huina1 Shi Qiong1 Wang Gang1 Gao Tianwen1 Li Chunying1 1Xijing Hospital, Fourth Military Medical University

Purpose Enhanced lipogenesis and mitochondrial function are two critical metabolic characteristics in melanoma, but their crosstalk involved in tumor biology and targeted therapy remains unknown. ATP-citrate lyase (ACLY) is a crucial lipogenic enzyme that is greatly implicated in tumor development, but its role in mitochondrial function and melanoma pathogenesis has not been elucidated. Methods In vitro and in vivo functional experiments were performed to determine the effect of ACLY on melanoma growth. mRNA expression profile analysis and a panel of biochemical assays were used to investigate the role of ACLY in mitochondrial oxidative phosphorylation and the underlying mechanism. The impact of combined inhibition of ACLY on the efficacy of MAPK inhibition therapy was also examined. Results We first found that ACLY expression was increased in melanoma and facilitated cell proliferation and tumor growth both in vitro and in vivo. Subsequent mRNA expression profile analysis and functional studies unveiled that ACLY specifically activated MITF-PGC1α axis to promote mitochondrial biogenesis and melanoma growth. Mechanistically, ACLY enhanced the

280

2019CSID Poster communication activity of acetyltransferase P300, increasing the histone acetylation at MITF locus to activate MITF-PGC1α axis transcription. More importantly, the combined inhibition of ACLY sensitized BRAF-mutant melanoma to MAPK inhibition by suppressing MITF-PGC1α axis. Conclusions We demonstrate that ACLY epigenetically potentiates oxidative phosphorylation to promote melanoma growth and MAPK inhibition adaptive resistance. Our study discovers the novel crosstalk between lipogenesis and mitochondrial function in tumor biology, and highlights targeting ACLY as a potent therapeutic approach via simultaneously impairing tumor growth and MAPK inhibition resistance in melanoma.

PO-194 Pou4f1 promotes braf inhibitor resistance by reactivating mapk signaling pathway in melanoma

Qiao Yue1 Liu Lin1 Shi Qiong1 Li Chunying1 1Department of Dermatology, Xijing Hospital, Fourth Military Medical University

Despite there is a nice response rate in BRAF mutant melanoma with BRAF inhibitor, the overwhelming majority of patients eventually develop resistance. Preclinical studies suggest that ERK reactivation is a major resistance mechanism to BRAF inhibitor, the mechanism by which ERK gets phosphorylated was not fully understood. Here, we show that POU class 4 homeobox 1 (POU4F1) is high expression in BRAF mutant melanoma, which leads to hyperproliferation of melanoma by reactivation of MAPK pathway, and finally promote melanoma resistance. Further mechanistic studies showed that POU4F1 is abnormally highly expressed in melanoma tissues, knock down POU4F1 inhibite the proliferation ofmelanoma, and vice versa. POU4F1 is highly expressed in in BRAF inhibitor-resistant melanoma, and the expression of p-ERK in BRAF inhibitor-resistant cells is also significantly increased. In addition, overexpression of POU4F1 promoted the Phosphorylation of ERK in melanoma, which is confirmed that high expression of POU4F1 promotes the reactivation of ERK, a key downstream molecule of the MAPK pathway, strongly suggesting that POU4F1 mediates melanoma BRAF inhibitor resistance by reactivation of the MAPK signaling pathway. These findings establish POU4F1 as a therapeutic strategy in treatment-resistant BRAF mutant melanoma and provide insight into the mechanism of action.

281

2019CSID Poster communication

PO-195 The function and mechanism of MDA5 in the onset and progression of virus-induced vitiligo

Tongtian Zhuang1 Li Shuli1 Yi Xiuli1 1Department of Dermatology, Xijing Hospital, Fourth Military Medical University

Objective IFIH1, encoding MDA5 as a cytoplasm receptor to sense virus, has been identified as a susceptible gene in vitiligo. But the specific role of virus and MDA5 in vitiligo pathogenesis have not been determined. We sought to explicit whether virus could induce the onset and progression of vitiligo and the underlying mechanisms. Methods We firstly detected the serum IgM of cytomegalovirus (CMV) in vitiligo patients using ELISA Kit. The expression of MDA5 and IFN-β were examined by immunofluorescence in vitiligo epidermis and healthy controls. The chemokines and IFN-β secretion of keratinocytes stimulated by poly (I:C), a nuclear acid analogue of virus, was determined by corresponding ELISA Kits. The signaling pathway was explored by respectively silencing the key proteins using small interference RNA (si-RNA) and detected by western-blot assay. Results Firstly, we verified that virus possibly correlate with vitiligo. In addition, MDA5 and IFN-β is higher expressed in the epidermis of vitiligo patients than that of healthy controls. Sequentially, in vitro assay validated that poly (I:C) could promote the expression of CXCL10 and CXCL16 in keratinocytes. Mechanistically, we found that the secretion of CXCL10 is mediated by the pathway of MDA5-MAVS-NF-kb/IRF3-IFN-β-JAK1-STAT1, while the expression of CXCL16 is mediated by MDA5-MAVS-NF-kb/IRF3. Conclusion Our study demonstrated that virus have the tight relationship to vitiligo and the underlying mechanisms is that virus infection could significantly promote the secretion of CXCL10 and CXCL16 which have been found to play a key role in attracting autoimmune melanocyte- targeted CD8+ T cells to epidermis to exacerbate vitiligo.

282

2019CSID Poster communication

PO-196 Juglone potentiates BRAF inhibitor-induced apoptosis in melanoma through ROS-p38-p53 pathway

zheng li1 xu jinhua1 wu jinfeng1 1Huashan Hospital, Fudan University

Objective BRAF inhibitor is one of the most effective drugs against melanoma, however its clinical application is largely limited by drug resistance. Juglone, isolated from walnut trees, has demonstrated antitumor activity. In the present study, we investigated if juglone could enhance the responses of BRAF inhibitor to BRAF inhibitor acquired resistant melanoma cells (A375R and SK-MEL-5R). Method These cells were treated with juglone alone or BRAF inhibitor alone or juglone combined with BRAF inhibitor. The cytotoxicity was detected by MTT. The cell proliferation was determined by crystal violet stains. The cell apoptosis was determined by flow cytometry and the apoptosis related proteins such as cleaved poly(ADP-ribose) polymerase (PARP), Survivin, Bcl-2, and Bax were measured by Western-Blot.DCFH-DA was used to assay the intracellular ROS level; JC-1 stain was used to study the mitochondrial transmembrane potential.The p38,p53 and their phosphorylation counterparts were measured by Western-Blot. Furthermore, NAC, a ROS scavenger, was used to test whether juglone and PLX4032 cotreatment-induced cytotoxicity was partially reversed Results Juglone potentiated BRAF inhibitor-induced cytotoxicity and mitochondrial apoptosis in both A375R and SK-MEL-5R cells, which was accompanied by decline of mitochondrial transmembrane potential, increase of Bax and decrease of Bcl-2. Moreover, juglone combined with BRAF inhibitor markedly increased the intracellular level of reactive oxygen species (ROS) and activated p38, and p53, as compared to juglone alone or BRAF inhibitor alone. N-acetyl cysteine (NAC), a ROS scavenger, completely reversed juglone combined with BRAF inhibitor- induced cytotoxicity. Juglone potentiated BRAF inhibitor-induced cytotoxicity and mitochondrial apoptosis in both A375R and SK-MEL-5R cells, which was accompanied by decline of mitochondrial transmembrane potential, increase of Bax and decrease of Bcl-2. Moreover, juglone combined with BRAF inhibitor markedly increased the intracellular level of reactive oxygen species (ROS) and activated p38, and p53, as compared to juglone alone or BRAF inhibitor alone. N-acetyl cysteine (NAC), a ROS scavenger, completely reversed juglone combined with BRAF inhibitor-induced cytotoxicity.

