A Method of Multiplex PCR for Detection of Field

World J Microbiol Biotechnol (2015) 31:675–679 DOI 10.1007/s11274-015-1821-6

SHORT COMMUNICATION

A method of multiplex PCR for detection of ﬁeld released Beauveria bassiana, a fungal entomopathogen applied for pest management in jute (Corchorus olitorius)

Chinmay Biswas • Piyali Dey • B. S. Gotyal • Subrata Satpathy

Received: 9 December 2014 / Accepted: 7 February 2015 / Published online: 14 February 2015 Ó Springer Science+Business Media Dordrecht 2015

Abstract The fungal entomopathogen Beauveria bassi- jewellery and home decorations (Kundu 1956). Jute is of ana is a promising biocontrol agent for many pests. Some two kinds namely, tossa jute (Corchorus olitorius) and B. bassiana strains have been found effective against jute white jute (C. capsularis). Jute is severely affected by pests. To monitor the survival of field released B. bassiana various insect-pests such stem weevil (Apion corchori), a rapid and efficient detection technique is essential. jute semilooper (Anomis sabulifera), Bihar hairy caterpillar Conventional methods such as plating method or direct (Spilosoma obliqua) etc. (Ramasubramanian et al. 2010). culture method which are based on cultivation on selective Earlier reports suggest that jute pests particularly Bihar media followed by microscopy are time consuming and not hairy caterpillar and semilooper can be controlled by so sensitive. PCR based methods are rapid, sensitive and Beauveria bassiana (Pandit and Som 1988). Apart from reliable. A single primer PCR may fail to amplify some of causing ecological hazards complete reliance on chemical the strains. However, multiplex PCR increases the possi- pesticides becomes a burden on resource poor jute farmers bility of detection as it uses multiple primers. Therefore, in of the Indian subcontinent. Therefore, efforts are on to the present investigation a multiplex PCR protocol was substitute some use of pesticides by low cost biocontrol developed by multiplexing three primers SCA 14, SCA 15 agents. B. bassiana (Balsamo) Vuillemin (Ascomycota: and SCB 9 to detect field released B. bassiana strains from Hypocreales) is an important entomopathogenic fungus. soil as well as foliage of jute field. Using our multiplex Since long it is known to cause white muscardine disease in PCR protocol all the five B. bassiana strains could be de- silkworm (Bombyx mori). Spores of B. bassiana germinate tected from soil and three strains viz., ITCC 6063, ITCC and grow directly through the cuticle to the inner body of 4563 and ITCC 4796 could be detected even from the crop their host, proliferate throughout the insect’s body and foliage after 45 days of spray. eventually kill it. It has been found useful to control many crop pests such as stem borer (Chilo partellus) in maize Keywords Multiplex PCR Beauveria bassiana Jute and sorghum (Maniania 1993; Reddy et al. 2009), leaf SCAR marker Endophyte roller (Sylepta derogata) in cotton (Ramesh et al. 1999); beetle (Leptinotarsa decemlineata) in potato (Wraight and Jute is an important fibre crop only second to cotton which Ramos 2002), aphids (Aphis spp.) as well as mites (Am- is mainly grown in the South East Asian countries like blyomma maculatum and A. americanum) in wheat (Hat- India, Bangladesh, Nepal, China, Indonesia, Thailand, ting et al. 2004; Kirkland et al. 2004) etc. Presently many Myanmar and few South American countries. It is used in commercial formulations of B. bassiana are available in making sacks, ropes, bags, carpets, shoes, geo-textiles, the market and its use is increasing. However, as it is a live product and is introduced into a particular ecosystem from outside its survival is always challenged by the native C. Biswas (&) P. Dey B. S. Gotyal S. Satpathy microbial populations. Therefore, monitoring of field re- Central Research Institute for Jute and Allied Fibres (CRIJAF), leased B. bassiana is essential and it requires an efficient Barrackpore, Kolkata 700120, West Bengal, India e-mail: [email protected]; and robust detection technique. Like other fungi, B. [email protected] bassiana is conventionally detected by plating or culturing 123 676 World J Microbiol Biotechnol (2015) 31:675–679 on selective media. But these cultivation methods are time K were added and kept at 37 °C for half an hour and 0.6 consuming and not so sensitive (Biswas et al. 2012). volume of ice cold isopropanol was added. The precipitate However, PCR based methods are rapid, sensitive and re- was again centrifuged at 80009g and the pellet was washed liable in microbial diagnostics (Yamamoto 2002; Baric and with 70 % ethanol and dried at room temperature. Then the Dalla-Via 2004). The technique is recently being applied in DNA pellet was dissolved in TE buffer (10 mmol-1 Tris– detection of B. bassiana (Castrillo et al. 2003; Quesada- HCl, 1.0 mmol-1 EDTA) and stored at -20 °C. Moraga et al. 2006; Ownley et al. 2008). But, a single Genomic DNA was extracted from the young leaves of primer PCR may fail to amplify some of the strains. The both B. bassiana treated as well as untreated jute (C. oli- probability of detection in PCR can be increased by using torius) plant samples collected from the field. 