EXPRESSION AND REGULATION OF THE RATE-LIMITING ENZYMES OF THE KYNURENINE PATHWAY IN THE MOUSE BRAIN

BY

ALEXANDRA KELLY BROOKS

DISSERTATION

Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Neuroscience in the Graduate College of the University of Illinois at Urbana-Champaign, 2017

Urbana, Illinois

Doctoral Committee:

Research Assistant Professor Robert H. McCusker, Chair Assistant Professor Andrew J. Steelman Assistant Professor Monica Uddin Professor Rodney W. Johnson P a g e | ii

ABSTRACT

During the mid-1900’s, early anti-depressants were developed to increase levels of catecholamines within the brain, leading to the theory that depression symptomology was a result of an imbalance of neurotransmitters within the brain. To date, the catecholamine theory of depression is still held to be the prevailing theory as selective serotonin reuptake inhibitors being the most commonly prescribed anti-depressants. However, the incidence of depression is still rising with a vast amount of patients failing to respond to current treatments, and with this knowledge, additional theories of the neurobiology of depression have arisen over the past 30 years. A leading theory is Kynurenine Pathway activation in relation to inflammation- or stress- induced depression-like behaviors. There has been a tremendous amount of data connecting activated immune system (or hypothalamic-pituitary-adrenal axis), increased kynurenine production and depression symptomology. Thus, understanding the factors that activate this pathway, as well as determining a relationship between anti-depressants and regulation of the

Kynurenine Pathway, is an important next step in understanding the complex etiology of depression. My work has focused on 1) describing interactions between inflammation and stress to accentuate the expression of rate-limiting enzymes (indoleamine/tryptophan-2,3-dioxygenase:

DOs) that metabolize the essential amino acid tryptophan to kynurenine, 2) detailing a novel interaction between galectins and interferon-gamma to accentuate DO expression within the brain, and finally 3) discuss the ability of current anti-depressant desipramine to block these interactions and attenuate DO expression within the brain and periphery as a possible new mechanism by which anti-depressants may be working to reduce depression symptomology. P a g e | iii

ACKNOWLEDGEMENTS

I could not have completed this degree or dissertation without the support of my advisor and mentor, Dr. Robert (Bob) McCusker. Thank you for encouraging me to develop my own ideas and test them out and for creating a supportive environment to discuss theories and new projects. I may have cried a few times in your office, but you were always there to help pick me back up, set me on track, and laugh about it later. We had a discussion in one of the neuroscience ethics seminar’s about an advisor also being a mentor, and we all agreed that an advisor should be (at minimum) a decent advisor with the hope that they would also be a mentor. Bob, you have been more than an advisor over the past three years; you have been the most amazing mentor, and I hope a close colleague and friend in the future. Thank you for working endlessly to help make my manuscripts great.

Another key member of the lab, without whom I would not be finishing as quickly as I am, is Marc Lawson. I cannot thank you enough for all of your help working with mice and helping me slowly gain confidence with all the laboratory techniques over the years. Marc, you were my second mentor in the lab, and truly a wonderful lab mate, colleague and friend. Our long talks delving into different theories and molecular mechanisms helped shape my scientific mind, while our fun and crazy talks helped break up the monotony of the day. With both you and

Bob by my side these past few years, I was given the opportunity to learn from some of the greatest scientists I know and will hopefully become even ½ of the researcher you both are in the future.

I also could not have completed this dissertation without my wonderful undergrads that worked with me from the beginning: Tiffany Janda and Cecilia Ocampo-Solis. Thank you for working hard over the past three years, for dedicating your time to help me finish this degree, P a g e | iv and for your unwavering friendship. You are both going places, and I truly can’t wait to see you guys succeed; I’ll be there every step of the way cheering you on and will always be there if you need me. Similarly, without the help of Dr. McCusker’s other fantastic undergrads, Jill Braun and

Nic Gamsby, I couldn’t have made it through the longest (and earliest morning) experiments. I believe you both are fantastic workers and beautiful people. Thank you for your help in the lab over the past two years, and more importantly, for being a listening ear that I could rely on when days were stressful. Bet you guys are going to miss those week long 8 am morning experiments!

Finally, I would like to thank my husband, Sean Brooks, and parents (Barbara and Kevin

Kelly). Sean, thank you for putting up with my late nights and weekends at the lab and for being understanding when I (we) needed to stay in Champaign during breaks instead of seeing family.

Thank you for all of the hugs when I needed them after a rough day, for giving me support and praise after completely messing up an experiment, and for allowing me to be the best person and scientist I could be, even when that meant being separated for an extended amount of time. I don’t know what the future holds for us, but I know it’s going to be amazing because I have you.

Mom and Dad, I know you never envisioned me going to get a PhD in neuroscience, and especially not from Dad’s alma mater! I truly can’t believe I’m graduating with a doctorate from the same school as you, Dad, exactly 20 years later. I want you to know that part of my decision to go to UIUC was for us (both you and me) to remember the past when I was growing up here, and remember all of the great times we had when Dad was in grad school. I have always wanted you both to support me in my decision to leave music, and I hope now you can be proud of all that I’ve accomplished. Thank you for the long phone calls home twice a week, for taking the time to listen to my “drama,” and for helping me figure out the next chapter of my life. P a g e | v

TABLE OF CONTENTS

CHAPTER 1: Introduction ...... 1 1.1 Inflammation ...... 1 1.2 Stress ...... 2 1.3 Tryptophan Metabolism ...... 3 1.4 DO and Behavior ...... 5 1.5 DO Transcripts ...... 6 1.6 Overlapping Pathways ...... 7 1.7 Clinical Relevance ...... 8 1.8 Conclusion ...... 9

CHAPTER 2: Interactions between inflammatory mediators and corticosteroids regulate transcription of genes within the Kynurenine Pathway in the mouse hippocampus ...... 11 2.1 Abstract ...... 11 2.2 Introduction ...... 13 2.3 Methods...... 17 2.4 Results ...... 22 2.5 Discussion ...... 35

CHAPTER 3: Immunomodulatory factors galectin-9 and interferon-gamma synergize to induce expression of rate-limiting enzymes of the Kynurenine Pathway in the mouse hippocampus ...... 41 3.1 Abstract ...... 41 3.2 Introduction ...... 43 3.3 Methods...... 46 3.4 Results ...... 51 3.5 Discussion ...... 64

CHAPTER 4: Desipramine decreases expression of human and murine indoleamine-2,3-dioxygenases...... 70 4.1 Abstract ...... 70 4.2 Introduction ...... 72 4.3 Methods...... 75 4.4 Results ...... 79 4.5 Discussion ...... 87

CHAPTER 5: Conclusion ...... 94 5.1 Conclusion ...... 94 5.2 Additional Completed Work ...... 96

REFERENCES ...... 99

P a g e | 1

CHAPTER 1: Introduction

1.1 Inflammation

The body responds to stimuli (i.e. infection or damage) by generating an inflammatory response: increasing pro-inflammatory cytokine levels including interleukin (IL)-1β, IL-6, tumor necrosis factor (TNFα), and interferons (IFNs) alpha and gamma. These cytokines are proteins necessary to guide immune cell activity to fight the inflammatory agent or aide in wound healing. However, data support the idea that elevated cytokines may be responsible for deleterious effects as well. Increases in inflammatory markers such as IL-1β, C-reactive protein

(CRP), IL-6, and TNFα have been linked with multiple psychiatric conditions including bipolar disorder, depression, and schizophrenia (2).

In both human and rodent models, sickness behavior occurs when pro-inflammatory cytokines are elevated following inflammatory insult. Cytokines cause changes in neuronal circuits that decrease goal-directed or reward behavior (3), increase sensitivity to pain, reduce general activity, reduce food intake, reduce body weight and cause fever. Once the initial sickness response begins to wane and locomotor activity returns to normal, depression-like behaviors remain (4). These cytokine-mediated events also occur in humans. Patients receiving

IFNimmunotherapy to fight Hepatitis C or cancer initially experience sickness behavior, then up to 45% of these patients report depression-like symptoms (5-7). Additionally, healthy volunteers when injected with bacterial endotoxin (lipopolysaccharide, LPS), develop depression-like behaviors following a sickness response and elevated peripheral cytokines (8).

Extensive research has been reported on the ability of an inflammatory challenge to induce a depression-like phenotype with rodent models. Like the human studies, administration of LPS to rodents evokes cytokine expression followed by a sickness response. Depression-like behaviors

P a g e | 2 such as despair (increased immobility during tail suspension test, TST) and anhedonia (decreased sucrose preference) are evident following an inflammatory challenge (4, 9-15).

1.2 Stress

Glucocorticoids (GCs) are hormones released following hypothalamic-pituitary-adrenal

(HPA) axis activation. These hormones play a pivotal role in regulating immune and neuroendocrine responses and are critical in maintaining homeostasis within the body (16). The

GCs corticosterone in rodents/cortisol in humans bind to both the glucocorticoid receptor (GR) and mineralocorticoid receptor (MR) with varying affinities. Aldosterone (Aldo) binds to the

MR, which plays a role in maintaining basal activation of the HPA axis (17). The hippocampus is a prime target for glucocorticoid effects (18); MRs have been shown to be highly concentrated in the hippocampus (17), while GRs are distributed throughout the brain, although still found at high concentrations within the hippocampus (17, 19). Complicating the matter further, MRs can be occupied by either mineralocorticoids (MCs) such as Aldo or GCs (cortisol/corticosterone), with GCs being 100–1000 times more abundant than mineralocorticoids within the circulation.

Dysregulation of the stress response has been associated with multiple psychiatric disorders such as PTSD (20), depression (21), and schizophrenia (22). Depressed patients have increased concentrations of cortisol in plasma, urine, and cerebrospinal fluid (21), and elevated circulating Aldo (23, 24), most likely due to altered HPA axis activity. Administration of Aldo,

Cort, and Dex or subjecting animals to stress induces anxiety and depression-like behaviors, despair and anhedonia, in rodents (25-29). Similarly, patients suffering from hyperaldosteronism

(Conn’s syndrome) have been shown to display depression-like symptoms (30, 31), and further research shows that there’s an increase of Aldo during stress of animals (19, 25, 32) and humans

(19, 33). Approximately 54% of patients suffering from hypercortisolemia (Cushing’s disease)

P a g e | 3 suffer from major depression; with increased depression symptom severity associated with higher cortisol levels (34).

1.3 Tryptophan Metabolism

Tryptophan, an essential amino acid, is used in the body for multiple purposes; it is regularly used in the synthesis of proteins, can be metabolized into the neurotransmitter serotonin or metabolite kynurenine, and used as a substrate for NAD/NADP production. Interestingly, after tryptophan’s necessary function in protein synthesis, almost 90% of tryptophan metabolism is to synthesize kynurenine while only 3% of tryptophan is used to synthesize serotonin (only 1% in the brain) (35). Historically, depression symptoms are attributed to decreased serotonin synthesis, however research is now focused on tryptophan metabolism away from serotonin and towards the Kynurenine Pathway (Fig. 1). Indoleamine-2,3-dixoxygenase 1 (Ido1), Ido2, and tryptophan-2,3-dioxygenase 2 (Tdo2) are the three rate-limiting enzymes that metabolize tryptophan to intermediate N-formyl-kynurenine, which is then hydrolyzed to kynurenine.

Cytokines (the most potent being IFN) can increase expression of Ido1 and Ido2, while stress hormones can increase Tdo2 expression. Kynurenine can then be metabolized by kynureninase

(Kynu, generating anthranilic acid), kynurenine 3-monooxygenase (KMO, generating 3- hydroxykynurenine; 3-HK), or kynurenine aminotransferases (Kat2, generating kynurenine acid

(KynA)). 3-HK is metabolized to 3-hydroxyanthranilic acid (3-HANA) by Kynu, which is then metabolized by 3-Hydroxyanthranilic acid oxygenase (Haao) to 2-amino-3-carboxymuconic-6- semialdehyde, which can either be metabolized to quinolinic acid (QuinA) or picolinic acid (36).

QuinA is then metabolized by quinolinic acid phosphoribosyltransferase (Qprt), yielding nicotinic acid mononucleotide (NAD) and further metabolic product NAD+, necessary to generate energy throughout the body and to battle inflammatory assault.

P a g e | 4

Figure 1. Tryptophan metabolism pathway.

The two main neuroactive metabolites QuinA and KynA have been implicated in glutamatergic dysregulation through modulation of N-methyl-D-aspartate receptor (NMDA-R) activity (37, 38). QuinA is thought to induce neurotoxicity mediated by NMDA-R activation and promote the generation of free radicals (36). KynA blocks excitatory neurotransmission/excitotoxic injury, is anticonvulsant, and is a competitive antagonist of the

NMDA-R and non-competitive antagonist of the alpha7 nicotinic acetylcholine receptor (36, 39).

The properties of KynA (neuroprotective) and QuinA (excitotoxic) in the brain suggest that kynurenine metabolites may play a role in the pathophysiology and etiology of neurological conditions (36) and deviation from basal levels of these two metabolites could directly impact brain health. Indeed, there are increased QuinA and KynA levels in the CSF following traumatic brain injury (40) and amyotrophic lateral sclerosis (41, 42) patients, increased QuinA levels in

IFN-treated Hepatitis C patients (43, 44), (with QuinA levels correlating to severity of

P a g e | 5 symptoms (43)), increased KynA in post-mortem brain tissue of individuals diagnosed with schizophrenia (45) and in CSF of patients diagnosed with bipolar disorder (46), and elevated

QuinA in CSF of patients that correlated with suicide intents (47).

1.4 DO and Behavior

As the neuroactive metabolites are strongly associated with multiple disorders, studies investigating the role of Ido1, Ido2, and Tdo2 to impact behavior are critical. Some work has been done to determine the role of Ido1 in animal behavior; very little work has been performed describing the influence of Ido2 and Tdo2. Eliminating Ido1 activity using a genetic knockout

(Ido1KO mice) or blocking activity by administration of 1-methyltryptophan (1-MT, an inhibitor of both Ido1 and Ido2 enzymatic activity (48)) are common models used to define Ido1's role in animal behavior and immune function. Ido1KO mice display normal dendritic cell development and functional characteristics (49). Ido1 deficiency, assessed in both Ido1KO and 1-MT treated mice, protects mice against LPS-mediated endotoxin shock (50) and decreases sensitivity to neurotoxicity induced by QuinA (51). In both intraperitoneal Bacillus Calmette–Guérin (BCG) infected and LPS intracerebroventricular treated mice, both 1-MT administered and Ido1KO animals were protected from helplessness/despair depression-like behaviors (immobility during

TST or forced swim test (FST)) (11, 14). Both Ido1KO and Ido2KO mice have deficits in oxazolone–induced Kyn/KynA-mediated T-cell maturation to the immunosuppressive Treg phenotype (52). Despite a similar anti-inflammatory role is these models, in a contact hypersensitivity model, cytokine expression was suppressed in Ido2KO mice compared to both

Ido1KO and wild-type (WT) control mice. Similarly, in a rheumatoid arthritis model, it was also shown that Ido2, not Ido1, was necessary for the development of arthritic symptoms, as Ido2KO mice displayed decreased inflammation in the joint shown by decreased cytokine levels (53).

P a g e | 6

Interestingly, Tdo2KO mice seem to have decreased anxiety in the elevated plus maze as well as increased neurogenesis in the hippocampus (54, 55).

Following Toxoplasma gondii infection and dexamethasone administration, there is significant neuroinflammation as well as significantly increased plasma IFN levels and increased IFN, Ido1 and Ido2 expression within the brain (56). Similarly, these mice displayed increased immobility during both FST and TST and had decreased sucrose preference (56).

Together these data connect Toxoplasma gondii infection, increased brain IFN and Ido expression and enhanced depression-like behaviors. During Japanese encephalitis infection, Ido1 expression within the brain increased over time and correlated with clinical signs of viral disease progression, suggesting a relationship between brain Ido1 expression and severity of neurological symptoms seen after infection (57). Similarly, viral mimetic poly I:C and BCG induces neuroinflammation, Ido expression within the brain and depression-like behaviors in rodents (12, 58).

These studies suggest that Ido1, Ido2, and Tdo2 may play distinct roles in animal behavior, however the distinct roles of Ido1, Ido2, and Tdo2 in the brain in relation to depression-like behavior is still unknown.

1.5 DO Transcripts

Blocking Ido activity seems like an effective way to decrease inflammation-induced depression-like behavior, the pharmacological inhibitor of Ido activity, 1-MT, is also currently being tested in patients with cancer. 1-MT may have additional actions independent of its ability to block Ido activity, and this prompts the need for additional, more potent and specific Ido inhibitors (59). The idea of creating more specific inhibitory effects is exciting given the existence of multiple Ido1 and Ido2 variants, which suggests that individual mRNA transcripts

P a g e | 7 may be implicated in the induction of inflammation-induced depression-like behavior, and thus, blocking specific transcripts could allow for more precise control than blocking overall Ido activity. One manuscript describes expression of three Tdo2 transcripts within the mouse brain during development. This is the first manuscript to suggest that differential regulation of Tdo2 transcripts could play a role in postnatal brain development (60). Soon after, another manuscript described Ido1 and Ido2 transcripts found in both human and mouse mesenchymal and neural stem cells and multiple tissues, including brain (61). It was the first manuscript to suggest that only certain transcripts were detectable in the brain, while other transcripts could be induced by inflammatory mediators (i.e. IFN) in a tissue-specific manner (61). We followed this work to identify and describe regulation for multiple Ido1 and Ido2 transcripts in the brain.

1.6 Overlapping Pathways

Although inflammation or stress can induce depression-like behaviors, only recently has there been work suggesting that these two pathways synergize to induce depressive-symptoms

(62). In a study of suicide attempters, there was a significant association between inflammatory markers (IL-6 and CRP), psychological stress, and suicidal risk (63). In chronically stressed mice, a single low-dose of LPS accentuated depression-like behaviors (64). Similarly, repeated

LPS administration to chronic mild stress mice accentuated depression-like behavior (65).

Although no mechanism was given, my dissertation research suggests that inflammation and stress could interact to accentuate expression of the DOs and induce the Kynurenine Pathway.

Galectins (Gals) are B-galactoside-binding lectins which can interact extracellularly with cell-surface glycans on multiple immune cells to exert their immunomodulatory capabilities (66).

There are three distinct groups of Gals, classified by differences in the carbohydrate-recognition domain (CRD). For example, Gal-1 is a member of the proto-type group which only has one

P a g e | 8

CRD, while Gal-3 is part of the chimera-type group which has one CRD connected to a non- lectin region, consisting of proline and glycine rich sections. Finally, Gal-9 is a member of the tandem repeat-type group which is made up of two distinct CRDs connected by a linker.

Although Gal-1, Gal-3 and Gal-9 are members of different groups based on CRD content, these three Gals are also associated with neuroinflammation (67-69) and multiple disorders including multiple sclerosis (MS) (70, 71) and amyotrophic lateral sclerosis (ALS) (69). Although there is research suggesting that Gals may modulate neuroinflammation, there is no work suggesting overlap between Gals, the Kynurenine Pathway, or depression. Thus, I investigated the ability of neuroinflammation and Gals to interact to accentuate DO expression and induce the Kynurenine

Pathway.

1.7 Clinical Relevance

Many of the most commonly prescribed anti-depressants are selective serotonin reuptake inhibitors, such as fluoxetine, or serotonin/norepinephrine reuptake inhibitors, such as desipramine (Desip). Although the main purpose of anti-depressants was originally to increase neurotransmitter levels within the brain, it has been postulated that anti-depressants may have additional mechanisms of action. However, there has been no work suggesting that anti- depressants alter DO expression in the brain or periphery, and thus, it would be important to determine if an anti-depressant could decrease inflammation- and/or inflammation x corticosteroids or Gal-9- induced Ido1 and Ido2 expression in the brain. Discovering a novel mechanism by which anti-depressants may affect patients is of critical importance as it could help with the design of future therapeutics. Physicians choosing medications for their depressed patients is considered an art, not necessarily based in science, as it is unclear why certain patients do or do not respond to different anti-depressants. Further defining anti-depressant action within

P a g e | 9 the brain may reveal that patients battling cancer or Hepatitis C may respond better to an anti- depressant that does or does not alter DO expression. Although too soon to be sure, this is definitely an exciting path for the future.

In addition to inflammation-induced depression-like behaviors, Kynurenine Pathway activation (specifically DOs) is well associated with other neurological and autoimmune disorders. Increased Ido1 expression is found in the brain of a murine model of Huntington’s disease (72), while an increased kynurenine:tryptophan ratio within plasma is found in patients with Huntington’s disease (73). Similarly, in mouse models of Alzheimer’s disease, there was increased Ido1 and Tdo2 expression in the brain (74) and furthermore, an Ido inhibitor was able to decrease Ido activity as well as decreasing amyloid plaque formation (75). There are also higher levels of Ido1 and Tdo2 positive cells within the brain of Alzheimer’s disease patients

(74, 76, 77). As Ido1 and Ido2 play a role in regulating inflammation, there is a strong connection between activated Kynurenine Pathway and both multiple sclerosis (MS) and amyotrophic lateral sclerosis (ALS). Patients with relapse-remitting MS have higher expression of Ido1 in peripheral blood mononuclear cells (PBMCs) (78), while patients with ALS have increased microglial Ido expression as well as increased serum kynurenine and quinolinic acid levels (79). There is a strong connection between Kynurenine Pathway activation and multiple neurological/ autoimmune diseases, suggesting that independent of inflammation-induced depression, understanding the regulation of the DOs may be crucial for determining the etiology of a variety of disorders.

1.8 Conclusion As depression is predicted to become the number one major disease burden in the US by

2030, there is an urgent need to define the underlying mechanisms responsible for MDD. One potential, under-appreciated mechanism to consider is the Kynurenine Pathway, which can be

P a g e | 10 induced by inflammatory mediators and stress hormones to produce neuroactive metabolites.

Thus, my dissertation research is focused on the relationship between factors associated with depression (i.e. inflammation and stress) to discover overlapping pathways that may modulate the rate-limiting enzymes of this pathway to help define new therapeutic targets for anti- depressant treatment and to better understand the mechanism behind current anti-depressant treatments.

P a g e | 11

CHAPTER 2: Interactions between inflammatory mediators and corticosteroids regulate

transcription of genes within the Kynurenine Pathway in the mouse hippocampus1

2.1 Abstract

Increased tryptophan metabolism towards the production of kynurenine via indoleamine/tryptophan-2,3-dioxygenases (DOs: Ido1, Ido2 and Tdo2) is strongly associated with the prevalence of major depressive disorder in patients and the induction of depression-like behaviors in animal models. Several studies have suggested that activation of the immune system or elevated corticosteroids drive DO expression, however, mechanisms linking cytokines, corticosteroids and DOs to psychiatric diseases remain unclear. Various attempts have been made to correlate DO gene expression within the brain to behavior, but disparate results have been obtained. We believe that discrepancies arise as a result of the under-recognized existence of multiple mRNA transcripts for each DO. Unfortunately, there are no reports regarding how the multiple transcripts are distributed or regulated. Here, we used organotypic hippocampal slice cultures (OHSCs) to directly test the ability of inflammatory and stress mediators to differentially regulate DO transcripts. OHSCs were treated with pro-inflammatory mediators

(interferon-gamma (IFN, lipopolysaccharide (LPS) and polyinosine-polycytidylic acid (pI:C)) with or without corticosteroids (dexamethasone (Dex: glucocorticoid receptor (GR) agonist), aldosterone (Aldo: mineralocorticoid receptor (MR) agonist), or corticosterone (Cort: GR/MR agonist)). IFN induced Ido1-full length (FL) and Ido1-variant (v) expression, and surprisingly,

Dex, Cort and Aldo interacted with IFN to further elevate expression of Ido1, importantly, in a

1 Adapted from the published version in the Journal of Neuroinflammation (renumbered figures and formatting): Brooks AK, Lawson MA, Smith RA, Janda TM, Kelley KW, McCusker RH. Interactions between inflammatory mediators and corticosteroids regulate transcription of genes within the Kynurenine Pathway in the mouse hippocampus. J Neuroinflammation 2016, 1:98.

P a g e | 12 transcript dependent manner. IFN, LPS and pI:C increased expression of Ido2-v1 and Ido2-v3 transcripts, whereas only IFN increased expression of Ido2-v2. Overall Ido2 transcripts were relatively unaffected by GR or MR activation. Naïve mouse brain expresses multiple Tdo2 transcripts, Dex and Cort induced expression of only one of the three Tdo2 transcripts (Tdo2-FL) in OHSCs. These results establish that multiple transcripts for all three DOs are expressed within the mouse hippocampus, under the control of distinct regulatory pathways. These data identify a previously unrecognized interaction between corticosteroid receptor activation and inflammatory signals on DO gene expression, which suggest that corticosteroids act to differentially enhance gene expression of Ido1, Ido2 and Tdo2.

P a g e | 13

2.2 Introduction

The lifetime prevalence of major depressive disorder (MDD) is almost 15 % (80) with nearly 10 % of the USA population taking antidepressants on any occasion (81). Within the general population, prevalence is 5 - 10 times higher in patients with a known medical illness

(82), particularly when this medical illness is a chronic inflammatory condition (82). For example, people with multiple sclerosis have a prevalence rate of MDD up to 50% (83). Over the past 20 years, an association between the immune system and MDD has been clearly established.

Studies have shown that patients with MDD have elevated levels of immunomodulatory factors

(pro-inflammatory cytokines) within the circulation and increased expression of pro- inflammatory cytokines in the central nervous system, neuroinflammation (6). During chronic administration of the pro-inflammatory cytokine IFN to patients with Hepatitis C or malignant melanoma, up to 45 % of patients eventually exhibit elevated symptoms of MDD (6, 7, 84). As such, patients who have undergone a chronic immune challenge express a variety of depressive symptoms (7, 85). Now, one of the most pressing issues is to determine how inflammatory cytokine signaling is linked to a pathway responsible for depression-like behaviors (3). The answer to this question could aid in development of new anti-depressant drugs that would benefit a large percentage of the population. This is especially pertinent considering that anti-depressants are therapeutically effective in only 15% of patients after accounting for the placebo effect (86).

Several reports have identified polymorphisms associated with DO expression, an elevated immune response and dysregulation of the hypothalamic-pituitary-adrenal axis.

Polymorphisms in the Ido1 gene are associated with both treatment efficiency of anti-depressants

(87) and symptomology of depression (88). A polymorphism in the promotor region of the Ido1 gene (rs9657182, CC genotype) is a risk factor for patients to develop depression after

P a g e | 14 immunotherapy (88). An additional study (89) found that patients are more likely to develop symptoms of depression following immunotherapy if they harbored the “high producer” allele

(IFN+874, T allele) that is associated with elevated IFN expression (90, 91). This allele is also associated with increased DO activity (89, 92), suggesting that this genotype may be a risk factor for increased interferon/DO-induced depression (93). There are also functional polymorphisms in the GR gene associated with symptoms of depression (94-96). These data provide accumulating evidence for convergence of immune (IFN → DO) and stress (HPA dysregulation/corticosteroid → GR activation → DO expression) pathways involved in depression. The least characterized aspect of this convergence is the interaction between these two pathways as regulatory pathways controlling DO expression.

