Characterization of a New Insect Cell Line (NTU-YB)

Journal of Invertebrate Pathology 102 (2009) 256–262

Contents lists available at ScienceDirect

Journal of Invertebrate Pathology

journal homepage: www.elsevier.com/locate/yjipa

Characterization of a new insect cell line (NTU-YB) derived from the common grass yellow butterﬂy, Eurema hecabe (Linnaeus) (Pieridae: Lepidoptera) and its susceptibility to microsporidia

Yun-Ru Chen a, Leellen F. Solter b, Tsz-Ying Chien a, Ming-Han Jiang a, Hsieh-Fang Lin a, Huai-Sheng Fan c, Chu-Fang Lo d,*, Chung-Hsiung Wang a,d,* a Department of Entomology, College of Bioresources and Agriculture, National Taiwan University, Taipei 106, Taiwan, ROC b Illinois Natural History Survey, 1816 S. Oak Street, Champaign, IL 61820, United States c Division of Zoology, Endemic Species Research Institute, Nantou 552, Taiwan, ROC d Institute of Zoology, College of Life Science, National Taiwan University, Taipei, Taiwan article info abstract

Article history: A new lepidopteran cell line, NTU-YB, was derived from pupal tissue of Eurema hecabe (Linnaeus) (Pieri- Received 16 July 2009 dae: Lepidoptera). The doubling time of YB cells in TNM-FH medium supplemented with 8% FBS at 28 °C Accepted 10 September 2009 was 26.87 h. The chromosome numbers of YB cells varied widely from 21 to 196 with a mean of 86. Com- Available online 15 September 2009 pared to other insect cell lines, the YB cells produced distinct esterase, malate dehydrogenase, and lactate dehydrogenase isozyme patterns. Identity of the internal transcribed spacer region-I (ITS-I) of YB cells to Keywords: E. hecabe larvae was 96% and to Eurema blanda larvae (tissue isolated from head) was 81%. The YB cells Eurema blanda were permissive to Nosema sp. isolated from E. blanda and the infected YB cells showed obvious cyto- Eurema hecabe pathic effects after 3 weeks post inoculation. The highest level of spore production was at 4 weeks post Microsporidia NTU-YB cell line inoculation when cells were infected with the Nosema isolate, and spore production was 6 Nosema sp. 1.34 ± 0.9 10 spore/ml. Ultrastructrual studies showed that YB cells can host in vitro propagation of the E. blanda Nosema isolate, and developing stages were observed in the host cell nuclei as observed in the natural host, E. blanda. The NTU-YB cell line is also susceptible to Nosema bombycis. Ó 2009 Elsevier Inc. All rights reserved.

1. Introduction ceptible to Nosema bombycis (Dwyer et al., 1988), the first described microsporidian species isolated from Bombyx mori. No other butter- Insect cell lines are important tools for scientific study and, since fly cell lines have been reported to be permissive to microsporidia. 1962, have been used for in vitro propagation and studies of patho- Microsporidia are obligate intracellular eukaryotic parasites that in- gens and obligate intracellular parasites, and for research on pest fect almost all animal phyla and unicellular organisms (Weber et al., control, recombinant protein production, and the molecular basis 1994; Weiss, 2003). This taxon was previously considered to be of development (Goodman and McIntosh, 1994; Murhammer, primitive Protozoa; however, current phylogenetic evidence indi- 1996; Grace, 1962; Jarvis, 1997; O’Reilly et al., 1994; Summers and cates that it belongs within the Fungi (Adl et al., 2005; James et al., Smith, 1988; Wu et al., 1989). Over 500 insect cell lines have been 2006; Keeling et al., 2000; Vossbrinck et al., 2004.) Because micro- established from more than 100 insect species (Lynn, 2001.) To sporidia are obligate intracellular parasites, the establishment of understand functionality and to identify the differences and the sta- in vitro propagation systems is very important for functional genetic bility of each cell line, cell line characterization is critical. There are studies (Kurtti et al., 1994; Tsai et al., 2009; Visvesvara, 2002). more than 260 cell lines derived from about 60 species of Lepidop- The common grass yellow butterfly, Eurema hecabe (Pieridae), is tera (Lynn, 2007), but only a few butterfly cell lines have been estab- one of the most abundant yellow butterflies from the Oriental tro- lished. These include BTI-PR, NIAS-PRC819A-C, and NYAES-PR4A pics and occurs throughout subtropical and temperate zones into cell lines derived from Pieris rapae,(Dwyer et al., 1988; Mitsuhashi East Asia. It is also one of the most difficult species for taxonomists et al., 2003), and Px-58 and Px-64 cell lines derived from Papilio to study because of the numerous geographic and seasonal wing xuthus (Mitsuhashi, 1973). Only the NIAS-PRC819A-C cell line is sus- color patterns (Kobayashi et al., 2001; Narita et al., 2007)In Taiwan, it is difficult to distinguish E. hecabe from Eurema blanda (three spot yellow butterfly), another abundant species of yellow * Corresponding authors. Address: Department of Entomology, National Taiwan University, Taipei, Taiwan, ROC (C.-H. Wang). Fax: +886 2 27364329. butterfly because the morphology of the adults and the host plant E-mail address: [email protected] (C.-H. Wang). species utilized overlap. Larvae, however, are easily distinguished;

