Fish TLR4 Does Evolution of Lipopolysa

Evolution of Lipopolysaccharide (LPS) Recognition and Signaling: Fish TLR4 Does Not Recognize LPS and Negatively Regulates NF- κB Activation This information is current as of September 27, 2021. María P. Sepulcre, Francisca Alcaraz-Pérez, Azucena López-Muñoz, Francisco J. Roca, José Meseguer, María L. Cayuela and Victoriano Mulero J Immunol 2009; 182:1836-1845; ; doi: 10.4049/jimmunol.0801755 Downloaded from http://www.jimmunol.org/content/182/4/1836

References This article cites 50 articles, 13 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/182/4/1836.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 27, 2021 • Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Evolution of Lipopolysaccharide (LPS) Recognition and Signaling: Fish TLR4 Does Not Recognize LPS and Negatively Regulates NF-␬B Activation1

María P. Sepulcre,* Francisca Alcaraz-Pe´rez,2*† Azucena Lo´pez-Mun˜oz,2* Francisco J. Roca,* Jose´Meseguer,* María L. Cayuela,† and Victoriano Mulero3*

It has long been established that lower vertebrates, most notably fish and amphibians, are resistant to the toxic effect of LPS. Furthermore, the lack of a TLR4 ortholog in some fish species and the lack of the essential costimulatory molecules for LPS activation via TLR4 (i.e., myeloid differentiation protein 2 (MD-2) and CD14) in all the fish genomes and expressed sequence tag databases available led us to hypothesize that the mechanism of LPS recognition in fish may be different from that of mammals.

To shed light on the role of fish TLRs in LPS recognition, a dual-luciferase reporter assay to study NF-␬B activation in whole Downloaded from zebrafish embryos was developed and three different bony fish models were studied: 1) the gilthead seabream (Sparus aurata, Perciformes), an immunological-tractable teleost model in which the presence of a TLR4 ortholog is unknown; 2) the spotted green pufferfish (Tetraodon nigroviridis, Tetraodontiformes), which lacks a TLR4 ortholog; and 3) the zebrafish (Danio rerio, Cyprini- formes), which possesses two TLR4 orthologs. Our results show that LPS signaled via a TLR4- and MyD88-independent manner in fish, and, surprisingly, that the zebrafish TLR4 orthologs negatively regulated the MyD88-dependent signaling pathway. We think that the identification of TLR4 as a negative regulator of TLR signaling in the zebrafish, together with the absence of this http://www.jimmunol.org/ receptor in most fish species, explains the resistance of fish to endotoxic shock and supports the idea that the TLR4 receptor complex for LPS recognition arose after the divergence of fish and tetrapods. The Journal of Immunology, 2009, 182: 1836–1845.

he TLR multigene family comprises a family of trans- molecular patterns (PAMPs), which are essential for pathogen sur- membrane proteins first described in Drosophila. They vival (5). The interaction of a given PAMP with its specific TLR T are highly conserved in both the invertebrate and verte- leads to the expression of inflammatory cytokines and chemokines brate lineages (1, 2). In mammals, these receptors are mainly in- and to the activation of antimicrobial host defense mechanisms, volved in host defense, whereas in Drosophila, Toll receptors are such as the production of reactive nitrogen and oxygen radicals by guest on September 27, 2021 also involved in development (3). All family members share the and antimicrobial peptides. To date, a complete set of TLRs has same structure, defined by the presence of leucine-rich repeats been described in two phylogenetically distant teleost fish species, 4 (LRRs) in their extracellular domain and by the presence of a namely the pufferfish Fugu rubripes and the zebrafish Danio rerio. Toll/IL-1 receptor domain (TIR domain) in the C-terminal, the This set includes orthologs of the 10 mammalian TLR families and cytosolic part of the protein that initiates signal transduction (4). 2 fish-specific members (6–9). Additionally, it seems that some of TLRs recognize a variety of highly conserved pathogen-associated these orthologs are functionally analogous to their mammalian counterparts (10, 11). However, one of the most striking aspects found in these genomic studies is that while the zebrafish has two *Department of Cell Biology and Histology, Faculty of Biology, University of Mur- TLR4 paralogs, more evolutionarily advanced pufferfish, namely cia, Murcia, Spain; and †Research Unit, Department of Surgery, University Hospital “Virgen de la Arrixaca”, Murcia, Spain Fugu and Tetraodon, lack a TLR4 ortholog (6, 7). Received for publication May 30, 2008. Accepted for publication December 3, 2008. LPS is the major component of the outer membrane of Gram- negative bacteria. Structurally, it is composed of a core polysac- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance charide and an O-polysaccharide of variable length, as well as a with 18 U.S.C. Section 1734 solely to indicate this fact. lipid portion termed “lipid A”, which is the responsible for the 1 This work was supported by the Spanish Ministry of Education and Science (Grants activation of the innate immune response in mammals and confers BIO2005-05078 and CSD2007-00002 to V.M.), the Sixth Framework Programme of the European Union (Grant FOOD-CT-2005-007103 to V.M.), the Spanish Ministry its endotoxic properties (12, 13). Different bacteria produce struc- of Health (Grant PI060369 to M.L.C.), and the University of Murcia (fellowships to turally different LPS molecules, varying in their phosphate pat- F.A.-P. and A.L.-M.). terns, number of acyl chains, and fatty acid composition. Bacterial 2 F.A.-P. and A.L-M. contributed equally to this work. mutants that fail to add the inner core or the O-specific chain are 3 Address correspondence and reprint requests to Dr. Victoriano Mulero, Department said to produce “rough LPS” (R) because of the morphology of the of Cell Biology and Histology, Faculty of Biology, University of Murcia, 30100 Murcia, Spain. E-mail address: [email protected] colonies they form. Wild-type strains produce “smooth LPS” (S) 4 Abbreviations used in this paper: Ec, Escherichia coli; hu, human; LRR, leucine- and grow as smooth colonies. LPSs are amphipathic molecules rich repeats; MD-2, myeloid differentiation protein 2; MO, morpholino; PAMP, whose hydrophobicity decreases with increasing length of the pathogen-associated molecular pattern; Pg, Porphyromonas gingivalis; P/S, penicillin sugar part. Due to these differences, the S and R forms show and streptomycin; R, rough LPS; S, smooth LPS; Sa, Salmonella abortus equi; Sm, Salmonella minnesota; St, Salmonella thyphimurium; TIR, Toll/IL-1 receptor; TRIF, marked differences in their abilility to activate mouse macrophages TIR domain-containing adapter inducing IFN-␤; TRAM, TRIF-related adapter mol- and splenocytes (14). ecule; VaDNA, Vibrio anguillarum genomic DNA; zf, zebrafish. In mammals, the mechanism by which LPS initiates a signal was Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 solved in 1998 by positional cloning, which revealed that TLR4 is www.jimmunol.org/cgi/doi/10.4049/jimmunol.0801755 The Journal of Immunology 1837

Table I. Gene accession numbers and primer sequences used for gene expression analysisa

Species Gene Accession No. Name Sequence (5Ј–3Ј)