283

2019CSID Poster communication

Conclusion juglone potentiated BRAF inhibitor-induced apoptosis in resistant melanoma cells, and these effects were partially through ROS-p38-p53 pathway, which suggested the potential of juglone to be a sensitizer for BRAF inhibitor in the treatment of melanoma. 96 Normal010 磅 02falsefalsefalseEN-USZH-CNX-NONE

PO-197 Homocysteine induces apoptosis of melanocytes via PERK- eIF2α- CHOP pathway in vitiligo

Jiaxi Chen1 Yi Xiuli1 Gao Tianwen1 Li Chunying1 1Department of Dermatology, Xijing Hospital, Fourth Military Medical University

Hyperhomocysteinemia and folate deficiencies have been reported in patients with vitligo, while the mechanism underlying this process are unclear. This study aims to investigate the effect of homocysteine (Hcy) on vitiligo pathogenesis and the underlying mechanisms. Our results demonstrated that Hcy was highly expressed in the serum of patients with vitiligo and associated with the degree of disease progression. In vitro study confirmed that oxidative stress can promote the accumulation of Hcy in melanocytes. Hcy treatment can inhibit melanocyte growth and induce cell apoptosis in a dose-dependent manner. Hcy treatment upregulated glucose-regulated protein 78(GRP78), activated endoplasmic reticulum stress and induced the expression of C/EBP homologous protein(CHOP). Interfering with the IRE1 pathway has no effect on apoptosis, whereas, the level of apoptosis is reduced by interfering with the PERK pathway. We also observed activation of pPERK in peripheral melanocytes of vitiligo patients. Folic acid serves as cofactors of homocysteine methyltransferase of methionine from homocysteine. Folic acid supplementation can reduce intracellular Hcy levels, reduce the level of pPERK, inhibit the activation of the perk-eif2a-CHOP pathway, reduce the toxicity of Hcy to cells and promote melanocyte surivival. Our study also showed that homosysteine disrupts melanogenesis via inhibition of MITF TYR TYRP1 and melanA experssion, supplementation of folic acid can restore above molecular expression and restore melanin synthesis. Our data suggest that an elevated Hcy level may be a precipitating factor for vitiligo in predisposed individuals. In addition, Hcy facilitate melanocyte apoptosis through perk-eif2a-CHOP pathway, and decrease melanin synthesis. Importantly, folic acid supplementation can reduce the Hcy toxicity to melanocyte and restore melanin synthesis.

284

2019CSID Poster communication

PO-198 Necroptosis is a novel way of melanocyte death in oxidative stress- related vitiligo pathogenesis

Jianru Chen1 1Xijing Hospital, the Fourth Military Medical University

Objective To determine whether melanocyte perishes in an alternative way of programmed cell death named necroptosis under oxidative stress in vitiligo pathogenesis other than apoptosis. Methods Confocal microscopy were applied to observe necroptotic markers in melanocytes derived from vitiligo lesional skin. Real-time PCR, western blot, CCK-8 assay, flow cytometry, immunocytofluorescense, immunoprecipitation were conducted to explore mechanisms of necroptosis in human immortalized normal melanocyte cell line PIG1 and vitiligo melanocyte

PIG3V under H2O2 stimulation. Results We found that phosphorylation of RIP3 and MLKL, the biomarkers of necroptosis, were prominently up-regulated in melanocytes of vitiligo lesions, which were hardly detected in heathy control. Next, we validated that oxidative stress induced conspicuous necroptosis in PIG1 and PIG3V. Furthermore, inhibition of either RIP1 or MLKL significantly protected melanocytes against H2O2-induced cell death by ameliorating oxidative damage. Noteworthily, we found PIG3V was more vulnerable to oxidative stress-induced necroptosis, as the interaction of RIP1 with RIP3 and the occurrence of phospho-MLKL cell membrane translocation was earlier in PIG3V. In supplement, mitochondrial ROS are partially involved in necroptosis of melanocytes under H2O2 treatment. Conclusion We demonstrated that necroptosis was a novel way of melanocyte death in oxidative stress-induced vitiligo pathogenesis, which may help inform our understanding of vitiligo pathogenesis and treatment.

285

2019CSID Poster communication

PO-199 The Up-regulated Ubiquitin Ligase TNFAIP3 Plays an Oncogenic Role in Melanoma

Xiuli Yi1 Ma Jinyuan1 Guo Weinan1 Wang Huina1 Wang Shiyu1 Liu Lin1 Gao Tianwen1 Li Chunying1 1Department of Dermatology, Xijing hospital, Fourth Military Medical University

Introduction Tumor Necrosis Factor α inducible protein 3 (TNFAIP3, also called A20) is well known for its immunosuppressive functions. However, few studies has investigated functions on tumor intrinsic A20. Here, we report A20 promotes melanoma growth, metastasis, and immune evasion through STAT3/PD-L1 pathway. Objective To investigate functions and mechanism on TNFAIP3 regulating melanoma development. Materials and Methods Tissue microarray, GO database analysis, western blot and qRT-PCR were used to evaluate A20 expression in vivo and in vitro. Xenograft assays in nude mouse, western blot and flow cytometry was used to evaluate growth rate of melanoma tissues, melanoma cells proliferation and cell cycle progression respectively. Cell immunofluorescence, mouse tail intravenous injection and transwell assays were used to detect melanoma metastasis ability. Flow cytometry on tumor infiltrating lymphocytes of xenografted C57 mouse was used to evaluate tumor immune evasion. Co-IP assays, mass spectrum analysis, ChIP assays and western blot assays were used to identified A20 binding proteins and transcription factors of PD- L1. Analysis on TCGA database and flow cytometry on tumor infiltrating CD8+ T cells of melanoma patients was used to confirm the relationship between expression of A20 and PD-L1 clinically. Results Compared with the melanocytic nevus and normal melanocytes, A20 is significantly up- regulated in both melanoma tissues and cell lines. Knocking down of A20 significantly prevent melanoma proliferation both in vitro and in vivo. Skeleton proteins in melanoma cells loss its rule of arrangement after A20 was silenced, as well as the metastasis capability. A20 expression is positively correlated with PD-L1 expression, and the capability of tumor immune escape in vivo. A20 links ubiquitin chains on Prohibitin, subsequently accelerates stat3 phosphorylation and improves PD-L1 expression transcriptionally. Conclusion: Tumor intrinsic A20 promotes melanoma growth, metastasis, and immune evasion by activating STAT3/PD-L1 pathway.

286

2019CSID Poster communication

PO-200 Metastatic melanoma cells rely on Sestrin2 to acquire anoikis resistance via detoxifying intracellular ROS

Xiuli Yi1 Zhu Guannan1 Guo Sen1 Wang Huina1 Yang Yuqi1 Wang Shiyu1 Gao Tianwen1 Li Chunying1 1Department of Dermatology, Xijing Hospital, Fourth Military Medical University

Distant metastases are responsible for the majority of melanoma mortalities. As a critical barrier against metastasis, anoikis is a distinct programmed cell death induced by the integrated stress from extracellular matrix (ECM) detachment. In order to survive, tumor cells employ various strategies for overcoming this barrier. Recently, Sestrin2(Sesn2) has been reported to play a protective role against integrated stress. In this study, we found ECM detachment triggered the up-regulation of Sesn2 in metastatic melanoma cells. Knockdown of Sesn2 impaired not only the cell viability but also the tumor sphere formation of melanoma cells in suspension cultures.Moreover, an elevated oxidative stress level was detected in Sesn2-silencing melanoma cells in suspension cultures, accompanied with an increased apoptosis rate. Last of all, in vivo studies indicated that Sesn2-knockdown remarkably reduced the formation of distant metastasis. Taken together, our findings illustrated that the up-regulation of Sesn2 in response to suspension stress plays a protective role in melanoma against anoikis by detoxifying oxidative stress.

287

2019CSID Poster communication

PO-201 CD147 regulates melanoma metastasis via NFAT1-MMP9 pathway

Nian Liu1,2,3 chen xiang1,2,3 Zhang Jianglin1,2,3 Peng Cong1,2,3 1Department of Dermatology, Xiangya Hospital, Central South University, Changsha, Hunan 410008, China 2Hunan Key Laboratory of Skin Cancer and Psoriasis, Changsha, Hunan 410008, China 3Human Engineering Research Center of Skin Health and Disease, Changsha, Hunan 410008, China

Objective CD147 plays a crucial role in the regulation of melanoma invasion and migration. Although studies have shown that NFAT1 has oncogenic activity, the relationship between CD147 and NFAT1 in melanoma is unclear. Methods Firstly, the correlation between CD147 and NFAT1 was analyzed by tissue microarray. Next, the calcium-dependent phosphatase activity was detected by the CAN activity assay after CD147 knockdown. The knockdown effect was confirmed by Western blotting and RT-PCR experiments. Then, the cells were treated with TG after stable knockdown of CD147. The effects of CD147 on Ca2+/NFAT1 signal were analyzed by Western blotting and immunofluorescence. Subsequently, transwell and scratch assays were used to detect the invasion and metastasis ability after NFAT1 knockdown. Further, we rescued the expression of NFAT1 and detected the invasion and metastasis ability. In vivo, the nude mouse lung metastasis model was constructed to detect the effect of NFAT1 on melanoma invasion and metastasis. Finally, luciferase reporter gene assay and CHIP assay were used to confirm the binding between NFAT1 and MMP9. Results We demonstrated that CD147 and NFAT1 are overexpressed in primary and metastatic melanoma patients and positively correlated. Then, we report that CD147 regulates NFAT1 expression and activation through [Ca2+]i-calcineurin pathway. Knockdown of NFAT1 with shRNA significantly suppressed melanoma metastasis in vitro and in vivo. In addition, we demonstrated that NFAT1 directly target MMP9. Conclusion Taken together, our findings indicate that CD147 is involved in regulating NFAT1 induced melanoma metastasis, suggesting that CD147 and NFAT1 may be potential target for therapy or chemo-prevention in melanoma.

