Characterization of a New Insect Cell Line (NTU-YB)
Total Page：16
File Type：pdf, Size：1020Kb
Journal of Invertebrate Pathology 102 (2009) 256–262 Contents lists available at ScienceDirect Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/yjipa Characterization of a new insect cell line (NTU-YB) derived from the common grass yellow butterfly, Eurema hecabe (Linnaeus) (Pieridae: Lepidoptera) and its susceptibility to microsporidia Yun-Ru Chen a, Leellen F. Solter b, Tsz-Ying Chien a, Ming-Han Jiang a, Hsieh-Fang Lin a, Huai-Sheng Fan c, Chu-Fang Lo d,*, Chung-Hsiung Wang a,d,* a Department of Entomology, College of Bioresources and Agriculture, National Taiwan University, Taipei 106, Taiwan, ROC b Illinois Natural History Survey, 1816 S. Oak Street, Champaign, IL 61820, United States c Division of Zoology, Endemic Species Research Institute, Nantou 552, Taiwan, ROC d Institute of Zoology, College of Life Science, National Taiwan University, Taipei, Taiwan article info abstract Article history: A new lepidopteran cell line, NTU-YB, was derived from pupal tissue of Eurema hecabe (Linnaeus) (Pieri- Received 16 July 2009 dae: Lepidoptera). The doubling time of YB cells in TNM-FH medium supplemented with 8% FBS at 28 °C Accepted 10 September 2009 was 26.87 h. The chromosome numbers of YB cells varied widely from 21 to 196 with a mean of 86. Com- Available online 15 September 2009 pared to other insect cell lines, the YB cells produced distinct esterase, malate dehydrogenase, and lactate dehydrogenase isozyme patterns. Identity of the internal transcribed spacer region-I (ITS-I) of YB cells to Keywords: E. hecabe larvae was 96% and to Eurema blanda larvae (tissue isolated from head) was 81%. The YB cells Eurema blanda were permissive to Nosema sp. isolated from E. blanda and the infected YB cells showed obvious cyto- Eurema hecabe pathic effects after 3 weeks post inoculation. The highest level of spore production was at 4 weeks post Microsporidia NTU-YB cell line inoculation when cells were infected with the Nosema isolate, and spore production was 6 Nosema sp. 1.34 ± 0.9 Â 10 spore/ml. Ultrastructrual studies showed that YB cells can host in vitro propagation of the E. blanda Nosema isolate, and developing stages were observed in the host cell nuclei as observed in the natural host, E. blanda. The NTU-YB cell line is also susceptible to Nosema bombycis. Ó 2009 Elsevier Inc. All rights reserved. 1. Introduction ceptible to Nosema bombycis (Dwyer et al., 1988), the first described microsporidian species isolated from Bombyx mori. No other butter- Insect cell lines are important tools for scientific study and, since fly cell lines have been reported to be permissive to microsporidia. 1962, have been used for in vitro propagation and studies of patho- Microsporidia are obligate intracellular eukaryotic parasites that in- gens and obligate intracellular parasites, and for research on pest fect almost all animal phyla and unicellular organisms (Weber et al., control, recombinant protein production, and the molecular basis 1994; Weiss, 2003). This taxon was previously considered to be of development (Goodman and McIntosh, 1994; Murhammer, primitive Protozoa; however, current phylogenetic evidence indi- 1996; Grace, 1962; Jarvis, 1997; O’Reilly et al., 1994; Summers and cates that it belongs within the Fungi (Adl et al., 2005; James et al., Smith, 1988; Wu et al., 1989). Over 500 insect cell lines have been 2006; Keeling et al., 2000; Vossbrinck et al., 2004.) Because micro- established from more than 100 insect species (Lynn, 2001.) To sporidia are obligate intracellular parasites, the establishment of understand functionality and to identify the differences and the sta- in vitro propagation systems is very important for functional genetic bility of each cell line, cell line characterization is critical. There are studies (Kurtti et al., 1994; Tsai et al., 2009; Visvesvara, 2002). more than 260 cell lines derived from about 60 species of Lepidop- The common grass yellow butterfly, Eurema hecabe (Pieridae), is tera (Lynn, 2007), but only a few butterfly cell lines have been estab- one of the most abundant yellow butterflies from the Oriental tro- lished. These include BTI-PR, NIAS-PRC819A-C, and NYAES-PR4A pics and occurs throughout subtropical and temperate zones into cell lines derived from Pieris rapae,(Dwyer et al., 1988; Mitsuhashi East Asia. It is also one of the most difficult species for taxonomists et al., 2003), and Px-58 and Px-64 cell lines derived from Papilio to study because of the numerous geographic and seasonal wing xuthus (Mitsuhashi, 1973). Only the NIAS-PRC819A-C cell line is sus- color patterns (Kobayashi et al., 2001; Narita et al., 2007)In Taiwan, it is difficult to distinguish E. hecabe from Eurema blanda (three spot yellow butterfly), another abundant species of yellow * Corresponding authors. Address: Department of Entomology, National Taiwan University, Taipei, Taiwan, ROC (C.