Seabream il1b AJ277166 F2 GGGCTGAACAACAGCACTCTC R3 TTAACACTCTCCACCCTCCA il6 AM749958 F AGGCAGGAGTTTGAAGCTGA R ATGCTGAAGTTGGTGGAAGG ccl4 AM765840 F GCTGTGTTTGTGCTGATGCT R GCTGGCTGGTCTTTTGGTAG il8 AM765841 F2 GCCACTCTGAAGAGGACAGG R2 TTTGGTTGTCTTTGGTCGAA rps18 AY587263 F1 AGGGTGTTGGCAGACGTTAC R1 CTTCTGCCTGTTGAGGAACC rps11 NM213377 F1 GGCGTCAACGTGTCAGAGTA R1 GCCTCTTCTCAAAACGGTTG Zebraﬁsh tlr4a XM001335971 F CAATGGCTTGGGTACTTTGC R GATTTGAGGAGTGCCGGATA tlr4b AY388400 F TGAATGCTGGACAAGGACAG R ATGCCACAGAGAAGGGAAGA il1b NM212844 F5 GCCTGTGTGTTTGGGAATCT Downloaded from R5 TGATAAACCAACCGGGACAT il12a AB183001 F1 AGCAGGACTTGTTTGCTGGT R1 TCCACTGCGCTGAAGTTAGA tnfa NM212859 F2 GCGCTTTTCTGAATCCTACG R2 TGCCCAGTCTGTCTCCTTCT lta AB183467 F2 AAGCCAAACGAAGAAGGTCA

R2 AACCCATTTCAGCGATTGTC http://www.jimmunol.org/ mxc NM001007284 F2 GAGGCTTCACTTGGCAACTC R2 TTGTTCCAATAAGGCCAAGC inf1 AY135716 53 TCTTAATACACGCAAAGATGAGAACT 3 GTCAGGACTAAAAACTTCAC Spotted green pufferﬁsh il1b ENSTRUG00000016002 F AGCTCCTCCTCCACAAGACA R CCTCACGGTTGGATTGAAGT il6 AJ555458 F AGCAAAGTGCCCTTACTCCA R CGCTCCTTCACCTTGTTCTC tnfa AB183465 F2 CTCCTGGCCATGTTCTTGAT R2 GGGGTTCTGTTCTCCTCCTC by guest on September 27, 2021

a The gene symbols follow the “Zebrafish Nomenclature Guidelines” (zfin.org/zf_info/nomen.html). the central component of the LPS receptor (15). To date, there is TIR domain-containing adapter inducing IFN-␤ (TRIF)-dependent much evidence that supports the view that activation of cells by pathways. Initiation of the MyD88-dependent pathway leads to the LPS is mediated by the TLR4 and that it is critically involved in activation of NF-␬B and the transcription of several proinflamma- the etiology of LPS-induced septic shock (16–18). For functional tory genes (31). A second pathway is mediated by the TIR-con- interaction with LPS, TLR4 must be associated with myeloid dif- taining protein called TRIF-related adapter molecule (TRAM) ferentiation protein 2 (MD-2) (also known as LY96) (19, 20), and (also know as TICAM2) and TRIF) (also know as TICAM1). Ini- activation of TLR4 is preceded by the transfer of LPS to mem- tiation of the TRIF-dependent pathway leads to the activation of brane-bound or soluble CD14 by LPS-binding protein (LBP) (21, IFN-regulatory factor 3 (IRF3) and the expression of INF-␤ and 22). Interestingly, a recent structural study has demonstrated that IFN-inducible genes (5). MD-2 is actually responsible for the binding of LPS (23). Addi- It has long been established that lower vertebrates, most notably tionally, CD14 is dispensable for the recognition of R-form LPS fish and amphibians, are resistant to the toxic effect of LPS (32). and lipid A but is indispensable for the recognition of the S-form Indeed, note that in many in vitro studies on leukocytes from dif- LPS (14, 18). This scenario is even more complicated since some ferent fish species, extremely high concentrations of LPS (␮g/ml) LPSs (from Leptospira interrongans and Porphyromonas gingiva- have been used to activate immune cells (33–37) in comparison to lis), which are structurally different from those of enterobacteria, studies on mammals (ng/ml). Furthermore, the lack of a TLR4 have been shown to activate cells through TLR2 and/or TLR4 (24–26). Thus, P. gingivalis LPS has also been shown to be active ortholog in some fish species as well as the lack of the essential in macrophages from C3H/HeJ mice (27–28), which possess a costimulatory molecules for LPS activation via TLR4 (i.e., MD-2 point mutation in the tlr4 gene that precludes signaling by enter- and CD14) in all the fish genomes and expressed sequence tag obacterial LPS (15, 17). Additionally, cell activation with P. gin- databases available led us to hypothesize that the mechanism of givalis LPS via TLR2 required heterodimerization with TLR1 and LPS recognition in fish may be different from that of mammals. To was MD-2-independent, while cell stimulation via TLR4 was shed light on the role of fish TLRs in LPS recognition, three dif- shown to be MD-2- and CD14-dependent (26). ferent bony fish models were studied: 1) the gilthead seabream Downstream signaling by the TLR4 receptor involves several (Sparus aurata, Perciformes), an immunological-tractable teleost intracellular TIR domain-containing adaptors mediating proin- model in which the presence of a TLR4 ortholog is unknown; 2) flammatory gene expression (29, 30). Two pathways that initiated the spotted green pufferfish (Tetraodon nigroviridis, Tetraodon- downstream TLR4 signaling are known, namely the MyD88 and tiformes), which lacks a TLR4 ortholog; and 3) the zebrafish 1838 LPS/TLR4 SIGNALING PATHWAY IN FISH

Table II. Morpholinos used for gene knockdown in zebraﬁsh embryosa

Gene Sequence Effect

myd88 TAGCAAAACCTCTGTTATCCAGCGA Translation blocking tlr4a GTAATGGCATTACTTACCTTGACAG Splice blocking GATGCTGCTGAGGTTTCTTCCCATG Translation blocking tlr4b CTATGTAATGTTCTTACCTCGGTAC Splice blocking AATCATCCGTTCCCCATTTGACATG Translation blocking tlr3 GTAAAAACATACCTTTAAGAGAGAG Splice blocking

a The gene symbols follow the “Zebraﬁsh Nomenclature Guidelines” (zﬁn.org/zf_ info/nomen.html).

(Danio rerio, Cypriniformes), which possesses two TLR4 orthologs. Stimulation of leukocytes from seabream and pufferﬁsh in vitro with different ultrapure LPS preparations and lipid A demonstrated that the leukocytes from both species were able to respond to different LPSs and lipid A from Escherichia coli but failed to respond to R- and S-form LPS and lipid A from Salmo-

nella spp. Additionally, we developed a zebraﬁsh embryo model to Downloaded from study LPS signaling in vivo using a classical NF-␬B-luciferase reporter assay together with antisense morpholino (MO)-mediated knockdown or gene overexpression. The results obtained demonstrated that LPS signaled in a TLR4- and MyD88-independent http://www.jimmunol.org/

FIGURE 2. LPS induces the expression of proinflammatory cytokines by guest on September 27, 2021 in leukocytes from green spotted pufferfish. Total head kidney leukocytes were stimulated for 2 and 16 h with 10 ␮g/ml of EcLPS (serotypes 055:B5 and 0111:B4), 10 ␮g/ml of PgLPS, 50 ␮g/ml of VaDNA, and 1 ␮g/ml of flagellin, and the mRNA levels of the proinflammatory cytokines il1b (A), il6 (B), and tnfa (C) were determined by real-time RT-PCR. Gene expression is normalized against rps11 and is shown as relative to the mean of nonstimulated cells. Each bar represents the mean Ϯ SE of triplicate samples. Different letters denote statistically significant differences between the groups according to a Tukey test. The groups marked with “a” did not show statistically significant differences from control cells.

manner and that, surprisingly, the zebrafish TLR4 orthologs negatively regulated the MyD88-dependent NF-␬B activation by sequestering the TLR adaptors. Therefore, our results could help explain the resistance of fish to endotoxic shock and support the hypothesis that the TLR4 receptor complex for LPS recognition arose after the divergence of fish and tetrapods.