7 the compound eyes of E. blanda are black while those of E. hecabe in ddH2O to a concentration of 1.8 10 cells/ml. The suspended are light green. cells were lysed by four freeze–thaw procedures, then centrifuged In our laboratory, a new cell line was established from theE. hec- at 90g (KUBOTA 1300) for 10 min. The supernatants were electro- abe pupal tissues and named NTU-YB. This cell line is susceptible to phoresed on 10% polyacrylamide gels at a constant voltage of 70 V the Nosema species isolated from E. blanda (N. sp. EB isolate) (Tsai for 6 h, and then tested for three isozymes including esterase, lac- et al., 2009), and to N. bombycis. To further characterize this new cell tate dehydrogenase (LDH), and malate dehydrogenase (MDH) by line, doubling time, karyotypes, isozyme patterns, internal tran- using the staining protocols of Manchenko (2003). scribed spacer (ITS), microsporidian susceptibility, and cytopathic effects (CPE) are described in this report. 2.5. Internal transcribed spacer-I (ITS-I) region analysis

2. Materials and methods The DNA of E. hecabe and E. blanda larvae, and cell lines NTU-YB, HH, LD, LY, MV56 and SF9 were extracted following the procedure 2.1. Primary culture and subculture of Wang et al. (1996). The ITS-I region was amplified by the prim- ers, ITS-I: 50CCCCATAAACGAGGAATTCC30 and ITS4: 50TCCTCCGC 0 E. hecabe pupae were collected from Puli, Taiwan in March of TTATTGATATGC3 (Lin, unpublished). PCR conditions were 94 °C, 2006. The pupae were sterilized by washing with 70% alcohol and 2 min; followed by 40 cycles of 94 °C, 1 min; 50, 1 min; 70 °C, 70% iodine alcohol. The larvae were air dried in a laminar flow hood 3 min; 70 °C, 10 min. The PCR products were commercially se- and pupal tissues, except alimentary canal, were removed and incu- quenced (Genomics Bioscience & Technology), and ClustalX1.81 bated at 28 °C in TNM-FH medium (Hink and Strauss, 1976) contain- was used to analyze the identity of the ITS-I regions among the ing 100 IU/ml penicillin, 100 lg/ml streptomycin, and 1.25 lg/ml samples. fungizone supplemented with 16% fetal bovine serum (FBS). Cells were subcultured when they approached confluence. After the 2.6. Nucleopolyhedrovirus (NPV) infection assay 50th passage, the interval between each subculture was 4 days after cell confluence on the bottom of culture flask. The established cell The susceptibility of the YB cell line to nucleopolyhedroviruses, line was designated NTU-YB. Cell morphology was observed and dis- including AcMNPV-TWN4 (Autographa califorica NPV Taiwan iso- tinguished based on Wang et al. (1996).