Extensive research has illustrated mechanisms by which inflammatory challenge induces a depression-like phenotype with rodent models. Administration of LPS, pI:C, or infection with

Mycobacterium bovis evokes peripheral and CNS cytokine expression followed by the manifestation of depression-like behaviors such as helplessness/despair (increased immobility during tail suspension test, TST) and anhedonia (decreased sucrose preference (32, 33).

Importantly, development of depressive symptoms is tied to elevated tryptophan metabolism to kynurenine via the DOs (38) which are rate limiting for the metabolism of tryptophan to kynurenine (Kyn) via the Kynurenine Pathway (12-14, 97). Ido1, Ido2 and Tdo2 mRNA expression are induced within the brain and peripheral tissues by LPS and bacterial infection, pI:C and viral infection, and systemic and CNS administration of pro-inflammatory cytokines

(10, 12-14, 98-101). Inflammatory cytokines released during an immune challenge include IFN,

IFNα, interlukin-1 beta (IL-1ß), IL-6 and tumor necrosis factor alpha (TNF. These cytokines are necessary to activate both lymphoid and myeloid cells in the periphery and induce

P a g e | 15 neuroinflammation, but their presence is not sufficient to induce depression-like behaviors. DO induction is requisite for depressive-like behaviors as genetic knockout of Ido1 gene transcription (Ido1KO mice) inhibits inflammation-dependent depression-like behaviors (11, 14,

97). Kyn produced by the DOs is not directly responsible for behavioral changes. Kyn is further metabolized by non-rate-limiting enzymes: kynureninase (Kynu) + kynurenine 3- monooxygenase (KMO) leading to quinolinic acid (QuinA) production or by kynurenine aminotransferase (Kat2) that generates kynurenine acid (KynA) (46). QuinA and KynA directly interact with neurons to interfere with neurotransmitter activity, and they are believed to be the end products responsible for the behavioral changes that are initiated and dependent on DO expression. KynA acts on neurons to decrease glutamate and acetylcholine signaling, whereas

QuinA enhances glutamate receptor activation on neurons, suggesting that Kyn metabolites play distinct roles in the pathophysiology and etiology of a variety of neurological conditions (47, 48).

Similar to the effects of cytokines, a recent study has shown that elevated corticosteroids increase Ido1 expression in the mouse hippocampus (102). Chronic unpredictable mild stress increases both serum corticosterone and Ido1 and leads to depression-like behaviors of rats

(103). Additionally, swimming stress is well known to elevate blood corticosterone levels in mice, and when combined with systemic LPS injection, there is an induction of Ido2 expression in the mouse hippocampus (99). These data suggest that inflammatory cytokines and stress hormones can act both alone and together to induce Ido1 and Ido2 expression. Although several papers indicate elevated Tdo2 expression in the liver following corticosteroid administration

(104, 105), there are no studies investigating the regulation of Tdo2 within the brain.

Unfortunately, the DO specificity, inflammatory-mediator specificity and corticosteroid-receptor specificity or their interactions have not been defined.

P a g e | 16

Our first attempts to define the interaction between inflammation and stress for the regulation of DO within the brain were met with mixed results. Results differed when we used qPCR assays that amplified the 5' regions of the DOs versus qPCR assays that amplified 3' regions of the DOs. This discrepancy was addressed by purchasing or designing qPCR assays the specifically amplified the unique splice variants for each DO (Fig. 2). Since both inflammatory stimuli and stress hormones induce depression-like behaviors and DO upregulation, we hypothesized that inflammatory stimuli and glucocorticoids interact to regulate DO expression.

More importantly, we hypothesized that splice variants for the DO exist as a means to differentially regulate DO expression dependent on the type of stimuli presented to the brain. We found that both Dex and Cort (but not Aldo) attenuate LPS and pI:C-induced pro-inflammatory cytokine expression, a typical anti-inflammatory response. Surprisingly, instead of diminishing the effect of inflammatory stimuli on Ido expression, corticosteroids upregulated IFN-induced

Ido1 expression in a transcript dependent manner. The corticosteroids had minimal effects on

Ido2 expression, but Ido2 was induced by both LPS, pI:C and IFN, whereas Ido1 was only induced by IFN. Only one of three Tdo2 transcripts was induced by corticosteroids. These data uncover novel pathways that can be manipulated to control DO expression.

P a g e | 17

2.3 Methods

Mice

C57BL/6J founders were purchased from Jackson Laboratories. Pups were supplied from a breeding colony established and maintained in the University of Illinois’s Institute for Genomic

Biology animal facility. All animal care and use procedures were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council) and approved by the Institutional Animal Care and Use Committee.

Reagents

Hank’s balanced salt solution (HBSS, SH30030.03), heat-inactivated horse serum

(SH30074.03) and MEM (SH30024.02) were purchased from Hyclone (Logan, UT). D-glucose

(15023-021) was from Gibco (Carlsbad, CA). Gey’s balanced salt solution (GBSS, G9779), pI:C

(tested at 10 µg/ml, P0913), Dex (tested at 12.5 µM, D4902), Aldo (tested at 100 nM, A9477),

Cort (tested at 1 µM, 27840) and LPS (tested at 2 µg/ml, Escherichia coli 0127:B8, L-3129) were from Sigma (St. Louis, MO). Recombinant mouse IFN (tested at 1 µg/ml, 315-05) was from Peprotech (Minneapolis, MN). Since there are no publications describing the corticosteroid responsiveness or corticosteroid x inflammation interactions of OHSCs, we used treatment doses to assure that consistent OHSC responses to both types of stimuli were present.

Organotypic Hippocampal Slice Cultures (OHSCs)

OHSCs were prepared from 7-10 d old pups as previously described (10). Briefly, mice were decapitated and brains were removed, followed by extraction of the hippocampi from both brain hemispheres. Transverse slices (350 µm) were prepared with a McIlwain tissue chopper

(Campden Instruments Ltd, UK) then transferred onto porous (0.4 μm) transparent membrane inserts (30 mm in diameter; EMD Millipore) with one slice from each of six different mice per

P a g e | 18 insert. Inserts were placed into six-well culture plates with 1.25 ml of culture medium composed of 25 % heat-inactivated horse serum, 25 % Hank’s Balanced Salt Solution (HBSS), 50 %

Modified Eagle’s Medium (MEM), 1 x penicillin/streptomycin (Pen/Strep), 0.5 % D-glucose and

15 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES buffer pH 7.4). Plates were maintained in a humidified incubator (5 % CO2, 95 % atmospheric air) at 37 °C. Medium was changed every 2-3 days. On day 7 in culture after slices had recovered from the inflammatory response associated with slice preparation (10), OHSCs were rinsed several times and incubated for 2 h in serum-free conditions (Dulbecco's MEM, Pen/Strep, HEPES and 150 µg/ml bovine serum albumin) before a replacement of the serum-free medium and addition of treatments. Six hours following addition of treatments, supernatants and tissues were collected and stored at -80

°C for further analysis. A six hour treatment duration was chosen based on our finding that the maximal cytokine and Ido1 mRNA responses to LPS occurred after this duration (10).

Reverse transcription and Real-time RT-PCR

Total RNA from OHSCs was extracted using a commercially available kit as per the supplier’s instructions (E.Z.N.A. Total RNA Kit II, Omega Bio-Tek, Norcross, Georgia). RNA was reverse transcribed to cDNA using a High Capacity cDNA Reverse Transcription Kit

(Applied Biosystems, Grand Island, NY). The cDNA samples were analyzed for steady-state mRNA levels (i.e. gene expression) by qPCR using TaqMan universal PCR master mix and the

Prism 7900 thermocycler (Applied Biosystems, Foster City, CA). Data were analyzed using the comparative threshold cycle method (GAPDH expression used to normalize target gene expression (13). Changes in target cDNA levels were analyzed by comparing 2-ΔΔCts, where Ct is the cycle threshold.

P a g e | 19

Figure 2. Gene, transcript and qPCR assay information for murine Ido1, Ido2 and Tdo2. Top: Gene structure (to scale) is shown in the shaded areas for each of the 3 DOs with each gene having either 11 or 12 exons. Ido1 and Ido2 are contiguous on chromosome 8, separated by only 7,733 bp (red bar). Tdo2 is located on chromosome 3. Each of the 3 genes are transcribed into multiple transcripts (exon inclusion for unique transcripts are shown below the gene structure, approximate scale) which encode full-length (FL) and variant (v) forms of each protein (protein coding areas shown in yellow within each transcript). Splicing patterns were taken from two databases (Ensemble and NCBI, neither of which describe all of the variants) and two manuscripts (52, 60) all with unique naming criteria. Thus, simplified names for each transcript are used in the manuscript (shown on the left, colored text) and database/manuscript sequence names are provided in black text. Ido2-v3 (4 described in (52)) is not listed in either database; a partial sequence of this transcript has been published (thick bar area), but when the transcript was over- expressed it encodes an active enzyme (52) that lacks 12 amino acids (due to the absence of the first 36 bp of exon 5). Invariant exons that are used for all mRNA transcripts within DO are grey; exons that vary in usage or length are colored. Bottom: All qPCR assays were purchased from IDT. User-specific (custom) assays were designed using the IDT PrimerQuest® Design Tool. It is not possible to design an assay specific to Tdo2-FL as its complete sequence lies within Tdo2-v1 (however data within this manuscript indicate distinct differences in expression and regulation of Tdo2-FL and Tdo2-v1). Ido2-v3:4, Tdo2-FL/-v1/-v2 transcript names and Tdo2 exon 0a and 0b exon designations are shown in the figure to agree with published nomenclature (52). Specifics shown for each qPCR assay include location (assay location is also shown in upper panel; ), catalog numbers (if predesigned by IDT), primer/probe sequences and confirmed amplicon size.

P a g e | 20

DO transcripts and qPCR Assay Design

Much of this work was prompted by data generated while investigating the mRNA expression of DOs across mouse tissues. Results varied dependent on the qPCR assay location.

However, the average mouse gene has 3 mRNA isoforms (7 for human) (106), suggesting that a single qPCR assay may not detect the true expression level of a gene or intimacies of its tissue/cellular distribution and regulation. To determine the relevance of gene splicing to the

DOs, it is important to outline the multiple transcripts for the three DOs. The gene structures and transcripts (2 for Ido1, 4 for Ido2 and 3 for Tdo2) are illustrated as are the qPCR assays used to quantify each transcript (Fig. 2 bottom). Correct amplicon size for each qPCR assay was confirmed by gel electrophoresis. Proteins transcribed from these transcripts (~ 51 kDa Ido1-FL

(107, 108), ~ 45 kDa Ido1 (probably FL but possibly v1) (109, 110), ~ 54 kDa Ido2-FL (52,

108), < 54 kDa Ido2-v3 (52), ~ 46 kDa Tdo2-FL (60), ~ 46 kDa Tdo2-v1 (60) and ~ 44 kDa

Tdo2-v2 (60)) have been expressed and found to encode enzymatically active proteins. Ido2-v1 and Ido2-v2 transcripts are predicted to encode variant DO proteins that are distinct from the confirmed active Ido2-FL and Ido2-v3 encoded proteins (Fig. 2 top, Ensemble and NCBI databases); enzymatic activity of these predicted proteins has not been tested.

Cytokine Levels

Media collected from slice cultures were analyzed for TNF and IL-6 levels using BD

OptEIA™ ELISA kits (BD Biosciences; San Diego, CA) following the manufacturer’s instructions.

Statistics

All data are presented as mean ± SEM. Gene expression data are means of 3-4 independent OHSC preparations. Two-way analysis of variance was performed using SigmaPlot

P a g e | 21

13.0 software and a 2 x 6 arrangement of treatments. Post-hoc analysis for multiple comparisons was performed only in the presence of a significant interaction, as assessed by Holm-Šídák method. Significance was set at p < 0.05 for all comparisons.

P a g e | 22

2.4 Results

Ido1, Ido2 and Tdo2 transcript expression differ between tissues and across brain regions

Although gene expression has been published for several of the DO transcripts, a quantitative comparison of full length (FL) versus variant (v) transcripts has not been performed for the 3 DOs within the brain or across tissue types. Comparing brain regions to lung and liver, the Ido1-FL transcript is essentially absent (Ct values > 37) in mouse brain (Fig. 3 top), but it is expressed in the mouse liver and abundantly so in the lung. In contrast, Ido1-v1 expression is lowest in liver, but is expressed in both the frontal cortex and hippocampus (Ct's ~32) and is again highest in the lung. The Ido2-FL transcript is lowest in the mouse brain (Ct's ~ 32), expressed in lung, but highest in liver, essentially opposite of the expression pattern for the Ido2- v1 transcript. Unlike either Ido1 or Ido2, Tdo2 transcripts are lowest in the frontal cortex of the mouse brain (Ct's ~34), considerably higher in the hippocampus and lung, but highest in the liver. These data indicate that tissues differentially express specific transcripts for each of the

DOs. Thus quantifying DO expression within different tissue may require the use of different assays. These data also suggest that distinct mechanisms must exist to determine which transcript will be expressed. More importantly, these data indicate that a single qPCR assay does not reflect changes in DO transcript levels. This is illustrated using assays that quantify all transcript variants for each DO (-Tot). Total DO mRNA expression does not realistically reflect relative expression of any given transcript, which is most obvious for Ido2 where Ido2-v1 is highest in the frontal cortex whereas Ido2-FL and Ido2-Tot are highest in the liver.

Given these major differences across tissues and two brain regions, we analyzed additional brain regions for the same DO transcripts. As shown in bottom of Fig. 3, each region of the mouse brain has a distinct pattern of DO expression. All brain regions from naïve mice

P a g e | 23

have essentially no Ido1-FL transcript expression (frontal cortex average Ct = 38.9, see the figure for the average Ct values of each transcript in the frontal cortex). All 4 brain regions express varying levels of the other DO transcripts. The frontal cortex is not particularly abundant for any

DO transcript, however the hypothalamus and striatum are enriched for Ido1-v1 and Ido2-FL expression, whereas the hippocampus and to a much lesser extent the hypothalamus, displays enriched Tdo2-FL expression. Tdo2-v1 is similarly expressed across these 4 brain regions. Ido1-

Tot reflects Ido1-v1, because of the absence of Ido1-FL. As such, a qPCR assay for Ido1-v1 or

Ido1-Tot would not detect the essential absence of Ido1-FL across these brain regions. Ido2-Tot reflects Ido2-v1 because of the relatively high expression of the variant compared Ido2-FL. Once again, note that assaying brain regions with assays for Ido2-v1 or Ido2-Tot would not detect the difference in relative abundance of Ido2-FL. Tdo2-Tot expression reflects Tdo2-FL because of the similar expression of the variant across brain regions. Therefore, assaying brain regions with

Tdo2-FL or Tdo2-Tot assays would not detect the constant expression of Tdo2-v1 across brain regions.

The cause of the distribution differences noted above is unknown, but it is clear that results will vary dependent on the design of the qPCR assay. As a first step to understand the differential regulation of DO expression, qPCR assays designed to quantify the various DO transcripts (Fig. 2 bottom) were used to test for differences in DO regulation in the hippocampus.

Given that Ido1 and Ido2 have previously been shown to be induced by inflammatory signals, whereas Tdo2 is purportedly corticosteroid dependent, we next investigated the individual and combined actions of inflammatory mediators and corticosteroids on DO expression using

OHSCs.

P a g e | 24

Figure 3. Ido1, Ido2 and Tdo2 transcript expression differ between tissues and across brain regions. Top: Two brain regions (frontal cortex, FrCor; hippocampus, Hip), lung and liver were collected from naïve mice (n=6). Expression of two transcripts for each DO is presented to illustrate tissue and brain region specificity. The sample type with the lowest expression was set to 1.0, with other samples showing relative expression levels within transcript (i.e. across row, Ct values for FrCor are shown to illustrate relative amplification across transcripts). The tissue with the highest relative expression for each transcript is highlighted for emphasis. Total DO expression (Ido1-Tot, Ido2-Tot and Tdo2-Tot) was assessed using assays that span exons conserved across all transcripts within each gene. Bottom: Similarly, brain regions were collected to quantify differences in expression levels across additional brain regions of naïve mice (n=4). Expression within the frontal cortex was set to 1.0 for all transcripts and other regions show expression relative to the FrCor. Ct values for each transcript within the FrCor are shown to indicate relative amplification level during the qPCR reaction (Ido1-FL is essentially absent in the naïve mouse brain, samples without a calculated Ct value are assigned a value of 40 for presentation). For both data sets, mice (10-12 week old) were euthanized under CO2, then perfused with cold saline to minimize blood content within samples prior to tissue or brain region excision. Samples were then processed for qPCR analysis as described in the methods section for OHSC samples.

P a g e | 25

Dex and Cort elicit expected anti-inflammatory and negative feedback responses by OSHCs

We previously characterized the pro-inflammatory responsiveness of OHSCs by demonstrating that TNF, IL-6 and iNOS expression is induced by both LPS (10) and IFN

(111). To confirm responsiveness of our slice cultures to corticosteroids, we first tested for the widely accepted anti-inflammatory role of corticosteroids and the ability of corticosteroids to elicit a negative feedback loop. The glucocorticoid receptor (GR) agonist dexamethasone (Dex), mineralocorticoid receptor (MR) agonist aldosterone (Aldo), or corticosterone (Cort; which binds to both receptors with varying affinity; MR > GR) were tested in the presence or absence of inflammatory mediators (IFN, LPS and pI:C). There was a significant inflammatory mediator main effect on both TNF and IL-6 mRNA gene expression and protein secretion. IFN LPS and pI:C induced TNF, IL-6 and RANTES mRNA expression (Fig. 4 A, B and C, respectively, p ) as well as TNF and IL-6 protein secretion (insets). Dex significantly (p < 0.001) decreased the ability of IFN, LPS and pI:C to induce cytokine/chemokine mRNA (Fig. 4 A, B and C) and protein expression (insets). Corticosterone had essentially the same effect as Dex (not shown). Aldo did not affect cytokine or chemokine expression or secretion (not shown).

Interestingly, Dex enhanced the ability of LPS and pI:C to induce iNOS expression although Dex was ineffective when added alone (Fig. 4D), indicating that signaling through the GR can potentiate some inflammatory responses.

OHSCs express both the GR (Nr3c1) and MR (Nr3c2). As expected, GR expression was decreased by Dex (p < 0.001), a negative feedback response, but was unaffected by inflammatory mediators (Fig. 4E). Cort mimicked this effect, whereas Aldo was inactive (not shown). MR expression was unaffected by these treatments or their combinations (Fig. 4F).

These data indicate that GRs are expressed and active as would be necessary for an anti-

P a g e | 26 inflammatory effect elicited by Dex or Cort, but not Aldo. The lack of an anti-inflammatory effect of Aldo is not due to the absence of the MR expression by OHSCs, but an anti- inflammatory response was not expected by MR activation. FK506 binding protein 5 (fkbp5;

FKBP51) and 4 (fkbp4; FKBP52) are considered regulators of corticosteroid receptor activity.

FKBP51 acts as negative regulator by preventing translocation of corticosteroid receptor complexes (CR:R) to the nucleus whereas FKBP52 serves a positive regulator by binding to and translocating the CR:R complex to the nucleus to self-regulate their activity primarily via the regulation of FKBP51 expression (112). To confirm that this pathway was intact in OHSCs, we quantified FKBP51 and FKBP52 expression. Similar to other reports, we found that Dex (Fig.

4G) increased expression of FKBP51 (p < 0.001). The Dex effect was diminished in the presence of LPS and pI:C. Cort, but not Aldo (not shown) mimicked this response. Neither Dex (Fig. 4H),

Cort (not shown), Aldo (not shown), nor inflammatory mediators affected expression of

FKBP52.

Together, the data in Fig. 4 establish that the ability of corticosteroids to block or enhance specific inflammatory responses (↓ cytokines, ↓ chemokine and ↑ iNOS). Corticosteroids also diminish (GR) or enhance (FKBP51) expression of genes that are part of a negative feedback regulation of corticosteroid action. Inflammatory mediators can attenuate corticosteroid action (↓

FKBP51). This characterization is necessary to confirm that the OHSC response is similar to those reported in both animal systems and other in vitro models are intact. These confirmatory data were then used to investigate the interaction between corticosteroids and inflammatory mediators on the expression of genes within the Kynurenine Pathway.

P a g e | 27

Figure 4. Within OHSCs, Dex elicits a prototypical anti-inflammatory action and acts to down-regulate its own action. OHSCs were treated with 3 inflammatory mediators (IFN, LPS, or pI:C) ± Dex. Gene expression of cytokines (TNF and IL-6), a chemokine (Ccl5), inducible nitric oxide synthase 2 (iNOS, Nos2), glucocorticoid receptor (GR; Nr3c1), mineralocorticoid receptor (MR; Nr3c2) and FK506 binding protein 5 (fkbp5; FKBP51) and 4 (fkbp4; FKBP52) was quantified as were protein levels for TNF and IL-6 in conditioned media (inset). Expression levels are relative to control (no inflammatory mediator and no corticosteroid) samples normalized to 1.0. * p < 0.05 for the main effect of an inflammatory mediator, p < 0.05 for the main effect of Dex;  p < 0.05 post-hoc analysis for an interaction effect for Dex within inflammatory mediator.

P a g e | 28

Dex, Cort and Aldo interact with IFN to induce Ido1 expression

In control OHSCs, Ido1-FL was essentially absent (Ct values > 37), but Ido1-v1 was detectible (Ct < 34), a finding that closely mimics relative expression found in brains of naïve mice (Fig. 3) validating the use of OHSCs as a model to quantify Ido1 expression. As we have previously shown (111), IFN induced Ido1-FL expression (Fig. 5A, C, E). IFN also induced

Ido1-v1 (Fig. 5B, D, F) in OHSCs, although the fold increase was not as large as for Ido1-FL.

Alone, neither Dex (A, B), Cort (C, D), nor Aldo (E, F) changed Ido1-FL or Ido1-v1 expression.

Interestingly, there was a significant interaction of Dex with inflammatory mediators on Ido1-FL

(F(3,22) = 8.1, MSE = 6,120, p < 0.001)and Ido1-v1 expression (F(3,22) = 15.0, MSE = 130.0, p <

0.001). By post-hoc analysis, Dex significantly accentuated the ability of IFN to induce expression of Ido1-FL p  and Ido1-v1 p . Although Cort and Aldo mimicked this Dex by IFN interaction, neither reached significance for Ido1-FL. However, there were significant interactions between Cort p  and Aldo p  with IFN on Ido1-v1 expression. Both steroids significantly accentuated the ability of IFN to induce expression of

Ido1-v1. LPS and pI:C did not induce Ido1-FL or Ido1-v1 expression, nor did they interact with

Cort, Dex, or Aldo. Collectively, these data suggest a unique regulatory pattern for Ido1 expression. Unlike cytokines whose expression is diminished by Dex and Cort, Ido1-FL transcript expression is accentuated by corticosteroids via GR activation, i.e. by Dex and Cort.

Unlike iNOS whose expression is increased only by Dex via the GR, Ido1-v1 expression is increased by Dex, Cort and Aldo, suggesting mediation by the GR, GR/MR and MR, respectively.

P a g e | 29

Figure 5. Two distinct Ido1 transcripts are expressed by hippocampal slice cultures, with IFN being a strong inducer of Ido1 expression and synergistic with corticosteroids. OHSCs were treated with IFN, LPS and pI:C ± Dex, Cort or Aldo. Expression levels of two Ido1 transcripts are relative to control samples normalized to 1.0. * p < 0.05 for the main effect of an inflammatory mediator,  p < 0.05 for the main effect of either Dex, Cort or Aldo;  p < 0.05 post-hoc analysis for an interaction effect for Dex, Cort or Aldo within inflammatory mediator.

Inflammatory mediators and Aldo induce Ido2 transcripts

Ido2-FL was essentially absent (Ct values > 37) in OHSCs and was not inducible by inflammatory mediators, corticosteroids, or their combination (not shown). In contrast, Ido2-v1

(Ct ~ 32), Ido2-v2 (Ct ~ 33) and Ido2-v3 (Ct ~ 33) were all detectable in OHSCs. The lower Ct of

Ido2-v1 compared to Ido2-FL of OHSCs agrees with the relative Ct levels in the hippocampus of naïve mice (Fig. 3) validating the use of OHSCs as a model to quantify Ido2 expression. Ido2-v1

(Fig. 6A, D, G), Ido2-v2 (Fig. 6B, E, G) and Ido2-v3 (Fig. 6C, G, I) expression was induced by

IFN (p < 0.001), with the fold induction of Ido2-v1 (~ 12 fold) and Ido2-v3 (~ 10 fold) being

P a g e | 30 greater than that for Ido2-v2 (~ 3 fold). In contrast to Ido1 expression, LPS and pI:C induce

Ido2-v1 (p < 0.001) and Ido2-v3 (p < 0.001) expression, but like Ido1 they do not increase Ido2- v2 expression. Interestingly, Dex did not significantly change Ido2 expression, although there was a significant interaction between Cort and inflammatory mediators for Ido2-v3 expression

(F(3,23) = 5.6, MSE = 24.4, p < 0.01). By post-hoc analysis, Cort significantly accentuated the induction of Ido2-v3 in the presence of IFN p . Cort did not alter LPS nor pI:C action.

There was neither a Cort (A, B, C) nor Dex (D, E, F) main effect nor a significant interaction between either Cort or Dex and inflammatory mediators for Ido2-v1 and Ido2-v2. However, there was a small but significant main stimulatory effect of Aldo on Ido2-v1 expression (Fig. 6G)

(p < 0.05). Thus, although there was not a significant interaction between Aldo and inflammatory mediators, MR activation may enhance Ido2-v1 expression. These data suggest that the regulation of Ido2 expression is distinct from Ido1. Ido2 does not appear to be responsive to GR activation, although MR activation has a mild stimulatory effect that is highly dependent upon the transcript being assessed. Importantly, the 3 Ido2 transcripts detected in OHSCs are differentially regulated by IFN, LPS and pI:C. This later finding illustrates again that qPCR assay design will affect the response elicited in a treatment-dependent manner.

P a g e | 31

Figure 6. Three distinct Ido2 transcripts are expressed by hippocampal slice cultures, with IFN, LPS, pI:C and Aldo inducing expression of specific Ido2 transcripts. OHSCs were treated with IFN, LPS and pI:C ± Dex, Cort or Aldo. Expression of Ido2 transcripts are relative to control samples normalized to 1.0. * p < 0.05 for the main effect of an inflammatory mediator,  p < 0.05 for the main effect of Dex, Cort or Aldo;  p < 0.05 post-hoc analysis for an interaction effect for Dex, Cort or Aldo within inflammatory mediator.