-H. Wang). Fax: +886 2 27364329. butterfly because the morphology of the adults and the host plant E-mail address: [email protected] (C.-H. Wang). species utilized overlap. Larvae, however, are easily distinguished; 0022-2011/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2009.09.003 Y.-R. Chen et al. / Journal of Invertebrate Pathology 102 (2009) 256–262 257 7 the compound eyes of E. blanda are black while those of E. hecabe in ddH2O to a concentration of 1.8 Â 10 cells/ml. The suspended are light green. cells were lysed by four freeze–thaw procedures, then centrifuged In our laboratory, a new cell line was established from theE. hec- at 90g (KUBOTA 1300) for 10 min. The supernatants were electro- abe pupal tissues and named NTU-YB. This cell line is susceptible to phoresed on 10% polyacrylamide gels at a constant voltage of 70 V the Nosema species isolated from E. blanda (N. sp. EB isolate) (Tsai for 6 h, and then tested for three isozymes including esterase, lac- et al., 2009), and to N. bombycis. To further characterize this new cell tate dehydrogenase (LDH), and malate dehydrogenase (MDH) by line, doubling time, karyotypes, isozyme patterns, internal tran- using the staining protocols of Manchenko (2003). scribed spacer (ITS), microsporidian susceptibility, and cytopathic effects (CPE) are described in this report. 2.5. Internal transcribed spacer-I (ITS-I) region analysis 2. Materials and methods The DNA of E. hecabe and E. blanda larvae, and cell lines NTU-YB, HH, LD, LY, MV56 and SF9 were extracted following the procedure 2.1. Primary culture and subculture of Wang et al. (1996). The ITS-I region was amplified by the prim- ers, ITS-I: 50CCCCATAAACGAGGAATTCC30 and ITS4: 50TCCTCCGC 0 E. hecabe pupae were collected from Puli, Taiwan in March of TTATTGATATGC3 (Lin, unpublished). PCR conditions were 94 °C, 2006. The pupae were sterilized by washing with 70% alcohol and 2 min; followed by 40 cycles of 94 °C, 1 min; 50, 1 min; 70 °C, 70% iodine alcohol. The larvae were air dried in a laminar flow hood 3 min; 70 °C, 10 min. The PCR products were commercially se- and pupal tissues, except alimentary canal, were removed and incu- quenced (Genomics Bioscience & Technology), and ClustalX1.81 bated at 28 °C in TNM-FH medium (Hink and Strauss, 1976) contain- was used to analyze the identity of the ITS-I regions among the ing 100 IU/ml penicillin, 100 lg/ml streptomycin, and 1.25 lg/ml samples. fungizone supplemented with 16% fetal bovine serum (FBS). Cells were subcultured when they approached confluence. After the 2.6. Nucleopolyhedrovirus (NPV) infection assay 50th passage, the interval between each subculture was 4 days after cell confluence on the bottom of culture flask. The established cell The susceptibility of the YB cell line to nucleopolyhedroviruses, line was designated NTU-YB. Cell morphology was observed and dis- including AcMNPV-TWN4 (Autographa califorica NPV Taiwan iso- tinguished based on Wang et al. (1996). 2.2. Growth rate of NTU-YB cells To measure growth rate, YB cells were seeded in 25 cm2 flasks at a density of 3 Â 106 cells per flask and cultured with TNM-FH supplemented with different concentrations of FBS, including 0%, 4%, 8%, and 16% FBS. The cells were then incubated at 28 °C, and cell numbers were counted every 24 h. After determining the most appropriate concentration of FBS, cells were cultured at different temperatures with the selected concentration of FBS, and cell num- bers were counted every 24 h. 2.3. Chromosome numbers Log phase NTU-YB cells (1.8 Â 107 cells) were treated with 1 ml (1.5 lg/ll) Demecolcine (Sigma, D-6279) overnight at 28 °C. The cells were then dispersed and centrifuged at 65g (Hettich Universal 30F/RF) for 10 min, resuspended in a hypotonic solution (TNM-FH and distilled water in a 1:4 dilution) for 40 min at 4 °C, then fixed in 3:1 methanol:glacial acetic acid for 10 min. The fixing process was repeated four times, then the fixed cells were dropped verti- cally onto slides. After drying at 37 °C, the cells were stained with Giemsa for 1 min and the chromosome number was counted under a microscope. 2.4. Isozyme analysis The isozyme patterns of confluent cells of NTU-YB were com- pared with those of NTU-PN-HH (derived from Perina nuda pupal ovary tissue, Wang et al., 1996), IPLB-LD-652Y (derived from Lymantria dispar pupal ovary tissue, Goodwin et al., 1978), NTU- LY1 (derived from Lymantria xylina pupal tissue, Wu and Wang, 2006), NTU-MV56 (derived from Maruca vitrata ovary tissue, Chen et al., 2008; Yeh et al., 2007), and commercial Sf9 (Spodoptera fru- giperda cell line.) The HH, LD, LY, and MV56 cells were cultured in TNM-FH supplemented with 8% FBS.