2.2. Growth rate of NTU-YB cells

To measure growth rate, YB cells were seeded in 25 cm2 ﬂasks at a density of 3 106 cells per ﬂask and cultured with TNM-FH supplemented with different concentrations of FBS, including 0%, 4%, 8%, and 16% FBS. The cells were then incubated at 28 °C, and cell numbers were counted every 24 h. After determining the most appropriate concentration of FBS, cells were cultured at different temperatures with the selected concentration of FBS, and cell numbers were counted every 24 h.

2.3. Chromosome numbers

Log phase NTU-YB cells (1.8 107 cells) were treated with 1 ml (1.5 lg/ll) Demecolcine (Sigma, D-6279) overnight at 28 °C. The cells were then dispersed and centrifuged at 65g (Hettich Universal 30F/RF) for 10 min, resuspended in a hypotonic solution (TNM-FH and distilled water in a 1:4 dilution) for 40 min at 4 °C, then fixed in 3:1 methanol:glacial acetic acid for 10 min. The fixing process was repeated four times, then the fixed cells were dropped verti- cally onto slides. After drying at 37 °C, the cells were stained with Giemsa for 1 min and the chromosome number was counted under a microscope.

2.4. Isozyme analysis

The isozyme patterns of confluent cells of NTU-YB were com- pared with those of NTU-PN-HH (derived from Perina nuda pupal ovary tissue, Wang et al., 1996), IPLB-LD-652Y (derived from Lymantria dispar pupal ovary tissue, Goodwin et al., 1978), NTU- LY1 (derived from Lymantria xylina pupal tissue, Wu and Wang, 2006), NTU-MV56 (derived from Maruca vitrata ovary tissue, Chen et al., 2008; Yeh et al., 2007), and commercial Sf9 (Spodoptera fru- giperda cell line.) The HH, LD, LY, and MV56 cells were cultured in TNM-FH supplemented with 8% FBS. The Sf9 cell was cultured in Fig. 1. Cell culture: (A) primary cell culture of Eurema hecabe pupal tissues showing SF900 medium (Gibco). The cells were scraped, counted, and then the cells spreading from the pupal tissue debris and (B) the continuous NTU-YB cell centrifuged at 80g (Hettich Universal 30F/RF) for 10 min at 4 °C. line. Bar: 200 lm. P, polymorphic cells; R, round cells; S, squamous cells; SP, spindle The supernatants were discarded and the pellets were resuspended shaped cells. 258 Y.-R. Chen et al. / Journal of Invertebrate Pathology 102 (2009) 256–262 late from Spodoptera exigua)(Kao et al., 2000; Wang et al., 2000), the spores and the attached cells. Spores were counted and spore LyxyNPV (L. xylina NPV) (Wu and Wang, 2005), MaviNPV (M. vitrata production was recorded every week until 4 weeks pi. NPV) (Chen et al., 2008), and PenuNPV (P. nuda NPV) (Wang et al., 1996) was tested. The host cell lines of each virus were positive 2.8. Ultrastructure observation of infected cells controls. The YB cells (1 106 cells in 6-well plates) were incubated with 10 multiplicity of infection (MOI) either AcMNPV- At three weeks pi, YB cells infected with N. sp EB isolate were TWN4, LyxyNPV, MaviNPV, and PenuNPV for 24 h at 28 °C, and scraped from the surfaces of flasks and centrifuged at 80g (Hettich then washed twice with the culture medium. After washing, Universal 30F/RF). The supernatant was discarded and the pellet 1.5 ml fresh medium was added and cells were incubated at was washed with pH7.2 phosphate buffer twice then fixed in 5%

28 °C. At 7 days post inoculation (dpi), cytopathic effects (CPE) glutaraldehyde in pH 7.2 phosphate buffer with OsO4 at room tem- were observed, and virus titers were determined by the end-point perature for 2 h. The pellet was dehydrated in an alcohol gradient dilution method (TCID50 analysis) (Summers and Smith, 1988). series (70–100%) and embedded in Epon 812. Thin sections were cut on a Reichert OMU 3 ultramicrotome, then stained with uranyl acetate and lead citrate. The photomicrographs were made with a 2.7. Microsporidian infection assay Hitachi H7100 electron microscope at 100 kV.