288

2019CSID Poster communication

PO-202 MicroRNAs in the exosomes derived from keratinocytes under oxidative stress suppress the survival of melanocytes

Jingjing Ma1 Yang Yuqi1 Zhang Weigang1 Gao Tianwen1 Li Chunying1 Zhe Jian1 1Department of Dermatology, Xijing Hospital, Fourth Military Medical University

Objective Vitiligo is a skin disease characterized by the destruction of epidermal melanocytes. Oxidative stress is closely related to the development of vitiligo. As the main constituent cells in the epidermis, keratinocytes regulates the viability and the function of melanocytes, but the underlying mechanism is still not clear. It has been proved that keratinocytes can secrete quite a number of functional exosomes, so we hypothesized that exosomes derived from keratinocytes under oxidative stress induce the survival of melanocytes.

Methods We treated human keratinocytes (HaCaT) with different concentrations of H2O2 for 24h and extracted exosomes from culture media. The identification of exosomes was performed by transmission electron microscope (TEM) and western blotting. Then we co-cultured human melanocytes (PIG1) with exosomes for 24h to 96h ，the intaking ability of melanocytes for exosomes was accessed with carbocyanine dyes, DiR and cell proliferation of melanocytes was tested by Cell Counting kit. MicroRNA-seq was conducted to reveal the microRNAs profile of exosomes derived from H2O2 treated keratinocytes, compared to those from untreated keratinocytes, then the microRNA-seq data was validated by RT-PCR. After transfection of the micro RNAs mimics to PIG1, cell survival was accessed by Cell Counting KIT and apoptotic analyzing. Results Exosomes secreted by keratinocytes displayed double layer membranes and cup-like structure. The markers of exosomes, CD63 and Hsp70, can be detected in the extracted exosomes. Interestingly, we found that the amount of exosomes secreted by keratinocytes was dramatically increased under H2O2 treatment, with concentration dependent. H2O2 at 0.4mM enhanced exosomes secretion by 3-fold (p=0.008), compared to the untreated control group. Meanwhile, we found than exosomes secreted by keratinocytes were successfully intake by PIG1 after 24h co-culture. Importantly, exosomes derived from H2O2-treated keratinocytes significantly suppressed the proliferation of melanocytes after 96h co-culture (p=0.03). MicroRNA-seq data and the subsequent validation showed that there were 4 micorRNAs enriched in the exosomes derived from H2O2-treated keratinocytes. Transfection of these microRNAs mimics to PIG1 significantly suppressed cell proliferation and enhanced the apoptosis.

289

2019CSID Poster communication

Conclusion In conclusion, our data have proved that microRNAs enriched in the exosomes derived from keratinocytes under oxidative stress suppress the survival of melanocytes. Our finds provide new insights for understanding the pathogenesis of vitiligo.

PO-203 Disruption of epidermal permeability barrier enhances UV-induced hyperpigmentation

Chun-Yan Yang1, Yan Li1, Mao-Qiang Man2, Hua Gu1,Wen-Juan Wu1, YingTu1，Li He1* 1. Department of Dermatology, First Affiliated Hospital of Kunming Medical University, Institute of Dermatology & Venereology of Yunnan Province, Kunming, Yunnan, China. 2. VAMC 4150 Clement St San Francisco, Dermatology.

Background Disruption of epidermal permeability barrier decreases the resistance of skin to external stimuli. Ultraviolet (UV), a common stimulus of skin, can induces skin hyperpigmentation. Whether barrier disruption influences ultraviolet (UV)-induced hyperpigmentation is unknown yet. Objective The aim of the present study was to assess the impact of disruption of epidermal permeability barrier on UV-induced hyperpigmentation. Materials and Methods A total of 36 C57BL/6 mice were divided into 4 groups (n=9), i.e. control, tape striping, UV-irradiation, tape striping plus UV-irradiation groups. Skin samples were collected 1h, 6h and 48h after UV-irradiation. RT-qPCR was used to assess expression levels of mRNA for ty rosinase family, Microphthalmia-associated transcription factor (MITF), p53 and pro- opiomelanocortin (POMC). Following UV irradiation, changes in epidermal pigmentation were assessed in guinea pigs with or without barrier disruption. Results Disruption of epidermal permeability barrier augmented UV irradiation-induced increases in expression levels of mRNA for p53, POMC, and tyrosine related protein-1 (TRP-1) in C57BL/6 mice (p<0.05). In parallel, marked increases in epidermal melanin content were observed in guinea pigs tape-stripped followed by UV irradiation in comparison with UV irradiation alone. Conclusion Disruption of epidermal permeability barrier aggravates UV-induced hyperpigmentation, likely via P53/POMC/TRP1 signal pathway.

290

2019CSID Poster communication

PO-204 Cardamonin, a potential drug for melanoma treatment, induces human melanoma cell apoptosis

Yuyang Yue1 1The First Hospital of Hebei Medical University

Objective Melanoma is the most invasive skin tumor, derived from melanocytes, is the most deadly type of skin tumor. Skin melanoma accounts for 1.6% of new malignant tumors worldwide, and the incidence is increasing at the rate of 2-7% per year. The incidence of melanoma has been increasing over the past few decades. Although traditional therapies such as surgery, chemotherapy, and radiotherapy can improve the prognosis of patients, but the effect is still limited. The researchers are committed to finding drugs that have the greatest impact on cancer cells and the least toxic to normal cells. In recent years, the role of traditional Chinese medicine has been recognized by researcheres world wide. Studies on the effect of active ingredients of Chinese herbal medicine on tumor are new directions in the field of cancer research. Cardamonin is an alkaloid monomer component extracted from the seeds of Alpinia katsumadai. Studies have confirmed the inhibitory effect of cardamonin on various tumor cells, but there is still no research on the effect of cardamonin on melanoma. In this study, melanoma M14 cells was treated with cardamonin, and the effects of M14 cell proliferation, apoptosis and apoptotic related proteins in M14 cell line were observed, and the potential mechanism was explored. Methods 1. Melanoma M14 cells were cultured in 1640 media containing 10% fetal bovine serum and cultured in a 37 ° C, 5% CO 2 incubator. 2. The effect of cardamonin on proliferation of melanoma M14 cells was examined by MTS assay. In the experiment, the blank control group was only added with media without cardamonin, and the negative control group. The negative control group was cells cultured in media containing different concentrations of cardamonin (30, 60, 90, 120μmol/L). Each group and concentration has 6 wells. After 24 h, 48 h, 72 h, MTS was added to detect the effect of cardamonin on the proliferation of melanoma M14 cells, and the survival rate of cells at different concentrations of drug was calculated. 3. The apoptosis of melanoma M14 cells induced by cardamonin was detected by flow cytometry. Two groups were set up in the experiment. The negative control group was cells cultured in media without cardamonin, and the treated group was cells cultured in media with following concentrations (30, 60, 90 micromol/L) of cardamonin. After 24 hours of incubation, the assay was performed.