FIGURE 1. LPS primes the respiratory burst of seabream leukocytes in Materials and Methods vitro. Head kidney leukocytes were incubated for 16 h with the indicated Animals concentrations of non-ultrapure (nu) EcLPS, or ultrapure EcLPS, S-SaLPS, R-SmLPS, and PgLPS (A)orEcLipid A and StLipid A (B) and their re- Healthy specimens (150 g mean weight) of the hermaphroditic pro- spiratory burst activity was measured as the luminol-dependent chemilu- trandrous marine fish gilthead seabream (S. aurata) were obtained from Culmarex. They were kept in 260 liters of recirculating seawater aquaria minescence triggered by PMA. Data are presented as means Ϯ SE fold (flow rate 1500 L/h) at 20 Ϯ 2°C with a 12-h light/dark cycle and fed with increase relative to cells incubated with medium alone and are represen- a commercial pellet diet (Trouvit) at a feeding rate of 1% body weight/day. tative of several independent experiments. Different letters denote statisti- Spotted green pufferfish (T. nigroviridis) were purchase in a local pet shop. cally significant differences between the groups according to a Tukey test. Zebrafish (D. rerio) of the AB, TL, and WIK genetic backgrounds were The groups marked with “a” did not show statistically significant differ- kindly provided by the Zebrafish International Resource Center and main- ences from control cells. tained as described in a zebrafish handbook (38). The Journal of Immunology 1839

FIGURE 3. LPS exclusively induces the expression of MyD88-dependent genes in the zebrafish. Ze- brafish were injected in the left epaxial muscle with the indicated PAMPs, and the mRNA levels of il1b (A), il12 (B), tnfa (C) lta (D), inf1 (E), and mxc (F) were determined by real- time RT-PCR at different time points. Gene expression is normalized against rps11 and is shown as relative to the mean of nonstimulated cells. Downloaded from Each bar represents the mean Ϯ SE of triplicate samples. Different letters denote statistically significant differences between the groups according to a Tukey test. The groups marked with “a” did not show statistically significant differences from controls. http://www.jimmunol.org/ by guest on September 27, 2021

Cell culture and treatments was brought about by adding 100 ␮M luminol (Sigma-Aldrich) and 1 ␮g/ml PMA (Sigma-Aldrich), while the chemiluminescence was recorded Seabream head kidney (bone marrow equivalent in fish) leukocytes, ob- every 117 s for1hinaFLUOstart luminometer (BMG Labtechnologies). tained as described elsewhere (39), were maintained in sRPMI (RPMI 1640 The values reported are the average of quadruple readings, expressed as the culture medium (Invitrogen) adjusted to gilthead seabream serum osmo- slope of the reaction curve from 117 to 1170 s, from which the apparatus larity (353.33 mOsm) with 0.35% NaCl) supplemented with 5% FCS (In- background was subtracted. vitrogen) and 100 IU/ml penicillin and 100 ␮g/ml streptomycin (P/S; Bio- chrom). Some experiments were conducted using purified cell fractions of macrophages and acidophilic granulocytes, the two professional phagocytic cell types of this species (39, 40). Briefly, acidophilic granulocytes Injection of fish with different PAMPs were isolated by MACS using a mAb specific to gilthead seabream acido- Four adult zebrafish were anesthetized by immersion in benzocaine (100 philic granulocytes (G7) (39). Macrophage monolayers were obtained after Ϫ ␮g/ml) (Sigma-Aldrich) before injection. Each fish was injected in the left overnight culture of G7 fractions in FCS-free medium and their identity ␮ ␮ ␮ was confirmed by the expression of macrophage CSF receptor (M-CSFR) epaxial muscle with 1 l of PBS containing 5 gofEcLPS, 5 gof ␮ ␮ (40). PgLPS, 0.1 g of flagellin, or 2.5 g of poly(I:C) (Invivogen). Tissue Seabream macrophages, acidophilic granulocytes, and total leukocytes samples from the injection site were collected at different time points and from seabream head kidney were stimulated for different incubation times processed for gene expression analysis (see below). at 23°C with 0.1–10 ␮g/ml LPS of E. coli (EcLPS, strain 0111.B4, Sigma- Aldrich), 0.1–10 ␮g/ml ultrapure S-form LPS from Salmonella abortus equi (S-SaLPS, Alexis Biochemicals), 0.1–10 ␮g/ml ultrapure R-form LPS Analysis of gene expression of Salmonella minnesota (R-SmLPS, Alexis Biochemicals), 0.1–10 ␮g/ml ultrapure LPS of P. gingivalis (PgLPS, InvivoGen), 1–10 ␮g/ml diphos- Total RNA was extracted from cell pellets with TRIzol reagent and purified phoryl lipid A of E. coli (EcLipid A, Sigma-Aldrich), or 0.1–10 ␮g/ml with PureLink Micro-to-Midi total RNA purification system (Invitrogen) diphosphoryl lipid A of Salmonella thyphimurium (StLipid A, Sigma- following the manufacturer’s instructions and treated with DNase I, am- Aldrich) in sRPMI supplemented with 5% FCS and P/S. plification grade (1 U/␮g RNA; Invitrogen). Ϫ Spotted green pufferfish head kidney leukocytes were stimulated for The SuperScript III RNase H reverse transcriptase (Invitrogen) was ␮ several incubation times at 23°C with 10 ␮g/ml ultrapure EcLPS (strain used to synthesize first-strand cDNA with oligo(dT)18 primer from 1 gof 055:B5; Alexis Biochemicals), 10 ␮g/ml ultrapure EcLPS (0111:B4; total RNA at 50°C for 50 min. Real-time PCR was performed with an ABI Alexis Biochemicals), 10 ␮g/ml LPS of PgLPS, 50 ␮g/ml phenol-extracted Prism 7500 instrument (Applied Biosystems) using SYBR Premix Ex Taq genomic DNA from Vibrio anguillarum ATCC19264 cells (VaDNA), or 1 (Takara Bio). Reaction mixtures were incubated for 10 min at 95°C, fol- ␮g/ml flagellin (Invivogen) in RPMI 1640 culture medium supplemented lowed by 40 cycles of 15 s at 95°C, 1 min at 60°C, and finally 15 s at 95°C, with 5% FCS and P/S. 1 min 60°C, and 15 s at 95°C. For each mRNA, gene expression was Respiratory burst assays corrected by the ribosomal protein S11 (rps11)(Tetraodon and zebrafish) or rps18 (seabream) content in each sample. The primers used are shown Respiratory burst activity was measured as the luminol-dependent chemi- in Table I. In all cases, each PCR was performed with triplicate samples luminescence produced by seabream head kidney leukocytes (41). This and repeated at least twice. 1840 LPS/TLR4 SIGNALING PATHWAY IN FISH

