Journal of Human Evolution 73 (2014) 75e87

Contents lists available at ScienceDirect

Journal of Human Evolution

journal homepage: www.elsevier.com/locate/jhevol

Genetic comparisons yield insight into the evolution of enamel thickness during human evolutionq

Julie E. Horvath a,b,c,d, Gowri L. Ramachandran c, Olivier Fedrigo d, William J. Nielsen e, Courtney C. Babbitt d,e, Elizabeth M. St. Clair c, Lisa W. Pfefferle e, Jukka Jernvall f, Gregory A. Wray c,d,e, Christine E. Wall c,*,1 a North Carolina Museum of Natural Sciences, Nature Research Center, Raleigh, NC 27601, USA b Department of Biology, North Carolina Central University, Durham, NC 27707, USA c Department of Evolutionary Anthropology, Duke University, Durham, NC 27708, USA d Duke Institute for Genome Sciences and Policy, Duke University, Durham, NC 27708, USA e Department of Biology, Duke University, Durham, NC 27708, USA f Institute for Biotechnology, University of Helsinki, Helsinki, Finland article info abstract

Article history: Enamel thickness varies substantially among extant hominoids and is a key trait with significance for Received 6 June 2013 interpreting dietary adaptation, life history trajectory, and phylogenetic relationships. There is a strong Accepted 9 January 2014 link in humans between enamel formation and mutations in the exons of the four genes that code for the Available online 5 May 2014 enamel matrix proteins and the associated protease. The evolution of thick enamel in humans may have included changes in the regulation of these genes during tooth development. The cis-regulatory region in Keywords: the 50 flank (upstream non-coding region) of MMP20, which codes for enamelysin, the predominant Primate comparative genomics protease active during enamel secretion, has previously been shown to be under strong positive selection MMP20 AMELX in the lineages leading to both humans and chimpanzees. Here we examine evidence for positive se- 0 fl 0 fl ENAM lection in the 5 ank and 3 ank of AMELX, AMBN, ENAM, and MMP20. We contrast the human sequence AMBN changes with other hominoids (chimpanzees, gorillas, orangutans, gibbons) and rhesus macaques (outgroup), a sample comprising a range of enamel thickness. We find no evidence for positive selection in the protein-coding regions of any of these genes. In contrast, we find strong evidence for positive selection in the 50 flank region of MMP20 and ENAM along the lineage leading to humans, and in both the 50 flank and 30 flank regions of MMP20 along the lineage leading to chimpanzees. We also identify pu- tative transcription factor binding sites overlapping some of the species-specific nucleotide sites and we refine which sections of the up- and downstream putative regulatory regions are most likely to harbor important changes. These non-coding changes and their potential for differential regulation by tran- scription factors known to regulate tooth development may offer insight into the mechanisms that allow for rapid evolutionary changes in enamel thickness across closely-related species, and contribute to our understanding of the enamel phenotype in hominoids. Ó 2014 Elsevier Ltd. All rights reserved.

Introduction

Abbreviations: UTR, untranslated region; kb, kilobase; DNA, deoxyribonucleic Thick enamel distinguishes modern humans from chimpanzees acid; mRNA, messenger ribonucleic acid; miRNA, micro ribonucleic acid; mya, and gorillas and has long been a central feature in discussions of the 0 fl 0 fl million years ago; 5 anking, upstream non-coding region; 3 anking, down- origins and evolution of humans (Molnar and Gantt, 1977; Martin, stream non-coding region; Gene names are italicized and are uppercase for humans (e.g., MMP20), but only the first letter is uppercase for mice or rats (e.g., Mmp20), 1983; Martin, 1985; Grine and Martin, 1988; Schwartz, 2000; Protein names follow the same naming convention for humans and mice, but are Teaford and Ungar, 2000; Ungar et al., 2006; Teaford, 2007). not italicized. Teeth are frequently preserved in the fossil record and enamel q Accession number KF509948 was generated for this manuscript. thickness has measurable links to tooth function and development, * Corresponding author. conferring a strong potential for variation in enamel thickness to E-mail address: [email protected] (C.E. Wall). 1 Department of Evolutionary Anthropology, Box 90383 Duke University, provide insights into the inter-relations among dietary adaptation, Durham, NC 27708, USA. phylogeny, behavioral ecology, and life history during human http://dx.doi.org/10.1016/j.jhevol.2014.01.005 0047-2484/Ó 2014 Elsevier Ltd. All rights reserved. 76 J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87 evolution (Dean, 1985, 1987; Smith, 1991, 1993, 1994; Smith and that disrupts mRNA splicing results in hypomineralized (i.e., weakly Tompkins, 1995; Dean, 2000; Dean, 2006; Lacruz et al., 2008; mineralized) and hypoplastic (i.e., thin) enamel, demonstrating Dean and Smith, 2009; Guatelli-Steinberg, 2009; Dean, 2010; that normal MMP20 expression is essential for proper enamel for- Schwartz, 2012). Our interest in the thick enamel phenotype of mation (Kim et al., 2005; Lu et al., 2008; Wright et al., 2009). The humans stems from our efforts to uncover the genetic basis for the role of MMP20 in enamel formation is likely to be shared across origin of diet-related traits in humans (Haygood et al., 2007; Babbitt mammals as mice lacking functional Mmp20 have hypoplastic and et al., 2011; Fedrigo et al., 2011; Pfefferle et al., 2011). A critical step hypomineralized enamel (Wright et al., 2009). Amelogenin, ame- in expanding our understanding of pattern and process in human loblastin, and enamelin are the major structural EMPs (Wright, evolution is to integrate genetic, comparative anatomical, and 2006) and are encoded by AMELX, AMBN, and ENAM, respectively. paleontological information. Enamel thickness is a trait that pro- Together, these proteins and their products account for about 97% vides an ideal opportunity to combine these types of data. of the enamel extracellular matrix prior to maturation (Fincham Comparative genomics is a powerful method to identify con- et al., 1991). Although it is evident from both genetic and geno- nections to phenotypic trait differences (for a review see Babbitt typeephenotype association studies on primate and mouse denti- et al., 2011), as well as functional elements (ENCODE et al., 2007; tions that tooth development involves the actions of many genes Margulies et al., 2007) and evolutionary changes in gene architec- (Jernvall and Thesleff, 2000; Hlusko et al., 2004; Hu et al., 2005), the ture (Horvath et al., 2011; Lindblad-Toh et al., 2011). Comparative genetic and phenotypic evidence suggests that the four genes methods can identify potential cases of positive selection in one investigated here are excellent candidates for beginning to under- species relative to two or more others, based on sequence changes stand the genetic underpinnings of the evolution of enamel thick- that accumulate faster than would be expected through the neutral ness in humans (Hu et al., 2005; Wright, 2006; Gibson, 2011; process of genetic drift. This elevated rate of sequence change Moradian-Oldak, 2012). suggests a selective advantage to the organism that derives from Here we expand the Haygood et al. (2007) analysis of MMP20 by changes in the function of a protein or the regulation of a gene. The considering more species (gorillas, orangutans and gibbons) in specific identity of genomic regions under positive selection can addition to humans, chimpanzees and rhesus macaques. We also offer insight into how those changes are related to phenotypic investigate three additional genes (AMELX, AMBN, and ENAM) and evolution. Positive selection in protein-coding regions has been additional genic regions (coding and 30 flank). Given the strong link studied extensively at the scale of single genes (Evans et al., 2004a, between enamel formation and mutations in these four genes in 2004b; Al-Hashimi et al., 2009; Fedrigo et al., 2011; Pfefferle et al., humans (Hart et al., 2003; Pavlic et al., 2007; Wright et al., 2011), 2011) and the entire genome (Clark et al., 2003; Vallender and Lahn, we predict that the evolution of thick enamel is linked, at least in 2004; Bustamante et al., 2005; Cooper et al., 2005; Lindblad-Toh part, to genetic changes in the cis-regulatory and/or coding regions et al., 2005; Nielsen et al., 2005; Sabeti et al., 2006; Kosiol et al., of these four genes. The comparative species span a range of 2008; Enard et al., 2010). More recently, methods have been enamel thickness phenotypes from thin (chimpanzees and gorillas) developed to test for positive selection in putative regulatory re- to intermediate (orangutans, gibbons and rhesus macaques) as gions of genes, which have been applied throughout the genome measured by relative enamel thickness (Martin, 1985; Smith et al., (Pollard et al., 2006; Prabhakar et al., 2006; Haygood et al., 2007). 2003, 2005; Olejniczak et al., 2008a). Our goal is to determine King and Wilson (1975) predicted that many of the trait differ- whether there are signals of positive selection in the cis-regulatory ences distinguishing humans and chimpanzees are due to changes regions contrasted with the coding regions in humans as compared in gene regulation rather than protein structure. In support of this with other extant hominoids. We test the null hypothesis that the hypothesis, Haygood et al. (2007) detected at least as much evi- genomic signals of natural selection associated with these genes are dence of adaptive change in cis-regulatory sequences as in protein- similar across species. A lack of similarity will indicate selection in coding sequences, and identified signatures of positive selection one or more species that is correlated with the enamel phenotype. throughout the genome of chimpanzees and humans in compari- son with macaques. Significantly, they found that genes associated Materials and methods with diet are prominently represented among the positively selected cis-regulatory sequences. Consequently, we expect muta- Gene sequence analysis tions affecting gene expression to comprise an important part of the genetic basis for dietary adaptations during human evolution. Genomic sequences at least 5 kb upstream and downstream of Cis-regulatory regions, portions of DNA that can control the tran- each gene were obtained from Ensembl (http://www.ensembl.org/) scription of a gene, are often found immediately upstream of a gene for humans (Homo sapiens, GRCh37/hg19), chimpanzees (Pan (the 50 flank is upstream of the transcription start) but may also be troglodytes, CHIMP 2.1.4), gorillas (Gorilla gorilla, gorGor3.1), found within introns or in the downstream (the 30 flank) region orangutans (Pongo abelii, PPYG2), gibbons (Nomascus leucogenys, adjacent to the gene (reviewed in Wray, 2003). Changes in the Nleu1.0) and rhesus macaques (Macaca mulatta, MMUL_1) based on amino acid sequence of protein-coding genes can often dramati- the coordinates in Table 1. Sequence 5 kb upstream and down- cally alter or destroy gene functionality. In contrast, changes in the stream of each gene was chosen for analysis because the majority of cis-regulatory DNA sequence can modify gene function, activity or regulatory elements lie within the first few kb of the transcription expression timing and duration without affecting the integrity of start (Blanchette et al., 2006; ENCODE Project Consortium, 2012). the encoded protein (Wray, 2007). Genomic sequences were masked for repetitive elements with One promising candidate gene identified by Haygood et al. RepeatMasker version 3.3.0 (RMLib: 20110920) at http://www. (2007) that may provide insight into the evolution of the human repeatmasker.org/ (A.F.A. Smit, R. Hubley and P. Green, Unpub- enamel thickness phenotype is MMP20, which encodes a protease lished data) using the cross_match search engine with default known as enamelysin or matrix metalloproteinase-20. Enamelysin speed and the human source library. This step allowed us to remodels the large enamel matrix proteins (EMPs) that surround identify species-specific repeats and aided subsequent sequence the enamel crystallites during the secretory phase of amelogenesis alignment and trimming. Sequences were imported into Geneious (Krebsbach et al., 1996; Llano et al., 1997), and more recently was (v 6.0.4) (Biomatters Ltd., Auckland, New Zealand) and aligned suggested to play a role in cleaving ameloblast junctional com- using the MAFFTv6.814b plug-in (Katoh et al., 2002) with the auto- plexes (Bartlett and Smith, 2013). An MMP20 mutation in humans algorithm 200 PAM/k ¼ 2 scoring matrix, a gap open penalty of 1.53 J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87 77

Table 1 Gene coordinates.