Dex and Cort induce Tdo2-FL expression

A few studies have suggested that glucocorticoids regulate Tdo2 expression by peripheral tissues (104, 105), however, corticosteroid regulation of specific Tdo2 transcripts has not been reported. Here we show that all three Tdo2 transcripts are expressed by OHSCs with varied amplification results; average Ct's were ~29, ~25 and ~25 for Tdo2-FL/v1, Tdo2-v1 and Tdo2- v2, respectively. Thus, Tdo2-v1 has a lower Ct value than Tdo2-FL/v1 in both OHSCs and in the hippocampus of naïve mice (Fig. 3), again validating the use of OHSCs as a model to quantify

DO expression. Addition of IFN, LPS and pI:C did not alter the expression of any Tdo2 transcripts (Fig. 7A-F), but both Dex (Fig. 7A; p < 0.001) and Cort (Fig. 7D; p < 0.05) induced

Tdo2-FL/v1 expression. As Tdo2-FL/v1 expression is shown to be highest in the hippocampus

(Fig. 3), a brain region with a high density of both GRs and MRs (113, 114), it is not surprising that both Dex and Cort induce Tdo2-FL. Aldo did not alter Tdo2-FL expression (not shown),

P a g e | 32 indicating that the stimulatory effects of Cort and Dex are mediated by the GR. Surprisingly,

Tdo2-v1 and Tdo2-v2 expression were not regulated by corticosteroids. Since the assay for

Tdo2-FL also amplifies Tdo2-v1, the latter having a lower Ct and thus possible greater expression level, the true inductive power of Cort and Dex on Tdo2-FL expression is diluted by the concurrent detection of the non-inducible Tdo2-v1 transcript. This finding confirms that the

Tdo2-FL sequence is not just a truncated/incomplete version of Tdo2-v1, but that Tdo2-FL is a unique transcript under distinct regulatory control compared to its two counterparts. These results also indicate that quantifying corticosteroid induction of Tdo2 is only feasible when assessing expression of the Tdo2-FL transcript.

Figure 7. Three distinct Tdo2 transcripts are expressed by hippocampal slice cultures with Cort and Dex inducing only Tdo2-FL. OHSCs were treated with IFN, LPS and pI:C ± Dex or Cort. Expression levels of Tdo2 are relative to control samples normalized to 1.0. p < 0.05 for the main effect of either Dex or Cort.

Changes in the genetic expression of enzymes downstream of DOs along the Kynurenine

Pathway

There are several enzymes involved in the metabolism of tryptophan along the

Kynurenine Pathway. Although the DOs are rate limiting for entry of tryptophan into the pathway, downstream enzymes are necessary for the conversion of Kyn to either QuinA or

KynA. Kat2, Kynu, KMO and Haao are involved in the conversion of Kyn neuroactive metabolites (Fig. 8 picture insert). By analyzing the expression pattern of three of these enzymes,

P a g e | 33 we further emphasize the unique transcriptional regulation of the DOs. None of the downstream enzymes were inducible by Dex, Cort or Aldo and none showed the positive interaction between inflammatory mediators and GR or MR activation. There was an inflammatory main effect on

KMO and Kynu expression in which both LPS and pI:C significantly induced the expression of

KMO (Fig. 8A) (p 0.01) while IFN and LPS significantly increased Kynu (Fig. 8B) (p <

0.05). Dex decreased expression of KMO (p < 0.05) and Kynu (p < 0.001). Haao expression was not changed by any of the treatments nor their combination (Fig. 8C). In contrast, LPS and pI:C significantly decreased Kat2 expression (p < 0.001), without an effect of Dex (Fig. 8D). The actions of Dex on Kynu and KMO expression were mimicked by Cort, but not Aldo (not shown).

These findings support the hypothesis that corticosteroids regulate expression of KMO and Kynu enzymes via the GR. Overall, the stimulatory effect of inflammatory mediators on Kynu and

KMO expression in parallel with a decrease in Kat2 expression should shift Kyn metabolism towards QuinA production (Fig. 8 insert). This effect would be somewhat tempered by the inhibitory effect of Dex on Kynu and KMO expression. More importantly, the non-rate limiting enzymes are not susceptible to the positive interaction between IFN and corticosteroids to induce Ido1 or the induction by Aldo or Dex seen with Ido2 and Tdo2, respectively.

P a g e | 34

Figure 8. Regulation of mRNA expression of enzymes downstream of the DOs in the Kynurenine Pathway in hippocampal slice culture. OHSCs were treated with IFN, LPS and pI:C ± Dex. Kynu, KMO, Haao and Kat2 expression was quantified relative to control samples normalized to 1.0. * p < 0.05 for the main effect of an inflammatory mediator,  p < 0.05 for the main effect of Dex.

P a g e | 35

2.5 Discussion

Induction of the Kynurenine Pathway by inflammatory stimuli or stress has been associated with development of depression-like behaviors (10, 12-14, 97, 100). An understanding of the regulation of enzymes within this pathway will aid in discovering the mechanism for the etiology of inflammation-induced depression. This is the first study to 1) design assays for specific mRNA transcript variants of Ido1, Ido2 and Tdo2, 2) describe tissue specificity for each variant and 3) uncover a novel interaction between inflammatory mediators and stress hormones to induce specific Ido1, Ido2 and Tdo2 mRNA transcript variants. OHSCs were used to model how the hippocampus responds to corticosteroids and inflammatory stimuli.

We validated the OHSC model by showing that GR, but not MR, activation elicits an anti- inflammatory response while initiating a negative feedback loop (↓ GR, ↑ FKBP51). Thus,

OHSCs maintain corticosteroid responses that occur in the intact murine brain. Unexpectedly,

LPS and pI:C induced iNOS expression was accentuated by Dex. Microglial iNOS expression is induced by LPS but attenuated by Dex (115, 116). However, after 6 h (as in the current study),

Dex did not attenuate the LPS-induced iNOS promoter activity in astrocytes (117). Thus not all cells respond with a diminution of iNOS expression. The cell type, or cell-cell interaction within

OHSCs, that mediates Dex-enhanced iNOS expression is unknown at this time.

In contrast to the expected anti-inflammatory response, Dex, Cort and Aldo amplified the ability of IFN to increase Ido1 expression, establishing that both GR and MR activation are involved in the induction of Ido1. Whether corticosteroids synergize with IFN to induce Ido1-

FL or Ido1-v1 expression by a specific cell type(s) is unknown. Additionally, we found that

OHSC's express 3 Ido2 transcripts. IFN induced expression of all 3 transcripts whereas LPS and pI:C increased expression of only 2 transcripts. Aldo and Cort, but not Dex, upregulated

P a g e | 36 expression of specific Ido2 transcripts although these responses were muted compared to that of

Ido1. Aldo moderately induced expression of Ido2-v1 independent of inflammation, while Cort interacted with IFN to accentuate expression of Ido2-v3. These findings suggest a small but significant MR-mediated regulation of Ido2. Finally, OHSC's express 3 Tdo2 transcripts; Cort and Dex (not Aldo) increase expression of only one Tdo2 transcript, indicating a GR-mediated stimulatory response. These important data are essential in further understanding the regulation of the Kynurenine Pathway in the brain and detailing the importance of investigating post- transcriptional regulation of the DO genes.

Ido1 expression is induced by IFN in human and mouse microglia, macrophages, astrocytes (118-122), neurons (123), brain endothelial cells (124) and mouse OHSCs ((53); Fig.

5). However, although extremely critical to our understanding of DO regulation, none of these manuscripts provide enough information to determine basal expression or to identify variations in transcript(s) responsiveness to IFN. In the current work and as suggested in the literature,

Ido1-FL mRNA expression is extremely low to undetectable in the naïve mouse brain (Fig. 3)

(61, 125), including the hippocampus (126). Although there is essentially no Ido1-FL mRNA in the naïve mouse brain, there is Ido1 enzymatic activity (127-129). Enzymatic activity attributed to Ido1 in the naïve must derive from the protein product of Ido1-v1. Similarly, we have shown that control OHSCs have Ido1 enzymatic activity (10); OHSCs express Ido1-v1 but not Ido1-FL

(Fig. 4). As such, basal Ido1 activity within OHSCs (like naïve mouse brain) must be mediated by the Ido1-v1-encoded protein. Confirmation of this conclusion awaits overexpression of this variant and assessment of its activity. Austin (107) over-expressed a ~ 51 kDa Ido1-FL protein, whereas Ball (108) and Pallotta (109) over-expressed ~ 45 kDa proteins. Whether the enzymatic

P a g e | 37 activity of the smaller proteins was due to Ido1-FL- or Ido1-v1-derived product or whether the two products have similar specific activities was unclear.

We find Ido1-v1 in all brain regions examined (Fig. 3) with particular enrichment in the striatum and hypothalamus. The relevance of this finding relative to animal behavior, especially relative to inflammation- and stress-induced depression-like behavior and innate immune responses in the CNS, warrants further investigation. To determine the human relevance of DO transcript regulation, we have generated assays to measure human Ido1, Ido2, and Tdo2 variant transcripts. We detected multiple Ido1, Ido2 and Tdo2 transcripts (unpublished data) in human cells. Several Ido1 and Ido2 transcripts were IFN inducible and further induced by corticosteroids. This work suggests that the complex regulation of DO transcripts that we have identified in the mouse hippocampus is also present in human cells. Relevance of these finding to psychiatric diseases warrants further investigation.

Glucocorticoid response elements (GRE) modulate GR and MR binding to promotors to directly affect gene transcription. Using Motif Map, we found no evidence for a GRE within the mouse Ido1 or Ido2 genes. This finding suggests that corticosteroid:receptor complexes (C:GR or C:MR) are not binding directly to the Ido1 or Ido2 promotor, but are more likely to interact with the IFN signaling cascade to accentuate Ido1 and Ido2 expression. IFN activates the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway, and C:GR's can enhance JAK/STAT signaling to increase gene transcription independent of GREs (130-134).

These published mechanisms suggest that GR activation (by Dex or Cort) enhance Ido1-FL,

Ido1-v1, Ido2-v3 and iNOS expression via JAK/STAT. To date, the C:MR complex has not been shown to directly modulate the JAK/STAT pathway although we did find that Aldo interacts with IFN to induce Ido1-v1 expression. The mechanism by which Aldo and IFN interact to

P a g e | 38 induce Ido1-v1 or Aldo acts independently to induce Ido2-v1 expression is unclear at this time.

Independent of the mechanism, our findings are important because they illustrate a multifaceted interaction between corticosteroids and IFN to upregulate genes along the Kynurenine Pathway, particularly the rate-limiting enzymes Ido1 and Ido2.

Ido2-FL mRNA has been reported as low to undetectable in the naïve mouse brain (61,

108). However, in a separate study using a probe that detects all Ido2 transcripts, Ido2 mRNA was detected in neurons of the cerebral cortex and cerebellum (125). Using qPCR, we find Ido2-

FL primarily in the mouse striatum and hypothalamus, whereas Ido2-v1 is expressed uniformly across at least 4 brain regions (Fig. 3). Only variant Ido2 transcripts were detectable in OHSCs.

Unlike Ido1, Ido2 transcripts are induced by LPS and pI:C, in addition to IFN Also, Ido2-v1 expression is increased by Aldo alone. However, similar to Ido1, Ido2-v2 was induced only by

IFN Thus, it is clear that Ido2 is regulated in a transcript-specific manner by both inflammatory mediators and corticosteroids.

Proteins encoded by Ido2-FL and Ido2-v3 are enzymatically active although the Ido2-FL product has higher activity/unit protein than the variant protein encoded by Ido2-v3 (52). This result suggests that differential expression of Ido2 transcripts will have profound effects on net enzymatic activity. Thus, it is critical to evaluate expression of all transcripts and ultimately the enzymatic activity of each protein variant. Clearly an assay such as the one that quantifies all three Ido2 transcripts (Ido2-Tot) does not accurately reflect changes in expression of any given variant (Fig. 3), nor would it be expected to parallel enzymatic activity.

The presence of a significant LPS and pI:C effect on Ido2 expression may relate to an undiscovered role for Ido2 during bacterial and viral infections within the brain. The induction of

Ido1 and Ido2 transcripts by IFN within OHSCs mimics the cytokine-mediated response of the

P a g e | 39 brain to a peripheral infection. This induction is critical to development of depression-like behaviors (11, 14). However, based upon data in this report, it is quite possible that specific Ido2 transcripts will be induced by bacterial (e.g. LPS) or viral (e.g. pI:C) infection within the brain. To date there are no studies describing behavioral responses associated with the induction of Ido2, due to lack of Ido2-specific inhibitors and only the recent development of Ido2KO mice (52). Thus, the role of Ido2 in inflammation-dependent psychiatric diseases is unknown.

Tdo2 mRNA is present throughout the rodent brain (60, 135). Similar to the study by

Kanai (60), our results suggest that there are unique and unappreciated roles for the various Tdo2 transcripts within the brain. Tdo2-FL and Tdo2-v1 encode the same mature protein, while Tdo2- v2 encodes an N-terminal truncated 'variant' protein. Both Tdo2 protein isoforms have similar enzymatic activity (60). Since any qPCR assay designed to quantify Tdo2-FL also assays Tdo2- v1, it is impossible to independently assess Tdo2-FL expression. However, Tdo2-FL is not a simple incomplete sequence of Tdo2-v1 but is rather a unique transcript that is controlled by specific regulatory mechanisms. As supported by our OHSCs data: expression of only Tdo2-FL is induced by Dex and Cort. This inductive response is probably a direct effect of Dex and Cort on GR activation as a GRE motif has been predicted within the Tdo2 gene (136, 137).

There is a significant amount of research suggesting that elevated Ido1 and Ido2 is associated depression-like behavior (11, 14) and elevated Tdo2 expression is linked to

Schizophrenia (138, 139). With very minimal information on the activity of the proteins translated from variant DO transcripts, the results presented in this manuscript are only the first step of many necessary to define their role in depression or other psychiatric diseases. Although it is generally believed that DO enzymatic activity within the brain of naïve and experimental mice (127-129) results from the protein product of Ido1-FL, our data suggest that the expression

P a g e | 40 of other DO variants may be responsible for Kyn production within the brain. Ascertaining the enzymatic activity of each transcript product is outside the scope of this study, but such knowledge would greatly add to the understanding of the functional relevance of the DOs and their relevance to psychiatric diseases.

In conclusion, our data support a role of the Kynurenine Pathway in major depression

(140) and suggest that inflammatory and corticosteroid pathways converge to induce DO expression. This convergence has not been previously tested. Our data show that Ido1, Ido2 and

Tdo2 are differentially regulated (summarized in Fig. 8E). Ido1 induction by IFNis enhanced by GR and MR activation, suggesting that stress hormones interact with IFN to enhance kynurenine synthesis within the hippocampus. In contrast, Ido2 transcripts are activated by IFN,

LPS and pI:C. Thus Ido2 expression is responsive to peripheral immune-cell-derived IFN

(resident cells in the brain do not produce IFN) and bacterial or viral infections (via LPS or dsRNA), but relatively unaffected by stress hormones. Finally, Tdo2 transcripts are either unchanged (v1 and v2) or induced by GR activation (Tdo2-FL) indicating a unique stress responsiveness. Associating physiological and behavioral consequences to the differential regulation of DO transcripts is beyond the scope of this manuscript. However, these data show that rate-limiting enzymes for tryptophan metabolism along the Kynurenine Pathway can be differentially regulated to allow the brain to specifically respond to various challenges.

Quantifying the expression of a single DO or a single DO transcript will not accurately reflect the true expression of the tryptophan-degrading enzymes. Thus, it is imperative to evaluate the expression of each transcript for both animal and in vitro studies. The current study validated assays that are needed to achieve this goal. It is also the first work to describe Ido1, Ido2 and

Tdo2 variant transcripts within the brain.

P a g e | 41

CHAPTER 3: Immunomodulatory factors galectin-9 and interferon-gamma synergize to induce

expression of rate-limiting enzymes of the Kynurenine Pathway in the mouse hippocampus2

3.1 Abstract

Elevated levels of circulating pro-inflammatory cytokines are associated with symptomology of several psychiatric disorders, notably major depressive disorder.

Symptomology has been linked to inflammation/cytokine-dependent induction of the Kynurenine

Pathway. Galectins, like pro-inflammatory cytokines, play a role in neuroinflammation and the pathogenesis of several neurological disorders, but without a clearly defined mechanism of action. Their involvement in the Kynurenine Pathway has not been investigated. Thus, we searched for a link between galectins and the Kynurenine Pathway using in vivo and ex vivo models. Mice were administered LPS and pI:C to determine if galectins (Gal's) were upregulated in the brain following in vivo inflammatory challenges. We then used organotypic hippocampal slice cultures (OHSCs) to determine if Gal's, alone or with inflammatory mediators (interferon- gamma (IFN), tumor necrosis factor-alpha (TNF), interleukin-1beta (IL-1), polyinosine- polycytidylic acid (pI:C) and dexamethasone (Dex; synthetic glucocorticoid)), would increase expression of indoleamine/tryptophan-2,3-dioxygenases (DOs: Ido1, Ido2 and Tdo2; Kynurenine

Pathway rate-limiting enzymes). In vivo, hippocampal expression of cytokines (IL-1β,

TNFand IFN), Gal-3 and Gal-9 along with Ido1 and Ido2 were increased by LPS and pI:C

(bacterial and viral mimetics). Of the cytokines induced in vivo, only IFN increased expression of two Ido1 transcripts (Ido1-FL and Ido1-v1) by OHSCs. Although ineffective alone, Gal-9

2 Adapted from the published version in the Frontiers in Immunology, Molecular Innate Immunity (renumbered figures and formatting): Brooks AK, Lawson MA, Rytych JL, Yu KC, Janda TM, Steelman AJ, McCusker RH. Immunomodulatory factors galectin-9 and interferon-gamma synergize to induce expression of rate-limiting enzymes of the Kynurenine Pathway in the mouse hippocampus. Frontiers in Immunology. 2016 Oct 17; 7: 422.

P a g e | 42 accentuated IFN-induced expression of only Ido1-FL. Similarly, IFNinduced expression of several Ido2 transcripts (Ido2-v1, Ido2-v3, Ido2-v4, Ido2-v5 and Ido2-v6). Gal-9 accentuated

IFN-induced expression of only Ido2-v1. Surprisingly, Gal-9 alone, slightly but significantly, induced expression of Tdo2 (Tdo2-v1 and Tdo2-v2, but not Tdo2-FL). These effects were specific to Gal-9 as Gal-1 and Gal-3 did not alter DO expression. These results are the first to show that brain Gal-9 is increased during LPS- and pI:C-induced neuroinflammation. Increased expression of Gal-9 may be critical for neuroinflammation-dependent induction of DO expression, either acting alone (Tdo2-v1 and Tdo2-v2) or to enhance IFN activity (Ido1-FL and

Ido2-v1). Although these novel actions of Gal-9 are described for hippocampus, they have the potential to operate as DO-dependent immunomodulatory processes outside the brain. With the expanding implications of Kynurenine Pathway activation across multiple immune and psychiatric disorders, this synergy provides a new target for therapeutic development.

P a g e | 43

3.2 Introduction

There is a widely accepted association between activation of the immune system and major depression, with a multitude of studies showing that elevated levels of pro-inflammatory cytokines are found within the circulation of patients with MDD (141). Furthermore, up to 45% of patients receiving immunotherapy (IFN) for hepatitis C or cancer have a greater severity of symptoms of MDD (7, 84). Extensive work using rodent models has detailed the induction of depression-like behaviors, anhedonia (decreased sucrose preference) and helplessness/despair

(increased immobility during forced-swim and tail-suspension tests) after administration of LPS, pI:C or infection with Mycobacterium bovis (9, 58, 142, 143). These immune activators induce neuroinflammation; however the mechanism(s) linking inflammation and depression is widely debated. One probable causal factor is altered tryptophan metabolism.

Elevated tryptophan metabolism to kynurenine (Kyn) via rate-limiting DOs, is correlated to the development of depression-like behaviors in rodent models (14) and severity of depression behaviors in patients with MDD (7). Expression of all three DO enzymes (Ido1, Ido2 and Tdo2) is increased following activation of the immune system. Their expression is increased by LPS

(mimicking a bacterial infection), pI:C (mimicking a viral infection) and administration of pro- inflammatory cytokines (10, 12-14, 98-101). In contrast, in the absence of Ido1 (knockout mice), inflammation-dependent depression-like behaviors are attenuated (11, 14, 97). Inflammation- induced behavioral changes are largely attributed to increased Trp metabolism to Kyn followed by non-rate limiting Kyn conversion to downstream neuroactive metabolites quinolinic acid

(QuinA) and kynurenic acid (KynA) (9). QuinA and KynA bind to the N-methyl-D-aspartate and

7nAChR receptors to either enhance or decrease neurotransmitter signaling, respectively. An imbalance of these two metabolites is linked to several neurological diseases (36, 144, 145).

P a g e | 44

Galectins are β-galactoside-binding proteins. Although their mechanism of action is still unclear, Gal-1, Gal-3 and Gal-9 are believed to play significant roles in neuropathology and neuroinflammation (67). Gal-1 is typically classified as anti-inflammatory and neuroprotective: suppressing IFN-induced responses of microglia (146), glutamate neurotoxicity (147) and neurodegeneration (146). Gal-1 knockout mice are more susceptible to developing experimental autoimmune encephalomyelitis, a mouse model used to mimic MS symptomology. Gal-3 and

Gal-9 both have context-specific immunomodulatory capabilities (66, 148-151). As examples,

Gal-3 increases secretion of pro-inflammatory cytokines (150) from microglia and astrocytes, while Gal-9 is a potent chemoattractant (152) and up-regulates IFN production (153, 154).

A galectin - DO connection has not been directly linked to neuropsychiatric disorders, but there are several incidences of increased expression of both Gal-9 and Ido1. Increased expression of both Ido1 and Gal-9 are associated with MS (70, 71, 78), Grave’s disease, Hashimoto’s disease (155, 156) and rheumatoid arthritis (157, 158). Although the pathophysiology of these disorders is still unclear, a synergy between Ido1 and Gal-9 may be a crucial uncharacterized mechanism involved in the initiation and/or severity of immune disorders.

Data suggest that Gal-1, Gal-3 and Gal-9 modulate neuroinflammation, however there is no evidence directly connecting galectins to the Kynurenine Pathway. Thus, we determined whether galectins were increased in the mouse brain following peripheral administration of LPS or pI:C. We found that both Gal-3 and Gal-9 (plus DOs) were increased in the mouse hippocampus during neuroinflammation. We then decided to investigate whether the elevation in

Gal-3 and Gal-9 were involved in the concurrent increase in expression of the rate-limiting enzymes metabolizing tryptophan to kynurenine (the DOs: Ido1, Ido2 and Tdo2) using organotypic hippocampal slice cultures. As we have previously shown (1), IFN induced Ido1

P a g e | 45 and Ido2 expression by OHSCs. Interestingly, Gal-9 was able to directly increase Tdo2 expression and increased both Ido1 and Ido2 expression in the presence of IFN. These are the first findings to link immunomodulatory galectin activity to the Kynurenine Pathway, potentially providing a new target for neuroinflammatory therapies. The ability to induce expression of the rate-limiting enzymes of the Kynurenine Pathway also defines a mechanism by which Gal-9 can mediate symptoms associated with several psychiatric conditions.

P a g e | 46

3.3 Methods

Mice: C57BL/6J mice were maintained in the University of Illinois’s Institute for

Genomic Biology animal facility. Procedures and animal care were in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council) and approved by the

Institutional Animal Care and Use Committee. Young adult mice, used for neuroinflammation

(intraperitoneal, i.p. LPS or pI:C) experiments, were 12 week old males at time of treatment.

Saline (control), LPS or pI:C treatments were administered prior to the start of the dark cycle.

LPS (serotype 0127:B8, Sigma, St. Louis, MO) was administered at 330 μg/kg body weight; this dose has been shown to elicit neuroinflammation, elevated Ido1, Ido2 and Tdo2 expression and depression-like behaviors (159). pI:C (P0913, Sigma, St. Louis, MO) was administered at 12 mg/kg body weight. Previous work has shown that pI:C also causes cytokine and Ido1 response in the hippocampus and depression-like behaviors (58). Mice were sacrificed 6 h post-treatment.

Cell culture reagents: Heat-inactivated horse serum (SH30074.03), Hank’s balanced salt solution (HBSS, SH30030.03), Eagle's minimal essential medium (MEM, SH30024.02) were purchased from Hyclone (Logan, UT). D-glucose (15023-021) was purchased from Gibco

(Carlsbad, CA). Dex (tested at 1 µM, D4902), pI:C (tested at 10 µg/ml, P0913) and Gey’s balanced salt solution (GBSS, G9779) were from Sigma (St. Louis, MO). Recombinant mouse

IFN (tested at 10 ng/ml, 315-05) was from Peprotech (Minneapolis, MN). Gal-1 (1245), Gal-3

(1197) and Gal-9 (3535), all tested at 1 µg/ml and TNF (tested at 10 ng/ml, 410-MT) were purchased from R&D Systems (Minneapolis, MN). IL-1 (tested at 10 ng/ml, IL014) was purchased from Chemicon International (Temecula, CA).

Organotypic Hippocampal Slice Cultures (OHSCs): OHSCs were prepared from hippocampi of C57BL/6J pups, 7-10 days old, as previously described (1). Briefly, hippocampi

P a g e | 47 were cut into 350 µm transverse slices with a McIlwain tissue chopper (Campden Instruments

Ltd, UK) and positioned onto membrane inserts (PICM03050, EMD Millipore) with six slices per insert, each slice from a different animal. Inserts were placed into six-well culture plates with

1.25 ml of medium (50 % MEM, 25 % horse serum, 1 x penicillin/streptomycin (Pen/Strep), 15 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES buffer, pH 7.4), 25 % Hank’s

Balanced Salt Solution (HBSS) and 0.5 % D-glucose). Every 2-3 days, medium was changed. On the seventh day, OHSCs were rinsed three times with serum-free medium (Dulbecco's MEM,

Pen/Strep, HEPES and 150 µg/ml bovine serum albumin) and incubated for 2 hours. Slices were rinsed again with serum-free medium and treatments added to fresh serum-free medium. OHSCs were treated with IFN, TNF, IL-1, pI:C or Dex, with or without Gal-9. To determine if effects were specific to Gal-9, independent OHSC preparations were treated with IFN and pI:C with or without Gal-1 and Gal-3. Six hours later, tissues and supernatants were collected and kept at -80 °C for subsequent analysis.

Reverse transcription and real-time RT-PCR: RNA was extracted using the E.Z.N.A.

Total RNA Kit II (Omega Bio-Tek, Norcross, GA) and cDNA was prepared with the High

Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Grand Island, NY). The cDNA was amplified to quantify steady state gene expression by qPCR using TaqMan Universal PCR

Master Mix and Prism 7900 thermocycler (Applied Biosystems, Foster City, CA). Using the comparative threshold cycle method (GAPDH used to normalize target gene expression), differences in cDNA levels were determined by comparing 2-ΔΔCts, Ct = cycle threshold (1).

DO transcripts and qPCR assay design: Our previous publication describes validated qPCR assays to quantify the expression of distinct DO transcripts in mouse tissues and OHSCs.