Expression constructs The zebrafish (zf)TLR4b (BC068358) and zfTLR3 (NM_001013269) coding sequences were obtained by PCR amplification with Pfu DNA polymerase (Fermentas) using full-length cDNA clones provided by ImaGenes (IRBOp991G0340D and IRBOp991H0571D, respectively) as templates. The PCR amplified fragments were incubated at 72°C for 10 min with 1 unit of TaqDNA polymerase (Invitrogen) for addition of 3Ј A-overhangs and cloned into pcDNA3.1/V5-His-TOPO expression vector (Invitrogen)

for expression of V5/His6-tagged proteins. All constructs were sequenced using an ABI Prism 377 (Applied Biosystems). The full coding sequence of the zfTLR4a (XM_001335971) as well as zfTIR3 (NM_001013269), zfTIR9 (NC_007119), wild-type zfTIR4b, and zfTIR4b (713Ala3His) truncated versions containing the transmembrane and intracellular domains were synthesized by GenScript and then subcloned into the BamHI restric- tion site of a pcDNA6/V5-His construct in frame with the sequence coding for the powerful signal peptide of the seabream type II IL-1 receptor (42). The NF-␬B luciferase reporter was provided by Dr. R. Hay, the huTIR by Dr. R. Medzhitov, and the huTLR4, huMD-2, and huCD14 constructs were provided by Dr. M. F. Smith, Jr. Cell transfection

Plasmid DNA was prepared using the MiniPrep procedure (Qiagen). DNA Downloaded from pellets were resuspended in water and further diluted, when required, in PBS. Transfections were performed with a cationic lipid-based transfection reagent (LyoVec; InvivoGen) according to the manufacturer’s instructions. Brieﬂy, HEK/Elam-luc cells (provided by Dr. M. Lamphier) were plated in FIGURE 4. Ectopic expression of zebraﬁsh TLR4a or TLR4b in ␮ 24-well plates (120,000 cells/well) together with 25 l of transfection re- HEK293 does not conferred sensitivity to LPS. The HEK/Elam-luc cells Renilla agent containing a total of 250 ng of total plasmid DNA. The were transfected with expression constructs for zfTLR4a, zfTLR4b,

luciferase expression vectors pRL-CMV or pRL-TK (Promega) were used http://www.jimmunol.org/ zfTLR3, or huTLR4 alone or in combination with huMD-2 and huCD14. at a ratio of 10:1 as internal controls to normalize the values obtained with the firefly luciferase construct. A, Forty-eight hours after transfection, cells were stimulated for 8 h with the specific ligand for each TLR, and the relative luciferase production was Western blot determined as described in Materials and Methods. Each bar represents the mean Ϯ SE of triplicate samples. Different letters denote statistically sig- Forty-eight hours after transfection, cells were washed twice with serum- free medium and lysed in 100 ␮l of lysis buffer (10 mM Tris-HCl (pH 7.4), nificant differences between the groups according to a Tukey test. The 1% SDS). The samples were boiled in SDS sample buffer, resolved on 8% groups marked with “a” did not show statistically significant differences SDS-PAGE, and transferred for 30 min at 200 mA to nitrocellulose mem- from mock-transfected cells. B, The cells extracts from A were also probed branes (Bio-Rad). Blots were probed with specific Ab to the V5 epitope with the anti-V5 mAb.

(Invitrogen) and developed with ECL reagents (GE Healthcare) according by guest on September 27, 2021 to the manufacturer’s protocol.

Luciferase assay alyzed. Ultrapure EcLPS and PgLPS were both seen to increase Forty-eight hours after transfection, cells were stimulated for 8 h with the the respiratory burst of these cells in a dose-dependent manner, specific ligand for each TLR at the concentrations indicated above, washed, although the activation with PgLPS was significantly higher (Fig. and lysed with passive lysis buffer (Promega). Firefly and Renilla lucif- 1A). Notably, ultrapure EcLPS showed lower activation ability erase activity was measured by using the Dual luciferase assay kit (Pro- than the commonly used phenol-purified EcLPS since these prep- mega), as specified by the manufacturer, to discriminate the activity of the two types of luciferases, in an Optocomp I luminometer (MGM arations are often contaminated with other cellular components. In Instruments). contrast, S-LPS and R-LPS, both from Salmonella spp., failed to activate the respiratory burst of seabream leukocytes. Consistent Microinjection with these observations, head kidney leukocytes were also able to Splice- or translation-blocking MOs were designed and purchased from respond in a dose-dependent manner to diphosphoryl lipid A from Gene Tools (Table II) and solubilized in water (1 mM). MOs (4 ng/egg), E. coli but not from S. typhimurium (Fig. 1B). expression plasmids (0.1–1.0 ng/egg), firefly and Renilla reporter plasmids We analyzed by real-time PCR the expression of proinflam- (100 and 10 pg/egg, respectively), and the required PAMP (6.5 ng of VaDNA or 30 ng of EcLPS) were mixed in microinjection buffer (0.5ϫ matory cytokines and chemokines in total head kidney leuko- Tango buffer and 0.05% phenol red solution) and microinjected (4–6 nl) cytes as well as in the two professional phagocytic cell types of into the yolk sac of one-cell-stage embryos using a microinjector Narishige gilthead seabream, namely acidophilic granulocytes and mac- IM-300. The firefly and Renilla luciferase activities were determined 24 h rophages, that had been stimulated with different LPS. The postinjection as described above in 5–10 replicates (each one containing the tissue extracts from three embryos). mRNA levels of il1b, il6, ccl4, and il8 increased in a similar way in these cells after stimulation with EcLPS and PgLPS Statistical analysis (data not shown). However, S-SaLPS and R-SmLPS had only a Data were analyzed by ANOVA and a Tukey multiple range test to deter- slight effect on the mRNA levels of these cytokines compared mine differences between groups. The differences between two samples with EcLPS and PgLPS. Strikingly, there was no induction of were analyzed by Student’s t test. mxc (data not shown), a gene whose expression in mammals is induced by engagement of the TLR4 by LPS and the subsequent Results activation of the TRIF-dependent pathway (5). EcLPS and PgLPS increase the respiratory burst and induce the expression of proinflammatory cytokines and chemokines in EcLPS induces the expression of proinflammatory cytokines in seabream leukocytes leukocytes from the spotted green pufferfish The ability of LPS from different sources to modulate the respi- The above results prompted us to analyze the ability of ultrapure ratory burst of seabream head kidney leukocytes in vitro was an- EcLPS to activate in vitro head kidney leukocytes from the spotted The Journal of Immunology 1841 Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 5. Zebrafish MyD88, TLR4a and TLR4b morphants show intact LPS responsiveness. Zebrafish one-cell embryos were microinjected with 6.5 ng of VaDNA (A)or30ngofEcLPS (B) and NF-␬B luciferase and pRL-TK (10:1) reporter vectors alone or in combination with 4 ng of the indicated morpholinos. A and B, Twenty-four hours after microinjection, activation of the NF-␬B was measured as described in Materials and Methods. The results are expressed as the mean Ϯ SE of normalized lu- FIGURE 6. Zebrafish TLR4 negatively regulates NF-␬B-signaling ciferase activity relative to control embryos not injected with PAMPs. The pathway. Zebrafish one-cell embryos were microinjected with NF-␬B lu- asterisk denotes statistically significant differences between the indicated ciferase and pRL-TK (10:1) reporter vectors together with 6.5 ng of samples. C, RT-PCR analysis of zfTLR4 MO-induced altered splicing of VaDNA, 30 ng of EcLPS, and/or 0.1–1.0 ng of the expression constructs zfTLR4 transcripts 24 h after microinjecton. The 246-bp intact zfTLR4a zfTLR4b, zfTIR4b, zfTIR3, zfTIR9, zfTIR4b(Ala3His), and huTIR4. transcript was only detectable in uninjected embryo samples (Mock). A Twenty-four (A–C) and 48 (A) hours after microinjection, activation of the 107-bp product indicating the insertion of an intact intron between exons 1 NF-␬B was measured as described in Materials and Methods. The results and 2 of zfTLR4b was only observed in samples injected with MO and are expressed as the mean Ϯ SE of normalized luciferase activity relative when genomic DNA was used as template (Control ϩ), while it is absent to control embryos not injected with PAMPs. The asterisks denote statis- in uninjected embryos (Mock). Samples lacking cDNA (cDNA Ϫ) and tically significant differences between the indicated samples. those obtained in the absence of reverse transcriptase (RT Ϫ) gave no amplification. The primer pairs (forward and reverse, respectively) used mRNA levels of all these cytokines, whereas EcLPS serotype Ј Ј Ј for amplification were (5 -TGCATGGGAAGAAACCTCA-3 /5 -CAA 0111:B4 only increased the mRNA level of il6. As expected, GCATCCAGGAGCAAAAT-3Ј) and (5Ј-TGAATGCTGGACAAGGA PgLPS, VaDNA, and flagellin strongly increased the mRNA levels CAG-3Ј/5Ј-TCTTAGGCTCACATTAACAGACCA-3Ј) for zfTLR4a and zfTLR4b, respectively. The annealing of MOs (dashed lines) and the in- of all the inflammatory genes analyzed. Taken together, the above frame premature stop codons (arrowheads) are indicated. results demonstrate that the activation of seabream and pufferfish leukocytes by EcLPS is not mediated by TLR4, and they strongly suggest the existence of an unidentified receptor for this PAMP. green pufferfish, which lacks a TLR4 ortholog (9). Interestingly, the two serotypes of EcLPS used, 055:B5 and 0111:B4, were able EcLPS activates the zebrafish immune response via to induce the expression of the proinflammatory cytokines il1b a TRIF/TRAM-independent pathway (Fig. 2A), il6 (Fig. 2B), and tnfa (Fig. 2C), although each to a The recognition and activation of LPS by leukocytes from the different extent. Thus, EcLPS serotype 055:B5 increased the pufferfish led us to hypothesize whether the two TLR4 orthologs of 1842 LPS/TLR4 SIGNALING PATHWAY IN FISH Downloaded from

