Evolution of Lipopolysaccharide (LPS) Recognition and Signaling: Fish TLR4 Does Not Recognize LPS and Negatively Regulates NF- κB Activation This information is current as of September 27, 2021. María P. Sepulcre, Francisca Alcaraz-Pérez, Azucena López-Muñoz, Francisco J. Roca, José Meseguer, María L. Cayuela and Victoriano Mulero J Immunol 2009; 182:1836-1845; ; doi: 10.4049/jimmunol.0801755 Downloaded from http://www.jimmunol.org/content/182/4/1836 References This article cites 50 articles, 13 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/182/4/1836.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 27, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Evolution of Lipopolysaccharide (LPS) Recognition and Signaling: Fish TLR4 Does Not Recognize LPS and Negatively Regulates NF-␬B Activation1 María P. Sepulcre,* Francisca Alcaraz-Pe´rez,2*† Azucena Lo´pez-Mun˜oz,2* Francisco J. Roca,* Jose´Meseguer,* María L. Cayuela,† and Victoriano Mulero3* It has long been established that lower vertebrates, most notably fish and amphibians, are resistant to the toxic effect of LPS. Furthermore, the lack of a TLR4 ortholog in some fish species and the lack of the essential costimulatory molecules for LPS activation via TLR4 (i.e., myeloid differentiation protein 2 (MD-2) and CD14) in all the fish genomes and expressed sequence tag databases available led us to hypothesize that the mechanism of LPS recognition in fish may be different from that of mammals. To shed light on the role of fish TLRs in LPS recognition, a dual-luciferase reporter assay to study NF-␬B activation in whole Downloaded from zebrafish embryos was developed and three different bony fish models were studied: 1) the gilthead seabream (Sparus aurata, Perciformes), an immunological-tractable teleost model in which the presence of a TLR4 ortholog is unknown; 2) the spotted green pufferfish (Tetraodon nigroviridis, Tetraodontiformes), which lacks a TLR4 ortholog; and 3) the zebrafish (Danio rerio, Cyprini- formes), which possesses two TLR4 orthologs. Our results show that LPS signaled via a TLR4- and MyD88-independent manner in fish, and, surprisingly, that the zebrafish TLR4 orthologs negatively regulated the MyD88-dependent signaling pathway. We think that the identification of TLR4 as a negative regulator of TLR signaling in the zebrafish, together with the absence of this http://www.jimmunol.org/ receptor in most fish species, explains the resistance of fish to endotoxic shock and supports the idea that the TLR4 receptor complex for LPS recognition arose after the divergence of fish and tetrapods. The Journal of Immunology, 2009, 182: 1836–1845. he TLR multigene family comprises a family of trans- molecular patterns (PAMPs), which are essential for pathogen sur- membrane proteins first described in Drosophila. They vival (5). The interaction of a given PAMP with its specific TLR T are highly conserved in both the invertebrate and verte- leads to the expression of inflammatory cytokines and chemokines brate lineages (1, 2). In mammals, these receptors are mainly in- and to the activation of antimicrobial host defense mechanisms, volved in host defense, whereas in Drosophila, Toll receptors are such as the production of reactive nitrogen and oxygen radicals by guest on September 27, 2021 also involved in development (3). All family members share the and antimicrobial peptides. To date, a complete set of TLRs has same structure, defined by the presence of leucine-rich repeats been described in two phylogenetically distant teleost fish species, 4 (LRRs) in their extracellular domain and by the presence of a namely the pufferfish Fugu rubripes and the zebrafish Danio rerio. Toll/IL-1 receptor domain (TIR domain) in the C-terminal, the This set includes orthologs of the 10 mammalian TLR families and cytosolic part of the protein that initiates signal transduction (4). 