The YB cells were seeded in 6-well plate (1 106 cells/well), then 3. Results cells were inoculated with 10 MOI (10 purified spores per one cell) of either N. bombycis or N. sp EB isolate (Tsai et al., 2009). After inocu- 3.1. Morphology of NTU-YB cells lation, fresh medium was added (final volume 2 ml), and cells were incubated at 28 °C. The CPE was observed weekly. Released spores The primary cell culture of E. hecabe was derived from pupal tis- were collected by shaking the flask for 30 s at 70 rpm to separate sues (Fig. 1A.) The morphology of established NTU-YB cells after 50

Fig. 2. The NTU-YB cell line growth curve at different temperatures (A) and different FBS concentrations (B). Error bar: standard deviation. Y.-R. Chen et al. / Journal of Invertebrate Pathology 102 (2009) 256–262 259 subculture (approximately 2 years) is shown in Fig. 1B. There are 3.6. Nucleopolyhedrovirus (NPV) infection assay four distinctive morphological cell types in NTU-YB cell line, including polymorphic cells (22.12 ± 2.13%), round cells (51.756 ± 1.63%), At 7 dpi, CPE was not observed in the AcMNPV-TWN4-, Lyx- squamous cells (14.55 ± 1.28%), and spindle shaped cells (11.524 ± yNPV-, MaviNPV-, and PenuNPV-infected NTU-YB cells, and prog-

1.75%). The mean cell sizes were 28.54 ± 6.45 18.38 ± 3.24 lm, eny virus was not produced as assayed by TCID50 titration on 19.17 ± 3.03 lm, 24.24 ± 4.15 19.25 ± 3.35 lm, and 49.48 ± permissive cells for each virus (data not shown). 13.53 11.8 ± 3.01 lm, respectively (Fig. 1B). 3.7. Microsporidian infection assay 3.2. Growth rate of NTU-YB cells The CPE of YB cells infected with N. bombyis and N. sp EB isolate at 3 weeks pi are shown in Fig. 5. The formation of spores and ex- The doubling times of YB cells cultured with TNM-FH supple- tra-cellular microsporidian developmental forms (ECMDFs; Tsai ment with 0%, 5%, 8%, and 16% FBS were 38.85, 31.27, 26.87, and et al., 2009) were observed in the YB cells infected with N. sp EB 31.3 h, respectively (Fig. 2A). Cell proliferation was highest at a isolate (Fig. 5B); the numbers of spores and ECMDF were much temperature of 28 °C. (Fig. 2B). lower in the N. bombyis infected cells. Spore production for the N. sp EB isolate increased with time and reached a peak at 4 weeks 3.3. Chromosome numbers pi (Fig. 6).

The mitotic chromosomes of NTU-YB cells show the typical 3.8. Ultrastructure of infected cells round shape of lepidopteran chromosomes (Fig. 3A). Chromosome number distribution varied from 21 to 196 with a modal number of At 3 weeks pi, developmental forms of N. sp. EB and only a few 86 (Fig. 3B). mature spores were observed inside the cytoplasm of infected cells (Fig. 7A). Fig. 7B shows the sporoblast of N. sp EB isolate with 10 3.4. Isozyme analysis polar ﬁlament coils. Developing stages of the microsporidium were also observed inside the host cell nucleus (Fig. 8). Esterase, MDH, and LDH patterns for NTU-YB cells were different than those of HH, LD, LY, MV56, and SF9 cells (Fig. 4). 4. Discussion

YB cells possess characteristics that distinguish them from 3.5. Internal transcribed spacer-I (ITS-I) region other cell lines that are routinely maintained in our laboratory (Wang et al., 1996; Wu et al., 2002; Wu and Wang, 2006; Yeh The ITS-I sequences of YB cell line and tissues of E. hecabe larvae et al., 2007), it was the only continuous cell line established from showed 96% identity, while identity with tissues of E. blanda larvae the initiations. However, similar to other cell lines, TMN-FH med- was only 81% (Table 1). This result strongly indicated that the NTU- ium supplemented with 8% FBS at 28 °C provides the optimal YB cell line was derived from E. hecabe.