Assays for Ido1 (Ido1-FL, Ido1-v1), Ido2 (Ido2-FL, Ido2-v1, Ido2-v6, Ido2-v3) and Tdo2 (Tdo2-

P a g e | 48

FL, Tdo2-v1, Tdo2-v2) were described (1). Gene structure for Ido1, Ido2 and Tdo2 is shown in

Figure 9. Structures for the previously described transcripts are shown as well as the exon- structure of additional Ido1 (Ido1-v2) and Ido2 variants (Ido2-v2; Ido2-v4 and Ido2-v5) that were quantified for the first time for this manuscript. Assay specifics for DO transcript analyses are shown in Table 1. Probe-based assays were purchased from IDT with custom assays fashioned using the IDT PrimerQuest® Design Tool. Correct amplicon size was confirmed by gel electrophoresis. Several transcripts (notably Ido1-FL) are not detectable in all naïve mouse brain or control OHSC samples (Ct values ‘undetermined’) thus negating the ability to properly calculate relative gene expression: for mathematical analysis a Ct value of 40.0 was assigned when this occurred.

P a g e | 49

-

ng ng

, post

)

rated rated for

1

(

ailed ailed previously

).

atterns, atterns, with simplified names used in

length length (FL) and variant (v) transcripts encodi

-

oss oss transcripts are shown in grey, while exons that vary by transcript are

Structures of the three DO genes are shown to scale with spicing patterns illust

Figure 9. Murine Ido1, Ido2 and Tdo2 gene structure and transcripts. each gene. Ido1 and Ido2 are separated by translational 7,733 modification bp of (red precursor line) mRNA on results chromosome in 8, variable size several proteins (yellow regions within each transcript). while Ensemble and NCBI databases were alternative used to determine splicing p Tdo2 spliced is variants situated for on each chromosome DO: 3. the manuscript full shown As to the left of database det names. Within each gene, exons conserved acr ( shown are assay each span Exon for 1. Table in described are each transcript of expression the to quantify colored. Assays

P a g e | 50

Table 1. Assay specifics for analysis of murine Ido1, Ido2 and Tdo2 steady-state gene expression. Transcript Exon Span Assay ID or Custom Name Primer/Probe Sequence Amplicon (bp) Ido1-FL 1-3-4 Mm.PT.42.8645095 Forward TTTGCTCTACCACATCCACTG 117 Probe 6-FAMCAGATTTCTZenAGCCACAAGGACCCAGGIABkFQ Reverse GCAGCTTTTCAACTTCTTCTCG

Ido1-v1 2-3 Ido1-v ex 2-3 Forward GACCCCGGACGGTAAAATTAT 138 Probe 6-FAMTCGGGCAGCZenTCCACATTACAATTCAIABkFQ Reverse TCTCAATCAGCACAGGCAG

Ido1-v2 2b-3-4-5 Ido1-X2-mouse Set 1 Forward CGGACGGTGGAGCTG 256 Probe 6-FAMATTGAGAACZenGGGCAGCTTCGAGAAIABkFQ Reverse CGCAGTAGGGAACAGCAATA Ido2-FL 1-2-4 Mm.PT.42.8856312 Forward GGAGATACCACATTTCTGAGGA 114 Probe 6-FAMCCAGAGGATZenTTGGAAGGAGAAAGCCATIABkFQ Reverse CGATTAAGTGAGGAAGTCTGAGG

Ido2-v1 3-4 Ido2-v ex 3-4 Forward GGACTTTACATCCCTAACCTCAC 131 Probe 6-FAMCCTCAGCTTZenCTCGAACCCTGTAACTGTAIABkFQ Reverse CTGCTCACGGTAACTCTTTAGG

Ido2-v2 3'-4 Ido2-X4 Set 4 Forward AAGCCTGCGGAGCAAAG 88 Ido2-X2-mouse Set 1 Probe 6-FAMTGAAGAGATZenGAGCAATGAGCCGGTIABkFQ Ido2-v2-ex3-4 set2 Reverse GAGGCATCTGTCCTGCCT

Ido2-v3 4-5'-6-7 Ido2-v4-Mz Set1 Forward CCCCAAAAGGTATCCAGGAACT 107 Probe 6-FAMCTGACCTGGZenTGCTGACAAACTGGAIABkFQ Reverse ACTGATTTCCAACGGTCCTTCT

Ido2-v4 1-4-5 Ido2-X1b-mouse Set 2 Forward CCAAATCCTCTGATGCCTCTC 148 Probe 6-FAMTAAAGAGTTZenACCGTGAGCAGCGCCIABkFQ Reverse AAAGGTGCTGCCAAGATCTC

Ido2-v5/v2 3'-5 Ido2-X2-mouse Set 1 Forward AAGCCTGCGGAGCAAAG 244/253 Probe 6-FAMTGAAGAGATZenGAGCAATGAGCCGGTIABkFQ Reverse CCAAGTTCCTGGATACCTCAAC

Ido2-v6/v2 3'-4 Ido2-v2-ex3-4 set2 Forward GAGCTGAAGAGATGAGCAATGA 85/85 Probe 6-FAMAGGACAGATZenGCCTCTCCTGGACTIABkFQ Reverse ACGGTAACTCTTTAGGAATCTGC Tdo2-FL/v1 1-2 Mm.PT.42.9084201.g Forward CCTGAGACACTTCAGTACTATGAG 99/99 Probe 6-FAMCCCGTTTGCZenAGGAAACAGTGTAGGAIABkFQ Reverse CTGTCTTCTTCATTGTCCTCCA

Tdo2-v1 0a-0b-1 Tdo2 variant1 exons 0a 0b-1.2 Forward CCAGTACGAAATGAGATCCGG 132 Mm.PT.42.9084201.g Probe 6-FAMAGACACAGCZenCAATCAGCACCCAIABkFQ Reverse AGGTTTGCTAGGTCAGGAATG

Tdo2-v2 0a-2 Tdo2 variant2 exons 0a 1.2 Forward GAAATGAGATCCGGGCTAAGAG 78 Probe 6-FAMTGGGTGCTGZenATTGGCTGTGTCTIABkFQ Reverse GTGTATCTTTTATGTATCCTGATTGCC Probe based qPCR assays were obtained from IDT. The IDT PrimerQuest® Design Tool was used to design custom assays. Assay specifics: location of exons spanned, assay ID, primer/probe sequences and amplicon size (confirmed by gel electrophoresis) are shown. The transcript Ido2-v2 is detected by three assays: Ido2-X4 Set 4, Ido2-X2-mouse Set 1, and Ido2-v2-ex3-4 set2. However, the assay Ido2-X4 Set 4 spans an exon boundary unique to the Ido2-v2 transcript. Discerning changes in Ido2-v2 expression is possible using this assay. In addition, since the assays that assess Ido2-v5/v2 and Ido2-v6/v2 also detect Ido2-v2, changes in Ido2- v5 and Ido2-v6 can only be estimated based on unique changes in gene expression using either Ido2-X2-mouse Set 1 or Ido2-v2-ex3-4 set2 compared to Ido2-X4 Set 4.

Statistics: Data are reported as mean ± SEM for 3-4 independent OHSC preparations per treatment combination and 6 mice/ treatment group for the adult animal study. SigmaPlot 13.0 software was used to conduct two-way analysis of variance (2-way ANOVA) using a 2 x 6

(OHSC) or 2 x 2 (in vivo) arrangement of treatments. In the presence of a significant interaction, assessed by Holm-Šídák method, post-hoc analyses for multiple comparisons were performed.

Comparisons were considered significant at p < 0.05.

P a g e | 51

3.4 Results

In vivo: neuroinflammation

LPS and pI:C induce DOs, cytokines and galectins in the mouse hippocampus

Ido1 expression: LPS and pI:C were injected intraperitoneally into adult mice to determine if, along with the DOs, brain galectin expression was regulated by neuroinflammation.

Similar to previous studies (58, 99, 159), hippocampal Ido1 expression was increased within several hours of a LPS or pI:C challenge. Both LPS and pI:C induced all three Ido1 transcripts:

Ido1-FL, Ido1-v1 and Ido1-v2 (all p < 0.01, Figure 10A, B, C), with the greatest fold increase seen for Ido1-FL followed by Ido1-v2 (both transcripts essentially absent in the hippocampus of naïve/control mice), but only a minor increase for the highly expressed Ido1-v1 (see relative basal

Ct values in the figure legend).

Figure 10. In vivo, hippocampal Ido1 expression is increased after LPS and pI:C administration. Mice were administered saline (Ctrl), LPS or pI:C and hippocampi collected after 6 hours. Gene expression of three Ido1 transcripts was measured. Expression levels are relative to Ctrl samples normalized to 1.0. * p < 0.05 for the effect of LPS or pI:C. Average Ctrl Ct values for each transcript: A) Ido1-FL: Ct = 40.0, B) Ido1-v1: Ct = 29.8 and C) Ido1-v2: Ct = 39.7. Ct values indicate that Ido1-FL and Ido1-v2 are essentially not expressed in naïve (Ctrl) mouse hippocampi, whereas Ido1-v1 expression is detectable in all samples.

P a g e | 52

Ido2 expression: Several Ido2 transcripts are expressed in the mouse brain. Ido2-v1,

Ido2-v3 and Ido2-v6 were increased in the hippocampus following LPS treatment (all p < 0.05,

Figure 11A, C, F), whereas only Ido2-v1 was elevated by pI:C (p < 0.05, Figure 11A). Using assays that specifically assess Ido2-FL, Ido2-v2, Ido2-v4 and Ido2-v5 (Table 1), we found that their expression was not induced by either LPS or pI:C (Figure 11B, D, E). Ido2-FL was not detectable nor induced (not shown). Tdo2 expression: Tdo2-FL expression was not altered by

LPS or pI:C (Figure 12A), however both Tdo2-v1 and Tdo2-v2 were increased by pI:C (p <

0.05, Figure 12B, C).

P a g e | 53

Figure 11. Specific Ido2 transcripts expressed in the mouse hippocampus are increased by LPS and pI:C in vivo. Mice were administered saline (Ctrl), LPS or pI:C and hippocampi were collected after 6 hours. Expression of six Ido2 gene transcripts was measured. Expression levels are relative to Ctrl samples set to 1.0. * p < 0.05 for the effect of LPS or pI:C. Average Ctrl Ct values for each transcript: A) Ido2-v1: Ct = 29.2, B) Ido2-v2: Ct = 28.9, C) Ido2-v3: Ct = 28.4, D) Ido2-v4: Ct = 38.5, E) Ido2- v5/-v2: Ct = 31.6 and F) Ido2-v6/-v2: Ct = 28.3. Ct values indicate that Ido2-FL (non-detectable, not shown) and Ido2-v4 are essentially not expressed in naïve (Ctrl) mouse hippocampi. Expression of other Ido2 transcripts are readily detectable in all samples.

P a g e | 54

Figure 12. In vivo, hippocampal Tdo2 expression is increased after pI:C administration. Mice were administered saline (Ctrl), LPS or pI:C and hippocampi were collected after 6 hours. Gene expression of three Tdo2 transcripts was measured. Expression is relative to Ctrl, normalized to 1.0. * p < 0.05 for the effect of pI:C. Average Ctrl Ct values for each transcript: A) Tdo2-FL: Ct = 21.4, B) Tdo2-v1: Ct = 28.7 and C) Tdo2-v2: Ct = 27.7. Ct values indicate that all three Tdo2 transcripts are well- expressed in the mouse hippocampus.

Cytokines: Illustrating a classical neuroinflammatory response (99, 160), both LPS and pI:C increased IFN, TNF and IL-1 expression in the mouse hippocampus (all p < 0.05,

Figure 13A, B, C). Gal-1 was expressed, but not induced by LPS or pI:C (Figure 13D), while

Gal-3 expression was doubled by LPS and pI:C (p < 0.05, Figure 13E). Interestingly, Gal-9 expression was increased ~ 4 fold by LPS and ~10 fold by pI:C (all p < 0.001, Figure 13F).

In vivo summary: These data illustrate that neuroinflammation increased the expression of Gal-3 and Gal-9 along with the expected increase in pro-inflammatory cytokines. Galectin and cytokine induction was accompanied by elevated DO expression within the mouse hippocampus, but in a DO and transcript specific manner. Thus, we next investigated which (if any) of the induced cytokines or galectins directly mediated the changes in hippocampal DO expression, using OHSCs.

P a g e | 55

Figure 13. LPS and pI:C increase expression of pro-inflammatory cytokines and galectins in the mouse hippocampus. Mice were administered saline (Ctrl), LPS or pI:C and hippocampi were collected after 6 hours. Gene expression of A) IFN, B) TNF, C) IL-1, D) Gal-1, E) Gal-3 and F) Gal-9 was measured and expression is shown relative to Ctrl. * p < 0.05 for main effect of LPS or pI:C.

Ex vivo: OHSCs

Gal-9 synergized with IFN to induce Ido1-FL expression

As shown previously, IFN induced Ido1-FL (1, 10) and Ido1-v1 expression (1) by

OHSCs (p < 0.001, Figure 14A, B). Gal-9 alone did not induce expression of any Ido1 transcript, however Gal-9 significantly interacted with IFN to accentuate IFN-induced Ido1-FL

P a g e | 56

expression (F(5,24) = 8.02, MSE = 1418, p < 0.001, Figure 14A). In contrast, Ido1-v2 was not induced by IFN or Gal-9 (Figure 14C), despite being inducible in vivo.

Based on our in vivo results showing Gal-1 and Gal-3 expression within mouse hippocampus, we tested for Gal-9 specificity by treating OHSCs with Gal-1 or Gal-3.

Surprisingly, considering their immunomodulatory capabilities, Gal-1 and Gal-3 did not alter

Ido1 expression alone or in the presence of IFN (Figure 14, insets), suggesting that the synergy with IFN was Gal-9-specific. An additional degree of specificity is illustrated by the inability of

TNF, IL-1β, pI:C or Dex to induce any Ido1 transcript or to synergize with galectins. Thus, the elevated expression of IFN and Gal-9 associated with neuroinflammation in vivo would be expected to act synergistically to enhance Ido1-FL expression.

P a g e | 57

Figure 14. IFN increases expression of two Ido1 transcripts with Gal-9 interacting to accentuate only Ido1-FL ex vivo. OHSCs were treated with IFN, TNF, IL-1, pI:C and Dex ± Gal-9. Additional OHSCs (insets) were treated with IFN and pI:C ± Gal-1 or Gal-3. Gene expression of three Ido1 transcripts was measured and expression levels are relative to Ctrl samples  normalized to 1.0. * p < 0.05 for the effect of IFN. p < 0.05 for Gal-9 within inflammatory mediator. Average Ctrl Ct values for each transcript: A) Ido1-FL: Ct = 40.0, B) Ido1-v1: Ct = 34.9 and C) Ido1-v2: Ct = 40.0. Ct values indicate that only Ido1-v1 is expressed in Ctrl slice cultures, paralleling the relative expression pattern of mouse hippocampi (Figure 10).

P a g e | 58

Gal-9 synergized with IFN to induce the expression of Ido2-v1

Similar to our previous publication (1), both IFN and pI:C induced expression of Ido2- v1 and Ido2-v3 (p < 0.001, Figure 15A, C), but only IFN increased expression of Ido2-v6/v2 (p

< 0.001, Figure 15F). Interestingly, Gal-9 synergized with IFN to accentuate only Ido2-v1 expression (F(5,24) = 4.02, MSE = 30.0, p < 0.01, Figure 15A). Three additional Ido2 variants were expressed by OHSCs. IFN induced Ido2-v4 and Ido2-v5 expression (p < 0.05, Figure 15D,

E), but not Ido2-v2 (Figure 15B). These data suggests that each Ido2 transcript is differentially regulated. In addition, neither TNF, IL-1β nor Dex increased Ido2 expression, alone or with

Gal-9. Gal-1 and Gal-3 did not affect Ido2 expression (Figure 15, insets). Thus, the elevated expression of IFN and Gal-9 associated with neuroinflammation in vivo would be expected to act synergistically to enhance Ido2-v1 expression.

P a g e | 59

Figure 15. IFN increases expression of five Ido2 transcripts with Gal-9 interacting to accentuate only Ido2-v1 ex vivo. OHSCs were treated with IFN, TNF, IL-1, pI:C and Dex ± Gal-9. Additional OHSCs (insets) were treated with IFN and pI:C ± Gal-1 or Gal-3. Gene expression of six Ido2 transcripts was measured and expression levels are relative to Ctrl's normalized to  1.0. * p < 0.05 for the effect of IFN. p < 0.05 effect of Gal-9 within inflammatory mediator. Average Ctrl Ct values for each transcript: A) Ido2-v1: Ct = 32.9, B) Ido2-v2: Ct = 30.6, C) Ido2-v3: Ct = 34.4, D) Ido2-v4: Ct = 40.0, E) Ido2-v5/-v2: Ct = 36.1 and F) Ido2-v6/-v2: Ct = 33.7. Ct values indicate that Ido2-FL (non-detectable, not shown) and Ido2-v4 are not expressed in Ctrl slice cultures, similar to the hippocampus of naïve (Ctrl) mice (Figure 11).

Gal-9 induced Tdo2-v1 and Tdo2-v2

All three Tdo2 transcripts are well-expressed by OHSCs (Figure 16, Ct's presented in figure legend). Neither IFN, TNF, IL-1β nor pI:C affect Tdo2 expression (all 3 transcripts), although Dex has a specific inductive action on the Tdo2-FL transcript (p < 0.05, Figure 16A; as previously reported (1)). Gal-9 did not affect the expression of Tdo2-FL, but Gal-9 slightly but significantly increased expression of both Tdo2-v1 and Tdo2-v2 (p < 0.05, Figure 16B, C).

Neither Gal-1 nor Gal-3, alone or in combination with inflammatory mediators, affected Tdo2

P a g e | 60 expression (Figure 16 insets). Thus, the elevated expression of Gal-9 associated with neuroinflammation in vivo would be expected to enhance Tdo2-v1 and Tdo2-v2 expression within the hippocampus; whereas Tdo2-FL is specifically induced by the glucocorticoid receptor agonist, Dex.

P a g e | 61

Figure 16. Dex increases Tdo2-FL, whereas Gal-9 increases Tdo2-v1 and Tdo2-v2 expression ex vivo. OHSCs were treated with IFN, TNF, IL-1, pI:C and Dex ± Gal-9. Additional OHSCs (insets) were treated with IFN and pI:C ± Gal-1 or Gal-3. Gene expression of Tdo2 transcripts was measured and levels are normalized to 1.0 for Ctrl within each transcript. * p < 0.05 for  the effect of Dex. p < 0.05 for the main effect of Gal-9. Average Ctrl Ct values for each transcript: A) Tdo2-FL: Ct = 29.1, B) Tdo2-v1: Ct = 26.3 and C) Tdo2-v2: Ct = 25.3. Ct values indicate that all three Tdo2 transcripts are well-expressed in mouse hippocampal slice cultures, paralleling their expression pattern in the naïve mouse hippocampus (Figure 12).

P a g e | 62

Gal-9 increased TNF and IL-6 expression

Previous work had shown that Gal-9 can increase production of pro-inflammatory cytokines, such as TNF from microglia (148). To validate this immunomodulatory action, we investigated the ability of our treatments, including Gal-9, to induce an inflammatory response by OHSCs. Gal-9, IFN and pI:C induced TNF expression (p < 0.05, Figure 17A), while Gal-9, pI:C and IL-1 induced IL-6 expression (p < 0.05, Figure 17B). As expected, Dex decreased

TNF expression, acting in a typical anti-inflammatory (glucocorticoid-like) manner (p < 0.05).

Only pI:C increased expression of Gal-9 (p < 0.05); this induction was diminished by Gal-9 (p <

0.05, Figure 17C). Of note, none of the treatments (or combinations) resulted in detectable expression of IFN by OHSCs (not shown). Thus, IFN responsible for Ido1 and Ido2 expression is not derived from cells resident in the hippocampal parenchyma, while, in contrast, Gal-9 is expressed by the brain.

P a g e | 63

Figure 17. Gal-9 increases expression of pro-inflammatory mediators and down-regulates its own expression ex vivo. OHSCs were treated with IFN, TNF, IL-1, pI:C and Dex ± Gal-9. Expression of A) TNF, B) IL-6 and C) Gal-9 was quantified. Expression for Ctrl cultures was normalized to 1.0. * p < 0.05 for the effects of IFN, pI:C, IL-1 and Dex.  p < 0.05 for the main effect of Gal-9.  p < 0.05 effect for Gal-9 within inflammatory mediator. IFN expression was not detected in OHSCs.

P a g e | 64

3.5 Discussion

We previously reported an inflammation-by-stress synergy (IFN x glucocorticoid) that functions to accentuate expression of Ido1-FL, Ido1-v1 and Ido2-v3 within the mouse hippocampus (1). We now report another exciting synergistic interaction between two immunomodulatory factors: IFN and Gal-9 that acts to enhance Ido1-FL and Ido2-v1 expression.

These data indicate that IFN drives Ido1 and Ido2 induction, but secondary factors determine which transcripts mediate the synergistic induction of the Ido’s. We also describe assays to quantify expression of multiple Ido1 and Ido2 transcripts in vivo (during neuroinflammation) and ex vivo

(during inflammatory challenges of OHSCs).

In vivo, LPS or pI:C induced neuroinflammation (i.e. increased cytokine expression) and galectin expression, which was accompanied by increased expression of all Ido1 transcripts, but only specific Ido2 and Tdo2 transcripts. This is the first report demonstrating that both LPS- and pI:C-induced neuroinflammation involved increased Gal-3 and Gal-9 expression: paralleling the elevated expression of IFN, TNF and IL-1. Thus, we treated OHSCs with these cytokines ± galectins to determine which factors (or combination thereof) were responsible for elevated DO expression in vivo. Using OHSCs, we found that Gal-9 acted independently to increase Tdo2-v1 and Tdo2-v2 expression but Gal-9 only increased expression of Ido1 and Ido2 in the presence of

IFN. These findings suggest that Gal-9 plays a previously undefined role in the induction of the

Kynurenine Pathway.

Ido1: We previously detailed the regulation of two Ido1 transcripts and compared their relative expression across multiple areas of the brain. Ido1-v1 was well-expressed (1) in the mouse hippocampus and other brain regions, whereas Ido1-FL is low/undetectable across the naïve mouse brain (1). Like Ido1-FL, we now show that a third Ido1 transcript, Ido1-v2, is low/undetectable in

P a g e | 65 the mouse hippocampus of naïve mice (Figure 10). Not only is hippocampal basal expression of these three Ido1 transcripts different, but the regulation of Ido1 transcripts by inflammatory mediators and corticosteroids is unique as well. Expression of both Ido1-FL and Ido1-v2 were induced by LPS and pI:C in vivo (current work), but not ex vivo (1), suggesting that in vivo hippocampal responses to LPS and pI:C must be mediated by other secondary factors: presumably cytokines and other immunomodulatory mediators. Using OHSCs, we found that only IFN was able to directly induce Ido1-FL and Ido1-v1 expression (Figure 14, (1)). Since brain/hippocampal

IFN is inducible by LPS and pI:C, but OHSCs did not express IFN (not shown), non-resident cells from the periphery are probably responsible for the elevated IFN expression within the brain that occurs in vivo and thus for the increase in Ido1 expression. Indeed, during neuroinflammation,

IFN + cells infiltrate the brain (161). Hippocampal Ido1-v2 expression is increased by LPS and pI:C in vivo, however we have not, as yet, identified the mechanism responsible for this response; none of the treatments including IFN increased Ido1-v2 expression by OHSCs.

In the naïve hippocampus and control OHSCs, only Ido1-v1 is readily detectable, but Ido1- v1 expression is far less sensitive to pro-inflammatory induction compared to Ido1-FL. These data suggest that Ido1-v1 probably has a major role in basal metabolism (supplying Kyn for nicotinamide/NAD+ synthesis (162)), whereas the sizeable induction of Ido1-FL by IFN plus either Gal-9 (current work) or glucocorticoids (1) is necessary to meet the increased energy/NAD+ demand associated with inflammation (163-165) or stress, respectively (Figure 18). Indeed, elevated central nervous system NAD+ levels during experimental MS (166) are associated with increased Ido1 (167). An unfortunate consequence of Ido1 induction is elevated production and release of downstream neuroactive Kyn metabolites (QuinA and KynA) that mediate depression- like, anxiogenic and adverse cognitive behaviors (168).

P a g e | 66

Figure 18. Proposed model for Kynurenine Pathway activation in the brain. Multiple studies have shown that in vivo administration of LPS or pI:C to mice increased peripheral pro-inflammatory cytokines (including IFN, TNF and IL-1). These circulating cytokines, as well as immune cells that produce them, can enter the brain, to stimulate brain parenchymal production of additional immunomodulatory agents (cytokines and galectins). Gal-9 (produced within the brain or from the circulation) and IFN (from the circulation or infiltrating immune cells) synergize to increase expression of DO transcripts in the brain. Ex vivo, IFN is added (since brain parenchyma (i.e. OHSCs) does not express this cytokine), Gal-9 is also added to directly test its activity (but Gal-9 is expressed by cells resident to the brain). Independent of the source, IFN and Gal-9 increase DO expression in a DO- and transcript-specific manner, modeling in vivo responses. DO induction would increase flux down the Kynurenine Pathway to serve two purposes: supplying NAD+ for the brain but with consequences (metabolites, Kyn, KynA and QuinA, modulate behavior and immune activity).

Ido2: We recently found that several Ido2 transcripts are differentially expressed across the mouse brain, and again, inflammatory mediators and corticosteroids differentially regulate Ido2 transcripts (1). Obviously, post-translational processing of Ido2 (and Ido1) is not a random process but is utilized to fine-tune mRNA expression. A switch in post-translational processing of Ido2 was first addressed using macrophages and B-cells, wherein both cell types can switch from expression of predominantly Ido2-FL to predominantly Ido2-v3 (52). While investigating Ido2 expression in the brain, we had first shown that LPS increased hippocampal Ido2 expression in vivo, using an assay that simultaneously quantified all Ido2 transcripts (159). In the current work, we refined our understanding of central Ido2 expression by quantifying the regulation of its various transcripts.

During in vivo neuroinflammation, LPS and pI:C increased hippocampal Ido2 expression in a transcript-specific manner. Both LPS and pI:C increased Ido2-v1 expression, however only LPS increased Ido2-v3 and Ido2-v6/v2. Since LPS and pI:C were administered intraperitoneally, we used OHSCs to identify direct versus indirect mechanisms responsible for Ido2 induction.

P a g e | 67

Together with our previous work (1), OHSC expression of Ido2-v1 and Ido2-v3 was increased by IFN, LPS and pI:C, while Ido2-v4, Ido2-v5 and Ido2-v6 were increased slightly but by only IFN. These data indicate that LPS and pI:C may act directly or via IFN to induce Ido2- v1 and Ido2-v3 within the hippocampus. In contrast, in vivo induction of Ido2-v4, Ido2-v5 and

Ido2-v6 are mediated by IFN. Uniquely, Ido2-v2 is highly expressed but unaffected by inflammatory mediators and galectins. Overall, in both the mouse hippocampus and OHSCs, Ido2- v1 and Ido2-v3 are most susceptible to induction by inflammation, whereas the other transcripts are either unchanged in vivo or modestly induced ex vivo. These data suggest that Ido2-v1 and

Ido2-v3 induction was necessary to increase flux down the Kynurenine Pathway (Figure 18) to meet the increased energy (NAD+) demand associated with inflammation (163-165). A repercussion of their induction may be altered behaviors associated with Kyn production (52) and conversion to QuinA or KynA (145). Other Ido2 transcripts are relatively intractable and involved in basal metabolism.