291

2019CSID Poster communication

4. Real-time quantitative PCR (RT-qPCR) was used to detect apoptosis-related genes in M14 cells treating with cardamonin. Two groups were set up in the experiment. The negative control group was cells cultured by media without cardamonin, and the treated group was cells cultured by media with following concentrations (30, 60, 90 micromol/L) of cardamonin. After 24 hours of incubation, the assay was performed. 5. Western blot was used to detect the expression of apoptosis-related proteins (BAX, BCL2, Cleaved Caspase8, Cleaved Caspase9 and Cleaved PARP) in M14 cells treating with Cardamonin. The negative control group was cells cultured by media without cardamonin, and the treated group was cells cultured by media with following concentrations (30, 60, 90 micromol/L) of cardamonin. Results 1. Results of MTS assay showed that the viability of melanoma M14 cells after treatment with different concentrations of cardamonin for 24h were (87.9±4.2)%, (78.2±2.4)%, (70.1±2.2)%, (44.0±3.2)%, respectively. By comparison, the difference between the experimental group and the control group was statistically significant (P<0.05); the viability of the cardamonin treatment for 48 hours was (76.0±1.6)%, (35.5±2.2)%, (32.0±1.3)%, (23.5±1.7)%, the difference between the experimental group and the control group was statistically significant (P<0.05); the viability of the adzuki bean treatment for 72 hours was (40.1±1.3)%, (34.6±2.3)%, (23±2.2)%, (18.3±2.0)%, the difference between the experimental group and the control group was statistically significant (P<0.05). 2. Flow cytometry showed that, the proportion of Annexin V positive cells (the sum of early apoptotic cells and late apoptotic cells) increased gradually with the increasing of cardamonin dosage. 3. The results of RT-qPCR showed that after treated with different concentration of cardamonin for 24h, the expression of Bax at the mRNA level was 1.595±0.141, 2.201±0.388, 2.411±0.442, and the negative control group was 1.002±0.087. The difference between the control group and the experimental groups was statistically significant (P<0.05). There was no significant difference between the other groups (P>0.05). At the mRNA level, the expression of BCL2 gene were 0.755±0.044, 0.617±0.004, 0.536±0.074, and the negative control group was 1.008±0.180. The difference was statistically significant (P<0.05) between the control group and the experimental groups, and the difference between the other groups was not statistically significant (P>0.05). 4. The results of Western blot showed that the expression of Bax in M14 cells was 0.326±0.017, 0.585±0.013, 0.307±0.008, and 0.643±0.005 in the negative control group, and after comparison, the difference between the experimental group and the negative control group were statistically significant (P<0.05); BCL2 protein expression was 0.501±0.007, 0.465±0.011, 0.409±0.01, the negative control group was 0.537±0.007.After comparison ,the difference

292

2019CSID Poster communication between the experimental group and the negative control group was statistically significant (P<0.05). The expression of Cleaved Caspase 8 protein was 0.592±0.023, 0.872±0.022, 0.949±0.0259, respectively. The negative control group was 0.437±0.003, and after comparison, the difference between the experimental group and the negative control group was statistically significant (P<0.05). The expression of Cleaved Caspase 9 protein was 0.666±0.013, 0.915±0.013, 0.979±0.007, and the negative control group was 0.507±0.014. After comparison, the difference between the experimental group and the negative control group was statistically significant (P<0.05); the expression of Cleaved PARP protein was 0.320±0.006, 0. 900±0.025, 0.979±0.009, and the negative control group was 0.175±0.003. After comparison, the difference between the experimental group and the negative control group was statistically significant (P<0.05); the expression of P65 protein was 0.720±0.006, 0.630±0.008, 0.439±0.003, and the negative control group was 0.811±0.011. After comparison, the difference between the experimental group and the negative control group was statistically significant (P<0.05). Conclusion 1. In a certain concentration and time range, cardamonin has a significant inhibitory effect on the proliferation of melanoma M14 cells in a time-dose dependent manner. 2. Cardamonin can induce apoptosis of M14 melanoma cells in a certain concentration and time range. As the concentration increases, the induction of apoptosis is growing. 3. The apoptosis of melanoma M14 cells induced by cardamonin may be related to endogenous and exogenous apoptotic pathways.

293

2019CSID Poster communication

PO-205 A new method to differentiate Melanocytes from Human embryonic stem cell

Xuanhao Zeng1 1huashan hospital, Fudan university

Because of their undifferentiated nature, human embryonic stem cells (hESCs) are an ideal model system for studying both normal human development and the processes that underlie disease. In this study, we describe an efficient method for differentiating hESCs into a melanocyte population within less than 4 weeks. The hESC-derived melanocytes expressed melanocyte markers (such as microphthalmia-associated transcription factor and tyrosinase), developed melanosomes, and produced melanin. Also, our method showed a significant higher expression of melanocyte related markers than 2 publlished methods. Melanocyte differetiated from this method also showed a similar phenotype as normal human melanocyte during long-term cell, which can be more than 100 days. Combined those result, our method could be a relative easy way to produce melanocyte for experiment or cell therapy, which need further safety experiments to confirm.

PO-206 Platycodin D, a potential drug for melanoma treatment, induces human melanoma cell apoptosis

Yuting Li1 1 the first hospital of Hebei medical university

2019CSID Poster communication mechanism has not been well elucidated. In this study, melanoma A375 cells were treated with PD to observe the effects of A375 cell proliferation and apoptosis-related proteins in ERK signaling pathway. Methods 1 Cell culture. The melanoma A375 cells were cultured in DMEM medium containing 10% fetal bovine serum, placed on the incubator of 37℃and 5% CO2. 2 Inhibitory effect of Platycodin D on the proliferation of melanoma A375 cells detected by CCK8. The experiment was divided into blank control group (only medium without cell without drug), negative control group (culture medium containing cell without drug) and experimental groups (culture medium containing cell with drug of the following concentrations: 2.5 μmol/L, 5 μmol/L, 10 μmol/L, 15 μmol/L, 20 μmol/L), each group of 6 holes. The proliferation of the A375 cells were tested by CCK8 after different concentrations of drug effected 24h, 48h and 72h. Inhibition rates of the corresponding concentration and IC50 were calculated after the A375 cells groomed 24h, 48h and 72h with different concentrations of Platycodin D. 3 The changes in apoptosis morphology of A375 cells with different concentrations of Platycodin D were observed under fluorescence microscope. The experiment was divided into negative control group (Platycodin D was 0 μmol/L) and experimental groups (5μmol/L, 10 μmol/L, 15 μmol/L of Platycodin D). 4 The expression of apoptosis-related proteins (MEK、p-MEK、ERK、p-ERK、Foxo3a、p- Foxo3a) were investigated by Western blot. 5 The data was presented as mean ± SD. Statistical significance was evaluated by One-way ANOVA among groups with SPSS24.0 software. P<0.05 was considered statistically significant. Results 1 CCK8 showed that different concentrations (2.5 μmol/L, 5 μmol/L, 10 μmol/L, 15 μmol/L, 20 μmol/L) of Platycodin D in A375 cells for 24 hours, the cell inhibition rates were respectively (2.95±2.71)%、(15.35±4.03) %、(47.6±2.36)%、(53.58±1.35)% and (57.86±2.42)%. There was no significant difference between the experimental group with 15 μmol/L and 20 μmol/L, and there was significant difference among the rest(P<0.05). For 48 hours, the cell inhibition rates were respectively（9.87±0.59）%、（20.64±1.33）%、（62.23±0.47）%、（ 73.22±1.18 ） % and （ 74.17±0.89 ） %, There was no significant difference between the concentration of 15 μmol/L and 20 μmol/L, and there was significant difference among the rest(P<0.05). For 72 hours, the cell inhibition rates were respectively（10.06±1.35）%、（39.50±2.94）%、（67.87±1.10）%、（74.33±2.26）% and（80.64.17±1.94）%. There was no significant difference between the concentration of 15 μmol/L and 20 μmol/L, and there was significant difference among the rest(P<0.05). Different concentrations of Platycodin D in A375 cells for 24h, 48h and 72h, the