FIGURE 7. Multiple alignment of zebraﬁsh and hu- http://www.jimmunol.org/ man TLR4. Identical and similar residues identiﬁed in all proteins are indicated by asterisks and colons, respectively. The predicted leader peptide and the transmembrane domain (gray), the TIR domain (Prosite accession no. PS50104) (boldface), and the residue important for the activity of mammalian TLR4 (#) are shown. The accession numbers for the sequences are CAH72619 for huTLR4, XP_001336007 for zfTLRa, and AAH68358 for zfTLR4b. Note that no apparent leader peptide is present in zfTLR4a. by guest on September 27, 2021

the zebraﬁsh are involved in LPS recognition. As the mammalian dependent and -independent genes in the injection site of zebraﬁsh TLR4 signals via MyD88- and TRIF/TRAM-dependent pathways, injected i.m. with different PAMPs. The results showed that the and only the latter pathway results in the production of IFN-␤ and mRNA levels of several Myd88-dependent genes (e.g., il1b, il12, several downstream genes, we analyzed the expression of MyD88- tnfa, and lta) increased with all the PAMPs tested, including The Journal of Immunology 1843

ultrapure EcLPS of the serotype 0111:B4 (Fig. 3A–D). However, Zebrafish TLR4 negatively regulates the NF-␬B-signaling the expression pattern and the kinetics of the gene induced by pathway PgLPS and EcLPS were completely different, in accordance with As it has previously been shown that deletion of the extracellular previous data showing that EcLPS and PgLPS activate the immune domain of TLRs renders constitutively active mutants (44), we response by different pathways (24–26). Interestingly, however, generated zebrafish TLR4b, TLR3, and TLR9 mutants lacking the TRIF-dependent genes analyzed (i.e., inf1 and mxc) were dra- their extracellular domains (named zfTIR4b, zfTIR3, and zfTIR9, matically induced with poly(I:C), as was expected, although respectively). Interestingly, while overexpression of the huTIR4 EcLPS failed to induce any of them (Fig. 3, E and F). None of the (44), zfTIR3, and zfTIR9 induced the activation of NF-␬B, over- treatments used affected the mRNA levels of ifn2 and ifn3 (data not expression of zfTIR4b slightly decreased basal NF-␬B activation shown). Therefore, these data reveal that, in contrast to what hap- (Fig. 6A). These results prompted us to examine the alignment of pens in mammals, LPS is not able to induce the expression of zebrafish and human TLR4 polypeptides. Notably, although the TRIF/TRAM-dependent genes in the zebrafish. TIR domain is well conserved between fish and mammals, and almost identical in the two zebrafish paralogs (94% amino acid identity), they have a substitution (alanine instead of proline) in Ectopic expression of zebrafish TLR4a or TLR4b in HEK293 residue 681 of the TLR4a and 713 of TLR4b (corresponding to does not confer sensitivity on EcLPS residue 712 of mouse TLR4 and 714 of human TLR4) (Fig. 7). Since the zebrafish lacks the TLR4 costimulatory molecules MD-2 Replacement of proline with histidine at this position renders a nonfunctional mouse TLR4 (15). Therefore, we replaced alanine

and CD14, HEK293 cells were transiently transfected with ze- Downloaded from brafish TLR4a and TLR4b with or without human MD-2 and by histidine in wild-type zfTIR4b, and the resulting mutant was CD14, and the activation of the receptor was analyzed using a injected into zebrafish embryos. Interestingly, this mutant failed to ␬ NF-␬B luciferase reporter (Fig. 4A). While expression of huTLR4/ inhibit the activation of NF- B induced by VaDNA (Fig. 6B). MD-2/CD14, but not TLR4 alone, promoted NF-␬B activation Furthermore, wild-type zfTIR4b dramatically decreased the acti- ␬ upon addition of EcLPS, neither ortholog of the zebrafish induced vation of the NF- B induced by human TIR4 or VaDNA (Fig. 6, ␬ B and C). However, the zfTLR4b did not significantly affect the

the activation of the NF- B whether alone or together with human http://www.jimmunol.org/ activation of the NK-␬B induced by the huTIR4 (Fig. 6C), sug- MD-2 and CD14. Notably, activation of zebrafish TLR3 with gesting that engagement of this receptor by its unknown ligand poly(I:C) led to the induction of NF-␬B, indicating that the sig- would negatively regulate NF-␬B signaling in the zebrafish. Strik- naling pathway is well conserved among fish and mammals. The ingly, overexpression of zfTIR4b or zfTLR4b had no effect on the expression levels of all zfTLRs were analyzed by Western blot activation of NF-␬B induced by EcLPS (Fig. 6C), further confirm- using the V5 mAb and were found to be similar (Fig. 4B). ing that TLR4 is not the ligand for LPS in the zebrafish and suggesting that this receptor specifically inhibits the activation of ␬ Zebrafish MyD88, TLR4a, and TLR4b morphants show intact NF- B via the MyD88-dependent pathway.