Species Build AMELX AMBN ENAM MMP20

Human GRCh37/hg19 chrX:11306533-11323881 chr4:71452975-71478004 chr4:71489461-71517536 chr11:102442566-102501063 Chimpanzee CHIMP2.1.4 chrX:11216003-11233825 chr4:59543937-59568925 chr4:59503387-59531458 chr11:100416757-100475433 Gorilla gorGor3.1 chrX:11151674-11168866 chr4:79052784-79078048 chr4:79088418-79124609 chr11:100121455-100182001 Orangutan PPYG2 chrX:11132253-11149760 chr4:73682541-73707282 chr4:73716945-73746745 chr11:98871240-98933215 Gibbon Nleu1.0 GL397281.1:8574562-8591945 GL397302.1:2163819-2189920 GL398489.1:7930-15363 GL397262.1:35694144-35750051 Gibbon Nleu1.0 GL398489.1:1653-7834 Gibbon Nleu1.0 GL397302.1:2198763-2200060 Gibbon Nleu1.0 GL398489.1:17-354 Gibbon Nleu1.0 GL397302.1:2201830-2211827 Gibbon Nleu1.0 GL397302.1:2216216-2216482 Gibbon Nleu1.0 GL397302.1:2212055-2214074 Rhesus macaque MMUL_1 chrX:8960343-8977738 chr5:59023626-59048899 chr5:58990966-59015573 chr14:101163193-101222680

and an offset value of 0.123. Sequences were assessed for gaps by two non-coding exons (for AMELX and ENAM). The 30 flank region eye after alignment in Geneious. was defined by the 5000 bp downstream of the human translation stop. The regions were determined based on the mRNA and coding Non-human primate sequence gap filling sequences shown in Table 3. Each positive selection test conducted in HyPhy (Tables 4e6) was repeated three times, and all values The publicly available data are missing sequences for some exhibited only minor variation (data not shown). genes and flanking regions in some species. In order to fill these For each region, the human and chimpanzee branches were 0 0 gaps, we isolated genomic DNA using Qiagen’s DNeasy Blood and tested for positive selection. The protein-coding, 5 flank and 3 Tissue Kit (Qiagen, Valencia, CA) from a male lowland gorilla flank regions were tested using the method described in Haygood (Gorilla gorilla, PR00107) and a male orangutan (Pongo pygmaeus et al. (2007). This method is adapted from Wong and Nielsen abelii, AG12256) from cells obtained from the Coriell Cell Re- (2004) and incorporates the improved branch-site likelihood positories (Camden, NJ). Primers (see Table 2) were designed method (Zhang et al., 2005). It has been implemented in HyPhy spanning gaps in each species in Geneious (v 6.0.4) using primer3 (Pond et al., 2005) and is available at: (https://github.com/ofedrigo/ default settings. Polymerase chain reaction (PCR) assays were car- TestForPositiveSelection.git). This test divides branches of the tree ried out using Phusion (NEB, Ipswich, MA) high fidelity polymerase into a foreground branch (in our case either human or chimpanzee) on an MJ Research, Inc. thermocycler (Waltham, MA). General and background lineages (all of the other species). A likelihood ratio amplification conditions were as follows: an initial denaturation for test compares a model allowing positive selection on the fore- 2.0 min at 98 C; followed by 21 cycles of 10 s at 98 C, 20 s at ground branch (the alternate model or hypothesis) with a null 50 Ce65 C and 2.5 min at 72 C; and a final extension for 10.0 min model that does not allow positive selection on the foreground at 72 C. The PCR products were purified using the QIAquick PCR branch; if the alternate model fits the data better, then the null Clean-up kit (Qiagen, Valencia, CA) and Sanger sequenced following model is rejected, which indicates that a particular lineage accu- Garfield et al. (2012). The sequences we generated are available in mulated more changes in the region of interest than expected by the Supplementary Online Material (SOM). chance. In addition, the null model accounts for a relaxed constraint Once sequence gaps were filled in the aligned sequences, scenario (i.e., conservation on the background branches and neutral alignment gaps were removed using an in-house script (https:// evolution on the foreground branch). The q-value corrections for github.com/ofedrigo/TestForPositiveSelection/blob/master/ multiple comparisons were carried out according to Storey and RemoveDashes.py) prior to HyPhy assays, as the tests for selection Tibshirani (2003). consider only positions present in all species. SOM Table 1 indicates For the tests of positive selection in the protein-coding regions, the size of each compartment in base pairs before and after gap the orangutan was excluded from the AMELX coding positive se- removal. For the 30 flank analysis of ENAM, the rhesus macaque was lection analyses and the rhesus macaque was excluded from ENAM removed from the analysis due to a large deletion. coding positive selection analyses due to putative frameshift mu- tations observed when aligning the coding regions (see Table 4). Positive selection analyses This could affect our coding selection analyses since removing species limits the power to detect positive selection. 0 0 Three different regions (protein-coding, 50 flank and 30 flank) For the tests of positive selection in the 5 flank and 3 flank, the were analyzed for signatures of positive selection across each gene. method estimates the substitution rate on each lineage. This The 50 flank was defined by the 5000 bp upstream of the human method is analogous to the commonly used dN/dS ratio (⍵) for translation start, excluding the first intron if it was between the first protein-coding regions. It generates a substitution ratio (x) of the

Table 2 Primer sequences used to fill three sequence gaps.

Gap filled Gene Build Gap coordinate F Primer F primer sequence R Primer R primer sequence Sequence

Gorilla AMELX gorGor3.1 chrX:11152909-11153034 52F GAGTCCCTAGATAACTACT 54R TATACTCCAAGCAAATACACTATG See SOM Gorilla AMELX gorGor3.1 chrX:11152909-11153034 53F GTGTTTTGGCGAATATCTCCCCAA 55R TAGCTAAGATGGATAATTCAGCAT See SOM Orangutan AMELX PPYG2 chrX:11135373-11135986 5F CAAAGCTTGTTCAACTGTCC 6R CTTTGTTTCCGTGTTCTCAG KF509948 Orangutan AMELX PPYG2 chrX:11135373-11135986 27F ACCACCTTGCTGTACACCCC 28R GTGTGTTTTACCCCTCTACCTTGG KF509948 Gorilla ENAM gorGor3.1 chr4:79091746-79091851 117F ACAGTTGTAATTGTCTGAAGGG 159R GAGAGGAAATGACACAGGCACTG See SOM Gorilla ENAM gorGor3.1 chr4:79091746-79091851 118F GACTGAGAAGGGTAATGTAGA 159R GAGAGGAAATGACACAGGCACTG See SOM

For all three gaps we generated multiple PCR products using different primer sets (above) to produce complete high quality sequence to fill gaps. 78 J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87

Table 3 Table 5 mRNA and protein accessions. Results of non-coding positive selection assays with human on the foreground branch. Bold text indicates gene regions that are under positive selection. Gene Coding mRNA Notes Human Region Noncoding Intronic bp p value q value Notes AMELX NP_872621.1 NM_182680.1 1st intron between bp mRNA exons 1 and 2 AMBN NP_057603.1 NM_016519.4 AMELX 30 flank 4916 5129 0.767 1 ENAM NP_114095.2 NM_031889.2 1st intron between 50 flank 4392 5129 0.505 0.808 mRNA exons 1 and 2 AMBN 30 flank 4747 9279 1 1 MMP20 NP_004762.2 NM_004771.3 50 flank 4576 9279 0.99 1 ENAM 30 flank 3652 8431 0.128 0.256 *Macaque removed because of a 0 region of interest (e.g., the 5 flank of ENAM) relative to a nearby large deletion region of the genome that is assumed to have evolved neutrally 50 flank 5097 8431 0.00518 0.0207 0 (e.g., the introns of ENAM). A signature of positive selection in the MMP20 3 flank 5249 20278 0.077 0.205 50 flank 4945 20278 0.000738 0.0059 region of interest (e.g., more change in the 50 flank than in the in- trons of ENAM) is consistent with a ratio x > 1. By contrast, neutral evolution in the region of interest is consistent with a ratio x ¼ 1 background branches, and (4) positive selection (x > 1) on the 0 (e.g., the same amount of change in the 5 flank and the introns of foreground branch and neutral evolution (x ¼ 1) on the background ENAM) and negative selection is consistent with a ratio x < 1 (e.g., branches. less change in the 50 flank than in the introns of ENAM).Forboth50 0 fl and 3 anking regions, we assessed positive selection across the Transcription factor binding sites entire 5 kb region as well as within approximately 1 kb windows e 0 (Figs. 1 4). For each gene, we searched the upstream 5 flank 5000 bp using The neutral proxy provides the baseline for evaluating the TRANSFAC in Biobase with default settings (http://www.biobase- 0 fl 0 fl amount of DNA sequence change in the 5 ank and 3 ank of each international.com/product/transcription-factor-binding-sites). The w gene and comprises 5 kb of intronic sequence from the gene profile (group of matrices) was set as vertebrate_non- under analysis or a nearby region of the genome, following redundant_minFP with the ‘use only high-quality matrices’ op- fi Haygood et al. (2007). To generate the neutral proxy, the rst intron tion, and cut-off criteria were set to minimize false positives. and the centers of large introns were removed as they may contain Output coordinates and putative binding sites were annotated by regulatory elements that are not evolving neutrally (Blanchette hand in Geneious. We considered several transcription factors et al., 2006; Crawford et al., 2006; ENCODE Consortium, 2012). known to be associated with dental formation and/or enamel for- Then, 100 bp was trimmed from each end of the remaining introns, mation: DLX3, DLX5, OCT1, SOX9 (Davideau et al., 1999; Bouwman and the sequences concatenated. For AMELX, this concatenated et al., 2000; Narukawa et al., 2007; Xu et al., 2010; Athanassiou- < sequence was 5 kp, so 986 bp of intronic sequence from a nearby Papaefthymiou et al., 2011). A fifth transcription factor, SP3, was gene was added, again following Haygood et al. (2007). not available in TRANSFAC so we used Regulatory Sequence Anal- The null and alternate models are evaluated for a number of ysis Tools (RSAT) matrix-scan using default settings (http://rsat.ccb. evolutionary rate classes that strengthen the interpretation of sickkids.ca/)(Turatsinze et al., 2008) to identify binding sites positive selection on the foreground branch (see Haygood et al., (Bouwman Embo Karis J 2000). The SP3 matrix was determined in fl 2007 for a detailed discussion). Brie y, the null model has three human using PAZAR (http://www.pazar.info/)(Portales-Casamar rate classes all of which indicate neutral evolution or negative se- et al., 2007, 2009). lection on the foreground branch. The alternate model has four rate x < classes: (1) negative selection ( 1) on all branches, (2) neutral HapMap overlap with human unique sites evolution (x ¼ 1) on all branches, (3) positive selection (>1) on the x < foreground branch and negative selection ( 1) on the In order to better understand the evolutionary history of single base mutations that are unique to the human lineage relative to the Table 4 other five species analyzed here, we uploaded all such mutations as Results of coding positive selection analyses by gene. browser extensible data (BED) files into the UCSC browser and Gene Region Foreground Size (bp) p value q value Notes compared to single nucleotide polymorphisms (SNPs) in the Hap- Map track (Thorisson et al., 2005). If no SNPs are known at that AMELX Coding Human 616 0.995 0.995 *Orangutan was fi excluded due to a position, we considered the mutation to be xed within humans. putative frameshift AMBN Coding Human 1266 0.999 0.995 *Removed gorilla miRNA binding sites in 30 untranslated region indel spanning exons 7&8 0 ENAM Coding Human 3417 0.991 0.995 *Macaque was We assessed the 3 UTR of MMP20 in chimpanzees for putative excluded due to miRNA binding sites based on the Segal lab predictions (http:// putative frameshift genie.weizmann.ac.il/pubs/mir07/mir07_prediction.html). We MMP20 Coding Human 1452 0.579 0.995 used miRBase version 11.0 with a ddG threshold <10 with a seed AMELX Coding Chimpanzee 616 0.995 0.999 *Orangutan was of 8:0:0 (seed of 8 bp, no mismatches, no G:U wobble) or 8:0:1 excluded due to a (seed of 8 bp, no mismatches, 1 G:U wobble) (Kertesz et al., 2007). putative frameshift AMBN Coding Chimpanzee 1266 0.999 0.999 *Removed gorilla indel spanning exons 7&8 Results ENAM Coding Chimpanzee 3417 0.995 0.999 *Macaque was excluded due to In both the human branch and chimpanzee branch, foreground putative frameshift tests of the protein-coding regions showed no evidence of positive MMP20 Coding Chimpanzee 1452 0.931 0.999 selection in any of the genes (Table 4). J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87 79