Fig. 3. The chromosome number of NTU-YB cell line: (A) the mitotic chromosomes; bar = 25 lm and (B) distribution of chromosome number in NTU-YB cells. 260 Y.-R. Chen et al. / Journal of Invertebrate Pathology 102 (2009) 256–262

Fig. 5. The cytopathic effects of the NTU-YB cells infected with Nosema bombycis Fig. 4. Isozyme patterns of six insect cell lines including NTU-PN-HH (HH), IPLB-LD- (A) and Nosema sp EB isolate (B) at 3 weeks post infection. White arrow = mature 652Y (LD), NTU-LY1 (LY), NTY-MV56 (MV), Sf9, and NTU-YB (YB) cells. (A) Esterase, spores; black arrow = extra-cellular microsporidian developmental forms; (B) MDH, and (C) LDH. Lanes 1–6 are HH, LD, LY1, MV56, Sf9, and YB cells, bar = 10 lm. respectively.

Table 1 ITS identities (%) of NTU-YB cells to other lepidopteran cell lines and Eurema spp. larvae. EH-L: E. hecabe larva; EB-L: E. blanda larva.

PN Sf9 LY-1 LD MV YB EH-L EB-L PN 61 58 60 54 47 46 47 Sf9 56 56 58 51 50 50 LY-1 87 52 49 48 49 LD 52 48 48 48 MV 52 52 54 YB 96 81 EH-L 83 EB-L

culture conditions for growth and shortest doubling time. YB cells cultured at 28 °C were morphologically typical but those cultured at 4 °C, 20 °C, and 37 °C were morphologically atypical at 120 h after seeding. The temperature tolerance for YB cells was lower than for NTU-PN-HH cells (derived from P. nuda)(Wang et al., Fig. 6. Production of mature Eurema blanda Nosema sp. spores in NTU-YB cells. 1996), but was similar to that of NTU-LY, NTU-MV, and IPLB-LD cell Error bar: standard deviation. Y.-R. Chen et al. / Journal of Invertebrate Pathology 102 (2009) 256–262 261

Fig. 8. Eurema blanda Nosema species sporoblast observed in the nucleus of a NTU- YB cell. N: nucleus, S: sporont. Bar: 1 lm.

lines. E. hecabe and E. blanda are sympatric and morphologically similar insects. Based on ITS identities between YB cells and E. hecabe (96% identity), and E. blanda larva (81% identity), we confirmed again the derived host insect of YB cells. DNA markers by PCR amplification can be efficient tools for prevention of the cell contamination from other cell lines. We confirmed no occurrence of cell contamination in YB cells (Table 1, Fig. 4). Susceptibility to pathogens is an important character of a cell line, although several established cell lines are not susceptible to their homologous viruses. The SL7B cell line derived from Spodop- tera litura, for example, is not susceptible to S. litura NPV, but can support production of AcMNPV-TWN4 (A. califorica NPV Taiwan isolate from S. exigua)(Chang and Shih, 1999; Kao et al., 2000; Shih and Chang, 1997; Shih et al., 1997; Wang et al., 2000). In contrast to the wide host range of AcMNPV (Groener, 1986; Goodman and McIntosh, 1994; Hink, 1970; Hink and Hall, 1989; McIntosh et al., 2005), the host range of most NPVs is limited. YB cells were not susceptible to LyxyMNPV, MaviNPV, and PnNPV, which also demonstrated that YB cells were not contaminated with LD or LY, MV and PN cells, respectively. Of the seven butterfly cell lines Fig. 7. Ultrastructure of YB cells infected with Eurema blanda Nosema species established from P. rapae and P. xuthus,(Dwyer et al., 1988; showing different developmental stages in the cell (A) (Bar: 1 lm); sporoblast Mitsuhashi, 1973; Mitsuhashi et al., 2003), only the NIAS- (B) (Bar: 500 nm) at 3 weeks post inoculation. N: nucleus, PV: posterior vacuole; PRC819A-C cell line was reported to be susceptible to N. bombycis white arrow: polar filament. (Dwyer et al., 1988). The NTU-YB cell line was highly susceptible to N. bombycis and lines that are routinely maintained in our lab. YB cells are similar in also to the Nosema sp. isolated from E. blanda larvae. The N. sp EB- size to NTU-LY1-4 cells (Wu and Wang, 2006) and NTU-MV cells infected YB cells produced a higher number of extra-cellular (Yeh et al., 2007) but is smaller than IPLB-LD-652Y cells (Goodwin microsporidian developmental forms than N. bombycis, and devel- et al., 1978). Morphological characters are not be reliable to distin- oping stages were found in the nuclei of the infected YB cell, con- guish a newly established cell line because of inconsistencies firming our previous description of N. sp EB isolate in infected LD among generations or clones and also culture conditions (Lynn, cells (Tsai et al., 2009). The NTU-YB cell line appears to be distinct, 2000), thus, biochemical and molecular characters are more reli- stable and useful, and should be valuable for further studies of able markers for the insect cell lines. Although the morphology lepidopteran pathogens. of YB cells was similar to NTU-LY cells and NTU-MV cells, we could clearly distinguish these cell lines using isozyme patterns and ITS sequence identities. E. hecabe and E. blanda are congeners, but their Acknowledgment ITS-I identity was only 83%, revealing significant evolutionary var- iation between these two morphologically similar butterflies. We This study was supported by the National Science Council, therefore used ITS-I identities for distinguishing the YB cell line Republic of China under Grant No. NSC 98-2313-B-002-044 and from the other cell lines and for validating the origin of the cell 98-2621-B-002-009. 262 Y.-R. Chen et al. / Journal of Invertebrate Pathology 102 (2009) 256–262