300 mg tis- multiple primers in a single reaction, commonly known as sue was taken from each sample and was surface sterilized multiplex PCR (Loncaric et al. 2008). As many strains of by treating with 0.5 % sodium hypochlorite for 2 min and B. bassiana are used in pest management, multiplex PCR then with 70 % ethyl alcohol for 2 min. Then it was would be more useful for their detection. Therefore, in the thoroughly washed with sterile distilled water. DNA was present investigation a multiplex PCR protocol was de- extracted by using cetyl trimethyl ammonium bromide veloped to detect field released B. bassiana strains from (CTAB) method (Biswas et al. 2012). The sample was soil as well as foliage. crushed properly by adding Polyvinylpyrrolidone (PVP) Beauveria bassiana isolates viz., ITCC 6063, ITCC which helps to dissolve the mucilage present in jute plant. 4512, ITCC 4925, ITCC 4796 and ITCC 4644 used in the The tissues were ground in CTAB and transferred to 500 ll experiment were collected from Indian Type Culture Col- 4 M NaCl which was kept at 60 °C for 1 h with occasional lection (ITCC), Division of Plant Pathology, Indian Agri- stirring. Then equal volume of dichloromethane was added cultural Research Institute, New Delhi. All the fungal and centrifuged at 14,0009g for 15 min. The supernatant cultures were maintained at 25 °C on potato dextrose agar was carefully taken and 5 ll RNAse (5 mg/ml) was added (PDA). The leading C. olitorius variety JRO 524 was used and kept at 37 °C for half an hour. After that equal volume for the field experiments. Seeds were collected from Crop of dichloromethane was added followed by centrifugation Improvement Division, Central Research Institute for Jute at 10,0009g for 15 min. The supernatant was carefully and Allied Fibres, Barrackpore, India. taken out and was precipitated with 0.6 volume of ice cold The conidia of B. bassiana were harvested by scraping isopropanol. The precipitate was again centrifuged at the surface of fungal culture with a sterile camel hair brush 14,0009g and the pellet was washed with 70 % ethanol into a 100 ml glass beaker containing 50 ml sterile distilled and dried at room temperature. Then the DNA pellet was water. The conidial suspension was prepared by mixing the dissolved in TE buffer (10 mM Tris, 1.0 mM EDTA) and solution with a magnetic stirrer for 5 min. The concentra- stored at -20 °C. tion of conidia was adjusted to the desired concentration of For isolation of DNA from B. bassiana, monoconodial 1 9 108 conidia/ml using haemocytometer and a light cultures of all the seven strains were grown in potato microscope (409 magnifications). The conidial concen- dextrose agar (PDA) broth (pH 5.5) for 7 days at tration of B. bassiana @19 108 conidia/ml was chosen 25 ± 1 °C. The mycelia were filtered through Whatman following Biswas et al. (2012). For pest management in No. 1 filter paper. An amount of 500 mg mycelia was jute conidial suspension of the five B. bassiana isolates ground in liquid nitrogen and transferred to DNA extrac- were sprayed in the field where the crop was sown in tion buffer (100 mM Tris, 1.4 M NaCl, 20.0 mM EDTA, 3 9 2.5 m plots with four replications for each isolate in 4 % CTAB (Murray and Thompson 1980) and incubated at randomized block design along with untreated check. The 60 °C for 1 h with occasional stirring. Equal volume of crop was grown with recommended package of practices dichloromethane was added followed by centrifugation at without using any plant protection chemical. 14,0009g for 15 min. The supernatant was carefully taken Chemical lysis buffer was prepared by using CTAB out and was precipitated with 0.6 volume of ice cold iso- method (Robe et al. 2003) with major modifications. 400 mg propanol. The precipitate was again centrifuged at soil sample was grinded with liquid nitrogen and 1 ml of 14,0009g and the pellet was washed with 70 % ethanol preheated (65 °C) chemical lysis buffer was added in the and dried at room temperature. Then the DNA pellet was sample. Extraction lysis buffer was modified by adding dissolved in TE buffer (10 mM Tris, 1.0 mM EDTA) and 10 % CTAB, 40 mM Tris, 1.4 M NaCl, 20.0 mM EDTA, stored at -20 °C. The DNA yield obtained by modified 0.2 % b-marcaptoethanol and 3 % w/v PVP (Sigma). CTAB method from different soil samples varied from 370 Sample was then incubated at 60 °C for 1 h. Then equal to 450 lgg-1. In general, DNA yield from jute foliage was volume of dichloromethane was added and centrifuged at higher (430 lgg-1) than that from soil (Table 1). 80009g for 15 min. The supernatant was carefully taken A multiplex PCR protocol was developed by using three -1 -1 and 5 ll RNAse (5 mg ml ) and 200 lgml Proteinase SCAR primers viz., SCA14445, SCA15441 and SCB9677 123 World J Microbiol Biotechnol (2015) 31:675–679 677

Table 1 DNA yield and detection limit of Beauveria bassiana B. bassiana strain From soil From foliage Detection limit (DNA in pg)