Table 6 Results of non-coding positive selection assays with chimpanzees on the foreground branch. Bold text indicates gene regions that are under positive selection.

Gene Region Noncoding bp Intronic bp p value q value Notes

AMELX Chimpanzee 30 flank 4916 5129 0.999 1 Chimpanzee 50 flank 4392 5129 1 1 AMBN Chimpanzee 30 flank 4747 9279 1 1 Chimpanzee 50 flank 4576 9279 0.328 0.656 ENAM Chimpanzee 30 flank 3652 8431 0.944 1 *Macaque removed because of a large deletion Chimpanzee 50 flank 5097 8431 0.0947 0.253 MMP20 Chimpanzee 30 flank 5249 20278 3.005E-07 2.40E-06 Chimpanzee 50 flank 4945 20278 0.000586 0.00234

In comparing the flanking regions of humans with those of the (2nd_KB and 3rd_KB) with more unique sites relative to other other species, we found positive selection in the 50 flank of MMP20 sub-regions are the only ones showing overall evidence of positive (p ¼ 0.000738, q ¼ 0.0059, Table 5, Fig. 1) and in the 50 flank of selection (Fig. 1b). This trend of sub-regions with more unique sites ENAM (p ¼ 0.00518, q ¼ 0.0207, Table 5, Fig. 2). In the comparisons also exhibiting evidence of positive selection is consistent for the of chimpanzees with the other species, we found positive selection other genes and regions. The human ENAM 50 flank has 46 unique for MMP20 in both the 30 flank (p ¼ 3e-7, q ¼ 2.4e-6,Table 6, Fig. 3) sites with the 4th_KB sub-region showing evidence of positive se- and the 50 flank (p ¼ 0.000586 q ¼ 0.00234, Table 6 and Fig. 4). lection (Fig. 2b and c). Similarly, within the chimpanzee MMP20 30 There were no other significant tests for positive selection in the flank there are 56 sites unique to the chimpanzee branch and the human or chimpanzee foreground comparisons after correcting for 1st, 2nd, 3rd and 5th_KB sub-regions show evidence of positive multiple comparisons. selection (Fig. 3b and c). Within the chimpanzee MMP20 50 flank, For each 50 flank or 30 flank under positive selection (across the there are 38 sites unique to the chimpanzee branch (Fig. 4b and c). entire 5 kb), we assessed whether certain sub-regions showed The two regions with the most unique sites also showed evidence stronger evidence of selection in order to provide further insight of positive selection (see 4th_KB and 1st_KB in Fig. 3b). The two into which compartments and/or nucleotides may be important for sub-regions of MMP20 50 flank under selection along the human changes in gene regulation. For the MMP20 50 flank in human branch (2nd_KB and 3rd_KB) are different from the two sub- (Fig. 1b and c), there were 39 unique nucleotide changes along the regions under selection along the chimpanzee branch (1st_KB human branch relative to the other species. The two sub-regions and 4th_KB) (compare Figs. 1b to 4b).

Figure 1. Multi-species alignment of MMP20 50 flank in humans. a) Above is a schematic of the MMP20 gene indicating the expanded regions below that correspond to the upstream 5000 bp of 50 flank. b) The 5000 bp was divided into five approximately 1 KB regions with the 1st_KB region nearest the translation start (to the right). The graph shows the count of the number of sites within each 1 KB region that are unique to the human branch (green diamonds), and the number of putative transcription factor binding sites involved in tooth or enamel formation (purple triangles). The sub-regions under positive selection are indicated by gray boxes with p values. c) Along the top is the consensus sequence across this 5013 bp region upstream of the MMP20 gene. Coordinates correspond to the genomic location based on hg19. The identity plot below indicates 0e100% sequence identity with green showing 100% identity among all species. Each species’ sequence is shown by gray horizontal bars with black tick marks indicating sequence changes from the consensus. Below the human line are the unique sites (in green), and putative transcription factor binding sites (shown by purple arrowheads). The 1 KB regions are indicated by light blue horizontal bars. The brown box with an E indicates a putative enhancer element (see last paragraph of results). Alignment gaps are shown by lines across the sequence. There are small sequence gaps in chimpanzees and gorillas across this region, which are indicated by gray ovals (for interpretations of the references to color in this figure legend, the reader is referred to the web version of this article). 80 J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87

Figure 2. Multi-species alignment of ENAM 50 flank in humans. a) Along the top is a schematic of the ENAM gene indicating that the regions below are from the upstream 50 flank. b) The 50 flank was divided into five approximately 1 KB regions with the 1st_KB region nearest the translation start (to the right). The graph shows the number of sites within each 1 KB region that are unique to the human branch (green diamonds), and the number of putative transcription factor binding sites involved in tooth or enamel formation (purple triangles). The 4th_KB region, which is under positive selection, is indicated by gray shading. c) Along the top is the consensus sequence across this region upstream of the ENAM gene. There was a large alignment gap, which was removed in this picture (indicated by the double hatched line). Coordinates correspond to the genomic location based on hg19. The identity plot below indicates 0e100% sequence identity with green showing 100% identity among all species. Each species’ sequence is shown by gray horizontal bars with black tick marks indicating sequence changes from the consensus. Below the human line are the unique sites (in green) and putative transcription factor binding sites (shown by purple arrowheads). Alignment gaps are shown by dashes across the sequence. One gorilla gap was filled across here (indicated by yellow bar) and a 100 bp sequence gap remains in the gibbon sequence (denoted by a gray box). The red arrowhead to the right indicates the start of the untranslated region (for interpretations of the references to color in this figure legend, the reader is referred to the web version of this article).

We next assessed whether the unique sites in MMP20 and ENAM sites identified above overlapped putative transcription factor were variable in humans or if they were fixed in the human lineage. bindings sites from our analyses. We did this by overlaying these sites with HapMap single nucleo- tide polymorphisms (SNPs) in the UCSC genome browser (http:// Discussion genome.ucsc.edu/). All 39 MMP20 sites were fixed across human populations (data not shown). Similarly, 45 of the 46 ENAM sites The tests for positive selection we report here contrast se- were fixed in the human population (data not shown). quences in the 50 flank and 30 flank of humans or chimpanzees as The correlation between phenotype and positive selection is compared with these regions in gorillas, orangutans, gibbons and strengthened if the sequence changes can be linked to sites on the rhesus macaques. By contrasting the human and chimpanzee genome where transcription factors or other regulatory elements branches independently, we strengthen correlations with the such as microRNAs (miRNAs) bind to DNA in order to regulate its evolution of enamel thickness variation at the human-chimpanzee transcription. Therefore, we separately analyzed the 50 flank of node. Our results suggest strong positive selection within the 50 MMP20 and ENAM in humans by looking for putative binding sites flank of MMP20 on both human and chimpanzee branches, and in of transcription factors known to be involved in enamel or tooth the 30 flank of the chimpanzee branch (Tables 5 and 6). The results development (DLX3, DLX5, OCT1, SOX9, SP3) (Davideau et al., 1999; also indicate strong positive selection in the 50 flank of ENAM on the Bouwman et al., 2000; Narukawa et al., 2007; Xu et al., 2010; human branch. Thus, the human and chimpanzee branches show Athanassiou-Papaefthymiou et al., 2011). For both the 50 flank of distinct genomic signals of natural selection in MMP20 and ENAM MMP20 and ENAM, we identified a SOX9 binding site overlapping or that are correlated with differences in enamel thickness in the within 6 bp of a unique site along the human branch (SOM Figs. 1c, extant species. We find no evidence of positive selection in the 2c and 2d). Interestingly, the 1st_KB sub-region of MMP20 50 flank flanking regions of AMELX and AMBN on either branch. Similarly, has the fewest human unique sites but the most putative tran- there is no evidence of positive selection in any coding region on scription factor binding sites (Fig. 1b). In an independent analysis, either branch (Table 4). Since the human sites under positive se- the 1st_KB sub-region was also found to contain a putative lection are different from the chimpanzee sites under selection in enhancer element conserved across mammals (Jernvall and Halli- MMP20 50 flank, the human-specific changes we identified may be kas, Unpublished) (SOM Fig. 1c). In the 50 flank of MMP20 along the correlated with the thick enamel phenotype in humans while the chimpanzee branch, we identified one unique site adjacent to a changes along the chimpanzee branch may be correlated with the putative OCT1 binding site (SOM Fig. 3c). In the 30 flank of MMP20 thin enamel phenotype seen in extant chimpanzees. In addition to along the chimpanzee branch, we identified four putative miRNA enamel thickness, enamel hardness, which differs between humans binding sites, but none of these overlapped the unique sites iden- and chimpanzees (Lee et al., 2010), may be linked to the differences tified by our analyses (SOM Fig. 4c). None of the HapMap variable in selection on MMP20 regulation. Additionally, positive selection J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87 81