References Lynn, D.E., 2007. Lepidopteran insect cell line isolation from insect tissue. In: Murhammer, D.W. (Ed.), Baculovirus and Insect Cell Expression Protocols. Human Press Inc., pp. 139–154. Adl, S.M., Simpson, A.G., Farmer, M.A., Andersen, R.A., Anderson, O.R., Barta, J.R., Manchenko, F.P., 2003. Handbook of Detection of Enzymes on Electrophoretic Gels. Bowser, S.S., Brugerolle, G., Fensome, R.A., Fredericq, S., James, T.Y., Karpov, S., CRC Press, London. p. 285. Kugrens, P., Krug, J., Lane, C.E., Lewis, L.A., Lodge, J., Lynn, D.H., Mann, D.G., McIntosh, H.A., Grasela, J.J., Popham, H.J.R., 2005. AcMNPV in permissive, McCourt, R.M., Mendoza, L., Moestrup, O., Mozley-Standridge, S.E., Nerad, T.A., semipermissive, and nonpermissive cell lines from arthropoda. In Vitro Cell. Shearer, C.A., Smirnov, A.V., Spiegel, F.W., Taylor, M.F., 2005. The new higher Dev. Biol. Anim. 41, 298–304. level classification of eukaryotes with emphasis on the taxonomy of protists. J. Mitsuhashi, J., 1973. Establishment of cell lines from the pupal ovaries of the Eukaryot. Microbiol. 52, 399–451. swallow tail, Papilio xuthus LINNE: Lepidoptera: Papilionidae. Appl. Entomol. Chang, T.S., Shih, C.J., 1999. Factors influencing the production of baculovirus from a Zool. 8, 64–72. cell line derived from Spodoptera litura. Chinese J. Entomol. 19, 51–63. Mitsuhashi, J., Shouji, H., Shigeo, I., 2003. Continuous cell lines from the common Chen, Y.R., Wu, C.Y., Lee, S.T., Wu, Y.J., Lo, C.F., Tsai, M.F., Wang, C.H., 2008. Genomic white, Pieris rapae crucivora boisduval. In Vitro Cell. Dev. Biol. Anim. 39, 114– and host range studies of Maruca vitrata nucleopolyhedrovirus. J. Gen. Virol. 89, 116. 2315–2330. Murhammer, D.W., 1996. Production of viral insecticides in cell culture and their Dwyer, K.G., Webb, S.E., Shelton, A.M., Granados, R.R., 1988. Establishment of cell use for pest control. Appl. Biochem. Biotechnol. 59, 199–220. lines from Pieris rapae embryo: characterization and susceptibility to Narita, S., Nomura, M., Kato, Y., Yata, O., Kageyama, D., 2007. Molecular baculoviruses. J. Invertebr. Pathol. 52, 268–274. phylogeography of two sibling species of Eurema butterflies. Genetica 131, Goodman, C.L., McIntosh, A.H., 1994. Production of baculovirus for insect control 241–253. using cell culture. In: Maramorosch, K., McIntosh, A.H. (Eds.), Insect Cell O’Reilly, D.R., Miller, L.K., Luckow, V.A., 1994. Gene organization, regulation, and Biotechnology. CRC Press, Boca Raton, FL, pp. 33–56. function. In: Baculovirus Expression Vectors. A Laboratory Manual. Oxford Goodwin, R.H., Tropkins, F.J., McCawley, P., 1978. Gypsy moth cell lines divergent in University Press, New York, pp. 3–11. viral susceptibility. In Vitro 14, 485–494. Shih, C.J., Chang, J.C., 1997. High level expression of recombinant protein in a cell