Gal-9: Excitingly, in the presence of IFN, Gal-9 accentuated Ido1-FL and Ido2-v1 expression by OHSCs; neither Gal-1 nor Gal-3 affected DO expression. This statistical interaction suggests that Ido1 and Ido2 are regulated in a transcript-specific manner by additional factors: glucocorticoids (1) and Gal-9 (current work). Although IFN initiates Ido1-FL and Ido2-v1 induction (and indeed IFN action is necessary for neuroinflammation-induced Ido induction (13)), full induction in vivo requires synergy with glucocorticoids or Gal-9. As Gal-9 is expressed in many cell types within the brain, expression and induction of hippocampal Gal-9 can occur via activation of cells resident to the brain. Gal-9 can bind to many cell surface partners including the

T-cell immunoglobulin and mucin-domain containing-3 (TIM-3) receptor, as well as directly associating with several transcription factors (169) within the cell. Further analysis is required to

P a g e | 68 define which of these possible mechanisms are responsible for Gal-9's ability to enhance IFN- induced DO expression.

There are multiple autoimmune disorders associated with elevated levels of both Ido1 and

Gal-9 (70, 78, 155-158). As Ido2 function is associated with the development of severe rheumatoid arthritis symptoms (53), Gal-9's ability to enhance Ido2 expression may promote the development or severity of symptoms of rheumatoid arthritis or other autoimmune conditions. Thus, further characterization of the synergy between IFN and Gal-9 during the induction of Ido1 and Ido2 is important to our understanding the pathophysiology of autoimmune disorders such as MS,

Hashimoto’s disease, or rheumatoid arthritis. Similarly, Gal-9 is an important regulator of the immune system, promoting the differentiation of T regulatory cells (170) and modulating viral pathogenesis (171). Ido1 plays a similar role in T cell differentiation (172) and also modulates viral pathogenesis (173). These findings open that possibility that one of the mechanisms by which Gal-

9 controls T cell differentiation and viral pathogenesis is its ability to direct DO expression. These links warrant further investigation.

Tdo2: Three Tdo2 transcripts are expressed in the mouse brain, only Tdo2-FL is enriched in hippocampus (1, 60). Similar to Ido1 and Ido2, this specific enrichment implies a distinct regulatory mechanism for transcript expression. Although Tdo2-v1 and Tdo2-v2 expression was increased in the hippocampus post-pI:C administration to mice, treatment of OHSCs with pI:C, pro-inflammatory cytokines or LPS (1) did not increase Tdo2 expression. Thus, another factor(s) must mediate increased Tdo2 expression in vivo. Using, OHSCs, Tdo2-v1 and Tdo2-v2 expression was increased by Gal-9. Since, pI:C was a more potent inducer of hippocampal Gal-9 compared to

LPS in vivo, the ability of pI:C administration to increase Tdo2-v1 and Tdo2-v2 expression may be mediated by central Gal-9 induction. In contrast to Tdo2-v1 and Tdo2-v2, Tdo2-FL expression was

P a g e | 69 increased by glucocorticoids (Dex and corticosterone) in OHSCs (Figure 16; (1)), but not cytokines or Gal-9. Thus, like the Ido's, Tdo2 evolved to permit differential transcript expression in a stress- and inflammation-specific manner within the brain. Tdo2-FL expression is dependent on glucocorticoid activity; whereas, Tdo2-v1 and Tdo2-v2 are responsive to Gal-9. These data suggest that different promotors used for Tdo2 induction (174) are necessary to meet the increased metabolic (NAD+) demand (Figure 18) associated with stress (Tdo2-FL) and neuroinflammation

(Tdo2-v1 and Tdo2-v2), as previously suggested (163-165). A repercussion of aberrant Tdo2 expression may be altered behavior such as those associated with schizophrenia (138, 139) and anxiety (54, 55).

In conclusion: This is the first manuscript to link Gal-9 to the Kynurenine Pathway.

Following LPS and pI:C administration, IFN and Gal-9 expression are induced within the mouse hippocampus, as are Ido1 and Ido2. Using OHSCs, we clearly show that these two inflammatory modulators act in synergy to increase Ido1 and Ido2 expression. This ex vivo synergism presumably has a role during in vivo induction of Ido1 and Ido2 (Figure 18). Since changes in Gal-

9, IFN and Ido1 expression have been independently linked to central diseases such as depression and MS (7, 70, 78, 175), the ability of Gal-9 to accentuate DO expression during neuroinflammation may play a significant role in these and other psychiatric conditions and should be further studied as a putative therapeutic target. Finally, the action of Gal-9 is highly specific to the induction of distinct Ido1, Ido2 and Tdo2 transcripts, suggesting complex post-translational control over DO expression. Our understanding of this process is in its infancy. Additional work is required to clarify the relevance of DO expression to psychiatric illness, autoimmune disorders and neurological disease.

P a g e | 70

CHAPTER 4: Desipramine decreases expression of human and murine indoleamine-2,3- dioxygenases3

4.1 Abstract

Abundant evidence connects depression symptomology with immune system activation, stress and subsequently elevated levels of kynurenine. Anti-depressants, such as the tricyclic norepinephrine/serotonin reuptake inhibitor desipramine (Desip), were developed under the premise that increasing extracellular neurotransmitter level was the sole mechanism by which they alleviate depressive symptomologies. However, evidence suggests that anti-depressants have additional actions that contribute to their therapeutic potential. The Kynurenine Pathway produces tryptophan metabolites that modulate neurotransmitter activity. This recognition identified another putative pathway for anti-depressant targeting. Considering a recognized role of the Kynurenine Pathway in depression, we investigated the potential for Desip to alter expression of rate-limiting enzymes of this pathway: indoleamine-2,3-dioxygenases (Ido1 and

Ido2). Mice were administered lipopolysaccharide (LPS) or synthetic glucocorticoid dexamethasone (Dex) with Desip to determine if Desip alters indoleamine-dioxygenase (DO) expression in vivo following a modeled immune and stress response. This work was followed by treating murine and human peripheral blood mononuclear cells (PBMCs) with interferon-gamma

(IFN and Desip. In vivo: Desip blocked LPS-induced Ido1 expression in hippocampi, astrocytes, microglia and PBMCs and Ido2 expression by PBMCs. Ex vivo: Desip decreased

IFN-induced Ido1 and Ido2 expression in murine PBMCs. This effect was directly translatable to the human system as Desip decreased IDO1 and IDO2 expression by human PBMCs. These

3 Adapted from the published version in Brain, Behavior, and Immunity (renumbered figures and formatting): Brooks AK, Janda TM, Lawson MA, Rytych JL, Smith RA, Ocampo-Solis C, McCusker RH, 2017. Desipramine decreases expression of human and murine indoleamine-2,3-dioxygenases. Brain Behav Immun 62, 219-229.

P a g e | 71 data demonstrate for the first time that an anti-depressant alters expression of Ido1 and Ido2, identifying a possible new mechanism behind anti-depressant activity. Furthermore, we propose the assessment of PBMCs for anti-depressant responsiveness using IDO expression as a biomarker.

P a g e | 72

4.2 Introduction

Currently, over 350 million people world-wide suffer from depression, with about 1 in 20 people reporting a depressive episode over the last year (176). Even worse, depression is predicted to become the leading cause of disease burden world-wide by the year 2030 (177). The

US population taking anti-depressants has doubled over the past 12 years further highlighting the extent of this problem (81). Considering the poor efficacy of anti-depressants for patients suffering from Major Depressive Disorders (MDD) (86, 178, 179), identifying additional targets for the creation of more-effective therapeutics is of utmost importance.

A subset of individuals with major depressive disorder present with evidence of an activated immune system (increased inflammatory biomarkers) and another subset have increased peripheral tryptophan metabolism to kynurenine (Kyn) (141, 180). In patients with chronic elevation of inflammatory markers, anti-inflammatory drugs have potential anti- depressant efficacy (181). Thus, patients with elevated Kyn production should benefit from therapeutics that modulate the Kynurenine Pathway. Three rate-limiting dioxygenase enzymes

(DOs: indoleamine-dioxygenases Ido1 and Ido2, plus tryptophan-2,3-dioxygenase (Tdo2)) metabolize tryptophan into N-formyl-kynurenine that is then metabolized into Kyn. In human studies, up to 45% of patients with hepatitis C or cancer have a greater severity of depression symptoms following immunotherapy with IFN(6, 7, 84) with severity of depression symptoms associated with elevated Kyn production , while lipopolysaccharide (LPS) administration to subjects induced inflammation and a depression phenotype (182). These studies reveal that elevated inflammatory markers are linked to MDD and provide direct evidence that inflammation and the Kynurenine Pathway are linked to depressive symptomology (183-185).

P a g e | 73

Activation of the Kynurenine Pathway is associated with induction of inflammation- induced depression (141, 180). Expression and regulation of the DOs indicate that enhanced DO activity and elevated DO expression are correlated with depression symptomology in both human and rodent models (1, 7, 13). In preclinical studies, neuroinflammation induced by LPS administration, polyinosinic:polycytidylic acid (pI:C) treatment, peritoneal infection with

Mycobacterium bovis or acute/chronic stress culminate in depression-like behaviors such as anhedonia and helplessness/despair (9, 12, 58, 142, 143, 186, 187). Such pre-clinical models of depression are associated with increased DO expression and/or DO activity, primarily attributed to Ido1 as diminishing DO activity by the administration of Ido1 inhibitors or using Ido1 knockout (KO) mice results in decreased inflammation- and stress-induced depression-like behaviors (11, 14, 97, 187). Peripheral immune challenges, largely via IFNinduce Ido1 and

Ido2 (1, 13, 99, 188); whereas, stress hormones induce Tdo2 (1) in rodent models. Our recent work suggests that stress-inducible factors, glucocorticoids, synergize with IFN to further induce the DOs (1, 188). Thus, the induction of the Kynurenine Pathway following inflammatory and stress-induced stimulation is intimately associated with depression (7, 9, 13, 58, 142, 143).

Both Ido1 and Ido2 genes are transcribed into multiple transcript variants, and it is possible to distinguish expression of DO transcripts by amplifying regions unique to each transcript. As such, the Ido1- full length (FL) transcript (comprised of exons

1,3,4,5,6,7,8,9,10,11) is poorly expressed in the naïve mouse brain, but is highly inducible by inflammation and stress. In contrast, the Ido1-variant 1 (v1) transcript (comprised of exons

2,3,4,5,6,7,8,9,10,11) is well-expressed in the brain, but far less sensitive to inflammatory stimuli

(1). This profile suggests the use of alternate enhancer/promoters to control Ido1 expression in a transcript-dependent manner. Similarly, Ido2-FL (comprised of exons 1,2,4,5,6,7,8,9,10,11) is

P a g e | 74 poorly expressed and poorly induced by inflammatory mediators or stress in the mouse brain (1).

Ido2-v1 (comprised of exons 3,4,5,6,7,8,9,10,11) and Ido2-v3 (exon structure unknown) are well expressed within the brain and are increased following inflammatory stimuli (188). Similar to

Ido1, differential relative expression and regulation suggest the use of distinct enhancer/promoter sequences to control Ido2 expression(189). Desipramine (Desip; a tricyclic serotonin/norepinephrine reuptake inhibitor) is a commonly prescribed anti-depressant. In preclinical studies, Desip or its precursor imipramine decreased depression-like behavior of LPS- treated (65, 100, 190-194) and BCG-infected mice (195, 196). Many such studies attributed the induction of depression-like behaviors to Ido1, but no data were provided to determine if Desip altered DO expression as a mechanism associated with diminished depression-like behaviors. As previous work has shown that Desip or its precursor imipramine can decrease LPS-induced depression-like activity (65, 100, 190-194), we investigated the relationship between inflammation, Desip and DO expression.

We confirmed that LPS induces Ido1 expression in vivo in the brain and periphery.

Interestingly, Ido1 induction was blocked by Desip in the circulation (murine PBMCs, PBMC-Ts,

T cells and human PBMCs) and the brain (murine hippocampi, microglia and astrocytes). Using organotypic hippocampal slice cultures (OHSCs), we found that IFN-induced Ido1 and Ido2 expression was blocked by Desip, and furthermore, that our previously described synergy between IFN and either Dex (1) or galectin-9 (188) to accentuate specific Ido1 and Ido2 transcripts were blocked by Desip. Here we provide the first evidence that an anti-depressant drug Desip decreases Ido expression in both human and murine samples. This finding identifies a putative new mechanism that may be exploited to enhance anti-depressant activity.

P a g e | 75

4.3 Methods

Mice and in vivo reagents

C57BL/6J mice were bred in-house. All procedures were in accordance with the Guide for the Care and Use of Laboratory Animals (NRC), approved by the Institutional Animal Care and Use Committee. Twelve-week-old male C57BL/6J mice were used for intraperitoneal injections. Saline or Desip (20mg/kg body weight, D3900, Sigma) were administered 30min before saline, LPS (lipopolysaccharide, 330μg/kg, serotype 0127:B8, Sigma) or Dex

(2,500μg/kg, 11695-4013-1, Henry Shein, Dublin, OH). Treatments were administered prior to initiation of the dark cycle and mice were sacrificed 6h post-treatment. This Desip dosage blocked LPS-induced depression-like behaviors (100).

Reagents for ex vivo studies

Recombinant mouse IFN (tested at 10ng/ml, 315-05) and human IFN (tested at

10ng/ml, 300-02) were from Peprotech (Minneapolis, MN). Murine Gal-9 (1µg/ml, 3535) was from R&D Systems (Minneapolis, MN). Dex (1µM, D4902) was from Sigma. Desip was tested at 100µM.

Microglia and Astrocytes

Cells were isolated using the gentleMACS system (Miltenyi, San Diego, CA), as previously described (197, 198). Briefly, perfused brains were digested with Neural Tissue

Dissociation reagents. The resulting cell suspension was passed through a 40µm mesh to remove debris. After centrifugation, cells were re-suspended in 30% low-endotoxin Percoll Plus (GE

Healthcare) and centrifuged to remove myelin. Cells were re-suspended in PBS plus 2mM

EDTA and 0.5% BSA and incubated with microbeads labeled with either anti-CD11b (microglia enrichment) or anti-ACSA-2 (astrocytes enrichment). Target cells were separated from non-

P a g e | 76 antigenic cells in a magnetic field. Cells were treated for 6h in serum-free medium (Dulbecco's

MEM, 1x penicillin/streptomycin, 15mM HEPES pH 7.4, 150µg/ml BSA) then stored at -80°C for later extraction. Microglia enrichment was previously confirmed by flow cytometry (199) and here with IL-1β expression which was 24.0-fold higher in microglia versus astrocytes. We have confirmed cells isolated using Miltenyi CD11b+ microbeads as CD11b+, CD45low, and

Ly6C−, considered predominantly microglia, and IL-1β staining as a positive marker for activated microglia (198). Astrocyte enrichment was confirmed by Eaat1 expression which was

31.0-fold higher in astrocytes versus microglia. Multiple studies have described using magnetic beads (ACSA-2) to separate a relatively “pure” population of astrocytes from the brain (200-

202), and have confirmed that this population of cells express astrocytic mRNA and do not express markers/mRNA/protein specific to other population of cells in the brain (200).

Murine PBMCs

Cells were isolated from heparinized blood using Ficoll-Paque PLUS (GE Healthcare) according to the manufacturer’s protocol. Briefly, blood was layered above Ficoll-Paque PLUS and centrifuged. The mononuclear cell layer (PBMCs) was centrifuged (200xg) twice to remove platelets. If PBMCs were from mice treated in vivo, RNA was immediately extracted. If PBMCs from naïve mice were to be treated ex vivo, they were separated into CD90+ T cells and CD90-

PBMC-Ts. T cell enrichment: PBMCs were incubated with anti-CD90.2 microbeads (Miltenyi).

Target cells were separated in a magnetic field with positive (retained-eluted T cells) and negative (fall-through PBMC-Ts) fractions collected. Cd3d expression (T cell marker (203)) was

~700-fold higher in T cells than PBMC-Ts; indicating efficient T cell enrichment and removal from the PBMC-T fraction. Cells were rested for 1.5h, treated for 6h in serum-free medium then stored at -80°C for later extraction.

P a g e | 77

Human PBMCs

Cells (purified, characterized PBMCs) from healthy subjects (a 21 year old male and 21 year old female) were purchased from Precision For Medicine (Fredrick, MD). Cells were thawed, centrifuged to remove DMSO, then rested for 2h in serum-free medium. Cells were then treated for 6h and stored at -80°C until RNA extraction.

OHSCs

C57BL/6J pups were used to generate OHSCs as previously described (1, 188).

Hippocampi were sliced and placed onto membrane inserts in 6-well plates containing medium

(50% Eagle's MEM, 25% HBSS, 25% heat-inactivated horse serum, penicillin/streptomycin,

HEPES, 0.5% D-glucose). On day 7, media was replaced with serum-free medium. OHSCs were treated for 6h, then stored at -80°C for later extraction.

RT-qPCR

E.Z.N.A. Total RNA Kit II (Omega Bio-Tek, Norcross, Georgia) was used to extract

RNA. RNA was reverse transcribed to cDNA (High Capacity cDNA Reverse Transcription Kit,

Applied Biosystems, Foster City, CA), and qPCR was performed using TaqMan universal PCR master mix (Applied Biosystems). Gene expression was normalized to GAPDH. Relative

-ΔΔCts expression was calculated by comparing 2 , Ct=cycle threshold (1, 188). Previous publications (1, 188) describe probe-based assays to measure DO transcripts. Herein, we focused on 4 transcripts to quantify Ido1 (Ido1-FL, Ido1-v1) and Ido2 (Ido2-v1, Ido2-v3).

Plasma IFN

Blood was collected into heparinized syringes 6h post-treatment, and plasma analyzed for

IFN (ELISA, BD Biosciences; San Diego, CA) following manufacturer’s instructions.

P a g e | 78

Statistics

Data are mean±SEM of 6 mice per treatment combination (in vivo experiments) and 3-4 independent PBMC-T, T cell and OHSC preparations. Analysis of variance was conducted with

SigmaPlot 13.0. Post-hoc analyses (Holm-Šídák) for comparisons across treatment groups were performed only with a significant interaction. Significant effects required p<0.05.

P a g e | 79

4.4 Results

Ido1-FL

In vivo, Ido1-FL mRNA expression in mouse brain is strikingly induced by LPS (1, 61,

125) (but not Dex, data not shown). We found elevated Ido1-FL expression in hippocampus

(Figure 19A), astrocytes (Figure 19B) and microglia (Figure 19C) from LPS-treated mice, compared to controls. Interestingly, Ido1-FL was also induced in PBMCs (Figure 91D). Most important, LPS-induced Ido1-FL expression was blocked by Desip in hippocampus, astrocytes and PBMCs (with a similar non-significant trend in microglia).

Ex vivo, IFN is accepted as a major mediator of LPS-induced Ido1 expression. To test if

Desip was directly blocking IFN activity, samples were treated ex vivo. When PBMCs-T, T cells

(Figure 19E and 19F) and OHSCs (Figure 19G and 19H) were examined, Ido1-FL expression was increased by IFN. We also confirmed the ability of Dex (Figure 19G) and Gal-9 (Figure

19H) to enhance IFN-induced Ido1-FL (1). Excitingly, Desip decreased IFN-induced Ido1-FL in PBMCs-T and T cells. Desip also diminished IFN IFN+Dex or IFNGal-9 induced Ido1-FL expression by OHSCs.

Combined, the in vivo and ex vivo data suggest that the induction and suppression of Ido1-

FL in brain and OHSCs is mediated by astrocytes and microglia. These responses are mimicked by

PBMCs.

P a g e | 80

Figure 19. Desip decreased Ido1-FL expression. After i.p. treatment of mice with either LPS or Dex (in vivo, A-D) or cells/brain tissue with IFN (ex vivo, E-H) with and without Desip, expression of Ido1-FL was quantified in A) Hippocampi, B) Astrocytes (ACSA-2+ enriched cells), C) Microglia (CD11b+ enriched cells), D) PBMCs, E) PBMC-T, F) T cells (CD90+ enriched cells), G) OHSCs ± Dex and H) OHSC ± Gal-9. * p ≤ 0.05 for Ido1-FL induction by LPS or IFN;  p ≤ 0.05 for the inhibitory effect of Desip within LPS or IFN;  p ≤ 0.05 for the ability of Dex or Gal-9 to synergistically enhance IFN- stimulated gene expression.

Ido1-v1

In vivo, Ido1-v1 is well expressed in naïve mouse brain but only mildly (~2-fold) increased by LPS (188). Ido1-v1 expression was doubled in hippocampus by LPS (Figure 20A), but unaffected by Dex (not shown). Changes in Ido1-v1 are cell-type specific as LPS and Dex increased Ido1-v1 in astrocytes (Figure 20B) but not microglia (Figure 20C) or PBMCs (Figure

20D). Desip tended to depress basal PBMC Ido1-v1 expression (p=0.052, Figure 20D). Unlike

Ido1-FL, Ido1-v1 expression in vivo was relatively insensitive to Desip.

Ex vivo, IFN treatment did not significantly induce Ido1-v1 in PBMC-T or T cells

(Figure 20E and 20F), however Desip decreased basal Ido1-v1 expression in both cell populations. In OHSCs, IFN-induced Ido1-v1 (Figure 20G and 20H) was accentuated by Dex

(Figure 20G). As reported previously (1), Gal-9 did not alter Ido1-v1 (Figure 20H). In all cases,

IFN-dependent Ido1-v1 expression by OHSCs was decreased by Desip.

P a g e | 81

Combined, in vivo and ex vivo data suggest that the induction and suppression of Ido1-v1 in OHSCs is NOT driven by astrocytes and microglia. PBMCs are unique in that Desip inhibits basal Ido1-v1 expression.

Figure 20. Attenuation of Ido1-v1 expression by Desip. After treatment of mice i.p. with either LPS or Dex (in vivo, A-D) or cells/tissue with IFN (ex vivo, E-H) with and without Desip, expression of Ido1-v1 was quantified in A) Hippocampi, B) Astrocytes (ACSA-2+ enriched cells), C) Microglia (CD11b+ enriched cells), D) PBMCs, E) PBMC-T, F) T cells (CD90+ enriched cells), G) OHSCs ± Dex and H) OHSC ± Gal-9. * p ≤ 0.05 for Ido1-v1 induction by LPS, Dex or IFN;  p ≤ 0.05 for the inhibitory effect of Desip within LPS or IFN;  p ≤ 0.05 for the ability of Dex or Gal-9 to synergistically enhance IFN- stimulated gene expression; p ≤ 0.05 main effect of Desip.

Ido2-v1

In vivo, Ido2-FL is undetectable and not inducible in hippocampus (1, 188) and OHSCs

(1). Thus, we quantified other well-expressed transcripts: Ido2-v1 and Ido2-v3. LPS (and Dex, not shown) did not increase Ido2-v1 expression in hippocampus (Figure 21A), however Ido2-v1 induction was seen in astrocytes (Figure 21B), microglia (Figure 21C) and PBMCs (Figure 21D).

Desip did not affect astrocyte Ido2-v1. Desip accentuated LPS-induced Ido2-v1 in microglia but attenuated induction in PBMCs. Thus, hippocampal Ido2-v1 expression did not mimic changes seen in either astrocytes or microglia, suggesting that the induction seen in these cell types may be offset by other cell populations.

P a g e | 82

Ex vivo, Ido2-v1 expression was numerically higher in PBMC-T (p=0.08) and significantly higher in T cells treated with IFN. Independent of this, Desip significantly decreased Ido2-v1 in both cell populations (Figure 21E and 21F). IFN also increased Ido2-v1 expression in OHSCs, an effect unaltered by Dex (Figure 21G) but accentuated by Gal-9 (Figure

21H). The induction of Ido2-v1 by Gal-9 was blocked by Desip to levels seen with IFN alone.

Combined the in vivo and ex vivo data suggest that induction and suppression of Ido2-v1 is cell-type specific. For the first time, Desip induced a DO transcript (microglial Ido2-v1), but in other cells Desip was either inactive (astrocytes or IFNDex OHSCs) or inhibitory (PBMC and

IFN+Gal-9 OHSCs).

Figure 21. Attenuation of Ido2-v1 expression by Desip. After treatment of mice i.p. with either LPS or Dex (in vivo, A-D) or cells/tissue with IFN (ex vivo, E-H) with and without Desip, expression of Ido2-v1 was quantified in A) Hippocampi, B) Astrocytes (ACSA-2+ cells), C) Microglia (CD11b+ enriched cells), D) PBMCs, E) PBMC-T, F) T enriched cells (CD90+ enriched cells), G) OHSCs ± Dex and H) OHSC ± Gal-9. * p ≤ 0.05 for Ido2-v1 induction by LPS or IFN;  p ≤ 0.05 for the effect of Desip within LPS or IFN;  p ≤ 0.05 for the ability of Dex or Gal-9 to synergistically enhance IFN-stimulated gene expression.

P a g e | 83

Ido2-v3

In vivo, LPS (and Dex, not shown) did not increase Ido2-v3 expression in hippocampi

(Figure 22A), however, Ido2-v3 was increased by Dex in astrocytes (Figure 22B) and by LPS in both microglia (Figure 22C) and PBMCs (Figure 22D), similar to Ido2-v1 regulation.

Unexpectedly, Desip increased Ido2-v3 expression slightly in astrocytes and more so in LPS- treated microglia. The induction seen in astrocytes and microglia was not evident in hippocampus, as these cells are not the major source of this transcript. Thus, the small change in astrocytes and even the 20-fold increase in microglia represent a small portion of total brain

Ido2-v3. Ido2-v3 expression by PBMCs was decreased by Desip, independent of LPS or Dex.

Ex vivo, although unchanged by IFN, the inhibitory effect of Desip on PBMCs in vivo was also seen with PBMCs-T and T cells (Figure 22E and 22F). In contrast, IFN increased Ido2- v3 expression in OHSCs (Figure 22G and 22H). Neither Dex nor Gal-9 interacted to accentuate

Ido2-v3 expression, but Desip diminished the ability of IFNto induce Ido2-v3.

Combined, in vivo and ex vivo data suggest that the induction and suppression of Ido2-v3 is again cell-type specific. Desip induced Ido2-v3 in astrocytes and microglia, but Desip was inhibitory in PBMCs and OHSCs.

P a g e | 84

Figure 22. Attenuation of Ido2-v3 expression by Desip. After treatment of mice i.p. with either LPS or Dex (in vivo, A-D) or cells/tissue with IFN (ex vivo, E-H) with and without Desip, expression of Ido2-v3 was quantified in A) Hippocampi, B) Astrocytes (ACSA-2+ enriched cells), C) Microglia (CD11b+ enriched cells), D) PBMCs, E) PBMC-T, F) T cells (CD90+ enriched cells), G) OHSCs ± Dex and H) OHSC ± Gal-9. * p ≤ 0.05 for Ido2-v3 induction by LPS, Dex or IFN;  p ≤ 0.05 for the inhibitory effect of Desip within LPS or IFN; p ≤ 0.05 main effect of Desip.