Figure 3. Multi-species alignment of MMP20 30 flank in chimpanzees. a) Along the top is a schematic of the MMP20 gene in chimpanzees indicating that the regions below are from the downstream 30 flank region. b) The 30 flank was divided into five approximately 1 KB regions with the 1st_KB region nearest the translation stop (to the left). The graph shows the count of the number of sites within each 1 KB region that are unique to the chimpanzee branch (blue diamonds). The four sub-regions under positive selection are indicated by gray shading. c) Along the top is the consensus sequence across this region downstream of the MMP20 gene. The identity plot below indicates 0e100% sequence identity with green showing 100% identity. Each species’ sequence is shown by gray horizontal bars with black tick marks indicating sequence changes from the consensus. Below the human line is the 30 untranslated region (in red). Below the chimpanzee line are the sites unique to the chimpanzee branch (blue) and putative miRNA binding sites (in purple). There is one gap across this region in the macaque genome (indicated by a gray box) (for interpretations of the references to color in this figure legend, the reader is referred to the web version of this article). across both the 30 and 50 flanking regions of MMP20 in chimpanzees species (Dean et al., 2001; Avishai et al., 2004; Lacruz et al., 2008; suggests multiple levels of regulation of MMP20 in the chimpanzee Dean, 2010; Guatelli-Steinberg et al., 2012). This is not surprising lineage. given the large number of transcription factors and signaling molecules that operate in a complex gene network during enamel Tooth development and enamel thickness formation (Jernvall and Thesleff, 2000; Tummers and Thesleff, 2009). Enamel thickness is determined during the secretory phase of Enamelysin (encoded by MMP20) is the predominant proteolytic amelogenesis (Athanassiou-Papaefthymiou et al., 2011). It is a enzyme during the secretory phase of enamel formation (Bartlett function of the appositional growth rate (e.g., m/day) times the et al., 2006). Enamelysin is secreted continuously by ameloblasts duration of growth (e.g., number of days) in relation to the angle into the elongating enamel rod where it processes enamelin and of growth of the enamel rod relative to the dentineenamel the amelogenins (Bartlett and Simmer, 1999; Simmer and Hu, junction (Grine and Martin, 1988; Dean, 2000; Simmer et al., 2002). Thus, the proper expression of MMP20 is critical for regu- 2010). Multiple lines of evidence indicate the importance of lating the size and packing of enamelin and amelogenin molecules enamelysin (MMP20), enamelin (ENAM), amelogenin (AMELX), (Caterina et al., 2002; Beniash et al., 2006; Lu et al., 2008; and ameloblastin (AMBN) in shaping the space for the proper Moradian-Oldak, 2012). The Mmp20 null mouse has a dramatic growth in length of the enamel crystallite ribbons and enamel tooth phenotype including improper processing of the EMPs and rods prior to maturation (Simmer and Hu, 2002; Fukumoto et al., hypoplastic enamel. 2005; Bartlett et al., 2006; Margolis et al., 2006; Chun, 2009; Although enamelin (encoded by ENAM) is the least abundant Chun et al., 2010; Simmer et al., 2010; Yamakoshi et al., 2011; of the EMPs, mutations in ENAM are associated with hypoplasia Moradian-Oldak, 2012). The proximate mechanisms regulating (Bartlett et al., 2006), and Enam-nullmicelackenamel(Hu enamel thickness are unknown, but recent work points to the et al., 2008). Enamelin has been studied extensively at the importance of several families of transcription factors, signaling molecular level, revealing both its ancient origin and particular molecules and the circadian clock genes as regulators of enamel coding regions under selection in human populations and development (Cobourne and Sharpe, 2003; Lezot et al., 2008; nonhuman primates (Sire et al., 2007; Kelley and Swanson, Simmer et al., 2010; Athanassiou-Papaefthymiou et al., 2011; 2008). Zheng et al., 2011; Lacruz et al., 2012). Likewise, studies of the Fukumoto et al. (2005) show that enamelin is secreted into the time-dependent and rate-dependent features of forming tooth core of the enamel rod where it surrounds the crystal ribbon, and crowns suggest that there is still much to be learned about the that it is critical for maintaining the integrity of the pre-mineralized developmental genetics of enamel thickness among hominoid space of the enamel rod. Enamelin occurs in high concentrations at 82 J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87

Figure 4. Multi-species alignment of MMP20 50 flank in chimpanzee. a) Along the top is a schematic of the MMP20 gene in chimpanzees, indicating that the regions below are from the upstream 50 flank region. b) The 50 flank was divided into five approximately 1 KB regions with the 1st_KB region nearest the translation start (to the right). The graph shows the count of the number of sites within each 1 KB region that are unique to the chimpanzee branch (blue triangles) and the number of putative transcription factor binding sites involved in tooth or enamel formation (purple boxes). The two sub-regions under positive selection are indicated by gray shading. c) Along the top is the consensus sequence across this region upstream of the MMP20 gene. Coordinates correspond to the genomic location based on CHIMP 2.1.4 (the most recent chimpanzee genome assembly). The identity plot below indicates 0e100% sequence identity with green showing 100% identity. Each species’ sequence is shown by gray horizontal bars with black tick marks indicating sequence changes from the consensus. Below the human line are the human unique sites (in green) and putative transcription factor binding sites (shown by purple arrowheads). Below the chimpanzee line are the chimpanzee unique sites (in blue) and putative transcription factor binding sites (shown by purple arrowheads). The brown box under the human line with an E indicates a putative enhancer element (see last paragraph of results). There is one small gap in chimpanzee and one in gorilla (indicated by gray ovals) (for interpretations of the references to color in this figure legend, the reader is referred to the web version of this article). the dentin-enamel boundary and has been suggested to play a role Enamel thickness evolution, measurement, and function in maintaining structural organization in this region as well (Dohi et al., 1998; Fang et al., 2011). Since we found evidence for positive selection in MMP20 along Thus, the studies mentioned above provide compelling evidence both the human and chimpanzee branches, we undertook a set of for the importance of enamelysin and enamelin during enamel post hoc scans for positive selection to evaluate whether changes in thickness formation. Our findings suggest that natural selection the 50 and 30 flanking regions of MMP20 are species-specific in the results in targeted modifications to the regulatory regions of hominoid lineage. The first test contrasts the orangutan branch in MMP20 and ENAM rather than overhauling the entire enamel ma- comparison with a gibbon-rhesus macaque group. This test showed trix complement via coding changes. This scenario contrasts with no evidence for positive selection on the orangutan branch (data the more dramatic changes seen in baleen whales in which the loss not shown). The second test contrasts the gorilla branch in com- of a functional copy of MMP20 is accompanied by the complete loss parison with an orangutan-gibbon-rhesus macaque group and of dental enamel (Meredith et al., 2010). Similar changes occur in showed no evidence for positive selection (data not shown). From concert with mutations in ENAM in edentates (Meredith et al., these tests, we conclude that the non-coding changes in the 50 flank 2009). and 30 flank of MMP20 are specific to the human and chimpanzee Several transcription factor binding sites (SOX9 in human, and branches and that, using our methods, these regions are not under OCT1 and DLX5 in chimpanzee) span unique nucleotide sites, directional selective pressure across all species analyzed here. providing a possible functional explanation for a link between This result raises the question of why chimpanzees and humans enamel formation and these species-specific differences. are the only two hominoid species to show a signal of positive Papagerakis et al. (2009) identified a promoter region upstream of selection. One possibility is that tests for positive selection are the Enam gene in mice using transgenic lines. This region is statistically conservative and we may simply have failed to detect included in our analysis and contains 21 bp unique to the human some instances of positive selection. For example, a single mutation branch; two of the unique sites are within 6 bp of a putative SOX9 in the regulatory region could adaptively alter tooth morphology, binding site (SOM Fig. 5). Therefore, if this region serves as a pro- but statistically this would not be distinguished from a random moter in humans, there are likely several potential binding sites sequence change. Similarly, mutations in multiple genes could conferring regulation of the ENAM gene. Although no links to contribute to a change in enamel thickness but not be detectable in enamel thickness have been made with SOX9, the SOX family of any one gene. Moreover, the genes we examined are not the only transcription factors is implicated in the proper development of ones that have the potential to influence enamel. Nevertheless, it is neural-crest-derived tissues during morphogenesis of the branchial encouraging that even with a small set of genes, we have some arches, including teeth (Kanzler et al., 1998; Mori-Akiyama et al., indication about future directions for subsequent studies (e.g., 2003; Juuri et al., 2013). comparisons of RNA expression in chimpanzee and human teeth J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87 83 and comparison of the Neanderthal sequence data to that of the that thick enamel has been the dominant phenotype throughout human and chimpanzee). The strong signal of positive selection on the past four million years of hominin evolution (Smith et al., two out of five hominoid branches suggests that regulation of 2012). Our results raise the possibility that the enamel thick- MMP20 may be a frequent target of selection. ness phenotype of both chimpanzees and humans differs from An important motivation for this study was to look at genomic that of their last common ancestor. To attempt to place the evidence for natural selection that may ultimately link to a genomic signal of selection in phenotypic context, we mapped phenotypic trait that is preserved in the fossil record. The central the distribution of enamel thickness states in extant hominoids position of enamel thickness as a defining trait among hominoids is and fossil hominins onto a phylogeny and used maximum like- due to its dependability as a diagnostic feature (Molnar and Gantt, lihood estimation to reconstruct nodes in that phylogeny (Fig. 5, 1977; Kay, 1981, 1985; Gantt, 1983; Martin, 1983; Martin, 1985; SOM Table 2 and see also SOM). Thick enamel occurs in Aus- Beynon and Wood, 1986; Grine and Martin, 1988; Shellis et al., tralopithecus anamensis andmostsubsequenthominins(Beynon 1998; Schwartz, 2000; Grine, 2002; Olejniczak et al., 2008a, and Wood, 1986; Grine and Martin, 1988; Teaford and Ungar, 2008b; Smith et al., 2012). Average and relative enamel thickness 2000; Ungar et al., 2006; Olejniczak et al., 2008b; Smith et al., as defined by Martin (1983) are now the standard measures of 2012). Neanderthals are distinguished from the other hominin enamel thickness in comparative studies. Both variables provide a taxa in having intermediate enamel due primarily to the larger way to scale the amount of enamel relative to tooth size and volume of dentin but also to absolutely thinner enamel at some therefore also measure variation in tooth size. Neither variable tooth positions (Smith et al., 2010, 2012). The maximum likeli- measures the thickness of enamel deposited by an ameloblast (cf. hood analysis reconstructed a range of phenotypes at the node Simmer et al., 2010). Although tooth size and enamel thickness may uniting chimpanzee and human, depending on the position of be positively correlated, they are also independently regulated Ardipithecus and the enamel thickness inferred for the latter because large teeth can have thin, and small teeth can have thick (SOM). In a broader comparative study, St. Clair et al. (2013) enamel. A full understanding of the complex relationship between show that choice of enamel thickness variable has an effect on tooth size and enamel thickness requires more work to determine interpretations of phenotypic change along primate lineages. A the appropriate way to measure enamel thickness, particularly comparison of the genomic data presented here to the recently when the goal is to integrate genomic, developmental, and published Neanderthal (http://www.eva.mpg.de/neandertal/ phenotypic data across multiple species. index.html) and Denisovan (Meyer et al., 2012)genomesisun- However, it is clear that irrespective of the variable used to derway and may increase our ability to interpret the chim- quantify enamel thickness, humans have thick enamel in com- panzee and human differences in the signatures of selection in parison with chimpanzees and gorillas (Dean et al., 2001)and MMP20.