LPS responsiveness by guest on September 27, 2021 To finally demonstrate the involvement of zebrafish TLRs in LPS Discussion signaling, we developed a zebrafish embryo model to study the Earlier studies by Berczi and coworkers (32) unexpectedly found NF-␬B-signaling pathway using the classical NF-␬B luciferase re- that lower vertebrates, most notably fish and amphibians, were porter system, combined with antisense MO-mediated knockdown resistant to the toxic effects of LPS. More recently, it has been ␮ (Table II) or gene overexpression. We first used a translation- shown that extremely high concentrations of LPS ( g/ml) are re- blocking MO against MyD88 that has been shown to impair em- quired to activate in vitro isolated leukocytes from several phylo- bryo clearance of Salmonella (43). MyD88 morphants showed sig- genetically distant teleost species (33–37). Additionally, the avail- nificantly reduced NF-␬B induction when injected with VaDNA ability of the sequence of the genome of several teleost species has revealed the presence of two TLR4 orthologs in an ancient teleost compared with the controls (TLR3 morphants and embryos not fish, the zebrafish (Cypriniformes), but its absence in more evolu- injected with MO) (Fig. 5A). In sharp contrast, Myd88 morphants tionarily advanced pufferfishes (Tetraodon and Fugu, both Tetra- showed unaltered NF-␬B induction when injected with EcLPS odontiformes). This in silico work has also revealed that costimu- (Fig. 5B). Additionally, the induction of NF-␬BbyEcLPS (either latory molecules essential for LPS activation via TLR4 (i.e., MD-2 from 0111:B4 or 055:B5 strains) in TLR4a, TLR4b, and TLR4a/ and CD14) are absent in all fish and amphibian genomes and ex- TLR4b morphants was also unaffected (Fig. 5B). The effectiveness pressed sequence tag databases available to date. Here, using dif- of MO to alter the splicing of zebrafish TLR4 transcripts was as- ferent ultrapure LPS preparations, we have demonstrated that leu- sayed by RT-PCR (Fig. 5C). The results showed that the intron kocytes from seabream, Tetraodon, and zebrafish are indeed able between exon 1 and exon 2 of zfTLR4a and zfTLR4b was not to respond to this PAMP with much lower sensitivity than mam- skipped out during splicing in MO-injected embryos. More spe- mals and via a TLR4/MyD88-independent signaling pathway. This cifically, integration of these introns created in-frame premature observation is supported by 1) the activation of seabream leuko- stop codons, resulting in truncated proteins lacking most of the cytes by ultrapure LPS and lipid A from E. coli, 2) the absence of extracellular domain as well as the transmembrane and TIR a TLR4 ortholog in Tetraodon, 3) the intact LPS responsiveness of domains. Similar results were obtained with another MO (Table TLR4a, TLR4b, and MyD88 morphant zebrafish embryos, and 4) II) for each zebrafish TLR4 (data not shown). No apparent de- the ability of zfTIR to negatively regulate in zebrafish embryos the velopmental defects were observed in TLR4a, TLR4b, and induction of NF-␬B by bacterial DNA (TLR9 agonist) or the over- MyD88 morphants (data not shown). All of these results dem- expression of a constitutively active human TLR4 but not by LPS. onstrated that the zebrafish orthologs of TLR4 are not involved In mammals, TLR4 is a promiscuous receptor able to recognize in the recognition of LPS and that EcLPS induces NF-␬B ac- not only LPS but also different endogenous ligands from damaged/ tivation and the expression of proinflammatory cytokines via a stressed tissues, such us high-mobility group box 1 (HMGB1), MyD88-independent pathway. hyaluronan, and biglycan (45, 46). For the recognition of most of 1844 LPS/TLR4 SIGNALING PATHWAY IN FISH these ligands, MD-2 seems to be indispensable but CD14 may not Disclosures be essential (18, 47, 48). In fact, MD-2, but not TLR4, is respon- The authors have no financial conflicts of interest. sible for the binding of LPS (23). Although the absence of MD-2 and CD14 orthologs in fish makes it difficult to predict the ligand References of zfTLR4s, our results suggest that the ability of this receptor to 1. Aderem, A., and R. J. Ulevitch. 2000. Toll-like receptors in the induction of the recognize LPS, and probably most of these endogenous ligands, innate immune response. Nature 406: 782–787. 2. Medzhitov, R., and C. A. Janeway. 2000. Innate immune recognition: mecha- was acquired after the divergence of fish and tetrapods. As Dro- nisms and pathways. Immunol. Rev. 173: 89–97. sophila Toll is an activator and directly recognizes the endogenous 3. Hoffmann, J. A., and J. M. Reichhart. 2002. Drosophila innate immunity: an ligand Spaetzle rather than structural microbial patterns (3), we evolutionary perspective. Nat. Immunol. 3: 121–126. 4. Xu, Y., X. Tao, B. Shen, T. Horng, R. Medzhitov, J. L. Manley, and L. Tong. propose that the ancestor of vertebrate TLR4 was originally de- 2000. Structural basis for signal transduction by the Toll/interleukin-1 receptor voted to the recognition of an unknown endogenous ligand, and its domains. Nature 408: 111–115. 5. Akira, S., and K. Takeda. 2004. Toll-like receptors signaling. Nat. Rev. Immunol. association in higher vertebrates with MD-2 and other co-recep- 4: 499–511. tors, such as CD14 or CD44 (48), increased its promiscuity. How- 6. Oshiumi, H., M. Sasai, K. Shida, T. Fujita, M. Matsumoto, and T. Seya. 2003. ever, in fish, and probably amphibians, TLR4 has been lost in most Prediction of the prototype of the human Toll-like receptor gene family from the pufferfish, Fugu rubripes, genome. Immunogenetics 54: 791–800. species, with the exception of the order Cypriniformes, where loss- 7. Jault, C., L. Pichon, and J. Chluba. 2004. Toll-like receptor gene family and of-function mutation(s) of the TIR domain allowed its retention as TIR-domain adapters in Danio rerio. Mol. Immunol. 40: 759–771. a negative regulator of the TLR-signaling pathway, which was 8. Meijer, A. H., S. F. Gabby Krens, I. A. Medina Rodríguez, S. He, W. Bitter, B. Ewa Snaar-Jagalska, and H. P. Spaink. 2004. Expression analysis of the Toll- duplicated later in these fish. like receptor and TIR domain adaptor families of zebrafish. Mol. Immunol. 40: One of the most exciting contributions of the present study is 773–783. Downloaded from 9. Roach, J. C., G. Glusman, L. Rowen, A. Kaur, M. K. Purcell, K. D. Smith, that the zebrafish TIR4 acts as a negative regulator of TLR func- L. E. Hood, and A. Aderem. 2005. The evolution of vertebrate Toll-like recep- tions, while the zfTLR4b fails to do so. This suggests that engage- tors. Proc. Natl. Acad. Sci. USA 102: 9577–9582. ment of this receptor by its unknown ligand would negatively reg- 10. Tsujita, T., H. Tsukada, M. Nakao, H. Oshiumi, M. Matsumoto, and T. Seya. ␬ 2004. Sensing bacterial flagellin by membrane and soluble orthologs of Toll-like ulate NF- B signaling in the zebrafish. This result is supported by receptor 5 in rainbow trout (Onchorhynchus mikiss). J. Biol. Chem. 279: the presence of a nonconservative substitution (alanine instead of 48588–48597. 11. Takano, T., H. Kondo, I. Hirono, M. Endo, T. Saito-Taki, and T. Aoki. 2007. proline) in the TIR domain of zfTLR4s (residue 681 of the TLR4a http://www.jimmunol.org/ Molecular cloning and characterization of Toll-like receptor 9 in Japanese floun- and 713 of TLR4b, which correspond to residue 712 of mouse der Paralichthys olivaceus. Mol. Immunol. 44: 1845–1853. TLR4 and 714 of human TLR4). This is not surprising since the 12. Bishop, R. E. 2005. Fundamentals of endotoxin structure and function. Contrib. 3 Microbiol. 12: 1–27. Pro His point mutation of mouse TLR4, which is found 13. Raetz, C. R., and C. Whitfield. 2002. Lipopolysaccharide endotoxins. Annu. Rev. in the LPS-unresponsive C3H/HeJ strain, renders a nonfunctional Biochem. 71: 635–700. mouse TLR4 (15), which exerts a dominant negative effect on LPS 14. Huber, M., C. Kalis, S. Keck, Z. Jiang, P. Georgel, X. Du, L. Shamel, S. Sovath, S. Mudd, B. Beutler, et al. 2006. R-form LPS, the master key to the activation signal transduction (49). In fact, the substitution of this alanine by ofTLR4/MD-2-positive cells. Eur. J. Immunol. 36: 701–711. histidine in the zfTIR4b also renders a nonfunctional TIR4b do- 15. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. Van Huffel, X. Du, D. Birdwell, main, which is unable to inhibit NF-␬B activation. On the other E. Alejos, M. Silva, C. Galanos, et al. 1998. Defective LPS signaling in C3H/HeJ