IFN

In vivo, previous work suggested that Desip is anti-inflammatory; for example decreasing

IFN production by PBMCs (204, 205). As IFN is a potent inducer of Ido1 (62) and Ido2 (206), we quantified IFN expression to determine if Desip decreases IFN to control DO expression.

IFN expression was very low in astrocytes (and not induced, not shown) and not detected in

OHSCs (not shown). IFN expression was increased by LPS in hippocampi (Figure 23A), microglia (Figure 23B) and PBMCs (Figure 23C). Hippocampal and microglial expression was attenuated by Desip. These data suggest that diminished Ido1 and Ido2 expression in vivo involves decreased IFN. We confirmed this by showing that LPS-induced plasma IFN protein was strikingly diminished by Desip (Figure 23C inset).

Ex vivo, IFN expression was decreased by Desip in PBMCs-T (Figure 23E) but not T cells (Figure 23F, albeit T cell expression is ~7.6-fold higher than PBMCs, p<0.05). Thus, in

P a g e | 85 vivo Desip-dependent IFN repression may not occur in T cells per se. As T cells represent ~75% of PBMCs, their stable expression is mimicked by stable PBMC expression in vivo. IFN expression was not detected in OHSCs. This finding has a critical implication: Desip diminishes

DO expression ex vivo by directly diminishing activity of IFN.

TNF, IL-1β and IL-6 expression were also quantified. Expression by PBMCs, microglia and astrocytes did not change in response to Desip. In contrast, there was a slight but significant increase in TNF and IL-6 by OHSC's in response to Desip (data not shown). Thus, Desip does not appear to alter DO expression via diminished pro-inflammatory cytokine expression.

Figure 23. Attenuation of IFN expression by Desip. After treatment of mice i.p. with either LPS or Dex (in vivo, A, B and C) or cells with IFN (ex vivo, D and E) with and without Desip, expression of IFN was quantified in A) Hippocampi, B) Microglia (CD11b+ enriched cells), C) PBMCs, D) PBMC-T, and E) T cells (CD90+ enriched cells). * p ≤ 0.05 for IFN induction by LPS;  p ≤ 0.05 for the inhibitory effect of Desip within LPS; p ≤ 0.05 main effect of Desip.

Human PBMC’s

Human PBMC’s were treated with IFN with or without Desip to confirm that the finding extended beyond rodent models. As for the mouse, there are multiple human IDO1 transcripts, we measured two IDO1 transcripts (IDO1-001 and IDO1-005) and one IDO2 transcript (IDO2-

201); all three transcripts encode IDO proteins. IFN increased expression of IDO1-001 (Figure

24A) and IDO1-005 (Figure 24B). Desip decreased IFN-induced IDO1-001 expression while

IDO1-005 was numerically lower but statistically unaffected by Desip. IFN also increased

IDO2-201 expression (Figure 24C), an effect blocked by Desip.

P a g e | 86

Figure 24. Desip decreased IDO1 and IDO2 expression by human PBMCs. After human PBMCs were treated with IFN with or without Desip, expression of A) IDO1-001, B) IDO1-005 and C) IDO2-201 was quantified. * p ≤ 0.05 for induction by IFN;  p ≤ 0.05 for the inhibitory effect of Desip within IFN.

P a g e | 87

4.5 Discussion

Elevated DO activity (Kynurenine Pathway activation) is linked to both human depression and murine depression-like symptomology (14, 15, 43, 180). Although the

Kynurenine Pathway is associated with depression, there has been no work suggesting that anti- depressant activity involves modulation of the Kynurenine Pathway. With the incidence of depression rising, discovering mechanisms associated with successful anti-depressant therapy is vital. The current study determined that the anti-depressant, Desip, was able to decrease DO and

IFN expression in the brain (hippocampus, microglia and astrocytes) and the periphery

(PBMCs). Since IFN is the most potent stimulator of Ido1 and Ido2 expression (62, 206), these data suggest that Desip can act by limiting IFN production, and thus, diminishing IFN- dependent Ido1 and Ido2 expression. However, our ex vivo work confirmed that Desip was able to directly decrease IFNinduced Ido1 and Ido2 expression by murine PBMC-T, T cells ,

OHSCs and human PBMCs. In this scenario, IFN levels are set by the experimental conditions, and thus, Desip decreased IFN activity. Overall, our data suggest for the first time that Desip acts by decreasing both IFN levels and IFN activity providing a 2-prong approach to decrease

DO expression and thus Kynurenine Pathway activation.

We and others have previously shown that Desip or its precursor imipramine block depression-like behaviors of mice (65, 100, 190-195, 207), and that Ido1 is necessary for murine depression-like behavior (11, 14, 15, 97). With the current data, we highlight a new putative mechanism for Desip's anti-depressant activity: decreasing Ido1 and Ido2 expression within the brain and periphery. Determining patient DO-responsiveness to Desip may help to explain the variable effectiveness of this drug for alleviating depression symptoms. We cannot rule out that neurotransmitters play a role in Desip-mediated decrease in DO expression in vivo, however our

P a g e | 88 ex vivo work support the hypothesis (208) that altered neurotransmitter reuptake is not always necessary for a response to Desip. It has been suggested that anti-depressants have immunomodulatory actions outside of their ability to inhibit neurotransmitter reuptake (205).

Thus, it is not unlikely that Desip’s ability to alter Ido expression within the brain and periphery is distinct from its reuptake activity. However, confirming that the in vivo and ex vivo OHSC responses to Desip on IFN or Ido do not involve neurotransmitter signaling is outside the scope of the current manuscript.

Ido1: Ido1-FL is highly inducible and tightly linked to depression-like behavior in rodent models (13, 15, 209) and provided the most consistent Desip responses in the current work. LPS increased Ido1-FL expression in the hippocampus, astrocytes, microglia and PBMCs; Desip decreased these responses. Although broadly considered a potent enhancer of Ido1 expression in vivo, LPS increases the production of multiple factors (cytokines and stress hormones/corticosteroids) which may be involved in inflammation-induced behaviors (4, 210).

Corticosteroid levels are also acutely elevated following LPS administration (211, 212). We recently reported that the synthetic glucocorticoid-receptor agonist Dex enhanced the ability of

IFN to induce Ido1-FL (1), suggesting that stress and inflammation work together to elevate central Ido1. We now show that not only can Desip suppress the ability of IFN to induce Ido1,

Desip can block the synergistic actions of Dex and IFN. Thus, Desip may suppress inflammation and stress components of Ido system. Similarly we recently reported that LPS increases the expression of galectins within the mouse brain (188). The galectins are a group of lectins that have been implicated in several central diseases and neurological disorders (66, 71,

169, 213, 214). Like, corticosteroids, Gal-9 interacted with IFN to accentuate Ido1-FL expression (188). Again, the ability of Gal-9 to enhance Ido induction was suppressed by Desip.

P a g e | 89

Ido1-v1 expression was only minimally increased by LPS. In the hippocampus, the magnitude of Ido1-FL induction by LPS was ~500-fold versus ~2-fold for Ido1-v1 indicating that Ido1-FL is far more responsive to peripheral inflammation. Astrocytes respond to LPS with elevated Ido1-FL and Ido1-v1, whereas microglia respond but only with enhanced Ido1-FL expression. These data confirm previous work that murine microglial and astrocyte Ido1 expression can be similarly induced by IFN (120, 215), but extend those findings to show that this is true when quantifying Ido1-FL. We also found that astrocytes had increased Ido1-v1 expression in response to Dex suggesting that astrocytes play a unique role in the overall increase of Ido1 associated with both inflammation- and stress-induced depression-like behaviors. These data challenge the dogma that inflammation induced depression-like behaviors are solely driven by microglial Ido1-FL induction (15, 216).

Astrocytes generate the downstream kynurenine metabolite (kynurenic acid, KynA), a glutamate and acetylcholine receptor antagonist (39, 118, 217). KynA antagonizes the action of quinolinic acid and 3-hydroxykynurenine (glutamate receptor agonists), kynurenine metabolites from microglia (118, 123, 144, 218). Thus, astrocyte and microglia responses to inflammation lead to elevated levels of neurotransmitter antagonists and agonists (118, 123, 144, 218), resulting in what we have termed the 'Confused Brain' (165). Altered microglial and astrocyte density and pathology associated with depression reflect this imbalance (218-221). Both astrocyte and microglial Ido1-FL expression appear to be sensitive to anti-depressant treatment

(222, 223), indicating that both aspects of this 'confusion' are alleviated by Desip.

Possibly the most interesting aspect of these data is the PBMC response. Numerous studies have suggested that Ido1 in dendritic (224) and NK cells (225) produce Kyn to modulate the peripheral immune system (173, 224, 226, 227). Clinical studies suggest a link between this

P a g e | 90 response and depression (43, 180), connecting peripheral DO activity and MDD. Since Ido1-FL expression by PBMCs was increased in response to LPS (in vivo) and IFN (ex vivo) and blocked by Desip, our work clearly shows that Desip diminishes both CNS and peripheral DO expression.

Ido2: The primary source of brain Ido2 is neurons (125). As neither Ido2-v1 nor Ido2-v3 expression in the hippocampus (an area rich with neurons) was increased by LPS, there was no response for Desip to inhibit. This suggests that because of low in vivo basal expression, the

LPS-induced changes in Ido2-v1 within astrocytes and Ido2-v3 in both astrocytes and microglia were insufficient to impact total hippocampal Ido2. These data suggest that neuronal Ido2 is unaltered by LPS or Desip. LPS-increased Ido2 expression by microglia (Ido2-v1 and Ido2-v3).

The effect of LPS on microglia was amplified by Desip. This synergy was not found with astrocytes, PMBCs or OHSCs. These data suggest a cell-specific response. At this point, relatively little is known about Ido2 function, and thus, we can only speculate as to the significance of this synergy. However, Ido2 has a role as a negative regulator of Ido1 activity.

Ido2 competes with Ido1 for heme-binding. In doing so, Ido2 (with its lower enzymatic activity) effectively diminishes Kyn production (228). Confirming such an Ido1-inhibitory effect by Ido2- induction in microglia (which produce QuinA) but not in astrocytes (which produce KynA), would support a Desip-induced balance from QuinA (neurotoxic) to KynA (neuroprotective) within the brain. Such an action supports our theory that Desip alters Kyn impact via its ability to control DO expression. In contrast, addition of IFN to OHSCs is sufficient to elicit a direct and detectable Ido2-inducing response. IFN induction of Ido2-v1 is resistant, but Ido2-v3 induction is inhibited by Desip. However, the synergy between IFN and Gal-9 on Ido2-v1 expression is

P a g e | 91 blocked by Desip; albeit by undefined cell types. Interpreting the physiological impact of these

Ido2 responses will require additional studies, but clearly indicate a complex pattern of regulation.

In the periphery, LPS increased Ido2-v1 and Ido2-v3 expression by PBMCs, responses that were attenuated by Desip. The inhibitory effect of Desip was found with PBMC-T and T cells. Our data indicate that specific cell types need to be further studied to obtain an accurate view of Ido2 regulation in response to inflammation (188), stress (1) or anti-depressants. These data further support our conclusion that brain and peripheral Ido1 as well as peripheral Ido2 expression are modulated by the anti-depressant Desip.

IFN LPS increased IFN expression in hippocampi, microglia and PBMCs. These effects were decreased by Desip, confirming previous reports of the anti-inflammatory potential of anti-depressants (204, 205, 229, 230). In contrast, OHSCs did not express IFN clearly indicating that Desip was not inhibiting DO expression via diminished IFN production ex vivo.

The in vivo results suggest that neuroinflammation and concurrent elevation of DOs may be tempered by Desip partly via tempering IFN expression (204, 205). However, the OHSC results strongly suggest that in the absence of endogenous IFN, Desip is able to directly block the ability of added IFN to drive DO expression; the mechanism by which Desip attenuates DO expression is currently unknown, but under investigation.

As OHSCs do not express IFN, it is clear that Desip is not acting ex vivo by suppressing endogenous IFN production. However, in vivo, Desip could suppress Ido1 induction by altering

IFN access to the brain. We found that circulating IFN protein levels are increased by LPS and diminished by Desip. IFN enters the brain parenchyma from the circulation via a saturable transport system (231). By decreasing circulating IFN, Desip should diminish brain IFN levels and thus Ido1 induction. IFN can also be released directly into the brain by PMBCs that have

P a g e | 92 infiltrated the brain. Neutrophils and macrophages are capable of producing IFN and both infiltrate the brain following peripheral LPS injection (232, 233). By diminishing IFN expression by PBMCs, Desip can diminish IFN-production by PBMCs within the brain and thus reduce Ido induction.

PBMCs: Multiple cell types (monocytes, dendritic cells, NK cells and B cells) respond to

IFN by increasing Ido1 expression (225, 234-236). Thus, it is likely that several cell types in the human and murine PBMC responded to IFN. At this point it is unclear which cell type(s) was blocked by Desip. However, due to the near complete inhibition of Ido1expression, it’s clear that most cells were responding to Desip. To the best of our knowledge, this is the first report that T cells respond to IFN with elevated DO expression, which was diminished by Desip, similar to

PBMC-Ts. Similar to murine PBMC’s, IFN increased IDO-001 and IDO2-201 expression in human PBMCs, effects completely blocked by Desip. These data indicate that it may be possible to use DO regulation by an easily obtainable sample (PBMCs) to characterize anti-depressant responsiveness of patients.

Conclusion: The inhibitory effect of Desip on gene expression is not a general effect on transcription activity. In fact, Desip increased Ido2 expression by microglia. More importantly,

Desip did not decrease a number of genes in any of our murine models (examples: Haao, Kat2,

Maoa, Qprt, Tdo2, IL-6 and Ccl5/RANTES). Desip decreased LPS- and IFN-induced expression of Ido1 and Ido2 in peripheral cells (PBMCs, PBMCs-T and T cells), resident brain cells (astrocytes and microglia), hippocampi and OHSCs; albeit increasing microglial Ido2. As elevated DO activity is involved in both human and mouse depression-like behaviors (14, 15, 43,

180), Desip's ability to block DO expression suggests an additional activity for this anti- depressant drug (Figure 25). Our data suggest that regulation of DO expression, in particular

P a g e | 93

Ido1-FL, in brain and PBMCs are similarly responsive to this anti-depressant. These pioneering data offer insight into both peripheral and brain regulation of Ido1 and Ido2 during inflammation- or stressed-induced depression. We propose that monitoring anti-depressant responsiveness by assessing DO regulation in a clinically relevant sample, e.g. PBMCs, may be suitable for determining drug responsiveness on a case-by-case basis.

Figure 25. Proposed model for Desip blocking Kynurenine Pathway activation in brain and periphery. Multiple studies have linked inflammation and stress with major depression in humans and depressive-like behaviors in rodent models. Inflammation or stress increase peripheral pro-inflammatory cytokine release (ex. IFN into the circulation, which increases Ido expression by PBMCs and most tissues. Either peripheral IFN or infiltrating immune cells capable of producing IFN enter the brain to increase Ido expression by both microglia and astrocytes. We've extended this area of research by confirming that Desip can act in vivo by 1) blocking peripheral IFN expression as a mechanism to decrease Ido expression by PBMCs, microglia and astrocytes. 2) Ex vivo, IFN increases Ido expression by PBMCs (both human and mouse) and synergizes with multiple factors (i.e. Dex or Gal-9) to increase the DOs within the brain. As such, we now show that Desip is able to directly block IFN- dependent Ido induction in both peripheral cells (human and murine PBMCs) and within OHSCs. The later findings suggest that 3) Desip would also act to directly block DO expression in the periphery and brain by attenuating IFN activity. Kynurenine Pathway activation (via the DOs) results in production of additional downstream kynurenine metabolites (kynurenines: quinolinic acid: QuinA and kynurenic acid: KynA) that directly alter behavior and immune activity. Thus, Desip is able to modulate DO- dependent behavior and immune responses indirectly by regulating IFN expression and directly by blocking IFN activity, both in the brain and periphery.

P a g e | 94

CHAPTER 5: Conclusion

5.1 Conclusion

This work has shown that complex, intersecting pathways: inflammatory (IFN) and either stress (corticosteroids) or galectins (Gal-9), can induce the expression of the rate-limiting enzymes of the Kynurenine Pathway in the brain. Furthermore, we confirmed that IFN is a major inducer of Ido1 expression in the hippocampus, while multiple inflammatory mediators

(i.e. IFN, LPS, pI:C) increase hippocampal Ido2 transcript expression, glucocorticoids increase

Tdo2-FL and Gal-9 increases Tdo2-v1 and Tdo2-v2. In addition, this work emphasizes the importance of clarifying the intricate regulation of DO expression in the mouse brain, as the interactions are shown to accentuate specific Ido1, Ido2 and Tdo2 transcripts. Finally, we discovered that an anti-depressant Desip is able to decrease expression of the DOs within the brain and periphery, and interestingly, and this anti-depressant is furthermore able to block the synergy between inflammatory mediators and corticosteroids or Gal-9. With the expansive population requiring treatment to battle depression, this potential new mechanism for anti- depressant efficacy could be critical in helping decide first-line choices of anti-depressants for inflammation-induced depression in patients. Together, these data confirm that it is crucial to understand the connections between overlapping pathways activating the Kynurenine Pathway, and this knowledge is directly applicable to effectively treating patients with depression.

With the understanding that regulation of the DOs is both complex and potentially is unique to the individual, it now becomes crucial to determine ways to specifically block expression of individual DO isoforms. One way that could be investigated is the ability of

CRISPR-Cas9 to block induction of specific DO variants by removing exons found only in the inflammation-inducible transcripts, such as eliminating exon 1 from the Ido1 gene so that the

P a g e | 95

Ido1-FL transcript could not be produced. With CRISPR-Cas9 currently being used in clinical trials, this technique could potentially benefit a large population drastically affected by depression associated with cancer or other neurological/autoimmune conditions. In addition, we propose that DO transcript regulation could be controlled by multiple promoters; however, this intricate regulation of the DOs is still undefined. We believe that STAT1/5 signaling may be involved in initiating transcription of Ido1-FL, so potentially blocking STAT1/5 binding to the promoter may be able to block the large induction of Ido1-FL following inflammation x stress while not affecting basal Ido1-v1 expression. Finally, creating miRNA or siRNA to complementarily bind to specific DO transcripts could also be a way to block the large induction of DO transcripts (i.e. Ido1-FL). This could be tailored to blocking these transcripts only in specific cell types, but this could be an incredibly useful tool for the future.

P a g e | 96

5.2 Additional Completed work:

1) Inflammatory mediators and corticosteroids interact to regulate expression of Kynurenine

Pathway enzymes in neurons, endothelial cells, and microglia

o Following our previous work showing an interaction between IFN and

corticosteroids to accentuate Ido1 and Ido2 expression by OHSCs (Chapter 2), I

treated Neuro2a (neuronal), bEnd.3 (endothelial), C8-B4 (microglia) and 1°-microglia

with inflammatory mediators and corticosteroids to determine which cell type in the

brain could be responsible for accentuated Ido1 and Ido2 within the hippocampus.

We found that IFN increased expression of Ido1 and Ido2 by Neuro2a, C8-B4/1°-

microglia and bEnd.3 cells with Dex accentuating expression of Ido1 and Ido2 by

endothelial cells but attenuating expression of Ido1 and Ido2 by microglia. Finally,

Dex increased Tdo2-FL expression only by Neuro2a cells.

2) Inflammatory mediators and galectins interact to regulate expression of Kynurenine Pathway

enzymes in neurons, endothelial cells, and microglia

o Following our previous work showing an interaction between IFN and Gal-9 to

accentuate Ido1 and Ido2 expression by OHSCs (Chapter 3), I treated Neuro2a

(neuronal), bEnd.3 (endothelial), C8-B4 (microglia) and 1°-microglia with

inflammatory mediators and Gal-9 to determine which cell type in the brain could be

responsible for accentuated Ido1 and Ido2 within the hippocampus. We found that

IFN increased expression of Ido1 and Ido2 by C8-B4/1°-microglia and both IFN

and pI:C increased Ido1 and Ido2 expression by bEnd.3 cells. Gal-9 synergized with

IFN to accentuated Ido1-FL and Ido2-v1 expression by microglia, suggesting that

P a g e | 97

the interaction seen within OHSCs was mediated by changes in microglial Ido1 and

Ido2 expression.

3) Expression and regulation of Kynurenine Pathway enzymes in human cancer cells

o Previously we found that both murine microglia and bEnd.3 cells respond to both

inflammatory mediators and corticosteroids with IFN x Dex attenuating Ido1 and

Ido2 expression by microglia and accentuating expression by bEnd.3 cells. We

wanted to confirm that this work would extend to human cells, and thus, treated

T98G, SH-SY5Y and THP-1 cells with inflammatory mediators with or without Dex.

Interestingly, IFN increased Ido1 transcripts expression by T98G, SH-SY5Y and

THP-1 cells. While Dex synergized with IFN to accentuate Ido1 expression by SH-

SY5Y and THP-1 cells, Dex also synergized with IFN to accentuate Ido2 expression

by T98G cells. This exciting work again suggests that, similar to the murine cells

within the brain, regulation of human Ido1 and Ido2 expression is unique and can be

controlled by both cell-type and transcript-specific changes.

4) The disparate regulation of Kynurenine Pathway enzymes following inflammation and Desip

or Fluoxetine treatment in the mouse hippocampus and striatum

o Similar to Chapter 4, we investigated the ability for both Desip and fluoxetine (Fluox)

to attenuate LPS-induced Ido1 and Ido2 expression in both the hippocampus and

striatum. In the striatum and hippocampus, LPS increased Ido1-FL expression (~500-

fold) and excitingly, both Desip and Fluox attenuated this response. We hypothesize

that the increase of Ido1-FL expression within the striatum and hippocampus is

mediated by LPS-increased IFN activity and thus, quantified IFN protein levels

within the plasma and IFN receptor (IFNR) expression within the brain. We found

P a g e | 98

that LPS increased both IFN protein levels within the plasma and IFNR expression.

Both Desip and Fluox attenuated the LPS-induced IFN protein levels, while Fluox

decreased expression of IFNR. Together, these data suggest that both anti-

depressants are able to decrease Ido1-FL expression via blocking IFN signaling: by

decreasing plasma IFN levels and decrease IFNR within the brain.

5) Collaborative project with Dr. Steelman: The role of Indoleamine-2,3- dioxygenase in

Theiler's Murine Encephalomyelitis Virus infection

o In collaboration with Dr. Steelman’s lab, we were interested in determining the role

of Ido1 and Ido2 in Theiler's Murine Encephalomyelitis Virus (TMEV) infection. We

infected C57Bl6J wild-type (WT), Ido1 knock-out (KO), Ido1-T Cre and Ido2-T Cre

mice with TMEV and found that Ido1-KO/-T Cre mice had increased total seizures

compared to WT mice when watched during the afternoon (2-4 pm), while Ido2-T

Cre mice had decreased seizures compared to WT mice when watched during the

morning (8-10am). These data suggest that both Ido1 and Ido2 have important roles

during viral pathogenesis and clearance.

P a g e | 99

REFERENCES

1. Brooks AK, Lawson MA, Smith RA, Janda TM, Kelley KW, McCusker RH. Interactions between inflammatory mediators and corticosteroids regulate transcription of genes within the Kynurenine Pathway in the mouse hippocampus. J Neuroinflammation. 2016;13(1):98. 2. Swardfager W, Rosenblat JD, Benlamri M, McIntyre RS. Mapping inflammation onto mood: Inflammatory mediators of anhedonia. Neurosci Biobehav Rev. 2016;64:148-66. 3. Piser TM. Linking the cytokine and neurocircuitry hypotheses of depression: a translational framework for discovery and development of novel anti-depressants. Brain Behav Immun. 2010;24(4):515-24. 4. Dantzer R, O'Connor JC, Freund GG, Johnson RW, Kelley KW. From inflammation to sickness and depression: when the immune system subjugates the brain. Nat Rev Neurosci. 2008;9(1):46-56. 5. Miller AH, Maletic V, Raison CL. Inflammation and its discontents: the role of cytokines in the pathophysiology of major depression. Biol Psychiatry. 2009;65(9):732-41. 6. Raison CL, Borisov AS, Majer M, Drake DF, Pagnoni G, Woolwine BJ, et al. Activation of central nervous system inflammatory pathways by interferon-alpha: relationship to monoamines and depression. Biol Psychiatry. 2009;65(4):296-303. 7. Capuron L, Ravaud A, Neveu PJ, Miller AH, Maes M, Dantzer R. Association between decreased serum tryptophan concentrations and depressive symptoms in cancer patients undergoing cytokine therapy. Mol Psychiatry. 2002;7(5):468-73. 8. Makhija K, Karunakaran S. The role of inflammatory cytokines on the aetiopathogenesis of depression. Aust N Z J Psychiatry. 2013;47(9):828-39. 9. Dantzer R, O'Connor JC, Lawson MA, Kelley KW. Inflammation-associated depression: from serotonin to kynurenine. Psychoneuroendocrinology. 2011;36(3):426-36. 10. Fu X, Zunich SM, O'Connor JC, Kavelaars A, Dantzer R, Kelley KW. Central administration of lipopolysaccharide induces depressive-like behavior in vivo and activates brain indoleamine 2,3 dioxygenase in murine organotypic hippocampal slice cultures. J Neuroinflammation. 2010;7:43. 11. Lawson MA, Parrott JM, McCusker RH, Dantzer R, Kelley KW, O'Connor JC. Intracerebroventricular administration of lipopolysaccharide induces indoleamine-2,3- dioxygenase-dependent depression-like behaviors. J Neuroinflammation. 2013;10:87. 12. Moreau M, Andre C, O'Connor JC, Dumich SA, Woods JA, Kelley KW, et al. Inoculation of Bacillus Calmette-Guerin to mice induces an acute episode of sickness behavior followed by chronic depressive-like behavior. Brain Behav Immun. 2008;22(7):1087-95. 13. O'Connor JC, Andre C, Wang Y, Lawson MA, Szegedi SS, Lestage J, et al. Interferon- gamma and tumor necrosis factor-alpha mediate the upregulation of indoleamine 2,3- dioxygenase and the induction of depressive-like behavior in mice in response to bacillus Calmette-Guerin. J Neurosci. 2009;29(13):4200-9. 14. O'Connor JC, Lawson MA, Andre C, Briley EM, Szegedi SS, Lestage J, et al. Induction of IDO by bacille Calmette-Guerin is responsible for development of murine depressive- like behavior. J Immunol. 2009;182(5):3202-12.