Grace, T.D.C., 1962. Establishment of four strains of cells from insect tissues grown line derived from Spodoptera litura (Lepidoptera: Noctuidae). Appl. Entomol. in vitro. Nature 195, 788–789. Zool. 32, 179–188. Groener, A., 1986. Specificity and safety of baculovirus. The Biology of Shih, C.J., Lin, R.W., Wang, C.H., 1997. Establishment of a cell line from Spodoptera Baculoviruses, Biological Properties and Molecular Biology, vol. 1. CRC Press, litura (Lepidoptera: Noctuidae) and replication of S. litura nuclear Boca Raton, FL, pp. 177–202. polyhedrosisvirus in vitro. J. Invertebr. Pathol. 69, 1–6. Hink, W.F., 1970. Established insect cell line from the cabbage looper, Trichoplusia Summers, M.D., Smith, F.E., 1988. A manual of methods for baculovirus vectors and ni. Nature 226, 466–467. insect cell culture procedure. Texas Agricultural Experiment Station, No. 1555, Hink, W.F., Hall, R.L., 1989. Recently established invertebrate cell lines. In: pp. 57. Mitsuhashi, J. (Ed.), Invertebrate Cell System Applications. CRC Press, Boca Tsai, Y.C., Solter, L.F., Wang, C.Y., Fan, H.S., Chang, C.C., Wang, C.H., 2009. Raton, FL, pp. 269–293. Morphological and molecular studies of a microsporidium (Nosema sp.) Hink, W.F., Strauss, E., 1976. Growth of the Trichoplusia ni (TN-368) cell line in isolated from the three spot grass yellow butterfly, Eurema blanda arsakia suspension culture. In: Kurstak, E., Maramorosch, K. (Eds.), Invertebrate Tissue (Lepidoptera: Pieridae). J. Invertebr. Pathol. 100, 85–93. Culture, Applications in Medicine, Biology, and Agriculture. Academic Press, Visvesvara, G.S., 2002. In vitro cultivation of microsporidia of clinical importance. New York, pp. 297–300. Clin. Microbiol. Rev. 15, 401–413. James, T.Y., Kauff, F., Schoch, C.L., Matheny, P.B., Hofstetter, V., Cox, C.J., Celio, G., Vossbrinck, C.R., Andreadis, T.G., Weiss, L.M., 2004. Phylogenetics: taxonomy and Gueidan, C., Fraker, E., Miadlikowska, J., Lumbsch, H.T., Rauhut, A., Reeb, V., the microsporidia as derived fungi. World Class Parasit. 9, 189–213. Arnold, A.E., Amtoft, A., Stajich, J.E., Hosaka, K., Sung, G.H., Johnson, D., O’Rourke, Wang, C.H., Chou, C.M., Liu, H.C., Kau, S.L., Kou, G.H., Lo, C.F., 1996. Continuous cell B., Crockett, M., Binder, M., Curtis, J.M., Slot, J.C., Wang, Z., Wilson, A.W., line from pupal ovary of Perina nuda (Lepidoptera: Lymantriidae) that is Schüssler, A., Longcore, J.E., O’Donnell, K., Mozley-Standridge, S., Porter, D., permissive to nuclear polyhedrosis virus from P. nuda. J. Invertebr. Pathol. 