and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282: 2085–2088. by guest on September 27, 2021 hand, neither zfTIR4b nor zfTLR4b has an effect on the activation 16. Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda, of NF-␬B induced by EcLPS, further confirming that TLR4 is not and S. Akira. 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene prod- the ligand for LPS in the zebrafish and suggesting that this receptor uct. J. Immunol. 162: 3749–3752. specifically inhibits the activation of NF-␬B via the MyD88-de- 17. Qureshi, S. T., L. Larivie`re, G. Leveque, S. Clermont, K. J. Moore, P-Gros, P., pendent pathway. Therefore, zfTLR4s might act by sequestering and D. Malo. 1999. Endotoxin-tolerant mice have mutations in Toll-like receptor 4(Tlr4). J. Exp. Med. 189: 615–625. the TLR adaptors within the TLR signaling pathway, as has re- 18. Jiang, Z., P. Georgel, X. Du, L. Shamel, S. Sovath, S. Mudd, M. Huber, C. Kalis, cently been shown for mouse ST2L (50), a type-1 transmembrane S. Keck, C. Galanos, et al. 2005. CD14 is required for MyD88-independent LPS signaling. Nat. Immunol. 6: 565–570. receptor with a cytoplasmic TIR domain and an extracellular re- 19. Nagai, Y., S. Akashi, M. Nagafuku, M. Ogata, Y. Iwakura, S. Akira, T. Kitamura, gion that contains three Ig-like domains. However, note that there A. Kosugi, M. Kimoto, and K. Miyake. 2002. Essential role of MD-2 in LPS are conflicting reports on the actions of ST2L, as Schmitz et al. responsiveness and TLR4 distribution. Nat. Immunol. 3: 667–672. 20. Kimoto, M., K. Nagasawa, and K. Miyake. 2003. Role of TLR4/MD-2 and (51) described that ST2L was a receptor for the recently identified RP105/MD-1 in innate recognition of lipopolysaccharide. Scand. J. Infect. Dis. member of the IL-1 family IL-33, which exerts its biological ef- 35: 568–572. fects via the ST2L-enhanced activation of NF-␬B and MAPK. 21. Wright, S. D., R. A. Ramos, P. S. Tobias, R. J. Ulevitch, and J. C. Mathison. 1990. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS Whatever the case, we report for the first time the existence of a binding protein. Science 49: 1431–1433. TLR that would negatively regulate TLR signaling upon engage- 22. Tapping, R. I., and P. S. Tobias. 2000. Soluble CD14-mediated cellular responses to lipopolysaccharide. Chem. Immunol. 74: 108–121. ment with its specific ligand. The identification of the ligand of 23. Kim, H. M., B. S. Park, J. I. Kim, S. E. Kim, J. Lee, S. C. Oh, P. Enkhbayar, zfTLR4 and the receptor of LPS in fish will shed light into the N. Matsushima, H. Lee, O. J. Yoo, and J. O. Lee. 2007. Crystal structure of the evolution of the Toll family. We think that our identification of TLR4-MD-2 complex with bound endotoxin antagonist Eritoran. Cell 130: 906–917. TLR4 as a negative regulator of TLR signaling in the zebrafish 24. Werts, C., R. I Tapping, J. C. Mathison, T. H. Chuang, V. Kravchenko, together with the absence of this receptor in most fish species I. Saint Girons, D. A. Haake, P. J. Godowski, F. Hayashi, A. Ozinsky, et al. 2001. would explain the resistance of fish to the toxic effects of LPS and Leptospiral lipopolysaccharide activates cells through a TLR2-dependent mechanism. Nat. Immunol. 2: 346–352. the high concentrations of this substance required to activate the 25. Hirschfeld, M., J. J. Weis, V. Toshchakov, C. A. Salkowski, M. J. Cody, immune cells of these animals. D. C. Ward, N. Qureshi, S. M. Michalek, and S. N. Vogel. 2001. Signaling by Toll-like receptor 2 and 4 agonists results in differential gene expression in mu- rine macrophages. Infect. Immun. 69: 1477–1482. 26. Darveau, R. P., T. T. Pham, K. Lemley, R. A. Reife, B. W. Bainbridge, S. R. Coats, W. N. Howald, S. S. Way, and A. M. Hajjar. 2004. Porphyromonas Acknowledgments gingivalis lipopolysaccharide contains multiple lipid A species that functionally We thank I. Fuentes and E. M. García-Navarro for excellent technical interact with both Toll-like receptors 2 and 4. Infect. Immun. 72: 5041–5051. assistance, to Dr. M. Lamphier for the HEK/Elam-luc cells, Dr. R. Hay for 27. Kirikae, T., T. Nitta, F. Kirikae, Y. Suda, S. Kusumoto, N. Qureshi, and the NF-␬B luciferase reporter construct, Dr. R. Medzhitov for the huTIR4 M. Nakano. 1999. Lipopolysaccharides (LPS) of oral black-pigmented bacteria induce tumor necrosis factor production by LPS-refractory C3H/HeJ macro- construct, and Dr. M. F. Smith, Jr. for the huTLR4, huMD-2, and huCD14 phages in a way different from that of Salmonella LPS. Infect. Immun. 67: constructs. 1736–1742. The Journal of Immunology 1845