P a g e | 100

15. O'Connor JC, Lawson MA, Andre C, Moreau M, Lestage J, Castanon N, et al. Lipopolysaccharide-induced depressive-like behavior is mediated by indoleamine 2,3- dioxygenase activation in mice. Mol Psychiatry. 2009;14(5):511-22. 16. Pace TW, Hu F, Miller AH. Cytokine-effects on glucocorticoid receptor function: relevance to glucocorticoid resistance and the pathophysiology and treatment of major depression. Brain Behav Immun. 2007;21(1):9-19. 17. De Kloet ER, Vreugdenhil E, Oitzl MS, Joels M. Brain corticosteroid receptor balance in health and disease. Endocr Rev. 1998;19(3):269-301. 18. Ekthuwapranee K, Sotthibundhu A, Tocharus C, Govitrapong P. Melatonin ameliorates dexamethasone-induced inhibitory effects on the proliferation of cultured progenitor cells obtained from adult rat hippocampus. J Steroid Biochem Mol Biol. 2015;145:38-48. 19. Murck H, Buttner M, Kircher T, Konrad C. Genetic, molecular and clinical determinants for the involvement of aldosterone and its receptors in major depression. Nephron Physiol. 2014;128(1-2):17-25. 20. Vedantham K, Brunet A, Neylan TC, Weiss DS, Mannar CR. Neurobiological findings in posttraumatic stress disorder: a review. Dialogues Clin Neurosci. 2000;2(1):23-9. 21. Pariante CM, Miller AH. Glucocorticoid receptors in major depression: relevance to pathophysiology and treatment. Biol Psychiatry. 2001;49(5):391-404. 22. Walder DJ, Walker EF, Lewine RJ. Cognitive functioning, cortisol release, and symptom severity in patients with schizophrenia. Biol Psychiatry. 2000;48(12):1121-32. 23. Emanuele E, Geroldi D, Minoretti P, Coen E, Politi P. Increased plasma aldosterone in patients with clinical depression. Arch Med Res. 2005;36(5):544-8. 24. Murck H, Held K, Ziegenbein M, Kunzel H, Koch K, Steiger A. The renin-angiotensin- aldosterone system in patients with depression compared to controls--a sleep endocrine study. BMC Psychiatry. 2003;3:15. 25. Hlavacova N, Wes PD, Ondrejcakova M, Flynn ME, Poundstone PK, Babic S, et al. Subchronic treatment with aldosterone induces depression-like behaviours and gene expression changes relevant to major depressive disorder. Int J Neuropsychopharmacol. 2012;15(2):247-65. 26. Skupio U, Tertil M, Sikora M, Golda S, Wawrzczak-Bargiela A, Przewlocki R. Behavioral and molecular alterations in mice resulting from chronic treatment with dexamethasone: relevance to depression. Neuroscience. 2015;286:141-50. 27. Zhang JQ, Wu XH, Feng Y, Xie XF, Fan YH, Yan S, et al. Salvianolic acid B ameliorates depressive-like behaviors in chronic mild stress-treated mice: involvement of the neuroinflammatory pathway. Acta Pharmacol Sin. 2016;37(9):1141-53. 28. van Donkelaar EL, Vaessen KR, Pawluski JL, Sierksma AS, Blokland A, Canete R, et al. Long-term corticosterone exposure decreases insulin sensitivity and induces depressive- like behaviour in the C57BL/6NCrl mouse. PLoS One. 2014;9(10):e106960. 29. Gawali NB, Bulani VD, Gursahani MS, Deshpande PS, Kothavade PS, Juvekar AR. Agmatine attenuates chronic unpredictable mild stress-induced anxiety, depression-like behaviours and cognitive impairment by modulating nitrergic signalling pathway. Brain Res. 2017;1663:66-77. 30. Bay-Richter C, Hallberg L, Ventorp F, Janelidze S, Brundin L. Aldosterone synergizes with peripheral inflammation to induce brain IL-1beta expression and depressive-like effects. Cytokine. 2012;60(3):749-54.

P a g e | 101

31. Sonino N, Tomba E, Genesia ML, Bertello C, Mulatero P, Veglio F, et al. Psychological assessment of primary aldosteronism: a controlled study. J Clin Endocrinol Metab. 2011;96(6):E878-83. 32. Franklin M, Bermudez I, Hlavacova N, Babic S, Murck H, Schmuckermair C, et al. Aldosterone increases earlier than corticosterone in new animal models of depression: is this an early marker? J Psychiatr Res. 2012;46(11):1394-7. 33. Opstad PK, Oktedalen O, Aakvaag A, Fonnum F, Lund PK. Plasma renin activity and serum aldosterone during prolonged physical strain. The significance of sleep and energy deprivation. Eur J Appl Physiol Occup Physiol. 1985;54(1):1-6. 34. Sonino N, Fava GA, Raffi AR, Boscaro M, Fallo F. Clinical correlates of major depression in Cushing's disease. Psychopathology. 1998;31(6):302-6. 35. Richard DM, Dawes MA, Mathias CW, Acheson A, Hill-Kapturczak N, Dougherty DM. L-Tryptophan: Basic Metabolic Functions, Behavioral Research and Therapeutic Indications. Int J Tryptophan Res. 2009;2:45-60. 36. Schwarcz R, Pellicciari R. Manipulation of brain kynurenines: glial targets, neuronal effects, and clinical opportunities. J Pharmacol Exp Ther. 2002;303(1):1-10. 37. Ganong AH, Lanthorn TH, Cotman CW. Kynurenic acid inhibits synaptic and acidic amino acid-induced responses in the rat hippocampus and spinal cord. Brain Res. 1983;273(1):170-4. 38. Curras MC, Dingledine R. Selectivity of amino acid transmitters acting at N-methyl-D- aspartate and amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptors. Mol Pharmacol. 1992;41(3):520-6. 39. Hilmas C, Pereira EF, Alkondon M, Rassoulpour A, Schwarcz R, Albuquerque EX. The brain metabolite kynurenic acid inhibits alpha7 nicotinic receptor activity and increases non-alpha7 nicotinic receptor expression: physiopathological implications. J Neurosci. 2001;21(19):7463-73. 40. Yan EB, Frugier T, Lim CK, Heng B, Sundaram G, Tan M, et al. Activation of the kynurenine pathway and increased production of the excitotoxin quinolinic acid following traumatic brain injury in humans. J Neuroinflammation. 2015;12:110. 41. Guillemin GJ, Meininger V, Brew BJ. Implications for the kynurenine pathway and quinolinic acid in amyotrophic lateral sclerosis. Neurodegener Dis. 2005;2(3-4):166-76. 42. Jong-Min L, Tan V, Lovejoy D, Braidy N, Rowe DB, Brew BJ, et al. Involvement of quinolinic acid in the neuropathogenesis of amyotrophic lateral sclerosis. Neuropharmacology. 2016. 43. Baranyi A, Meinitzer A, Breitenecker RJ, Amouzadeh-Ghadikolai O, Stauber R, Rothenhausler HB. Quinolinic Acid Responses during Interferon-alpha-Induced Depressive Symptomatology in Patients with Chronic Hepatitis C Infection - A Novel Aspect for Depression and Inflammatory Hypothesis. PLoS One. 2015;10(9):e0137022. 44. Raison CL, Dantzer R, Kelley KW, Lawson MA, Woolwine BJ, Vogt G, et al. CSF concentrations of brain tryptophan and kynurenines during immune stimulation with IFN- alpha: relationship to CNS immune responses and depression. Mol Psychiatry. 2010;15(4):393-403. 45. Sathyasaikumar KV, Stachowski EK, Wonodi I, Roberts RC, Rassoulpour A, McMahon RP, et al. Impaired kynurenine pathway metabolism in the prefrontal cortex of individuals with schizophrenia. Schizophr Bull. 2011;37(6):1147-56.

P a g e | 102

46. Olsson S. Elevated levels of kynurenic acid in the cerebrospinal fluid of patients with bipolar disorder. Journal of Psychiatry & Neuroscience. 2010;35(3):195-9. 47. Courtet P, Giner L, Seneque M, Guillaume S, Olie E, Ducasse D. Neuroinflammation in suicide: Toward a comprehensive model. World J Biol Psychiatry. 2015:1-23. 48. Metz R, Duhadaway JB, Kamasani U, Laury-Kleintop L, Muller AJ, Prendergast GC. Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of the antitumor indoleamine 2,3-dioxygenase inhibitory compound D-1-methyl-tryptophan. Cancer Res. 2007;67(15):7082-7. 49. de Faudeur G, de Trez C, Muraille E, Leo O. Normal development and function of dendritic cells in mice lacking IDO-1 expression. Immunol Lett. 2008;118(1):21-9. 50. Jung ID, Lee MG, Chang JH, Lee JS, Jeong YI, Lee CM, et al. Blockade of indoleamine 2,3-dioxygenase protects mice against lipopolysaccharide-induced endotoxin shock. J Immunol. 2009;182(5):3146-54. 51. Mazarei G, Budac DP, Lu G, Lee H, Moller T, Leavitt BR. The absence of indoleamine 2,3-dioxygenase expression protects against NMDA receptor-mediated excitotoxicity in mouse brain. Exp Neurol. 2013;249:144-8. 52. Metz R, Smith C, DuHadaway JB, Chandler P, Baban B, Merlo LM, et al. IDO2 is critical for IDO1-mediated T-cell regulation and exerts a non-redundant function in inflammation. Int Immunol. 2014;26(7):357-67. 53. Merlo LM, Pigott E, DuHadaway JB, Grabler S, Metz R, Prendergast GC, et al. IDO2 is a critical mediator of autoantibody production and inflammatory pathogenesis in a mouse model of autoimmune arthritis. J Immunol. 2014;192(5):2082-90. 54. Funakoshi, Masaaki K, Toshikazu N. Modulation of Tryptophan Metabolism, Promotion of Neurogenesis and Alteration of Anxiety-Related Behavior in Tryptophan 2,3- Dioxygenase-Deficient Mice. International Journal of Tryptophan Research. 2011:7. 55. Kanai M, Funakoshi H, Takahashi H, Hayakawa T, Mizuno S, Matsumoto K, et al. Tryptophan 2,3-dioxygenase is a key modulator of physiological neurogenesis and anxiety-related behavior in mice. Mol Brain. 2009;2:8. 56. Mahmoud ME, Ihara F, Fereig RM, Nishimura M, Nishikawa Y. Induction of depression- related behaviors by reactivation of chronic Toxoplasma gondii infection in mice. Behav Brain Res. 2016;298(Pt B):125-33. 57. Kim SB, Choi JY, Uyangaa E, Patil AM, Hossain FM, Hur J, et al. Blockage of indoleamine 2,3-dioxygenase regulates Japanese encephalitis via enhancement of type I/II IFN innate and adaptive T-cell responses. J Neuroinflammation. 2016;13(1):79. 58. Gibney SM, McGuinness B, Prendergast C, Harkin A, Connor TJ. Poly I:C-induced activation of the immune response is accompanied by depression and anxiety-like behaviours, kynurenine pathway activation and reduced BDNF expression. Brain Behav Immun. 2013;28:170-81. 59. Lob S, Konigsrainer A, Rammensee HG, Opelz G, Terness P. Inhibitors of indoleamine- 2,3-dioxygenase for cancer therapy: can we see the wood for the trees? Nat Rev Cancer. 2009;9(6):445-52. 60. Kanai M, Nakamura T, Funakoshi H. Identification and characterization of novel variants of the tryptophan 2,3-dioxygenase gene: differential regulation in the mouse nervous system during development. Neurosci Res. 2009;64(1):111-7.

P a g e | 103

61. Croitoru-Lamoury J, Lamoury FM, Caristo M, Suzuki K, Walker D, Takikawa O, et al. Interferon-gamma regulates the proliferation and differentiation of mesenchymal stem cells via activation of indoleamine 2,3 dioxygenase (IDO). PLoS One. 2011;6(2):e14698. 62. Hughes MM, Connor TJ, Harkin A. Stress-Related Immune Markers in Depression: Implications for Treatment. Int J Neuropsychopharmacol. 2016. 63. Priya PK, Rajappa M, Kattimani S, Mohanraj PS, Revathy G. Association of neurotrophins, inflammation and stress with suicide risk in young adults. Clin Chim Acta. 2016;457:41-5. 64. Couch Y, Trofimov A, Markova N, Nikolenko V, Steinbusch HW, Chekhonin V, et al. Low-dose lipopolysaccharide (LPS) inhibits aggressive and augments depressive behaviours in a chronic mild stress model in mice. J Neuroinflammation. 2016;13(1):108. 65. Elgarf AS, Aboul-Fotouh S, Abd-Alkhalek HA, El Tabbal M, Hassan AN, Kassim SK, et al. Lipopolysaccharide repeated challenge followed by chronic mild stress protocol introduces a combined model of depression in rats: reversibility by imipramine and pentoxifylline. Pharmacol Biochem Behav. 2014;126:152-62. 66. Liu FT, Rabinovich GA. Galectins: regulators of acute and chronic inflammation. Ann N Y Acad Sci. 2010;1183:158-82. 67. Parikh NU, Aalinkeel R, Reynolds JL, Nair BB, Sykes DE, Mammen MJ, et al. Galectin- 1 suppresses methamphetamine induced neuroinflammation in human brain microvascular endothelial cells: Neuroprotective role in maintaining blood brain barrier integrity. Brain Res. 2015;1624:175-87. 68. Shin T. The pleiotropic effects of galectin-3 in neuroinflammation: a review. Acta Histochem. 2013;115(5):407-11. 69. Chen HL, Liao F, Lin TN, Liu FT. Galectins and neuroinflammation. Adv Neurobiol. 2014;9:517-42. 70. Burman J, Svenningsson A. Cerebrospinal fluid concentration of Galectin-9 is increased in secondary progressive multiple sclerosis. J Neuroimmunol. 2016;292:40-4. 71. Stancic M, van Horssen J, Thijssen VL, Gabius HJ, van der Valk P, Hoekstra D, et al. Increased expression of distinct galectins in multiple sclerosis lesions. Neuropathol Appl Neurobiol. 2011;37(6):654-71. 72. Mazarei G, Budac DP, Lu G, Adomat H, Tomlinson Guns ES, Moller T, et al. Age- dependent alterations of the kynurenine pathway in the YAC128 mouse model of Huntington disease. J Neurochem. 2013;127(6):852-67. 73. Stoy N, Mackay GM, Forrest CM, Christofides J, Egerton M, Stone TW, et al. Tryptophan metabolism and oxidative stress in patients with Huntington's disease. J Neurochem. 2005;93(3):611-23. 74. Wu W, Nicolazzo JA, Wen L, Chung R, Stankovic R, Bao SS, et al. Expression of tryptophan 2,3-dioxygenase and production of kynurenine pathway metabolites in triple transgenic mice and human Alzheimer's disease brain. PLoS One. 2013;8(4):e59749. 75. Yu D, Tao BB, Yang YY, Du LS, Yang SS, He XJ, et al. The IDO inhibitor coptisine ameliorates cognitive impairment in a mouse model of Alzheimer's disease. J Alzheimers Dis. 2015;43(1):291-302. 76. Bonda DJ, Mailankot M, Stone JG, Garrett MR, Staniszewska M, Castellani RJ, et al. Indoleamine 2,3-dioxygenase and 3-hydroxykynurenine modifications are found in the neuropathology of Alzheimer's disease. Redox Rep. 2010;15(4):161-8.

P a g e | 104

77. Guillemin GJ, Brew BJ, Noonan CE, Takikawa O, Cullen KM. Indoleamine 2,3 dioxygenase and quinolinic acid immunoreactivity in Alzheimer's disease hippocampus. Neuropathol Appl Neurobiol. 2005;31(4):395-404. 78. Mancuso R, Hernis A, Agostini S, Rovaris M, Caputo D, Fuchs D, et al. Indoleamine 2,3 Dioxygenase (IDO) Expression and Activity in Relapsing-Remitting Multiple Sclerosis. PLoS One. 2015;10(6):e0130715. 79. Chen Y, Stankovic R, Cullen KM, Meininger V, Garner B, Coggan S, et al. The kynurenine pathway and inflammation in amyotrophic lateral sclerosis. Neurotox Res. 2010;18(2):132-42. 80. Andrade L, Caraveo-Anduaga JJ, Berglund P, Bijl RV, De Graaf R, Vollebergh W, et al. The epidemiology of major depressive episodes: results from the International Consortium of Psychiatric Epidemiology (ICPE) Surveys. Int J Methods Psychiatr Res. 2003;12(1):3-21. 81. Kantor ED, Rehm CD, Haas JS, Chan AT, Giovannucci EL. Trends in Prescription Drug Use Among Adults in the United States From 1999-2012. JAMA. 2015;314(17):1818-31. 82. Krishnadas R, Cavanagh J. Depression: an inflammatory illness? J Neurol Neurosurg Psychiatry. 2012;83(5):495-502. 83. Lo Fermo S, Barone R, Patti F, Laisa P, Cavallaro TL, Nicoletti A, et al. Outcome of psychiatric symptoms presenting at onset of multiple sclerosis: a retrospective study. Mult Scler. 2010;16(6):742-8. 84. Constant A, Castera L, Dantzer R, Couzigou P, de Ledinghen V, Demotes-Mainard J, et al. Mood alterations during interferon-alfa therapy in patients with chronic hepatitis C: evidence for an overlap between manic/hypomanic and depressive symptoms. J Clin Psychiatry. 2005;66(8):1050-7. 85. Bonaccorso S, Puzella A, Marino V, Pasquini M, Biondi M, Artini M, et al. Immunotherapy with interferon-alpha in patients affected by chronic hepatitis C induces an intercorrelated stimulation of the cytokine network and an increase in depressive and anxiety symptoms. Psychiatry Res. 2001;105(1-2):45-55. 86. Kirsch I, Sapirstein G. Listening to Prozac but hearing placebo: A meta-analysis of antidepressant medication. Prevention & Treatment. 1998;1(2):1-16. 87. Cutler JA, Rush AJ, McMahon FJ, Laje G. Common genetic variation in the indoleamine-2,3-dioxygenase genes and antidepressant treatment outcome in major depressive disorder. J Psychopharmacol. 2012;26(3):360-7. 88. Smith AK, Simon JS, Gustafson EL, Noviello S, Cubells JF, Epstein MP, et al. Association of a polymorphism in the indoleamine- 2,3-dioxygenase gene and interferon- alpha-induced depression in patients with chronic hepatitis C. Mol Psychiatry. 2012;17(8):781-9. 89. Oxenkrug G, Turski W, Zgrajka W, Weinstock J, Ruthazer R, Summergrad P. Disturbances of Tryptophan Metabolism and Risk of Depression in HCV Patients Treated with IFN-Alpha. J Infect Dis Ther. 2014;2(2). 90. Anuradha B, Rakh SS, Ishaq M, Murthy KJ, Valluri VL. Interferon-gamma Low producer genotype +874 overrepresented in Bacillus Calmette-Guerin nonresponding children. Pediatr Infect Dis J. 2008;27(4):325-9. 91. Pravica V, Asderakis A, Perrey C, Hajeer A, Sinnott PJ, Hutchinson IV. In vitro production of IFN-gamma correlates with CA repeat polymorphism in the human IFN- gamma gene. Eur J Immunogenet. 1999;26(1):1-3.

P a g e | 105

92. Raitala A, Pertovaara M, Karjalainen J, Oja SS, Hurme M. Association of interferon- gamma +874(T/A) single nucleotide polymorphism with the rate of tryptophan catabolism in healthy individuals. Scand J Immunol. 2005;61(4):387-90. 93. Oxenkrug GF. Interferon-gamma-inducible kynurenines/pteridines inflammation cascade: implications for aging and aging-associated psychiatric and medical disorders. J Neural Transm (Vienna). 2011;118(1):75-85. 94. Udina M, Navines R, Egmond E, Oriolo G, Langohr K, Gimenez D, et al. Glucocorticoid Receptors, Brain-Derived Neurotrophic Factor, Serotonin and Dopamine Neurotransmission are Associated with Interferon-Induced Depression. Int J Neuropsychopharmacol. 2016;19(4). 95. Szczepankiewicz A, Leszczynska-Rodziewicz A, Pawlak J, Rajewska-Rager A, Dmitrzak-Weglarz M, Wilkosc M, et al. Glucocorticoid receptor polymorphism is associated with major depression and predominance of depression in the course of bipolar disorder. J Affect Disord. 2011;134(1-3):138-44. 96. Galecka E, Szemraj J, Bienkiewicz M, Majsterek I, Przybylowska-Sygut K, Galecki P, et al. Single nucleotide polymorphisms of NR3C1 gene and recurrent depressive disorder in population of Poland. Mol Biol Rep. 2013;40(2):1693-9. 97. Salazar A, Gonzalez-Rivera BL, Redus L, Parrott JM, O'Connor JC. Indoleamine 2,3- dioxygenase mediates anhedonia and anxiety-like behaviors caused by peripheral lipopolysaccharide immune challenge. Horm Behav. 2012;62(3):202-9. 98. Andre C, O'Connor JC, Kelley KW, Lestage J, Dantzer R, Castanon N. Spatio-temporal differences in the profile of murine brain expression of proinflammatory cytokines and indoleamine 2,3-dioxygenase in response to peripheral lipopolysaccharide administration. J Neuroimmunol. 2008;200(1-2):90-9. 99. Browne CA, O'Brien FE, Connor TJ, Dinan TG, Cryan JF. Differential lipopolysaccharide-induced immune alterations in the hippocampus of two mouse strains: effects of stress. Neuroscience. 2012;225:237-48. 100. Park SE, Dantzer R, Kelley KW, McCusker RH. Central administration of insulin-like growth factor-I decreases depressive-like behavior and brain cytokine expression in mice. J Neuroinflammation. 2011;8:12. 101. Larrea E, Riezu-Boj JI, Gil-Guerrero L, Casares N, Aldabe R, Sarobe P, et al. Upregulation of indoleamine 2,3-dioxygenase in hepatitis C virus infection. J Virol. 2007;81(7):3662-6. 102. Antunes MS, Ruff JR, de Oliveira Espinosa D, Piegas MB, de Brito ML, Rocha KA, et al. Neuropeptide Y administration reverses tricyclic antidepressant treatment-resistant depression induced by ACTH in mice. Horm Behav. 2015;73:56-63. 103. Liu W, Sheng H, Xu Y, Liu Y, Lu J, Ni X. Swimming exercise ameliorates depression- like behavior in chronically stressed rats: relevant to proinflammatory cytokines and IDO activation. Behav Brain Res. 2013;242:110-6. 104. Ren S, Correia MA. Heme: a regulator of rat hepatic tryptophan 2,3-dioxygenase? Arch Biochem Biophys. 2000;377(1):195-203. 105. Liao M, Pabarcus MK, Wang Y, Hefner C, Maltby DA, Medzihradszky KF, et al. Impaired dexamethasone-mediated induction of tryptophan 2,3-dioxygenase in heme- deficient rat hepatocytes: translational control by a hepatic eIF2alpha kinase, the heme- regulated inhibitor. J Pharmacol Exp Ther. 2007;323(3):979-89.

P a g e | 106

106. Lee Y, Rio DC. Mechanisms and Regulation of Alternative Pre-mRNA Splicing. Annu Rev Biochem. 2015;84:291-323. 107. Austin CJ, Astelbauer F, Kosim-Satyaputra P, Ball HJ, Willows RD, Jamie JF, et al. Mouse and human indoleamine 2,3-dioxygenase display some distinct biochemical and structural properties. Amino Acids. 2009;36(1):99-106. 108. Ball HJ, Sanchez-Perez A, Weiser S, Austin CJ, Astelbauer F, Miu J, et al. Characterization of an indoleamine 2,3-dioxygenase-like protein found in humans and mice. Gene. 2007;396(1):203-13. 109. Pallotta MT, Orabona C, Volpi C, Vacca C, Belladonna ML, Bianchi R, et al. Indoleamine 2,3-dioxygenase is a signaling protein in long-term tolerance by dendritic cells. Nat Immunol. 2011;12(9):870-8. 110. Austin CJ, Mailu BM, Maghzal GJ, Sanchez-Perez A, Rahlfs S, Zocher K, et al. Biochemical characteristics and inhibitor selectivity of mouse indoleamine 2,3- dioxygenase-2. Amino Acids. 2010;39(2):565-78. 111. Fu X, Lawson MA, Kelley KW, Dantzer R. HIV-1 Tat activates indoleamine 2,3 dioxygenase in murine organotypic hippocampal slice cultures in a p38 mitogen-activated protein kinase-dependent manner. J Neuroinflammation. 2011;8:88. 112. Vermeer H, Hendriks-Stegeman BI, van der Burg B, van Buul-Offers SC, Jansen M. Glucocorticoid-induced increase in lymphocytic FKBP51 messenger ribonucleic acid expression: a potential marker for glucocorticoid sensitivity, potency, and bioavailability. J Clin Endocrinol Metab. 2003;88(1):277-84. 113. Reul JM, de Kloet ER. Two receptor systems for corticosterone in rat brain: microdistribution and differential occupation. Endocrinology. 1985;117(6):2505-11. 114. Shirazi SN, Friedman AR, Kaufer D, Sakhai SA. Glucocorticoids and the Brain: Neural Mechanisms Regulating the Stress Response. Adv Exp Med Biol. 2015;872:235-52. 115. Huo Y, Rangarajan P, Ling EA, Dheen ST. Dexamethasone inhibits the Nox-dependent ROS production via suppression of MKP-1-dependent MAPK pathways in activated microglia. BMC Neurosci. 2011;12:49. 116. Golde S, Coles A, Lindquist JA, Compston A. Decreased iNOS synthesis mediates dexamethasone-induced protection of neurons from inflammatory injury in vitro. Eur J Neurosci. 2003;18(9):2527-37. 117. Kozuka N, Kudo Y, Morita M. Multiple inhibitory pathways for lipopolysaccharide- and pro-inflammatory cytokine-induced nitric oxide production in cultured astrocytes. Neuroscience. 2007;144(3):911-9. 118. Guillemin GJ, Kerr SJ, Smythe GA, Smith DG, Kapoor V, Armati PJ, et al. Kynurenine pathway metabolism in human astrocytes: a paradox for neuronal protection. J Neurochem. 2001;78(4):842-53. 119. Guillemin GJ, Smith DG, Smythe GA, Armati PJ, Brew BJ. Expression of the kynurenine pathway enzymes in human microglia and macrophages. Adv Exp Med Biol. 2003;527:105-12. 120. Kwidzinski E, Bunse J, Kovac AD, Ullrich O, Zipp F, Nitsch R, et al. IDO (indolamine 2,3-dioxygenase) expression and function in the CNS. Adv Exp Med Biol. 2003;527:113- 8. 121. Alberati-Giani D, Malherbe P, Ricciardi-Castagnoli P, Kohler C, Denis-Donini S, Cesura AM. Differential regulation of indoleamine 2,3-dioxygenase expression by nitric oxide