Figure 5. Phylogeny of enamel thickness phenotypes. Phylogenetic tree and enamel thickness states for extant taxa in this study as well as fossil hominins. Maximum likelihood reconstructions for enamel thickness at hominoid nodes suggest that the ancestral morphotypes for clades including hominins are highly dependent both on the phylogenetic position of Ardipithecus and how the enamel thickness of this genus is characterized (see SOM for details of the ancestral state reconstructions). Phylogenetic topography for hominins is based on a previous method (Strait et al., 1997). States were primarily based on relative enamel thickness when available. The maximum likelihood estimation routine in the ‘ape’ R package (Paradis et al., 2004) was used to reconstruct nodes under an assumption of equal rates (ER). 84 J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87

In primates and other mammals, thick molar enamel is linked to References a hard/tough-object diet and/or the inclusion of large amounts of abrasives in the diet (Jolly, 1970; Molnar and Gantt, 1977; Kay, 1981, Al-Hashimi, N., Sire, J.Y., Delgado, S., 2009. Evolutionary analysis of mammalian enamelin, the largest enamel protein, supports a crucial role for the 32-kDa 1985). Recent studies suggest that functional links to diet, and the peptide and reveals selective adaptation in rodents and primates. J. Mol. Evol. associated selective pressures, were complex during hominin 69, 635e656. evolution, and that variation in enamel thickness across the Athanassiou-Papaefthymiou, M., Kim, D., Harbron, L., Papagerakis, S., Schnell, S., fi Harada, H., Papagerakis, P., 2011. Molecular and circadian controls of amelo- occlusal surface is potentially useful for making ner-grained in- blasts. Eur. J. Oral Sci. 119 (Suppl 1), 35e40. ferences about dietary adaptation (Macho et al., 1995; Schwartz, Avishai, G., Muller, R., Gabet, Y., Bab, I., Zilberman, U., Smith, P., 2004. New approach 2000; Ungar, 2004; Lucas et al., 2008; Vogel et al., 2008; Smith to quantifying developmental variation in the dentition using serial micro- e et al., 2012). The persistence of thick enamel in modern humans tomographic imaging. Microsc. Res. Techniq. 65, 263 269. Babbitt, C.C., Warner, L.R., Fedrigo, O., Wall, C.E., Wray, G.A., 2011. Genomic signa- is somewhat paradoxical as many other skull features are gracile in tures of diet-related shifts during human origins. Proc. Biol. Sci. 278, 961e969. comparison with extinct hominins (Hylander, 1988; Wall et al., Bartlett, J.D., Simmer, J.P., 1999. Proteinases in developing dental enamel. Crit. Rev. e 2008; Smith et al., 2012). Pampush et al. (2013) have recently Oral Biol. Med 10, 425 441. Bartlett, J.D., Smith, C.E., 2013. Modulation of cell-cell junctional complexes by linked enamel thickness to lifetime dietary wear and long lifespan matrix metalloproteinases. J. Dent. Res. 92, 10e17. in a sample of nonhuman primates, a result that highlights the Bartlett, J.D., Ball, R.L., Kawai, T., Tye, C.E., Tsuchiya, M., Simmer, J.P., 2006. Origin, e importance of considering life history variables in conjunction with splicing, and expression of rodent amelogenin exon 8. J. Dent. Res. 85, 894 899. Beniash, E., Skobe, Z., Bartlett, J.D., 2006. Formation of the dentino-enamel interface mechanical variables in interpretations of enamel thickness (see in enamelysin (MMP-20)-deficient mouse incisors. Eur. J. Oral Sci. 114 (Suppl 1), also Teaford, 2007). 24e29 discussion 39e41, 379. Beynon, A.D., Wood, B.A., 1986. Variations in enamel thickness and structure in East African hominids. Am. J. Phys. Anthropol. 70, 177e193. Conclusions Blanchette, M., Bataille, A.R., Chen, X., Poitras, C., Laganiere, J., Lefebvre, C., Deblois, G., Giguere, V., Ferretti, V., Bergeron, D., Coulombe, B., Robert, F., 2006. fi 0 fl Genome-wide computational prediction of transcriptional regulatory modules We nd strong evidence for positive selection in the 5 ank of reveals new insights into human gene expression. Genome Res. 16, 656e668. 0 MMP20 along the human and chimpanzee branches, the 3 flank of Bouwman, P., Gollner, H., Elsasser, H.P., Eckhoff, G., Karis, A., Grosveld, F., MMP20 along the chimpanzee branch, and the 50 flank of ENAM Philipsen, S., Suske, G., 2000. Transcription factor Sp3 is essential for post-natal e fi fi survival and late tooth development. EMBO J. 19, 655 661. along the human branch. We further re ne the speci c regions and Bustamante, C., Fledel-Alon, A., Williamson, S., Nielsen, R., Hubisz, M.T., nucleotides under selection, which will direct future functional Glanowski, S., Tanenbaum, D.M., White, T.J., Sninsky, J.J., Hernandez, R.D., assays to help elucidate the importance of species-specific Civello, D., Adams, M.D., Cargill, M., Clark, A., 2005. Natural selection on protein- coding genes in the human genome. Nature 437, 1153e1157. sequence changes in these important genes. These results suggest Caterina, J.J., Skobe, Z., Shi, J., Ding, Y., Simmer, J.P., Birkedal-Hansen, H., Bartlett, J.D., that a component of the enamel matrix protein complement, 2002. Enamelysin (matrix metalloproteinase 20)-deficient mice display an enamelin, in tandem with regulation of the processing of the amelogenesis imperfecta phenotype. J. Biol. Chem. 277, 49598e49604. enamel matrix proteins by enamelysin is linked to the evolution of Chun, Y.-H., 2009. Ameloblastin: evolution, structure and function in enamel for- mation. Ph.D. Dissertation, University of Michigan, Ann Arbor. thick enamel in humans. Similarly, the nucleotides under selection Chun, Y.-H., Yamakoshi, Y., Yamakoshi, F., Fukae, M., Hu, J.C., Bartlett, J.D., in the regulatory regions of enamelysin along the chimpanzee Simmer, J.P., 2010. Cleavage site specificity of MMP-20 for secretory-stage e branch may have contributed to the thin enamel phenotype seen in ameloblastin. J. Dent. Res. 89, 785 790. Clark, A.G., Glanowski, S., Nielsen, R., Thomas, P.D., Kejariwal, A., Todd, M.A., modern chimpanzees. In addition to enamel thickness, factors such Tanenbaum, D.M., Civello, D., Lu, F., Murphy, B., Ferriera, S., Wang, G., Zheng, X., as maturation time or degree of mineralization could be underlying White, T.J., Sninsky, J.J., Adams, M.D., Cargill, M., 2003. Inferring nonneutral evolu- e the signals of positive selection in these genes. The studies reported tion from human-chimp-mouse orthologous gene trios. Science 302, 1960 1963. fi Cobourne, M.T., Sharpe, P.T., 2003. Tooth and jaw: molecular mechanisms of here provide a framework for understanding how speci c genetic patterning in the first branchial arch. Arch. Oral Biol. 48, 1e14. changes relate to the functional aspects of the process of enamel Cooper, G.M., Stone, E.A., Asimenos, G., Green, E.D., Batzoglou, S., Sidow, A., 2005. formation and development and offer insight into our evolutionary Distribution and intensity of constraint in mammalian genomic sequence. Genome Res. 15, 901e913. past as well as the potential for a better understanding of trait Crawford, G.E., Davis, S., Scacheri, P.C., Renaud, G., Halawi, M.J., Erdos, M.R., changes across species. Green, R., Meltzer, P.S., Wolfsberg, T.G., Collins, F.S., 2006. DNase-chip: a high- resolution method to identify DNase I hypersensitive sites using tiled micro- arrays. Nature Methods 3, 503e509. Acknowledgments Davideau, J., Demri, P., Hotton, D., Gu, T., MacDougall, M., Sharpe, P., Forest, N., Berdal, A., 1999. Comparative study of MSX-2, DLX-5, and DLX-7 gene expres- sion during early human tooth development. Pediatr. Res. 46, 650e656. This paper is dedicated to Charles A. Lockwood. We thank Jen- Dean, M.C., 1985. The eruption pattern of the permanent incisors and first per- nifer An, Annie Chen, Sujoy Ghosh, Michael Granatosky, Amy manent molars in Australopithecus (Paranthropus) robustus. Am. J. Phys. Heilman, Rich Kay, Anthony Moore, Christina Sheedy, Maxx Toler Anthropol. 67, 251e257. Dean, M.C., 1987. The dental developmental status of six East African juvenile fossil and Christine Wu for helpful discussions and interactions. We also hominids. J. Hum. Evol. 16, 197e213. thank the reviewers and editors for discussion and comments that Dean, M.C., 2000. Progress in understanding hominoid dental development. J. Anat. greatly improved the manuscript. We thank Dr. Lucia Carbone and 197 (Pt. 1), 77e101. Alan Mootnik for providing gibbon genomic DNA samples. For Dean, M.C., 2006. Tooth microstructure tracks the pace of human life-history evo- lution. Proc. R. Soc. B 273, 2799e2808. training in phylogenetic comparative methods, we thank the Dean, M.C., 2010. Retrieving chronological age from dental remains of early fossil AnthroTree Workshop, which is supported by the NSF (BCS- hominins to reconstruct human growth in the past. Phil. Trans. R. Soc. B 365, e 0923791) and the National Evolutionary Synthesis Center (NSF 3397 3410. Dean, M.C., Smith, B.H., 2009. Growth and development of the Nariokotome youth grant EF-0905606). This study was funded by NSF-BCS-08-27552 KNM-WT 15000. In: Grine, F.E., Fleagle, J.G., Leakey, R.E. (Eds.), The First HOMIND (GAW and CEW), the Wenner-Gren Foundation for Humans, Origins and Early Evolution of the Genus Homo. Springer, New York, e Anthropological Research (CEW) (Grant 3832395) and the Duke pp. 101 120. Dean, M.C., Leakey, M.G., Reid, D., Schrenk, F., Schwartz, G.T., Stringer, C., Walker, A., Primate Genomics Initiative (JEH and GAW). 2001. Growth processes in teeth distinguish modern humans from Homo erectus and earlier hominins. Nature 414, 628e631. Dohi, N., Murakami, C., Tanabe, T., Yamakoshi, Y., Fukae, M., Yamamoto, Y., Appendix A. Supplementary data Wakida, K., Shimizu, M., Simmer, J.P., Kurihara, H., Uchida, T., 1998. Immuno- cytochemical and immunochemical study of enamelins, using antibodies Supplementary data related to this article can be found at http:// against porcine 89-kDa enamelin and its N-terminal synthetic peptide, in porcine tooth germs. Cell Tissue Res. 293, 313e325. dx.doi.org/10.1016/j.jhevol.2014.01.005. J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87 85