2 fish-specific members (6–9). Additionally, it seems that some of TLRs recognize a variety of highly conserved pathogen-associated these orthologs are functionally analogous to their mammalian counterparts (10, 11). However, one of the most striking aspects found in these genomic studies is that while the zebrafish has two *Department of Cell Biology and Histology, Faculty of Biology, University of Mur- TLR4 paralogs, more evolutionarily advanced pufferfish, namely cia, Murcia, Spain; and †Research Unit, Department of Surgery, University Hospital “Virgen de la Arrixaca”, Murcia, Spain Fugu and Tetraodon, lack a TLR4 ortholog (6, 7). Received for publication May 30, 2008. Accepted for publication December 3, 2008. LPS is the major component of the outer membrane of Gram- negative bacteria. Structurally, it is composed of a core polysac- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance charide and an O-polysaccharide of variable length, as well as a with 18 U.S.C. Section 1734 solely to indicate this fact. lipid portion termed “lipid A”, which is the responsible for the 1 This work was supported by the Spanish Ministry of Education and Science (Grants activation of the innate immune response in mammals and confers BIO2005-05078 and CSD2007-00002 to V.M.), the Sixth Framework Programme of the European Union (Grant FOOD-CT-2005-007103 to V.M.), the Spanish Ministry its endotoxic properties (12, 13). Different bacteria produce struc- of Health (Grant PI060369 to M.L.C.), and the University of Murcia (fellowships to turally different LPS molecules, varying in their phosphate pat- F.A.-P. and A.L.-M.). terns, number of acyl chains, and fatty acid composition. Bacterial 2 F.A.-P. and A.L-M. contributed equally to this work. mutants that fail to add the inner core or the O-specific chain are 3 Address correspondence and reprint requests to Dr. Victoriano Mulero, Department said to produce “rough LPS” (R) because of the morphology of the of Cell Biology and Histology, Faculty of Biology, University of Murcia, 30100 Murcia, Spain. E-mail address: [email protected] colonies they form. Wild-type strains produce “smooth LPS” (S) 4 Abbreviations used in this paper: Ec, Escherichia coli; hu, human; LRR, leucine- and grow as smooth colonies. LPSs are amphipathic molecules rich repeats; MD-2, myeloid differentiation protein 2; MO, morpholino; PAMP, whose hydrophobicity decreases with increasing length of the pathogen-associated molecular pattern; Pg, Porphyromonas gingivalis; P/S, penicillin sugar part. Due to these differences, the S and R forms show and streptomycin; R, rough LPS; S, smooth LPS; Sa, Salmonella abortus equi; Sm, Salmonella minnesota; St, Salmonella thyphimurium; TIR, Toll/IL-1 receptor; TRIF, marked differences in their abilility to activate mouse macrophages TIR domain-containing adapter inducing IFN-␤; TRAM, TRIF-related adapter mol- and splenocytes (14). ecule; VaDNA, Vibrio anguillarum genomic DNA; zf, zebrafish. In mammals, the mechanism by which LPS initiates a signal was Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 solved in 1998 by positional cloning, which revealed that TLR4 is www.jimmunol.org/cgi/doi/10.4049/jimmunol.0801755 The Journal of Immunology 1837 Table I. Gene accession numbers and primer sequences used for gene expression analysisa Species Gene Accession No. Name Sequence (5Ј–3Ј) Seabream il1b AJ277166 F2 GGGCTGAACAACAGCACTCTC R3 TTAACACTCTCCACCCTCCA il6 AM749958 F AGGCAGGAGTTTGAAGCTGA R ATGCTGAAGTTGGTGGAAGG ccl4 AM765840 F GCTGTGTTTGTGCTGATGCT R GCTGGCTGGTCTTTTGGTAG il8 AM765841 F2 GCCACTCTGAAGAGGACAGG R2 TTTGGTTGTCTTTGGTCGAA rps18 AY587263 F1 AGGGTGTTGGCAGACGTTAC R1 CTTCTGCCTGTTGAGGAACC rps11 NM213377 F1 GGCGTCAACGTGTCAGAGTA R1 GCCTCTTCTCAAAACGGTTG Zebrafish tlr4a XM001335971 F CAATGGCTTGGGTACTTTGC R GATTTGAGGAGTGCCGGATA tlr4b AY388400 F TGAATGCTGGACAAGGACAG R ATGCCACAGAGAAGGGAAGA il1b NM212844 F5 GCCTGTGTGTTTGGGAATCT Downloaded from R5 TGATAAACCAACCGGGACAT il12a AB183001 F1 AGCAGGACTTGTTTGCTGGT R1 TCCACTGCGCTGAAGTTAGA tnfa NM212859 F2 GCGCTTTTCTGAATCCTACG R2 TGCCCAGTCTGTCTCCTTCT lta AB183467 F2 AAGCCAAACGAAGAAGGTCA R2 AACCCATTTCAGCGATTGTC http://www.jimmunol.org/ mxc NM001007284 F2 GAGGCTTCACTTGGCAACTC R2 TTGTTCCAATAAGGCCAAGC inf1 AY135716 53 TCTTAATACACGCAAAGATGAGAACT 3 GTCAGGACTAAAAACTTCAC Spotted green pufferfish il1b ENSTRUG00000016002 F AGCTCCTCCTCCACAAGACA R CCTCACGGTTGGATTGAAGT il6 AJ555458 F AGCAAAGTGCCCTTACTCCA R CGCTCCTTCACCTTGTTCTC tnfa AB183465 F2 CTCCTGGCCATGTTCTTGAT R2 GGGGTTCTGTTCTCCTCCTC by guest on September 27, 2021 a The gene symbols follow the “Zebrafish Nomenclature Guidelines” (zfin.org/zf_info/nomen.html). the central component of the LPS receptor (15). To date, there is TIR domain-containing