P a g e | 107

and inflammatory mediators in IFN-gamma-activated murine macrophages and microglial cells. J Immunol. 1997;159(1):419-26. 122. Fujigaki H, Yamamoto Y, Saito K. L-Tryptophan-kynurenine pathway enzymes are therapeutic target for neuropsychiatric diseases: Focus on cell type differences. Neuropharmacology. 2016. 123. Guillemin GJ, Smythe G, Takikawa O, Brew BJ. Expression of indoleamine 2,3- dioxygenase and production of quinolinic acid by human microglia, astrocytes, and neurons. Glia. 2005;49(1):15-23. 124. Owe-Young R, Webster NL, Mukhtar M, Pomerantz RJ, Smythe G, Walker D, et al. Kynurenine pathway metabolism in human blood-brain-barrier cells: implications for immune tolerance and neurotoxicity. J Neurochem. 2008;105(4):1346-57. 125. Fukunaga M, Yamamoto Y, Kawasoe M, Arioka Y, Murakami Y, Hoshi M, et al. Studies on tissue and cellular distribution of indoleamine 2,3-dioxygenase 2: the absence of IDO1 upregulates IDO2 expression in the epididymis. J Histochem Cytochem. 2012;60(11):854-60. 126. Connor TJ, Starr N, O'Sullivan JB, Harkin A. Induction of indolamine 2,3-dioxygenase and kynurenine 3-monooxygenase in rat brain following a systemic inflammatory challenge: a role for IFN-gamma? Neurosci Lett. 2008;441(1):29-34. 127. Lestage J, Verrier D, Palin K, Dantzer R. The enzyme indoleamine 2,3-dioxygenase is induced in the mouse brain in response to peripheral administration of lipopolysaccharide and superantigen. Brain Behav Immun. 2002;16(5):596-601. 128. Fujigaki S, Saito K, Takemura M, Fujii H, Wada H, Noma A, et al. Species differences in L-tryptophan-kynurenine pathway metabolism: quantification of anthranilic acid and its related enzymes. Arch Biochem Biophys. 1998;358(2):329-35. 129. Saito K, Markey SP, Heyes MP. Effects of immune activation on quinolinic acid and neuroactive kynurenines in the mouse. Neuroscience. 1992;51(1):25-39. 130. Stocklin E, Wissler M, Gouilleux F, Groner B. Functional interactions between Stat5 and the glucocorticoid receptor. Nature. 1996;383(6602):726-8. 131. Zhang Z, Jones S, Hagood JS, Fuentes NL, Fuller GM. STAT3 acts as a co-activator of glucocorticoid receptor signaling. J Biol Chem. 1997;272(49):30607-10. 132. Langlais D, Couture C, Balsalobre A, Drouin J. The Stat3/GR interaction code: predictive value of direct/indirect DNA recruitment for transcription outcome. Mol Cell. 2012;47(1):38-49. 133. Aittomaki S, Pesu M, Groner B, Janne OA, Palvimo JJ, Silvennoinen O. Cooperation Among Stat1, Glucocorticoid Receptor, and PU.1 in Transcriptional Activation of the High-Affinity Fc Receptor I in Monocytes. The Journal of Immunology. 2000;164(11):5689-97. 134. Rogatsky I, Ivashkiv LB. Glucocorticoid modulation of cytokine signaling. Tissue Antigens. 2006;68(1):1-12. 135. Haber R, Bessette D, Hulihan-Giblin B, Durcan MJ, Goldman D. Identification of tryptophan 2,3-dioxygenase RNA in rodent brain. J Neurochem. 1993;60(3):1159-62. 136. Comings DE, Muhleman D, Dietz G, Sherman M, Forest GL. Sequence of human tryptophan 2,3-dioxygenase (TDO2): presence of a glucocorticoid response-like element composed of a GTT repeat and an intronic CCCCT repeat. Genomics. 1995;29(2):390-6. 137. Soichot M, Vaast A, Vignau J, Guillemin GJ, Lhermitte M, Broly F, et al. Characterization of functional polymorphisms and glucocorticoid-responsive elements in

P a g e | 108

the promoter of TDO2, a candidate gene for ethanol-induced behavioural disorders. Alcohol Alcohol. 2013;48(4):415-25. 138. Miller CL, Llenos IC, Dulay JR, Barillo MM, Yolken RH, Weis S. Expression of the kynurenine pathway enzyme tryptophan 2,3-dioxygenase is increased in the frontal cortex of individuals with schizophrenia. Neurobiol Dis. 2004;15(3):618-29. 139. Miller CL, Llenos IC, Dulay JR, Weis S. Upregulation of the initiating step of the kynurenine pathway in postmortem anterior cingulate cortex from individuals with schizophrenia and bipolar disorder. Brain Res. 2006;1073-1074:25-37. 140. Oxenkrug G. Insulin resistance and dysregulation of tryptophan-kynurenine and kynurenine-nicotinamide adenine dinucleotide metabolic pathways. Mol Neurobiol. 2013;48(2):294-301. 141. Raison CL, Miller AH. Is depression an inflammatory disorder? Curr Psychiatry Rep. 2011;13(6):467-75. 142. Dantzer R, Kelley KW. Twenty years of research on cytokine-induced sickness behavior. Brain Behav Immun. 2007;21(2):153-60. 143. Hoyo-Becerra C, Schlaak JF, Hermann DM. Insights from interferon-alpha-related depression for the pathogenesis of depression associated with inflammation. Brain Behav Immun. 2014;42:222-31. 144. Guillemin GJ. Quinolinic acid, the inescapable neurotoxin. FEBS J. 2012;279(8):1356- 65. 145. Young KD, Drevets WC, Dantzer R, Teague TK, Bodurka J, Savitz J. Kynurenine pathway metabolites are associated with hippocampal activity during autobiographical memory recall in patients with depression. Brain Behav Immun. 2016;56:335-42. 146. Starossom SC, Mascanfroni ID, Imitola J, Cao L, Raddassi K, Hernandez SF, et al. Galectin-1 deactivates classically activated microglia and protects from inflammation- induced neurodegeneration. Immunity. 2012;37(2):249-63. 147. Lekishvili T, Hesketh S, Brazier MW, Brown DR. Mouse galectin-1 inhibits the toxicity of glutamate by modifying NR1 NMDA receptor expression. Eur J Neurosci. 2006;24(11):3017-25. 148. Steelman AJ, Li J. Astrocyte galectin-9 potentiates microglial TNF secretion. J Neuroinflammation. 2014;11:144. 149. Steelman AJ, Smith R, 3rd, Welsh CJ, Li J. Galectin-9 protein is up-regulated in astrocytes by tumor necrosis factor and promotes encephalitogenic T-cell apoptosis. J Biol Chem. 2013;288(33):23776-87. 150. Jeon SB, Yoon HJ, Chang CY, Koh HS, Jeon SH, Park EJ. Galectin-3 exerts cytokine- like regulatory actions through the JAK-STAT pathway. J Immunol. 2010;185(11):7037- 46. 151. Anderson AC, Anderson DE, Bregoli L, Hastings WD, Kassam N, Lei C, et al. Promotion of tissue inflammation by the immune receptor Tim-3 expressed on innate immune cells. Science. 2007;318(5853):1141-3. 152. Matsumoto R, Matsumoto H, Seki M, Hata M, Asano Y, Kanegasaki S, et al. Human ecalectin, a variant of human galectin-9, is a novel eosinophil chemoattractant produced by T lymphocytes. J Biol Chem. 1998;273(27):16976-84. 153. Gleason MK, Lenvik TR, McCullar V, Felices M, O'Brien MS, Cooley SA, et al. Tim-3 is an inducible human natural killer cell receptor that enhances interferon gamma production in response to galectin-9. Blood. 2012;119(13):3064-72.

P a g e | 109

154. Su EW, Bi S, Kane LP. Galectin-9 regulates T helper cell function independently of Tim- 3. Glycobiology. 2011;21(10):1258-65. 155. Sharma R, Di Dalmazi G, Caturegli P. Exacerbation of Autoimmune Thyroiditis by CTLA-4 Blockade: A Role for IFNgamma-Induced Indoleamine 2, 3-Dioxygenase. Thyroid. 2016;26(8):1117-24. 156. Leskela S, Serrano A, de la Fuente H, Rodriguez-Munoz A, Ramos-Levi A, Sampedro- Nunez M, et al. Graves' disease is associated with a defective expression of the immune regulatory molecule galectin-9 in antigen-presenting dendritic cells. PLoS One. 2015;10(4):e0123938. 157. Lee J, Oh JM, Hwang JW, Ahn JK, Bae EK, Won J, et al. Expression of human TIM-3 and its correlation with disease activity in rheumatoid arthritis. Scand J Rheumatol. 2011;40(5):334-40. 158. Trabanelli S, Ocadlikova D, Ciciarello M, Salvestrini V, Lecciso M, Jandus C, et al. The SOCS3-independent expression of IDO2 supports the homeostatic generation of T regulatory cells by human dendritic cells. J Immunol. 2014;192(3):1231-40. 159. Park SE, Lawson M, Dantzer R, Kelley KW, McCusker RH. Insulin-like growth factor-I peptides act centrally to decrease depression-like behavior of mice treated intraperitoneally with lipopolysaccharide. J Neuroinflammation. 2011;8:179. 160. Gibb J, Hayley S, Poulter MO, Anisman H. Effects of stressors and immune activating agents on peripheral and central cytokines in mouse strains that differ in stressor responsivity. Brain Behav Immun. 2011;25(3):468-82. 161. Lynch MA. The impact of neuroimmune changes on development of amyloid pathology; relevance to Alzheimer's disease. Immunology. 2014;141(3):292-301. 162. Braidy N, Guillemin GJ, Grant R. Effects of Kynurenine Pathway Inhibition on NAD Metabolism and Cell Viability in Human Primary Astrocytes and Neurons. Int J Tryptophan Res. 2011;4:29-37. 163. Wolowczuk I, Verwaerde C, Viltart O, Delanoye A, Delacre M, Pot B, et al. Feeding our immune system: impact on metabolism. Clin Dev Immunol. 2008;2008:639803. 164. Larkin PB, Sathyasaikumar KV, Notarangelo FM, Funakoshi H, Nakamura T, Schwarcz R, et al. Tryptophan 2,3-dioxygenase and indoleamine 2,3-dioxygenase 1 make separate, tissue-specific contributions to basal and inflammation-induced kynurenine pathway metabolism in mice. Biochim Biophys Acta. 2016;1860(11 Pt A):2345-54. 165. Lawson MA, Dostal CR, Brooks AK, McCusker RH. The Kynurenine (Kyn) Pathway and NeuroInflammation: The Confused Brain. In: Opp MR, editor. Primer of PsychoNeuroImmunology Research. Los Angeles, CA: PsychoNeuroImmunology Research Society; 2016. p. 95-101. 166. Castegna A, Palmieri L, Spera I, Porcelli V, Palmieri F, Fabis-Pedrini MJ, et al. Oxidative stress and reduced glutamine synthetase activity in the absence of inflammation in the cortex of mice with experimental allergic encephalomyelitis. Neuroscience. 2011;185:97-105. 167. Penberthy WT, Tsunoda I. The importance of NAD in multiple sclerosis. Curr Pharm Des. 2009;15(1):64-99. 168. Muller N, Schwarz MJ. The immune-mediated alteration of serotonin and glutamate: towards an integrated view of depression. Mol Psychiatry. 2007;12(11):988-1000. 169. John S, Mishra R. Galectin-9: From cell biology to complex disease dynamics. J Biosci. 2016;41(3):507-34.

P a g e | 110

170. Wiersma VR, de Bruyn M, Helfrich W, Bremer E. Therapeutic potential of Galectin-9 in human disease. Med Res Rev. 2013;33 Suppl 1:E102-26. 171. Merani S, Chen W, Elahi S. The bitter side of sweet: the role of Galectin-9 in immunopathogenesis of viral infections. Rev Med Virol. 2015;25(3):175-86. 172. van Baren N, Van den Eynde BJ. Tumoral Immune Resistance Mediated by Enzymes That Degrade Tryptophan. Cancer Immunol Res. 2015;3(9):978-85. 173. Murakami Y, Hoshi M, Imamura Y, Arioka Y, Yamamoto Y, Saito K. Remarkable role of indoleamine 2,3-dioxygenase and tryptophan metabolites in infectious diseases: potential role in macrophage-mediated inflammatory diseases. Mediators Inflamm. 2013;2013:391984. 174. Ott M, Litzenburger UM, Rauschenbach KJ, Bunse L, Ochs K, Sahm F, et al. Suppression of TDO-mediated tryptophan catabolism in glioblastoma cells by a steroid- responsive FKBP52-dependent pathway. Glia. 2015;63(1):78-90. 175. Maes M, Scharpe S, Meltzer HY, Okayli G, Bosmans E, D'Hondt P, et al. Increased neopterin and interferon-gamma secretion and lower availability of L-tryptophan in major depression: further evidence for an immune response. Psychiatry Res. 1994;54(2):143-60. 176. Marcus M, Yasamy MT, van Ommeren M, Chisholm D, Saxena S. Depression A Global Health Concern. World Health Organization Department of Mental Health and Substance Abuse 2012. p. 1-8. 177. WHO. World Health Organization: Global burden of mental disorders and the need for a comprehensive, coordinated response from health and social sectors at the country level In: Secretariat, editor. Executive Board Meeting, EB130/9 130th session, Provisional agenda item 62 World Health Organization; 2011. p. 1-6. 178. Anderson IM. SSRIS versus tricyclic antidepressants in depressed inpatients: a meta- analysis of efficacy and tolerability. Depress Anxiety. 1998;7 Suppl 1:11-7. 179. Jakubovski E, Varigonda AL, Freemantle N, Taylor MJ, Bloch MH. Systematic Review and Meta-Analysis: Dose-Response Relationship of Selective Serotonin Reuptake Inhibitors in Major Depressive Disorder. Am J Psychiatry. 2016;173(2):174-83. 180. Murakami Y, Ishibashi T, Tomita E, Imamura Y, Tashiro T, Watcharanurak K, et al. Depressive symptoms as a side effect of Interferon-alpha therapy induced by induction of indoleamine 2,3-dioxygenase 1. Sci Rep. 2016;6:29920. 181. Raison CL. The Promise and Limitations of Anti-Inflammatory Agents for the Treatment of Major Depressive Disorder. Curr Top Behav Neurosci. 2017;31:287-302. 182. Reichenberg A, Yirmiya R, Schuld A, Kraus T, Haack M, Morag A, et al. Cytokine- associated emotional and cognitive disturbances in humans. Arch Gen Psychiatry. 2001;58(5):445-52. 183. Kappelmann N, Lewis G, Dantzer R, Jones PB, Khandaker GM. Antidepressant activity of anti-cytokine treatment: a systematic review and meta-analysis of clinical trials of chronic inflammatory conditions. Mol Psychiatry. 2016. 184. Galecki P, Galecka E, Maes M, Chamielec M, Orzechowska A, Bobinska K, et al. The expression of genes encoding for COX-2, MPO, iNOS, and sPLA2-IIA in patients with recurrent depressive disorder. J Affect Disord. 2012;138(3):360-6. 185. Dowlati Y, Herrmann N, Swardfager W, Liu H, Sham L, Reim EK, et al. A meta-analysis of cytokines in major depression. Biol Psychiatry. 2010;67(5):446-57.

P a g e | 111

186. Wang N, Yu HY, Shen XF, Gao ZQ, Yang C, Yang JJ, et al. The rapid antidepressant effect of ketamine in rats is associated with down-regulation of pro-inflammatory cytokines in the hippocampus. Ups J Med Sci. 2015;120(4):241-8. 187. Liu YN, Peng YL, Liu L, Wu TY, Zhang Y, Lian YJ, et al. TNFalpha mediates stress- induced depression by upregulating indoleamine 2,3-dioxygenase in a mouse model of unpredictable chronic mild stress. Eur Cytokine Netw. 2015;26(1):15-25. 188. Brooks AK, Lawson MA, Rytych JL, Yu KC, Janda TM, Steelman AJ, et al. Immunomodulatory Factors Galectin-9 and Interferon-Gamma Synergize to Induce Expression of Rate-Limiting Enzymes of the Kynurenine Pathway in the Mouse Hippocampus. Frontiers in Immunology. 2016;7(422). 189. Ball HJ, Yuasa HJ, Austin CJ, Weiser S, Hunt NH. Indoleamine 2,3-dioxygenase-2; a new enzyme in the kynurenine pathway. Int J Biochem Cell Biol. 2009;41(3):467-71. 190. Basu Mallik S, Mudgal J, Nampoothiri M, Hall S, Dukie SA, Grant G, et al. Caffeic acid attenuates lipopolysaccharide-induced sickness behaviour and neuroinflammation in mice. Neurosci Lett. 2016;632:218-23. 191. Jain NK, Kulkarni SK, Singh A. Lipopolysaccharide-mediated immobility in mice: reversal by cyclooxygenase enzyme inhibitors. Methods Find Exp Clin Pharmacol. 2001;23(8):441-4. 192. Mello BS, Monte AS, McIntyre RS, Soczynska JK, Custodio CS, Cordeiro RC, et al. Effects of doxycycline on depressive-like behavior in mice after lipopolysaccharide (LPS) administration. J Psychiatr Res. 2013;47(10):1521-9. 193. Shen Y, Connor TJ, Nolan Y, Kelly JP, Leonard BE. Differential effect of chronic antidepressant treatments on lipopolysaccharide-induced depressive-like behavioural symptoms in the rat. Life Sci. 1999;65(17):1773-86. 194. Tomaz VS, Cordeiro RC, Costa AM, de Lucena DF, Nobre Junior HV, de Sousa FC, et al. Antidepressant-like effect of nitric oxide synthase inhibitors and sildenafil against lipopolysaccharide-induced depressive-like behavior in mice. Neuroscience. 2014;268:236-46. 195. Platt B, Schulenberg J, Klee N, Nizami M, Clark JA. A depressive phenotype induced by Bacille Calmette Guerin in 'susceptible' animals: sensitivity to antidepressants. Psychopharmacology (Berl). 2013;226(3):501-13. 196. Vijaya Kumar K, Rudra A, Sreedhara MV, Siva Subramani T, Prasad DS, Das ML, et al. Bacillus Calmette-Guerin vaccine induces a selective serotonin reuptake inhibitor (SSRI)-resistant depression like phenotype in mice. Brain Behav Immun. 2014;42:204- 11. 197. Nikodemova M, Watters JJ. Efficient isolation of live microglia with preserved phenotypes from adult mouse brain. J Neuroinflammation. 2012;9:147. 198. Matt SM, Lawson MA, Johnson RW. Aging and peripheral lipopolysaccharide can modulate epigenetic regulators and decrease IL-1beta promoter DNA methylation in microglia. Neurobiol Aging. 2016;47:1-9. 199. Gonzalez-Pena D, Nixon SE, O'Connor JC, Southey BR, Lawson MA, McCusker RH, et al. Microglia Transcriptome Changes in a Model of Depressive Behavior after Immune Challenge. PLoS One. 2016;11(3):e0150858. 200. Holt LM, Olsen ML. Novel Applications of Magnetic Cell Sorting to Analyze Cell-Type Specific Gene and Protein Expression in the Central Nervous System. PLoS One. 2016;11(2):e0150290.

P a g e | 112

201. Feldmann M, Pathipati P, Sheldon RA, Jiang X, Ferriero DM. Isolating astrocytes and neurons sequentially from postnatal murine brains with a magnetic cell separation technique. Journal of Biological Methods. 2014;1(2):11. 202. Jungblut M, Tiveron MC, Barral S, Abrahamsen B, Knobel S, Pennartz S, et al. Isolation and characterization of living primary astroglial cells using the new GLAST-specific monoclonal antibody ACSA-1. Glia. 2012;60(6):894-907. 203. Haeryfar SM, Hoskin DW. Thy-1: more than a mouse pan-T cell marker. J Immunol. 2004;173(6):3581-8. 204. Rink L, Plümäkers B, Sheldrick AJ, Fulda S, Himmerich H. IFN-γ Reduction by Tricyclic Antidepressants. The International Journal of Psychiatry in Medicine. 2010;40(4):413-24. 205. Diamond M, Kelly JP, Connor TJ. Antidepressants suppress production of the Th1 cytokine interferon-gamma, independent of monoamine transporter blockade. Eur Neuropsychopharmacol. 2006;16(7):481-90. 206. Fatokun AA, Hunt NH, Ball HJ. Indoleamine 2,3-dioxygenase 2 (IDO2) and the kynurenine pathway: characteristics and potential roles in health and disease. Amino Acids. 2013;45(6):1319-29. 207. O'Leary OF, Bechtholt AJ, Crowley JJ, Hill TE, Page ME, Lucki I. Depletion of serotonin and catecholamines block the acute behavioral response to different classes of antidepressant drugs in the mouse tail suspension test. Psychopharmacology (Berl). 2007;192(3):357-71. 208. Branco-de-Almeida LS, Kajiya M, Cardoso CR, Silva MJ, Ohta K, Rosalen PL, et al. Selective serotonin reuptake inhibitors attenuate the antigen presentation from dendritic cells to effector T lymphocytes. FEMS Immunol Med Microbiol. 2011;62(3):283-94. 209. Kim H, Chen L, Lim G, Sung B, Wang S, McCabe MF, et al. Brain indoleamine 2,3- dioxygenase contributes to the comorbidity of pain and depression. J Clin Invest. 2012;122(8):2940-54. 210. Dantzer R, Wollman EE, Vitkovic L, Yirmiya R. Cytokines, stress, and depression. Conclusions and perspectives. Adv Exp Med Biol. 1999;461:317-29. 211. Stinnett GS, Westphal NJ, Seasholtz AF. Pituitary CRH-binding protein and stress in female mice. Physiol Behav. 2015;150:16-23. 212. Sulakhiya K, Keshavlal GP, Bezbaruah BB, Dwivedi S, Gurjar SS, Munde N, et al. Lipopolysaccharide induced anxiety- and depressive-like behaviour in mice are prevented by chronic pre-treatment of esculetin. Neurosci Lett. 2016;611:106-11. 213. Lutomski D, Joubert-Caron R, Lefebure C, Salama J, Belin C, Bladier D, et al. Anti- galectin-1 autoantibodies in serum of patients with neurological diseases. Clin Chim Acta. 1997;262(1-2):131-8. 214. Wang X, Zhang S, Lin F, Chu W, Yue S. Elevated Galectin-3 Levels in the Serum of Patients With Alzheimer's Disease. Am J Alzheimers Dis Other Demen. 2015;30(8):729- 32. 215. Kwidzinski E, Bunse J, Aktas O, Richter D, Mutlu L, Zipp F, et al. Indolamine 2,3- dioxygenase is expressed in the CNS and down-regulates autoimmune inflammation. FASEB J. 2005;19(10):1347-9. 216. Corona AW, Norden DM, Skendelas JP, Huang Y, O'Connor JC, Lawson M, et al. Indoleamine 2,3-dioxygenase inhibition attenuates lipopolysaccharide induced persistent

P a g e | 113

microglial activation and depressive-like complications in fractalkine receptor (CX(3)CR1)-deficient mice. Brain Behav Immun. 2013;31:134-42. 217. Albuquerque EX, Schwarcz R. Kynurenic acid as an antagonist of alpha7 nicotinic acetylcholine receptors in the brain: facts and challenges. Biochem Pharmacol. 2013;85(8):1027-32. 218. Steiner J, Walter M, Gos T, Guillemin GJ, Bernstein HG, Sarnyai Z, et al. Severe depression is associated with increased microglial quinolinic acid in subregions of the anterior cingulate gyrus: evidence for an immune-modulated glutamatergic neurotransmission? J Neuroinflammation. 2011;8:94. 219. Cobb JA, O'Neill K, Milner J, Mahajan GJ, Lawrence TJ, May WL, et al. Density of GFAP-immunoreactive astrocytes is decreased in left hippocampi in major depressive disorder. Neuroscience. 2016;316:209-20. 220. Sanacora G, Banasr M. From pathophysiology to novel antidepressant drugs: glial contributions to the pathology and treatment of mood disorders. Biol Psychiatry. 2013;73(12):1172-9. 221. Yirmiya R, Rimmerman N, Reshef R. Depression as a microglial disease. Trends Neurosci. 2015;38(10):637-58. 222. Duseja R, Heir R, Lewitus GM, Altimimi HF, Stellwagen D. Astrocytic TNFalpha regulates the behavioral response to antidepressants. Brain Behav Immun. 2015;44:187- 94. 223. Czeh B, Di Benedetto B. Antidepressants act directly on astrocytes: evidences and functional consequences. Eur Neuropsychopharmacol. 2013;23(3):171-85. 224. Munn DH, Sharma MD, Lee JR, Jhaver KG, Johnson TS, Keskin DB, et al. Potential regulatory function of human dendritic cells expressing indoleamine 2,3-dioxygenase. Science. 2002;297(5588):1867-70. 225. Kai S, Goto S, Tahara K, Sasaki A, Tone S, Kitano S. Indoleamine 2,3-dioxygenase is necessary for cytolytic activity of natural killer cells. Scand J Immunol. 2004;59(2):177- 82. 226. Maldonado RA, von Andrian UH. How tolerogenic dendritic cells induce regulatory T cells. Adv Immunol. 2010;108:111-65. 227. Lippens C, Duraes FV, Dubrot J, Brighouse D, Lacroix M, Irla M, et al. IDO- orchestrated crosstalk between pDCs and Tregs inhibits autoimmunity. J Autoimmun. 2016. 228. Lee YK, Lee HB, Shin DM, Kang MJ, Yi EC, Noh S, et al. Heme-binding-mediated negative regulation of the tryptophan metabolic enzyme indoleamine 2,3-dioxygenase 1 (IDO1) by IDO2. Exp Mol Med. 2014;46:e121. 229. Obuchowicz E, Bielecka AM, Paul-Samojedny M, Pudelko A, Kowalski J. Imipramine and fluoxetine inhibit LPS-induced activation and affect morphology of microglial cells in the rat glial culture. Pharmacol Rep. 2014;66(1):34-43. 230. Su F, Yi H, Xu L, Zhang Z. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience. 2015;294:60-8. 231. Pan W, Banks WA, Kastin AJ. Permeability of the blood-brain and blood-spinal cord barriers to interferons. J Neuroimmunol. 1997;76(1-2):105-11. 232. Carvalho FB, Gutierres JM, Bueno A, Agostinho P, Zago AM, Vieira J, et al. Anthocyanins control neuroinflammation and consequent memory dysfunction in mice exposed to lipopolysaccharide. Mol Neurobiol. 2016.

P a g e | 114

233. Jeong HK, Jou I, Joe EH. Systemic LPS administration induces brain inflammation but not dopaminergic neuronal death in the substantia nigra. Exp Mol Med. 2010;42(12):823- 32. 234. Jones SP, Franco NF, Varney B, Sundaram G, Brown DA, de Bie J, et al. Expression of the Kynurenine Pathway in Human Peripheral Blood Mononuclear Cells: Implications for Inflammatory and Neurodegenerative Disease. PLoS One. 2015;10(6):e0131389. 235. Tattevin P, Monnier D, Tribut O, Dulong J, Bescher N, Mourcin F, et al. Enhanced indoleamine 2,3-dioxygenase activity in patients with severe sepsis and septic shock. J Infect Dis. 2010;201(6):956-66. 236. Braidy N, Rossez H, Lim CK, Jugder BE, Brew BJ, Guillemin GJ. Characterization of the Kynurenine Pathway in CD8+ Human Primary Monocyte-Derived Dendritic Cells. Neurotox Res. 2016.