Enard, D., Depaulis, F., Roest Crollius, H., 2010. Human and non-human primate Kelley, J.L., Swanson, W.J., 2008. Dietary change and adaptive evolution of enamelin genomes share hotspots of positive selection. PLoS Genet. 6, e1000840. in humans and among primates. Genetics 178, 1595e1603. ENCODE Project Consortium, 2007. Identification and analysis of functional ele- Kertesz, M., Iovino, N., Unnerstall, U., Gaul, U., Segal, E., 2007. The role of site ments in 1% of the human genome by the ENCODE pilot project. Nature 447, accessibility in microRNA target recognition. Nature Genet. 39, 1278e1284. 799e816. Kim, J.W., Simmer, J.P., Hart, T.C., Hart, P.S., Ramaswami, M.D., Bartlett, J.D., Hu, J.C., ENCODE Project Consortium, 2012. An integrated encyclopedia of DNA elements in 2005. MMP-20 mutation in autosomal recessive pigmented hypomaturation the human genome. Nature 489, 57e74. amelogenesis imperfecta. J. Med. Genet. 42, 271e275. Evans, P.D., Anderson, J.R., Vallender, E.J., Choi, S.S., Lahn, B.T., 2004a. Reconstructing King, M., Wilson, A., 1975. Evolution at two levels in humans and chimpanzees. the evolutionary history of microcephalin, a gene controlling human brain size. Science 188, 107e116. Hum. Mol. Genet. 13, 1139e1145. Kosiol, C., Vinar, T., da Fonseca, R.R., Hubisz, M.J., Bustamante, C.D., Nielsen, R., Evans, P.D., Anderson, J.R., Vallender, E.J., Gilbert, S.L., Malcom, C.M., Dorus, S., Siepel, A., 2008. Patterns of positive selection in six mammalian genomes. PLoS Lahn, B.T., 2004b. Adaptive evolution of ASPM, a major determinant of cerebral Genet. 4, e1000144. cortical size in humans. Hum. Mol. Genet. 13, 489e494. Krebsbach, P.H., Lee, S.K., Matsuki, Y., Kozak, C.A., Yamada, K.M., Yamada, Y., 1996. Fang, P.A., Lam, R.S., Beniash, E., 2011. Relationships between dentin and enamel Full-length sequence, localization, and chromosomal mapping of ameloblastin. mineral at the dentino-enamel boundary: electron tomography and high- A novel tooth-specific gene. J. Biol. Chem. 271, 4431e4435. resolution transmission electron microscopy study. Eur. J. Oral Sci. 119 Lacruz, R.S., Dean, M.C., Ramirez-Rozzi, F., Bromage, T.G., 2008. Megadontia, striae (Suppl. 1), 120e124. periodicity and patterns of enamel secretion in Plio-Pleistocene fossil hominins. Fedrigo, O., Pfefferle, A.D., Babbitt, C.C., Haygood, R., Wall, C.E., Wray, G.A., 2011. J. Anat. 213, 148e158. A potential role for glucose transporters in the evolution of human brain size. Lacruz, R.S., Hacia, J.G., Bromage, T.G., Boyde, A., Lei, Y., Xu, Y., Miller, J.D., Paine, M.L., Brain Behav. Evol. 78, 315e326. Snead, M.L., 2012. The circadian clock modulates enamel development. J. Biol. Fincham, A.G., Bessem, C.C., Lau, E.C., Pavlova, Z., Shuler, C., Slavkin, H.C., Rhythm 27, 237e245. Snead, M.L., 1991. Human developing enamel proteins exhibit a sex-linked Lee, J.J., Morris, D., Constantino, P.J., Lucas, P.W., Smith, T.M., Lawn, B.R., 2010. dimorphism. Calcified Tissue Int. 48, 288e290. Properties of tooth enamel in great apes. Acta Biomater. 6, 4560e4565. Fukumoto, S., Yamada, A., Nonaka, K., Yamada, Y., 2005. Essential roles of amelo- Lezot, F., Thomas, B., Greene, S.R., Hotton, D., Yuan, Z.A., Castaneda, B., Bolanos, A., blastin in maintaining ameloblast differentiation and enamel formation. Cells Depew, M., Sharpe, P., Gibson, C.W., Berdal, A., 2008. Physiological implications Tissues Organs 181, 189e195. of DLX homeoproteins in enamel formation. J. Cell. Physiol. 216, 688e697. Gantt, D.G., 1983. The enamel of Neogene hominoids: structural and phyletic im- Lindblad-Toh, K., Wade, C.M., Mikkelsen, T.S., Karlsson, E.K., Jaffe, D.B., Kamal, M., plications. In: Ciochon, R.L., Corruccini, R.S. (Eds.), New Interpretations of Ape Clamp, M., Chang, J.L., Kulbokas III, E.J., Zody, M.C., Mauceli, E., Xie, X., Breen, M., and Human Ancestry. Plenum, New York, pp. 249e298. Wayne, R.K., Ostrander, E.A., Ponting, C.P., Galibert, F., Smith, D.R., DeJong, P.J., Garfield, D., Haygood, R., Nielsen, W.J., Wray, G.A., 2012. Population genetics of cis- Kirkness, E., Alvarez, P., Biagi, T., Brockman, W., Butler, J., Chin, C.W., Cook, A., regulatory sequences that operate during embryonic development in the sea Cuff, J., Daly, M.J., DeCaprio, D., Gnerre, S., Grabherr, M., Kellis, M., Kleber, M., urchin Strongylocentrotus purpuratus. Evol. Develop. 14, 152e167. Bardeleben, C., Goodstadt, L., Heger, A., Hitte, C., Kim, L., Koepfli, K.P., Gibson, C.W., 2011. The amelogenin proteins and enamel development in humans Parker, H.G., Pollinger, J.P., Searle, S.M., Sutter, N.B., Thomas, R., Webber, C., and mice. J. Oral Biosci. 53, 248e256. Baldwin, J., Abebe, A., Abouelleil, A., Aftuck, L., Ait-Zahra, M., Aldredge, T., Grine, F.E., 2002. Scaling of tooth enamel thickness and molar crown size reduction Allen, N., An, P., Anderson, S., Antoine, C., Arachchi, H., Aslam, A., Ayotte, L., in modern humans. S. Afr. J. Sci. 98, 503e509. Bachantsang, P., Barry, A., Bayul, T., Benamara, M., Berlin, A., Bessette, D., Grine, F.E., Martin, L.B., 1988. Enamel thickness and development in Australopithecus Blitshteyn, B., Bloom, T., Blye, J., Boguslavskiy, L., Bonnet, C., Boukhgalter, B., and Paranthropus. In: Grine, F.E. (Ed.), Evolutionary History of the “Robust” Brown, A., Cahill, P., Calixte, N., Camarata, J., Cheshatsang, Y., Chu, J., Citroen, M., Australopithecines. Aldine de Gruyter, New York, pp. 3e42. Collymore, A., Cooke, P., Dawoe, T., Daza, R., Decktor, K., DeGray, S., Dhargay, N., Guatelli-Steinberg, D., 2009. Recent studies of dental development in Neandertals: Dooley, K., Dorje, P., Dorjee, K., Dorris, L., Duffey, N., Dupes, A., Egbiremolen, O., Implications for Neandertal life histories. Evol. Anthropol. 18, 9e20. Elong, R., Falk, J., Farina, A., Faro, S., Ferguson, D., Ferreira, P., Fisher, S., Guatelli-Steinberg, D., Floyd, B.A., Dean, M.C., Reid, D.J., 2012. Enamel extension rate FitzGerald, M., Foley, K., Foley, C., Franke, A., Friedrich, D., Gage, D., Garber, M., patterns in modern human teeth: two approaches designed to establish an Gearin, G., Giannoukos, G., Goode, T., Goyette, A., Graham, J., Grandbois, E., integrated comparative context for fossil primates. J. Hum. Evol. 63, 475e486. Gyaltsen, K., Hafez, N., Hagopian, D., Hagos, B., Hall, J., Healy, C., Hegarty, R., Hart, P.S., Wright, J.T., Savage, M., Kang, G., Bensen, J.T., Gorry, M.C., Hart, T.C., 2003. Honan, T., Horn, A., Houde, N., Hughes, L., Hunnicutt, L., Husby, M., Jester, B., Exclusion of candidate genes in two families with autosomal dominant hypo- Jones, C., Kamat, A., Kanga, B., Kells, C., Khazanovich, D., Kieu, A.C., Kisner, P., calcified amelogenesis imperfecta. Eur. J. Oral Sci. 111, 326e331. Kumar, M., Lance, K., Landers, T., Lara, M., Lee, W., Leger, J.P., Lennon, N., Haygood, R., Fedrigo, O., Hanson, B., Yokoyama, K., Wray, G., 2007. Promoter regions Leuper, L., LeVine, S., Liu, J., Liu, X., Lokyitsang, Y., Lokyitsang, T., Lui, A., of many neural- and nutrition-related genes have experienced positive selec- Macdonald, J., Major, J., Marabella, R., Maru, K., Matthews, C., McDonough, S., tion during human evolution. Nature Genet. 39, 1140e114 4. Mehta, T., Meldrim, J., Melnikov, A., Meneus, L., Mihalev, A., Mihova, T., Miller, K., Hlusko, L.J., Suwa, G., Kono, R.T., Mahaney, M.C., 2004. Genetics and the evolu- Mittelman, R., Mlenga, V., Mulrain, L., Munson, G., Navidi, A., Naylor, J., tion of primate enamel thickness: a baboon model. Am. J. Phys. Anthropol. Nguyen, T., Nguyen, N., Nguyen, C., Nicol, R., Norbu, N., Norbu, C., Novod, N., 124, 223e233. Nyima, T., Olandt, P., O’Neill, B., O’Neill, K., Osman, S., Oyono, L., Patti, C., Horvath, J.E., Sheedy, C.B., Merrett, S.L., Diallo, A.B., Swofford, D.L., Program, N.C.S., Perrin, D., Phunkhang, P., Pierre, F., Priest, M., Rachupka, A., Raghuraman, S., Green, E.D., Willard, H.F., 2011. Comparative analysis of the primate X-inacti- Rameau, R., Ray, V., Raymond, C., Rege, F., Rise, C., Rogers, J., Rogov, P., Sahalie, J., vation center region and reconstruction of the ancestral primate XIST locus. Settipalli, S., Sharpe, T., Shea, T., Sheehan, M., Sherpa, N., Shi, J., Shih, D., Sloan, J., Genome Res. 21, 850e862. Smith, C., Sparrow, T., Stalker, J., Stange-Thomann, N., Stavropoulos, S., Stone, C., Hu, J.C., Yamakoshi, Y., Yamakoshi, F., Krebsbach, P.H., Simmer, J.P., 2005. Proteomics Stone, S., Sykes, S., Tchuinga, P., Tenzing, P., Tesfaye, S., Thoulutsang, D., and genetics of dental enamel. Cells Tissues Organs 181, 219e231. Thoulutsang, Y., Topham, K., Topping, I., Tsamla, T., Vassiliev, H., Hu, J.C., Hu, Y., Smith, C.E., McKee, M.D., Wright, J.T., Yamakoshi, Y., Papagerakis, P., Venkataraman, V., Vo, A., Wangchuk, T., Wangdi, T., Weiand, M., Wilkinson, J., Hunter, G.K., Feng, J.Q., Yamakoshi, F., Simmer, J.P., 2008. Enamel defects and Wilson, A., Yadav, S., Yang, S., Yang, X., Young, G., Yu, Q., Zainoun, J., Zembek, L., ameloblast-specific expression in Enam knock-out/lacz knock-in mice. J. Biol. Zimmer, A., Lander, E.S., 2005. Genome sequence, comparative analysis and Chem. 283, 10858e10871. haplotype structure of the domestic dog. Nature 438, 803e819. Hylander, W.L., 1988. Implications of in vivo experiments for interpreting the Lindblad-Toh, K., Garber, M., Zuk, O., Lin, M.F., Parker, B.J., Washietl, S., functional significance of “robust” australopithecine jaws. In: Grine, F.E. (Ed.), Kheradpour, P., Ernst, J., Jordan, G., Mauceli, E., Ward, L.D., Lowe, C.B., Evolutionary History of the “Robust” Australopithecines. Aldine de Gruyter, Holloway, A.K., Clamp, M., Gnerre, S., Alfoldi, J., Beal, K., Chang, J., Clawson, H., New York, pp. 55e83. Cuff, J., Di Palma, F., Fitzgerald, S., Flicek, P., Guttman, M., Hubisz, M.J., Jaffe, D.B., Jernvall, J., Thesleff, I., 2000. Reiterative signaling and patterning during mamma- Jungreis, I., Kent, W.J., Kostka, D., Lara, M., Martins, A.L., Massingham, T., lian tooth morphogenesis. Mech. Develop. 92, 19e29. Moltke, I., Raney, B.J., Rasmussen, M.D., Robinson, J., Stark, A., Vilella, A.J., Jolly, C.J., 1970. The seed-eaters: a new model of hominoid differentiation based on Wen, J., Xie, X., Zody, M.C., Baldwin, J., Bloom, T., Chin, C.W., Heiman, D., a baboon analogy. Man 5, 5e26. Nicol, R., Nusbaum, C., Young, S., Wilkinson, J., Worley, K.C., Kovar, C.L., Juuri, E., Jussila, M., Seidel, K., Holmes, S., Wu, P., Richman, J., Heikinheimo, K., Muzny, D.M., Gibbs, R.A., Cree, A., Dihn, H.H., Fowler, G., Jhangiani, S., Joshi, V., Chuong, C.M., Arnold, K., Hochedlinger, K., Klein, O., Michon, F., Thesleff, I., 2013. Lee, S., Lewis, L.R., Nazareth, L.V., Okwuonu, G., Santibanez, J., Warren, W.C., Sox2 marks epithelial competence to generate teeth in mammals and reptiles. Mardis, E.R., Weinstock, G.M., Wilson, R.K., Delehaunty, K., Dooling, D., Development 140, 1424e1432. Fronik, C., Fulton, L., Fulton, B., Graves, T., Minx, P., Sodergren, E., Birney, E., Kanzler, B., Kuschert, S.J., Liu, Y.H., Mallo, M., 1998. Hoxa-2 restricts the chondro- Margulies, E.H., Herrero, J., Green, E.D., Haussler, D., Siepel, A., Goldman, N., genic domain and inhibits bone formation during development of the branchial Pollard, K.S., Pedersen, J.S., Lander, E.S., Kellis, M., 2011. A high-resolution map area. Development 125, 2587e2597. of human evolutionary constraint using 29 mammals. Nature 478, 476e482. Katoh, K., Misawa, K., Kuma, K., Miyata, T., 2002. MAFFT: a novel method for rapid Llano, E., Pendas, A.M., Knauper, V., Sorsa, T., Salo, T., Salido, E., Murphy, G., multiple sequence alignment based on fast Fourier transform. Nucleic Acids Simmer, J.P., Bartlett, J.D., Lopez-Otin, C., 1997. Identification and structural and Res. 30, 3059e3066. functional characterization of human enamelysin (MMP-20). Biochemistry 36, Kay, R.F., 1981. The nut-crackers: A new theory of the adaptations of the Ram- 15101e15108. apithecinae. Am. J. Phys. Anthropol. 55, 141e151. Lu, Y., Papagerakis, P., Yamakoshi, Y., Hu, J.C., Bartlett, J.D., Simmer, J.P., 2008. Kay, R.F., 1985. Dental evidence for the diet of Australopithecus. A. Rev. Anthropol. 14, Functions of KLK4 and MMP-20 in dental enamel formation. J. Biol. Chem. 389, 315e341. 695e700. 86 J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87