295

2019CSID Poster communication

IC50 were 12.05 μmol/L、8.63 μmol/L、6.52 μmol/L. Therefore, we selected 5μmol/L, 10 μmol/L, 15 μmol/L of Platycodin D in A375 cells for 24 hours for subsequent experiments; 2 After DAPI staining, the cell size of the negative control group was consistent and evenly distributed. The nucleus of the experimental group showed nuclear pyknosis, nucleus collection and apoptotic body formation. And with the increase of Platycodin D concentration, the morphological changes of apoptosis are more significant; 3 Western blot showed different concentrations of Platycodin D in A375 cells for 24 hours, the expression amount of protein MEK were respectively 0.638±0.059, 0.658±0.024, 0.654±0.035, the negative control group was 0.637±0.058, there was no significant difference between the groups (P>0.05); the expression amount of protein p-MEK were respectively 0.431±0.059，0.389±0.054，0.245±0.048，the negative control 0.743±0.047, There was no significant difference between the concentration of 5 μmol/L and 10 μmol/L, and there was significant difference among the rest (P<0.05); the expression amount of protein ERK were respectively 0.752±0.048，0.724±0.052，0.711±0.055，the negative control 0.767±0.054, there was no significant difference between the groups (P>0.05); the expression amount of protein p- ERK were respectively 0.659±0.048 ， 0.519±0.043 ， 0.246±0.054, the negative control 0.738±0.031, There was no significant difference between the negative control group and 5 μmol/L , and there was significant difference among the rest, (P<0.05); the expression amount of protein Foxo3a were respectively 0.421±0.045 ， 0.451±0.067 ， 0.490±0.054 ， the negative control 0.350±0.033, There was no significant difference between the concentration of 5 μmol/L and 10 μmol/L, and there was significant difference among the rest(P<0.05); the expression amount of protein p-Foxo3a were respectively 0.076±0.01 ，0.164±0.026，0.113±0.022, the negative control 0.224±0.023, There was no significant difference between the concentration of 10 μmol/L and 15 μmol/L, and there was significant difference among the rest(P<0.05). Conclusions 1 In a certain range, Platycodin D has significantly inhibitory effect on melanoma A375 cells proliferation in a time and dose dependent manner. 2 In a certain range, Platycodin D can induce the apoptosis of melanoma A375 cells. The higher the concentration is, the more significant inducing apoptosis effects it has. 3 Platycodin D induced to the apoptosis of melanoma cells A375 may relate to the ERK pathway. It promotes apoptosis of melanoma A374 cells by inhibiting the phosphorylation of MEK, ERK, and FOXO3a.

296

2019CSID Poster communication

PO-207 Knockdown of FOXM1 inhibits activation of keloid fibroblasts and extracellular matrix production via inhibition of transforming growth factor-β1/Smad signaling pathway

Chuantao Cheng1 1The Second Affiliated Hospital of Xi

Keloid is fibrotic tumor that is characterized by overactive fibroblasts. Forkhead box M1 (FOXM1) is transcription factor that plays important roles in the progression of fibrosis. However, the role of FOXM1 in keloid has not been elucidated. In the present study, we examined the expression levels of FOXM1 in clinical keloid tissue specimens and primary keloid fibroblasts (KFs). The results showed that FOXM1 levels were significantly increased in both keloid tissues and KFs. To further investigate the biological functions of FOXM1, FOXM1 was knocked down in KFs by transfection with small interfering RNA targeting FOXM1 (si-FOXM1). Knockdown of FOXM1 inhibited transforming growth factor-β1 (TGF-β1)-induced cell proliferation and migration of KFs. Besides, the increased expressions of collagen (coll I), connective tissue growth factor (CTGF), and α-smooth muscle actin (α-SMA) in TGF-β1-induced KFs were suppressed by si- FOXM1 transfection. Furthermore, TGF-β1-induced increase in p-Smad2 and p-Smad3 expressions was attenuated by FOXM1 knockdown. These data indicated that knockdown of FOXM1 inhibited TGF-β1-induced KFs activation and extracellular matrix (ECM) accumulation, which was attributed to the inhibition of TGF-β1/Smad pathway. These findings suggested that FOXM1 might act as a driver for keloids formation and a promising therapeutic target for keloids treatment.

PO-208 Long non-coding RNA LINC00504 expected as a therapy target for psoriasis

Jingxia Lin1 Chen Yongfeng1 1Dermatology hospital of Southern Medical University

297

2019CSID Poster communication

Psoriasis is a chronic inflammatory skin disease that presents with a clear genetic contribution, characterized by keratinocytes excessive proliferation. Based on the result of the previous studies, we focus on long non-coding RNAs (lncRNAs) that Specific expressed in psoriasis. Analysis of lncRNA-mRNA co-expression network indicated that the long non-coding RNA LINC00504 functions as a competing endogenous RNA to regulate TP63 expression by sponging miR-21. In our study, LINC00504 expression was measured in 30 paired psoriasis skin and non-psoriasis tissue samples by real-time polymerase chain reaction (PCR). Our results showed that LINC00504 was significantly up-regulated in skin lesions of patients with psoriasis. It indicates that the longnon-coding RNA LINC00504 is clearly related to psoriasis and further research on it is expected as a target for the treatment of psoriasis.

PO-209 Early prediction of the differentiation tendency of iPSCs in embryonic bodies

Ningning Guo1 Liu Liping1 Zheng Yunwen2 Li Yumei1 1The Affiliated Hospital of Jiangsu University 2University of Tsukuba Faculty of Medicine

Objective Induced pluripotent stem cells (iPSCs) show huge variations in their differentiation, even in the same conditions. Distinct iPSC lines have different capabilities to differentiate into a specific lineage. Whether these differentiation tendencies are predictable in the early stage of differentiation remains unclear. Thus, this study aimed to establish an efficient prediction system for differentiation tendency of hiPSC lines with parameters identified in the early EB stage. Methods Embryonic bodies (EBs) derived from four human iPSC lines (iPSC-1/4) were compared in their capability of EB formation and maintenance (evaluated by contrast phase microscopy, real-time PCR, and immunofluorescence staining), expression of specific germ layer markers (evaluated by real-time PCR), and melanocyte differentiation capability (assessed by real-time PCR and immunofluorescence and Masson-Fontana and L-DOPA staining). Results We found that EBs from iPSC-1/2 were regular, smooth, and not cystic, which could be maintained in culture for a relatively longer time. By contrast, iPSC-3/4 always formed cystic EBs with bright or dark cavities which broke in a short time. At the molecular level, high expression of ectodermal-specific markers and low expression of mesoderm and endoderm specific markers

298

2019CSID Poster communication were found in iPSC-1/2 derived EBs at day seven, while opposite results were observed in iPSC- 4 derived EB. All these markers were highly expressed in iPSC-3 derived EB. During the melanocyte differentiation using EBs, many dendritic-like cells migrated from the periphery of iPSC-1/2 derived EBs; this result could not be achieved with iPSC-3/4 derived EBs. The dendritic- like cells expressed melanocytic markers and presented characteristics similar to those of normal human melanocytes. Conclusions The differentiation tendency of iPSC lines might be predicted using specific parameters in the EB stage; the formation and maintenance of optimal EBs and the expression of germ layer-specific markers are particularly important in this regard.

PO-210 Clinical and Pathological analysis of ateriovenous hemangiomas in 23 cases

Tian Wang1 Tang Zhuangli1 Li Qingyan1 Zhao Lihong1 Shang Qian1 Du Xueshan1 Hu Jiahui1 Zhao Xi1 Geng Songmei1 1The Second Affiliated Hospital Of Xi

Objective To investigate the clinical and pathological features, diagnosis, differential diagnosis and treatments of arteriovenous hemangioma (AVH). Methods A total of 23 cases of arteriovenous hemangioma were obtained from the dermatology department of the Second Affiliated Hospital of Xi'an Jiaotong University from June 2011 to March 2019. The clinical data, pathological analysis and treatments were reviewed. Results The patients were 15 females and 8 males with ages ranged from 22 to 62 yr. Lesions were red, brown or skin color papules or nodules without obvious tenderness or other inflammatory signs. And no other family members had similar situation. All lesions were surgically removed. Pathological features showed multiple vascular channels resembling arteries and veins could be seen intermingled with each other throughout the connective tissue. The majority of the vascular channels didn’t show evidence of an internal elastic lamina, indicating that the venous component predominates over the arterial. The structure of arteries included thickened walls, muscle layers and internal elastic lamina. Red blood cells within the vessels could be seen occasionally. And the wall of the veins could also be thickened, but there were no internal elastic lamina. Extensive collagen fibrosis was found in dermis. No calcifications or thrombi were appreciated.

299

2019CSID Poster communication

Conclusion Arteriovenous hemangioma (AVH) is a rare, distinct, benign lesion that occurs commonly on the face. Its clinical manifestations are often not typical and difficult to identify. Pathological biopsy is the gold standard of diagnosis. If necessary, elastic fiber staining should be done. Differential diagnosis includes pyogenic granulomas, spider nevus, venous lakes, and other types of hemangioma. Surgical excision would be a preferred treatment.