28. Tanamoto, K., S. Azumi, Y. Haishima, H. Kumada, and T. Umemoto. 1997. The 41. Mulero, V., P. Pelegrín, M. P. Sepulcre, J. Munõz, and J. Meseguer. 2001. A fish lipid A moiety of Porphyromonas gingivalis lipopolysaccharide specifically me- cell surface receptor defined by a mAb mediates leukocyte aggregation and de- diates the activation of C3H/HeJ mice. J. Immunol. 158: 4430–4436. activation. Dev. Comp. Immunol. 25: 619–627. 29. O’neill, L. A., and A. G. Bowie. 2007. The family of five: TIR-domain-contain- 42. Lo´pez-Castejoń, G., M. P. Sepulcre, F. J. Roca, B. Castellana, J. V. Planas, ing adaptors in Toll-like receptor signaling. Nat. Rev. Immunol. 7: 353–364. J. Meseguer, and V. Mulero. 2007. The type II interleukin-1 receptor (IL-1RII) of 30. Vogel, S. N., K. A. Fitzgerald, and M. J. Fenton. 2003. TLRs: differential adapter the bony fish gilthead seabream Sparus aurata is strongly induced after infection utilization by Toll-like receptors mediates TLR-specific patterns off gene expres- and tightly regulated at transcriptional and post-transcriptional levels. Mol. Im- sion. Mol. Interv. 3: 466–477. munol. 44: 2772–2780. 31. Miggin, S. M., and L. A. O’Neill. 2006. New insights into the regulation of TLR 43. van der Sar, A. M., O. W. Stockhammer, C. van der Laan, H. P. Spaink, signaling. J. Leukocyte Biol. 80: 220–226. W. Bitter, and A. H. Meijer. 2006. MyD88 innate immune function in a zebrafish 32. Berczi, I., L. Bertok, and T. Bereznai. 1966. Comparative studies on the toxicity embryo infection model. Infect. Immun. 74: 2436–2441. of Escherichia coli lipopolysaccharide endotoxin in various animal species. Can. 44. Medzhitov, R., P. Preston-Hurlburt, C. A. Janeway, Jr. 1997. A human homo- J. Microbiol. 12: 1070–1071. logue of the Drosophila Toll protein signals activation of adaptive immunity. 33. Sepulcre, M. P., G. Lo´pez-Castejoń, J. Meseguer, and V. Mulero. 2007. The Nature 388: 394–397. activation of gilthead seabream professional phagocytes by different PAMPs un- 45. Beg, A. A. 2002. Endogenous ligands of Toll-like receptors: implications for derlines the behavioural diversity of the main innate immune cells of bony fish. regulating inflammatory and immune responses. Trends Immunol. 23: 509–512. Mol. Immunol. 44: 2009–2016. 46. Marshak-Rothstein, A. 2006. Toll-like receptors in systemic autoimmune disease. 34. Pelegrín, P., J. García-Castillo, V. Mulero, and J. Meseguer. 2001. Interleukin-1␤ Nat. Rev. Immunol. 6: 823–835. isolated from a marine fish reveals up-regulated expression in macrophages following activation with lipopolysaccharide and lymphokines. Cytokine 16: 67–72. 47. Schaefer, L., A. Babelova, E. Kiss, H. J. Hausser, M. Baliova, M. Krzyzankova, 35. MacKenzie, S., J. V. Planas, and F. W. Goetz. 2003. LPS-stimulated expression G. Marsche, M. F. Young, D. Mihalik, M. Go¨tte, et al. 2005. The matrix com- of a tumor necrosis factor-␣ mRNA in primary trout monocytes and in vitro ponent biglycan is proinflammatory and signals through Toll-like receptors 4 and differentiated macrophages. Dev. Comp. Immunol. 27: 393–400. 2 in macrophages. J. Clin. Invest. 115: 2223–2233. 36. Stafford, J. L., K. K. Ellestad, K. E. Magor, M. Belosevic, and B. G. Magor. 2003. 48. Taylor, K. R., K. Yamasaki, K. A. Radek, A. Di Nardo, H. Goodarzi, A Toll-like receptor (TLR) gene that is up-regulated in activated goldfish mac- D. Golenbock, B. Beutler, and R. L. Gallo. 2007. Recognition of hyaluronan rophages. Dev. Comp. Immunol. 27: 685–698. released in sterile injury involves a unique receptor complex dependent on Toll- Downloaded from 37. Zou, J., C. Tafalla, J. Truckle, and C. J. Secombes. 2007. Identification of a like receptor 4, CD44, and MD-2. J. Biol. Chem. 282: 18265–18275. second group of type I IFNs in fish sheds light on IFN evolution in vertebrates. 49. Rosenstreich, D. L., S. N. Vogel, A. R. Jacques, L. M. Wahl, and J. Immunol. 179: 3859–3871. J. J. Oppenheim. 1978. Macrophage sensitivity to endotoxin: genetic control by 38. Westerfield, M. 2000. The Zebrafish Book: A Guide for the Laboratory Use of a single codominant gene. J. Immunol. 121: 1664–1670. Zebrafish (Danio rerio). University of Oregon Press, Eugene, OR. 50. Brint, E. K., D. Xu, H. Liu, A. Dunne, A. N. McKenzie, L. A. O’Neill, and 39. Sepulcre, M. P., P. Pelegrín, V. Mulero, and J. Meseguer. 2002. Characterisation F. Y. Liew. 2004. ST2 is an inhibitor of interleukin 1 receptor and Toll-like of gilthead seabream acidophilic granulocytes by a monoclonal antibody un- receptor 4 signaling and maintains endotoxin tolerance. Nat. Immunol. 5:

equivocally points to their involvement in fish phagocytic response. Cell Tissue 373–379. http://www.jimmunol.org/ Res. 308: 97–102. 51. Schmitz, J., A. Owyang, E. Oldham, Y. Song, E. Murphy, T. K. McClanahan, 40. Roca, F. J., M. P. Sepulcre, G. Lo´pez-Castejoń, J. Meseguer, and V. Mulero. G. Zurawski, M. Moshrefi, J. Qin, X. Li, et al. 2005. IL-33, an interleukin-1-like 2006. The colony-stimulator factor-1 is a specific marker for macrophages from cytokine that signals via the IL-1 receptor-related protein ST2 and induces T the bony fish githead seabream. Mol. Immunol. 43: 1418–1423. helper type 2-associated cytokines. Immunity 23: 479–490. by guest on September 27, 2021