Lucas, P., Constantino, P., Wood, B., 2008. Inferences regarding the diet of extinct information coupled to the ORCA toolkit for the study of regulatory sequences. hominins: structural and functional trends in dental and mandibular Nucleic Acids Res. 37, D54eD60. morphology within the hominin clade. J. Anat. 212, 486e500. Prabhakar, S., Noonan, J.P., Pääbo, S., Rubin, E., 2006. Accelerated evolution of Macho, G.A., Shimizu, D., Jiang, Y., Spears, I.R., 1995. Australopithecus anamensis:A conserved noncoding sequences in humans. Science 314, 786. finite-element approach to studying the functional adaptations of extinct Sabeti, P.C., Schaffner, S.F., Fry, B., Lohmueller, J., Varilly, P., Shamovsky, O., Palma, A., hominins. Anat. Rec 283A, 310e318. Mikkelsen, T.S., Altshuler, D., Lander, E.S., 2006. Positive natural selection in the Margolis, H.C., Beniash, E., Fowler, C.E., 2006. Role of macromolecular assembly of human lineage. Science 312, 1614e1620. enamel matrix proteins in enamel formation. J. Dent. Res. 85, 775e793. Schwartz, G.T., 2000. Taxonomic and functional aspects of the patterning of enamel Margulies, E.H., Cooper, G.M., Asimenos, G., Thomas, D.J., Dewey, C.N., Siepel, A., thickness distribution in extant large-bodied hominoids. Am. J. Phys. Anthropol. Birney, E., Keefe, D., Schwartz, A.S., Hou, M., Taylor, J., Nikolaev, S., Montoya- 111, 221e244. Burgos, J.I., Loytynoja, A., Whelan, S., Pardi, F., Massingham, T., Brown, J.B., Schwartz, G.T., 2012. Growth, development, and life history throughout the evo- Bickel, P., Holmes, I., Mullikin, J.C., Ureta-Vidal, A., Paten, B., Stone, E.A., lution of Homo. Curr. Anthropol. 53, S395eS408. Rosenbloom, K.R., Kent, W.J., Bouffard, G.G., Guan, X., Hansen, N.F., Idol, J.R., Shellis, R.P., Beynon, A.D., Reid, D.J., Hiiemae, K.M., 1998. Variations in molar enamel Maduro, V.V., Maskeri, B., McDowell, J.C., Park, M., Thomas, P.J., Young, A.C., thickness among primates. J. Hum. Evol. 35, 507e522. Blakesley, R.W., Muzny, D.M., Sodergren, E., Wheeler, D.A., Worley, K.C., Simmer, J.P., Hu, J.C., 2002. Expression, structure, and function of enamel pro- Jiang, H., Weinstock, G.M., Gibbs, R.A., Graves, T., Fulton, R., Mardis, E.R., teinases. Connect. Tissue Res. 43, 441e449. Wilson, R.K., Clamp, M., Cuff, J., Gnerre, S., Jaffe, D.B., Chang, J.L., Lindblad- Simmer, J.P., Papagerakis, P., Smith, C.E., Fisher, D.C., Rountrey, A.N., Zheng, L., Toh, K., Lander, E.S., Hinrichs, A., Trumbower, H., Clawson, H., Zweig, A., Hu, J.C., 2010. Regulation of dental enamel shape and hardness. J. Dent. Res. 89, Kuhn, R.M., Barber, G., Harte, R., Karolchik, D., Field, M.A., Moore, R.A., 1024e1038. Matthewson, C.A., Schein, J.E., Marra, M.A., Antonarakis, S.E., Batzoglou, S., Sire, J.Y., Davit-Beal, T., Delgado, S., Gu, X., 2007. The origin and evolution of enamel Goldman, N., Hardison, R., Haussler, D., Miller, W., Pachter, L., Green, E.D., mineralization genes. Cells Tissues Organs 186, 25e48. Sidow, A., 2007. Analyses of deep mammalian sequence alignments and Smith, B.H., 1991. Dental development and the evolution of life history in Homi- constraint predictions for 1% of the human genome. Genome Res. 17, 760e774. nidae. Am. J. Phys. Anthropol. 86, 157e174. Martin, L.B., 1983. The relationships of the later Miocene Hominoidea. Ph.D. Smith, B.H., 1993. The physiological age of KNM-WT 15000. In: Walker, A., Leakey, R. Dissertation, University College London. (Eds.), The Nariokotome Homo erectus Skeleton. Harvard University Press, Martin, L.B., 1985. Significance of enamel thickness in hominoid evolution. Nature Cambridge, pp. 195e220. 314, 260e263. Smith, B.H., 1994. Patterns of dental development in Homo, Australopithecus, Pan, Meredith, R.W., Gatesy, J., Murphy, W.J., Ryder, O.A., Springer, M.S., 2009. Molecular and Gorilla. Am. J. Phys. Anthropol. 94, 307e325. decay of the tooth gene Enamelin (ENAM) mirrors the loss of enamel in the Smith, B.H., Tompkins, R.L., 1995. Toward a life history of the Hominidae. A. Rev. fossil record of placental mammals. PLoS Genet. 5, e1000634. Anthropol. 24, 257e279. Meredith, R.W., Gatesy, J., Cheng, J., Springer, M.S., 2010. Pseudogenization of the Smith, T.M., Martin, L.B., Leakey, M.G., 2003. Enamel thickness, microstructure and tooth gene enamelysin (MMP20) in the common ancestor of extant baleen development in Afropithecus turkanensis. J. Hum. Evol. 44, 283e306. whales. Proc. R. Soc. B 278, 993e1002. Smith, T.M., Olejniczak, A.J., Martin, L.B., Reid, D.J., 2005. Variation in hominoid Meyer, M., Kircher, M., Gansauge, M.T., Li, H., Racimo, F., Mallick, S., Schraiber, J.G., molar enamel thickness. J. Hum. Evol. 48, 575e592. Jay, F., Prufer, K., de Filippo, C., Sudmant, P.H., Alkan, C., Fu, Q., Do, R., Smith, T.M., Tafforeau, P., Reid, D.J., Pouech, J., Lazzari, V., Zermeno, J.P., Guatelli- Rohland, N., Tandon, A., Siebauer, M., Green, R.E., Bryc, K., Briggs, A.W., Steinberg, D., Olejniczak, A.J., Hoffman, A., Radovcic, J., Makaremi, M., Stenzel, U., Dabney, J., Shendure, J., Kitzman, J., Hammer, M.F., Shunkov, M.V., Toussaint, M., Stringer, C., Hublin, J.J., 2010. Dental evidence for ontogenetic Derevianko, A.P., Patterson, N., Andres, A.M., Eichler, E.E., Slatkin, M., Reich, D., differences between modern humans and Neanderthals. Proc. Natl. Acad. Sci. Kelso, J., Pääbo, S., 2012. A high-coverage genome sequence from an archaic 107, 20923e20928. Denisovan individual. Science 338, 222e226. Smith, T.M., Olejniczak, A.J., Zermeno, J.P., Tafforeau, P., Skinner, M.M., Molnar, S., Gantt, D.G., 1977. Functional implications of primate enamel thickness. Hoffmann, A., Radovcic, J., Toussaint, M., Kruszynski, R., Menter, C., Moggi- Am. J. Phys. Anthropol. 46, 447e454. Cecchi, J., Glasmacher, U.A., Kullmer, O., Schrenk, F., Stringer, C., Hublin, J.-J., Moradian-Oldak, J., 2012. Protein-mediated enamel mineralization. Front. Biosci. 17, 2012. Variation in enamel thickness within the genus Homo. J. Hum. Evol. 62, 1996e2023. 395e411. Mori-Akiyama, Y., Akiyama, H., Rowitch, D.H., de Crombrugghe, B., 2003. Sox9 is St. Clair, E.M., Babbitt, C.C., Wray, G.A., Wall, C.E. Enamel thickness measurements required for determination of the chondrogenic cell lineage in the cranial neural and reconstruction of the ancestral morphotype in primates. Accepted for crest. Proc. Natl. Acad. Sci. 100, 9360e9365. presentation at the 73rd meeting of the Society of Vertebrate Paleontology, Los Narukawa, M., Suzuki, N., Takayama, T., Yamashita, Y., Otsuka, K., Ito, K., 2007. Angeles, October 2013. Enamel matrix derivative stimulates osteogenesis- and chondrogenesis-related Storey, J.D., Tibshirani, R., 2003. Statistical significance for genomewide studies. transcription factors in C3H10T1/2 cells. Acta Bioch. Bioph. Sin 39, 1e7. Proc. Natl. Acad. Sci. 100, 9440e9445. Nielsen, R., Bustamante, C., Clark, A.G., Glanowski, S., Sackton, T.B., Hubisz, M.J., Strait, D.S., Grine, F.E., Moniz, M.A., 1997. A reappraisal of early hominid phylogeny. Fledel-Alon, A., Tanenbaum, D.M., Civello, D., White, T.J., J, J.S., Adams, M.D., J. Hum. Evol. 32, 17e82. Cargill, M., 2005. A scan for positively selected genes in the genomes of humans Teaford, M.F., 2007. What do we know and not know about diet and enamel and chimpanzees. PLoS Biol. 3, e170. structure? In: Ungar, P.S. (Ed.), Evolution of the Human Diet. Oxford University Olejniczak, A.J., Tafforeau, P., Feeney, R.N., Martin, L.B., 2008a. Three-dimensional Press, Oxford, pp. 56e76. primate molar enamel thickness. J. Hum. Evol. 54, 187e195. Teaford, M.F., Ungar, P.S., 2000. Diet and the evolution of the earliest human an- Olejniczak, A.J., Smith, T.M., Feeney, R.N., Macchiarelli, R., Mazurier, A., Bondioli, L., cestors. Proc. Natl. Acad. Sci. 97, 13506e13511. Rosas, A., Fortea, J., de la Rasilla, M., Garcia-Tabernero, A., Radovcic,J.,Skinner,M.M., Thorisson, G.A., Smith, A.V., Krishnan, L., Stein, L.D., 2005. The international Hap- Toussaint, M., Hublin, J.J., 2008b. Dental tissue proportions and enamel thickness in Map project web site. Genome Res. 15, 1592e1593. Neandertal and modern human molars. J. Hum. Evol. 55, 12e23. Tummers, M., Thesleff, I., 2009. The importance of signal pathway modulation in all Pampush, J.D., Duque, A.C., Burrows, B.R., Daegling, D.J., Kenney, W.F., McGraw, W.S., aspects of tooth development. J. Exp. Zool. B 312B, 309e319. 2013. Homoplasy and thick enamel in primates. J. Hum. Evol. 64, 216e224. Turatsinze, J.V., Thomas-Chollier, M., Defrance, M., van Helden, J., 2008. Using RSAT Papagerakis, P., Hu, Y., Ye, L., Feng, J.Q., Simmer, J.P., Hu, J.C., 2009. Identifying to scan genome sequences for transcription factor binding sites and cis- promoter elements necessary for enamelin tissue-specific expression. Cells regulatory modules. Nature Protocols 3, 1578e1588. Tissues Organs 189, 98e104. Ungar, P., 2004. Dental topography and diets of Australopithecus afarensis and early Paradis, E., Claude, J., Strimmer, K., 2004. APE: Analyses of phylogenetics and evo- Homo. J. Hum. Evol. 46, 605e622. lution in R language. Bioinformatics 20, 289e290. Ungar, P.S., Grine, F.E., Teaford, M.F., 2006. Diet in early Homo: A review of the evi- Pavlic, A., Lukinmaa, P.L., Nieminen, P., Kiukkonen, A., Alaluusua, S., 2007. Severly dence and a new model of adaptive versatility. A. Rev. Anthropol. 35, 209e228. hypoplastic amelogenesis imperfecta with taurodontism. Int. J. Paediatr. Dent. Vallender, E.J., Lahn, B.T., 2004. Positive selection on the human genome. Hum. Mol. 17, 259e266. Genet. 13 (Spec No. 2), R245eR254. Pfefferle, A.D., Warner, L.R., Wang, C.W., Nielsen, W.J., Babbitt, C.C., Fedrigo, O., Vogel, E.R., van Woerden, J.T., Lucas, P.W., Utami Atmoko, S.S., van Schaik, C.P., Wray, G.A., 2011. Comparative expression analysis of the phosphocreatine cir- Dominy, N.J., 2008. Functional ecology and evolution of hominoid molar enamel cuit in extant primates: Implications for human brain evolution. J. Hum. Evol. thickness: Pan troglodytes schweinfurthii and Pongo pygmaeus wurmbii. J. Hum. 60, 205e212. Evol. 55, 60e74. Pollard, K.S., Salama, S.R., King, B., Kern, A.D., Dreszer, T., Katzman, S., Siepel, A., Wall, C.E., Vinyard, C.J., Williams, S.H., Johnson, K.R., Hylander, W.L., 2008. Pedersen, J.S., Bejerano, G., Baertsch, R., Rosenbloom, K.R., Kent, J., Haussler, D., Specialization of the superficial anterior temporalis muscle for hard-object 2006. Forces shaping the fastest evolving regions in the human genome. PLoS feeding in baboons. In: Vinyard, C.J., Ravosa, M.J., Wall, C.E. (Eds.), Primate Genet. 2, e168. Craniofacial Function and Biology. Springer Academic Publishers, New York, Pond, S.L., Frost, S.D., Muse, S.V., 2005. HyPhy: hypothesis testing using phylogenies. pp. 113e126. Bioinformatics 21, 676e679. Wong, W.S., Nielsen, R., 2004. Detecting selection in noncoding regions of nucle- Portales-Casamar, E., Kirov, S., Lim, J., Lithwick, S., Swanson, M.I., Ticoll, A., otide sequences. Genetics 167, 949e958. Snoddy, J., Wasserman, W.W., 2007. PAZAR: a framework for collection and Wray, G.A., 2003. Transcriptional regulation and the evolution of development. Int. dissemination of cis-regulatory sequence annotation. Genome Biol. 8, R207. J. Dev. Biol. 47, 675e684. Portales-Casamar, E., Arenillas, D., Lim, J., Swanson, M.I., Jiang, S., McCallum, A., Wray, G.A., 2007. The evolutionary significance of cis-regulatory mutations. Nature Kirov, S., Wasserman, W.W., 2009. The PAZAR database of gene regulatory Rev. Genet. 8, 206e216. J.E. Horvath et al. / Journal of Human Evolution 73 (2014) 75e87 87