PO-211 Study of Clinical and Pathological features in 729 cases of nevus sebaceous

Tian Wang1 Li Qingyan1 Zhao Lihong1 Zhang Xinyue1 Zheng Yi1 Shang Qian1 Geng Songmei1 1The Second Affiliated Hospital of Xi

Objective To observe the manifestations and pathological features of NS and analyze the composition of concomitant or secondary diseases in NS. Methods Collect baseline data of patients with NS and classify their clinical manifestations and review the pathological diagnosis of NS, then analyze the statistical results with SPSS21.0. Results 1. There were 729 cases of NS, 434 (59.53%) for males and 295 (40.47%) for females, with a male to female ratio of 1.47:1. The average age of surgical excision was 16.16 years. Divided into groups in three different ages, there were 254 infants (34.84%), 270 (37.04%) adolescents, and 205 (28.12%) adults. Males were more than females in each group, but the difference was not statistical significant (P>0.05). Among 729 cases of NS, 695 (95.33%) of them had a single type lesion, and 34 of them (4.67%) had multiple lesions. The involved parts were prone to the head and face, and other parts included the buttocks and extremities were rare. There were 673 cases without other diseases, 4 (0.59%) cases had 2 types of lesions, and 4 (0.59%) cases were special. 340 (50.52%) Oval plaques with obvious ridges accounted for the largest proportion, followed by 153 (22.73%) oval plaques with little ridges, and cerebral plaques was the least. The plaques with obvious ridges showed different performances in different age groups (P<0.05), for the number of them was larger in puberty and adulthood than that in infants and children. The plaques with little ridges mainly existed in infants and children (P<0.05). 2. There were 673(92.3%) cases of NS without other concomitant diseases. Among the 673 subjects, the epidermis without significant changes were mainly in infants and children (P<0.05), papillary hyperplasia and verrucous hyperplasia occurred mainly in puberty (P<0.05); Cases of

300

2019CSID Poster communication sebaceous glands directly open to the epidermis mainly existed in puberty (P<0.05); the proportion of immature hair follicles in puberty was higher than that in adult (P<0.05). 3. There were 56(7.68%) cases of NS with other concomitant diseases, including 9(1.23%) cases of TB and 5(0.68%) cases of BCC. There were 12(1.65%) cases of SCAP, 1(0.13%) case of sebaceous epithelioma, 2(0.27%) cases of compound nevus, 1(0.13%) case of navus lipomatosus superficialis and so on. Conclusion Clinical and pathological manifestations of NS are relevant to the ages, which is consistent with the progress of the disease course. But they are not completely matched, for there are individual differences. Among the tumors associated with NS, the proportion of TB is the largest, BCC is not as much as previously thought, suggesting a low percentage of BCC in the third stage of NS. Prophylactic excision may be over-treatment, and conservative treatment may be a better choice, but cosmetic resection remains reasonable.

PO-212 Allergen Desensitization Reduces the Severity of Alopecia Areata in Atopic Patients

Zhang Xingqi1 Zeng Zixun1 1The First Affiliated hospital of Sun Yat-sen University

Background Previous studies have shown that atopy may be a facilitating factor in some alopecia areata (AA) patients with early disease onset and more severe/extensive AA. The underlying immune mechanisms are unknown, but activation of allergen responses may support a pro-inflammatory environment that indirectly promotes AA. Objectives To investigate the long term effect of allergen immunotherapy (AIT) against house dust mite (HDM) allergy on disease severity and the long term prognosis of HDM allergic AA patients. Methods A total of 69 atopic AA patients with confirmed HDM responses were evaluated. We retrospectively analyzed the treatment efficacy, safety, relapse rate, and the severity of AA, in 34 patients under traditional AA treatment (TrAA) plus AIT (AIT-TrAA) and 35 patients receiving TrAA alone. Serum total immunoglobulin E (tIgE), HDM specific IgE (sIgE), HDM specific IgG4 (sIgG4) and inflammatory cytokines including IL-4, IL-5, IL-10, IL-12, IL-13, IL-33 and IFNγ were quantified. Results Although relapse rates were similar in both groups, the AIT-TrAA group showed significantly lower SALT scores than those of the TrAA only group after 36 months,

301

2019CSID Poster communication especially in those with elevated tIgE levels, or patients with alopecia totalis (AT)/ universalis (AU). In the AIT-TrAA group, elevation of tIgE was positively correlated to exacerbation of AA. Elevation of IL-5 was observed at early treatment stages (3-6 months), while IL-33 was somewhat decreased at late treatment stages (>12 months), but there was no significant change for other cytokines. Conclusions Treatment against allergens may benefit atopic AA patients over the long term.

PO-213 Keratin 17 is a key regulator of ionizing radiation-induced skin damage response

ZhiCao Yue1 1Shenzhen University

Keratin 17 (K17) is a cytoskeletal protein that forms the intermediate filament in keratinocytes. We have shown previously that K17 is initially down-regulated, then strongly up-regulated in ionizing radiation (IR)-induced skin damage (radiation dermatitis, RD), suggesting its involvement in the damage and repair responses （Liao et al., JID 2016). Here, by using the K17-/- mouse, we show that K17 is a key regulator of IR-induced skin damage response. More severe hair loss is induced by IR in K17-/- mice. About 70% of the gene expression changes induced by IR in skin are regulated by both K17 and p53. However, K17 does not disrupt the dynamics of p53 activation nor its nuclear translocation, and there are very few differentially expressed, direct p53 target genes in skin upon IR irradiation. Therefore, both K17 and p53 regulate gene expression via indirect mechanisms. One such mechanism is through the regulation of the dimerization partner (DP), retinoblastoma (RB)-like, E2F and MuvB (DREAM) complex, which controls cell cycle-related gene expression in G2/M transition. K17 controls the nuclear retention of Bmyb and 14-3-3s, leading to mitotic catastrophe in epidermal keratinocytes. These results expand the role of K17 to regulate p53-dependent gene expression and G2/M cell cycle transition, and suggest that K17 is a master regulator of IR-induced skin damage responses.

302

2019CSID Poster communication

PO-214 Leptin receptor isoform B targets the hair follicle mesenchymal niche

Yingzi Liu1,2 Guerrero-Juarez Christian2 Li Ji1 Plikus Maksim2 1Xiangya Hospital, Central South University, Changsha, China 2Department of Developmental and Cell Biology, University of California, Irvine, Irvine, CA 92697, USA

The hair follicle (HF) is a leading model system for the study of stem cell (SC) biology and niche-SC interactions. These interactions instruct HF stem cell behavior during morphogenesis and regeneration. However, the lack of novel genetic tools to manipulate gene expression in the mesenchymal components of the HF has hampered the study of niche-SC interactions and their role on HF SC behaviors. Using LepRb-Cre;mTmG mice, we found that Leptin receptor B isoform (LepRb) labels the majority of the HF mesenchymal niche cells, including the dermal papilla (DP) cells, dermal fibroblasts and dermal adipocytes, in a HF cycle-dependent manner. We observed that LepRb began to label DP cells during first telogen, with more than 90% percent of DP cells labeled during second telogen. To quantify and probe unique gene expression profiles in LepR+ dermal cells, we performed single cell RNA-sequencing on GFP+ cells isolated from LepRb- Cre;mTmG mouse skin at the second telogen stage. We found that the majority of labeled LepR+ cells are DP cells (~70%), with the rest accounting for endothelial, fibroblasts and immune cells. Upregulation of Sonic Hedgehog signaling in LepRb+ cells using LepR-cre;SmoM2 mice led to prolonged HF anagen phase, ectopic HF growth and a significant expansion of the dermal adipocyte layer irrespective of HF cycle stage. We conclude that LepRb is a useful tool to specifically label and efficiently manipulate gene expression in the HF mesenchymal niche. Future studies using LepR-Cre mice will enable guided studies to manipulate gene expression in the HF niche and better understand niche-SC interactions on HF behavior.