67, Letcher, P.M., Powell, M.J., Taylor, J.W., White, M.M., Griffith, G.W., Davies, D.R., 199–204. Humber, R.A., Morton, J.B., Sugiyama, J., Rossman, A.Y., Rogers, J.D., Pfister, D.H., Wang, C.H., Yang, H.N., Liu, H.C., Kou, G.H., Lo, C.F., 2000. Nested polymerase chain Hewitt, D., Hansen, K., Hambleton, S., Shoemaker, R.A., Kohlmeyer, J., reaction and in situ hybridization for detection of nucleopolyhedrosis. J. Virol. Volkmann-Kohlmeyer, B., Spotts, R.A., Serdani, M., Crous, P.W., Hughes, K.W., Meth. 84, 65–75. Matsuura, K., Langer, E., Langer, G., Untereiner, W.A., Lücking, R., Büdel, B., Weber, R., Bryan, R.T., Schwartz, D.A., Owen, R.L., 1994. Human microsporidial Geiser, D.M., Aptroot, A., Diederich, P., Schmitt, I., Schultz, M., Yahr, R., Hibbett, infections. Clin. Microbiol. Rev. 7, 426–461. D.S., Lutzoni, F., McLaughlin, D.J., Spatafora, J.W., Vilgalys, R., 2006. Weiss, L.M., 2003. Microsporidia 2003: IWOP-8. J. Eukaryot. Microbiol. 50 (Suppl.), Reconstructing the early evolution of Fungi using a six-gene phylogeny. 566–568. Nature 443, 818–822. Wu, C.Y., Wang, C.H., 2005. Characterization and polyhedrin gene cloning of Jarvis, D.L., 1997. Baculovirus expression vectors. In: Miller, L.K. (Ed.), The Lymantria xylina multiple nucleopolyhedrovirus. J. Invertebr. Pathol. 88, 238– Baculovirus. Plenum Press, New York and London, pp. 389–431. 246. Kao, S.S., Jinn, T.R., Wang, C.H., 2000. Detection and identification of five Wu, C.Y., Wang, C.H., 2006. New cell lines from Lymantria xylina (Lepidoptera: nucleopolyhedrovirus isolates from Taiwan by PCR–RFLP. Chinese J. Entomol. Lymantriidae): characterization and susceptibility to baculovirus. J. Invertebr. 20, 23–35. Pathol. 93, 186–191. Keeling, P.J., Luker, M.A., Palmer, J.D., 2000. Evidence from beta-tubulin phylogeny Wu, J., King, G., Daugulis, A.J., Faulkner, P., Bone, D.H., Goosen, M.F.A., 1989. that microsporidia evolved from within the fungi molecule. Biol. Evol. 17, 23– Engineering aspects of insect cell suspension culture: a review. Microbiol. 31. Biotechnol. 32, 249–255. Kobayashi, A., Hiroki, M., Kato, Y., 2001. Sexual isolation between two sympatric Wu, C.Y., Yang, H.N., Lo, C.F., Wang, C.H., 2002. A Perina nuda cell line (NTU-Pn-HF) types of the butterfly Eurema hecabe (L.). J. Insect Behav. 14, 353–362. from pupal ovary that is persistently infected with a picorna-like virus (PnPV). Kurtti, T.J., Ross, S.E., Liu, Y., Munderloh, U.G., 1994. In vitro developmental biology Appl. Entomol. Zool. 37, 171–179. and spore production in Nosema furnacalis (Microspora: Nosematidae). J. Yeh, S.C., Lee, S.T., Wu, C.Y., Wang, C.H., 2007. A cell line (NTU-MV) established from Invertebr. Pathol. 63, 188–194. Maruca vitrata (Lepidoptera: Pyralidae): characterization, viral susceptibility, Lynn, D.E., 2000. Effects of long- and short-term passage of insect cells in different and polyhedra production. J. Invertebr. Pathol. 96, 138–146. culture media on baculovirus replication. J. Invertebr. Pathol. 76, 164–168. Lynn, D.E., 2001. Novel techniques to establish new insect cell lines. In Vitro Cell. Dev. Boil. Anim. 37, 319–321.