Wright, J.T., 2006. The molecular etiologies and associated phenotypes of amelo- Xu, L., Matsumoto, A., Sasaki, A., Harada, H., Taniguchi, A., 2010. Identification of a genesis imperfecta. Am. J. Med. Genet. A 140, 2547e2555. suppressor element in the amelogenin promoter. J. Dent. Res. 89, 246e251. Wright, J.T., Hart, T.C., Hart, P.S., Simmons, D., Suggs, C., Daley, B., Simmer, J., Yamakoshi, Y., Richardson, A.S., Nunez, S.M., Yamakoshi, F., Milkovich, R.N., Hu, J.C., Hu,J.,Bartlett,J.D.,Li,Y.,Yuan,Z.A.,Seow,W.K.,Gibson,C.W.,2009.Human Bartlett, J.D., Simmer, J.P., 2011. Enamel proteins and proteases in Mmp20 and and mouse enamel phenotypes resulting from mutation or altered Klk4 null and double-null mice. Eur. J. Oral Sci. 119 (Suppl. 1), 206e216. expression of AMEL, ENAM, MMP20 and KLK4. Cells Tissues Organs 189, Zhang, J., Nielsen, R., Yang, Z., 2005. Evaluation of an improved branch-site likeli- 224e229. hood method for detecting positive selection at the molecular level. Mol. Biol. Wright, J.T., Torain, M., Long, K., Seow, K., Crawford, P., Aldred, M.J., Hart, P.S., Evol. 22, 2472e2479. Hart, T.C., 2011. Amelogenesis imperfecta: genotype-phenotype studies in 71 Zheng, L., Papagerakis, S., Schnell, S.D., Hoogerwerf, W.A., Papagerakis, P., 2011. families. Cells Tissues Organs 194, 279e283. Expression of clock proteins in developing tooth. Gene Expr. Patterns 11, 202e206.