303

2019CSID Poster communication

PO-215 IgG Galactosylation Levels Are Decreased in Systemic Sclerosis Patients and Differ According to Disease Sub-classification

Qingmei liu1 Lin Jinran1 Wang Jiucun2 Wu Wenyu1 1Huashan hospital, Fudan University, Shanghai 2School of Life Sciences, Fudan University,Shanghai

Objectives Scleroderma is a connective tissue immune disease that features collagen overproduction and can be categorized into two subtypes, localized scleroderma (LSc) and systemic sclerosis (SSc). SSc is clinically classified into two subsets: limited cutaneous (lcSSc) and diffuse cutaneous (dcSSc) SSc. IgG galactosylation ratio is significantly abnormal in a number of immune diseases; however, IgG galactosylation has not been evaluated in SSc. Methods Ninety-three LSc patients, 298 SSc patients and 436 healthy controls were recruited for this study. Glycan extraction from IgG was isolated from plasma and detected by mass spectrum. The IgG galactosylation ratio (IgG-Gal ratio) was measured by calculating the relative intensities of agalactosylated (G0), mono-galactosyl (G1) and digalactosyl (G2) N-glycans according to the formula G0/(G1 + G2 × 2). Furthermore, we classified SSc patients according to established clinical standards and we examined whether the IgG-Gal ratio differed between the different subtypes. Results Our results show that the IgG-Gal ratio was significantly higher in SSc patients than LSc patients and controls . The IgG-Gal ratio successfully distinguished SSc patients from LSc and controls . In addition, the IgG-Gal ratio is significantly higher in dcSSc patients than in lcSSc patients and it significantly rises along with increases in modified Rodnan’s skin scores and erythrocyte sedimentation rate . Conclusions We found that IgG-Gal ratios were abnormal in SSc patients and were associated with the disease severity. The IgG-Gal ratio therefore shows potential as a biomarker for the diagnosis of SSc.

304

2019CSID Poster communication

PO-216 Distribution of hair barrier in human hair follicles according to the hair keratinization

Longquan PI1 LI Chuying1 JIN Meitong1 LUO Yinli1 JIN Zhehu1 1Yanbian University Affiliated Hospital

Background & Objective Integral hair lipid (IHL) plays an important role in all compartments of hair and skin substructures and also in involvement of hair development and function. In this study, we described the expression profile of IHL, lamellar granule-associated proteins and cornified cell envelope (CCE) precursor proteins in human hair follicles according to the hair keratinization. Methods Transmission electron microscopy was performed to observe the ultrastructure of the hairlipid, Immunofluorescence analysis was performed to observe the lamellar granule-associated proteins (Caveolin-1, Glucosylceramides, Cathepsin V) and CCE precursor proteins (Involucrin,Transglutaminase 5). Results Ultrastructure of anagen hair follicle at the level where Henle layers are keratinizing, showedthe intercellular lipid layer (IL) and lamellar structure (LS). Ultrastructure of anagen hair follicle at the level where the inner root sheath (IRS) is completely keratinized showed multiple LS and lamellar granules (LG). Multitudes of LS and IL are observed between the keratinized cells in IRS. Lamellar granule-associated proteins and CCE precursor proteins were mainly detected in the IRS region. Conclusion IHL in the hair follicle may be regarded as hair barrier to be similar to the epidermal lipid layer functioning as skin barrier.

305

2019CSID Poster communication

PO-217 Cdc42, a member of the Rho GTPase

hyee S1 1Institute of Shanghai Health

Founded in 1980, the Chinese Society for Cell Biology (CSCB) is one of the leading scientific organizations in China. With over 13,000 members, CSCB is home to scientists, as well as teachers and students in cell biology. CSCB is dedicated to facilitate learning and innovation through conferences and journals, promote research collaborations, provide training opportunities to students and young scientists, and educate the general public in cell biology and biomedicine. Since its foundation, CSCB has strived to achieve its multiple goals. Through national conferences, and many specialized meetings, CSCB has created platforms for all its members to actively participate the scientific exchanges. CSCB also provides multiple training courses to graduate students and young teachers each year. The CSCB-sponsored research journals, including Cell Research and JMCB, enjoy the high reputations at home and abroad. In addition, CSCB has orchestrated various activities for science education towards the general public, which have been well received by the broad social media.

PO-218 Circulating CCL20: A potential biomarker for active vitiligo together with the number of Th1/17 cells

Li Zhang1 1Department of Dermatology, Huashan Hospital

Background Vitiligo is an autoimmune disease with varying pathological features. Activation of the CCL20-CCR6 axis plays an important role in chronic inflammatory diseases. However, whether CCL20-CCR6 and Th1/17 cells are indicative of active vitiligo is unclear. Objective: To investigate the potential role of CCL20 and the involvement of Th1/17 and Tc1/17 cells in the mechanism in vitiligo. Methods One hundred patients with vitiligo, and 20 healthy controls were included. The serum and blister fluid IL-17, IFN-g, CCL20, and CXCL10 were studied using enzyme-linked 306

2019CSID Poster communication immunosorbent assays. The numbers of Th1/17 cells and Tc1/17 cells in circulation were quantified using flow cytometry. CCR6 mRNA in peripheral blood mononuclear cells (PBMCs) was analyzed by real-time polymerase chain reaction and the protein level was confirmed by western blotting. CCR6 and CCL20 expression in lesions was analyzed by immunohistochemistry. Results The serum CCL20 level was significantly elevated in patients with vitiligo. The level of serum CCL20 was higher in active than in the stable stage, which correlated positively with the Vitiligo European Task Force spreading score and the Vitiligo Area Scoring Index score. Patients with active vitiligo had elevated numbers of circulating Th1/17 cells and Tc1/17 cells, and upregulated expression of CCR6 in PBMCs and lesions. After effective treatment, the level of CCL20 in sera was significantly decreased, as were the numbers of circulating Th1/17 cells and Tc1/17 cells. Conclusion CCL20 might be a vital biomarker of active vitiligo, and circulating Th1/17 and Tc1/17 cells are involved in the pathogenesis of vitiligo

PO-219 Folic acid protects melanocytes from oxidative damage by regulating Keap1-Nrf2 pathway

Tingting Cui1 Zhang shaolong1 Li shuli1 Wang gang1 Gao tianwen1 Li chunying1 1Department of Dermatology, Xijing hospital

Background Vitiligo is a common skin disease characterized by the loss of functional melanocytes. Previous studies have indicated that oxidative stress plays a pivotal role in the onset of vitiligo. Thus, antioxidant therapy is a promising therapeutic strategy to prevent or even reverse the progression of depigmentation. Folic acid is a conventional antioxidant, but whether folic acid can be used to treat vitiligo is unclear. Objective This study aims to investigate whether folic acid could protect human melanocyte against oxidative damage and to elucidate the underlying pharmacological mechanism. Methods PIG1 is an immortalized human epidermal melanocyte cell line, which was cultured in

Medium 254. H2O2 at 800 μM was chosen to induce oxidative stress. CCK8 assay was used to estimate the cell survival rate. Flow cytometry was used to measure the intracellular ROS level and apoptosis rate. The nuclear translocation of Nrf2 was tested by immunofluorescence. Western blot and qRT-PCR were used to analyze the mRNA and protein expression levels of Keap1, Nrf2, HO-1, SOD2 and NQO1.

307

2019CSID Poster communication

Results We initially found that folic acid was able to ameliorate H2O2-induced oxidative damage in human melanocytes. In parallel, folic acid lessened the accumulation of intracellular ROS by potentiating the activity of antioxidant enzymes. Furthermore, folic acid protected melanocyte against oxidative stress by activating Nrf2 and its downstream genes HO-1, SOD2 and NQO1, and interfering with Nrf2 diminished the protection of folic acid against H2O2-induced apoptosis. At last, the down-regulation of Keap1 contributed to the activation of Nrf2 induced by folic acid. Conclusion we demonstrate that folic acid could protect melanocytes form oxidative damage. Folic acid is of great therapeutic potential in the treatment of vitiligo.

PO-220 Effects and mechanisms of N-acetyl-seryl-aspartyl-lysyl-proline inhibited the transformation of skin fibroblasts through Rho/ROCK signal pathway

Shan Wang1 Yang Jie1 Li Shifeng Xu Hong Yang Fang 1North China University of Science and Technology Affiliated hospital

Objective Exploring whether AcSDKP can inhibit skin fibroblasts transformation and migration via the Rho/ROCK signal pathway. Methods Primary culture rat fibroblasts and take the second generation cells for experiments. Experimental groups: 1. blank control group: cells incubated in serum-free medium culture; 2. TGF-β1 induction group: TGF-β1 was added at a final concentration of 100 nmol/L under serum- free culture conditions; 3.Ac-SDKP pretreatment group: Ac-SDKP(100 nmol/L of AC-SDKP for 1 h, followed by TGF-β1 induction) added to serum-free medium. Scratch test to detect cell migration ability, immunocytochemical detection of α-smooth muscle actin (α-SMA), type I collagen (ColI), Ras related C3 botulin substrate 1 (Rac1), Rho associated coiledcoil forming protein kinase (ROCK), cell division cycle 42 (CDC42), Ras homolog gene family, member A (RhoA) protein expression, Western-blot detection of α-SMA, serum response factor (SRF), myocardin related transcription factor A (MRTF-A), ColI, Rac1, RhoA, ROCK, type III collagen (ColIII), and CDC42 protein expression. Results 1 The sctatch results showed that compared with the control group, TGF-1 can significantly promote the migration of neonatal rat fibroblasts to the scratched blank area. Pretreatment with Ac-SDKP and TGF-β1 induction can significantly reduce cell migration and the difference is statistically significant. 2 The results of immunocytochemistry showed that the

308

2019CSID Poster communication expression of protein α-SMA and Rac1, ROCK, RhoA, CDC42 and Col1 were strongly detected intracellularly after TGF-β1-treatment compared with the blank control group, while in the Ac- SDKP pretreatment group the expression of protein α-SMA, Rac1, ROCK, RhoA, CDC42 and Col1 were significantly attenuated. 3 Western-blot results showed that compared with the blank control group, in the TGF-β1 treatment group the expression of myofibroblasts transformation related protein α-SMA, ColI, ColIII, SRF and MRTF-A was up-regulated by 1.8-fold, 2.8-fold, 2- fold, 1.69-fold and 1.76-fold respectively, meanwhile the expression of Rho GTPase-related proteins Rac1, CDC42, ROCK and RhoA was respectively up-regulated by 2-fold, 1.43-fold, 1.78- fold and 2.21-fold. Whereas in pretreated with Ac-SDKP group, the protein expression was decreased compare with the TGF-β1 treatment group. The expression of the myofiboblast transformation-related proteins α-SMA, ColI, ColIII, SRF and MRTF-A decreased by 57%, 36%, 71%, 67.76% and 52.08% respectively, simultaneouslythe expression of Rho GTPase-related proteins Rac1, CDC42, ROCK and RhoA were also down-regulated by 18.75%, 51.52%, 51.39% and 23.81% respectively (P<0.05). Conclusions Ac-SDKP can inhibit TGF-β1-mediated transformation and migration of skin fibroblasts via the Rho/ROCK signal pathway.

PO-221 Photodynamic Therapy in Cutaneous Wound Healing in Mice

Yan Sun1,2 Tosa Mamiko2 Takada Hiroya2 Ogawa Rei2 1The First Hospital of China Medical University 2Nippon Medical School

Background Cutaneous wound healing is a complex and dynamic physiological process. Traditional methods are not always effective. Consequently, alternative modalities such as photodynamic therapy (PDT) are needed. Therefore, we examined the efficacy of PDT in a murine model of acute wound healing and sought to elucidate the underlying mechanisms. Methods Two excisional wounds were generated on either side of the midline in C57bL/6J mice. Methyl 5-aminolevulinate hydrochloride (MAL) was applied onto the right-hand wound. After 1-3 hours incubation, the wound was irradiated with red light. The left-hand wound was not treated with either MAL or red light. On Day 14, the wounds were excised and subjected to histological analysis and immunohistochemical analysis.

309

2019CSID Poster communication

Results During the first week, no difference was seen between the two sides. However, during the second week, the PDT-treated wound started exhibiting delayed re-epithelialization. On Day 14, Hematoxylin & eosin (HE) staining showed that the untreated wounds had a continuous epithelial lining. By contrast, the PDT-treated wounds partially lacked epithelium in the wound bed. Masson’s Trichrome (MTC) staining showed that compared to the untreated wounds, the PDT- treated wounds had a thicker dermis, more collagen fibers and inflammatory cells. The immunohistochemistry analyses showed that compared to the untreated wounds, the PDT- treated wounds had significantly fewer CD31+ blood vessels and a greater Collagen III density. However, the treated and untreated wounds did not differ in terms of Collagen I density. Conclusions PDT delayed the acute wound healing process in a murine model of secondary intention wound healing.

PO-222 Expression of gastrin releasing peptide and its receptor in keloid and its clinical significance

Jingbo Cui1 yuan xinghua1 li zhouna1 jin chenglong1 jin shan1 jin zhehu1

1Yanbian university hospital

Objective To investigate the expression of gastrin releasing peptide(GRP) and its receptor(GRPR) in keloid and explore its role in keloid. Methods Western blot analysis was used to detect the content of GRP in keloid and normal skin. Real-time PCR was used to detect the expression of GRPR on keloid fibroblasts and normal fibroblasts. Results The expression of GRP and GRPR in keloid was significantly higher than that in normal skin (P<0.05). Conclusion GRP and GRPR overexpression in keloid may play an important role in the development of keloid.

310

2019CSID Poster communication

PO-223 The mechanism of Wnt/β-catenin signal transduction pathway in keloid

YANG TANG1 FEI MENG1 1The First Afiliated Hospital of Kunming Medical University

Objects To investigate the role of Wnt/beta-catenin signal transduction pathway in keloid developing. Methods Primary fibroblasts were cultured by tissue culture method. The levels of Wnt/beta- catenin signal transduction pathway related signal molecules Wnt5a, beta-catenin, GSK-3beta, p- GSK-3beta protein and Wnt5a, beta-catenin, GSK-3beta mRNA in normal skin and keloid fibroblasts were detected by Wes tern Blot and RT-PCR, respectively. Data were analyzed by SPSS18.0 software. Results Compared with normal skin, the levels of Wnt5a, beta-catenin, p-GSK-3 beta protein and Wnt5a, beta-catenin mRAN in keloid fibroblasts increased significantly (P < 0.05), while the expression levels of GSK-3 beta protein and mRNA are not significantly different. Conclusion Wnt5a and beta-catenin mRNA may play an important role in the formation of keloid by up-regulating Wnt5a and beta-catenin protein levels and phosphorylation of GSK-3 beta protein.

PO-224 Function of proteoglycans in keloid

Jing Cui1 Jin Chenglong1 Jin Shan1 Nan Meilan1 Jin Zhehu1 1Yanbian university hospital

Proteoglycans are the main components of the extracellular matrix as well as the cell surfaces and basement membranes. PGs namely, syndecan, biglycan and decorin, all of which participate in the processes of keloid. In recent years, many scholars have obtained the involvement of PGs in the process of keloid formation through molecular biology and genomics research, which provides a new direction for the diagnosis and treatment of keloid.

311

2019CSID Poster communication

PO-225 Effects of N-Acetylcysteine on apoptosis and collagen expression of Keloid Fibroblasts

Yunhe Jiao1 Jin Zhehu1 1Yanbian university hospital

Objective N-Acetylcysteine (NAC) is a traditional sputum lysing agent with some antioxidants property, anti-tumor and anti-fibrosis effects.This experiment is aimed to study the effects of NAC on keloid apoptosis, cell cycle and collagen by applying different concentrations of NAC to the keloid fibroblast strain in vitro. Methods KFs in logarithmic growth phase was applied with different concentrations of NAC. (1)The effect of different concentrations of NAC on the proliferation of keloid fibroblasts was determined by using MTT assay. (2)Flow cytometry was used to determine the apoptosis and changes in cell cycle. (3)The expressions of Pro-collagen Ⅰ and Collagen-Ⅲ were measured by Western blot . Results 1. The results of MTT assay showed that NAC 5mmol/L group was significantly inhibited as compared with the control group, and the cell proliferation of NAC 20mmol / L group was significantly inhibited, compared with the control group, the proliferation activity was about 50%. 2. Apoptosis results showed that there was no significant difference in apoptosis between NAC 5mmol/L group compared with the control group . The percentage of apoptosis in the NAC 10 mmol/L group was increased compared with the control group. Compared with the control group, the apoptosis rate of NAC 20mmol/L group was significantly increased. 3. The cell cycle results showed that there was no significant change in the G0 / G1 phase of the NAC 5mmol / L group compared with the control group. The G0/G1 phase of the NAC 10 mmol/L and 20 mmol/L groups were significantly increased compared with the control group. 4. Western blot results showed that compared with the control group, the expression of Pro-collange I protein in the 5mmol/L NAC group, 10mmol/L NAC group and 20mmol/L NAC group was significantly decreased. Compared with the control group, the expression of Collagen-III protein in the 5mmol/L NAC group did not change significantly , and the expression of Collagen-III protein in the 10mmol/L NAC group decreased compared with the control group , the expression of Collagen-III protein in the 20mmol/L NAC group was significantly lower than that in the control group. Conclusion N-Acetylcysteine can prevent keloids by inhibiting the proliferation of keloid fibroblasts with promoting the process of apoptosis and along with the reduction of collagen expression which ultimately, provides a theoretical basis for the treatment of keloids.

312