-1 -1 DNA yield (lgg )A260/280 DNA yield (lgg )A260/280

ITCC 6063 370.5 1.80 429.8 1.79 3.5 ITCC 4512 398.6 1.79 430.1 1.88 3.7 ITCC 4925 408.2 1.78 428.9 1.80 3.6 ITCC 4796 450.4 1.80 427.2 1.79 3.5 ITCC 4644 412.7 1.80 429.4 1.80 3.6

(Castrillo et al. 2003). The sequences of the primers are protocol was found efficient in amplifying minute quantity given in Table 2. PCR amplifications were optimized by of B. bassiana DNA isolated from both soil and foliage. varying number of cycles, time and temperature viz., initial Castrillo et al. (2003) reported detection of 100 pg of B. denaturation (2–5 min), number of initial denaturation Bassiana DNA in simple PCR. The detection limit of B. amplification cycles (n = 10–15), annealing time bassiana in the present protocol was determined by varying (30–60 s) and annealing temperatures (60–65 °C). Reac- the quantity of DNA in different dilutions and it was found tions were performed in each possible combination of all to be about 3.5 pg of DNA (Table 1). the above parameters. Multiplex-PCR was performed in Soil samples were collected from all the treated as well 25 ll containing 20 ll of PCR reaction mix with 3U ll-1 as untreated plots 45 days after spraying of conidial sus- units of Taq DNA polymerase with 50–75 ng per 100 llof pension of different B. Bassiana strains. For PCR based genomic DNA and 0.5 mM of each of three SCAR pri- detection initially three SCAR primers viz. SCA14445, mers. Each assay was also tested by adjusting the con- SCA15441 and SCB9677 were used separately to amplify centration of MgCl2 @ 1.5–3 mM and dNTPs the target DNA sequence of B. Bassiana in the collected (0.2–0.5 mM). The amplification was carried out using a soil samples. SCA 15 and SCB 9 amplified all the five thermocycler (MyCycler, BioRad). strains generating amplicons of 205 and 1300 bp respec- PCR amplification protocols using the SCAR primers tively. But, SCA 14 could detect only three strains viz., viz., SCA14445, SCA15441 and SCB9677 were optimized by ITCC 6063, ITCC 4563 and ITCC 4796 with an amplicon varying reaction conditions. The developed multiplex PCR of 250 bp, whereas ITCC 4644 and ITCC 4925 were not protocol was as follows: The PCR reactions were to be amplified. Later, all the three primers were used in multi- carried out in 25 ll with 20 ll of PCR reaction mixture plex PCR multiplexing SCA 14, SCA 15 and SCB 9 containing 2.5 ll of PCR buffer (109), 1.5 ll of MgCl2 wherein all the B. Bassiana strains could be detected in- (2.5 mM), 1.0 ll of dNTPs (0.5 mM), 0.5 ll of each for- cluding ITCC 4644 and ITCC 4925 (Fig. 1). ward and reverse primers (0.5 mM) and 0.5 ll of Taq DNA Fresh leaf samples collected from all the treated and polymerase (3 U ll-1). An initial denaturation period at untreated plots after 45 days of spray were assessed by 94 °C for 5 min followed by denaturation at 94 °C for multiplex PCR for presence of B. Bassiana. Samples col- 1 min for 15 cycles improved the amplification. Optimum lected from B. bassiana strains viz., ITCC 6063, ITCC annealing temperature was 63 ± 1.3 °C for 60 s. The 4563 and ITCC 4796 treated plots showed amplification multiplex PCR conditions for both soil and plant tissue with all the three SCAR primers viz., SCA 14, SCA 15 and samples remained same. Amplified DNA fragments were SCB 9 generating amplicons of 250, 205 and 1300 bp re- visualized on 1.8 % (w/v) agarose gel. The multiplex PCR spectively (Fig. 2). But two strains namely ITCC 4644 and ITCC 4925 were not amplified. Thus, detection of the three strains viz., ITCC 6063, ITCC from the jute foliage after Table 2 Sequence of SCAR primers used in detection of B. bassiana 45 days of application implies that foliar spray of conidial SCAR primers Sequence (50–30) suspension caused endophytic establishment of these three B. bassiana strains within jute plants. SCA14445 TCTGTGCTGGCCCTTATCG TCTGTGCTGGGTACTGACGTG PCR based detection is a rapid and effective approach in microbial diagnostics (Yamamoto 2002). Recently B. SCA15441 TTCCGAACCCGGTTAAGAGAC bassiana is also being detected by PCR (Quesada-Moraga TTCCGAACCCATCATCCTGC et al. 2006; Ownley et al. 2008; Landa et al. 2013). SCB9 TGGGGGACTCGC AAA CAG 677 However, false negatives due to reaction failure and false TGGGGGACTCAC TCC ACG positives due to contamination are potential problems in 123 678 World J Microbiol Biotechnol (2015) 31:675–679

M 1 2 3 4 5 6 jute. SCAR primers SCA15441 and SCB9677 have also been reported to be polymorphic generating different amplicons in various B. bassiana strains (Castrillo et al. 2003). We have also observed that B. bassiana strains ITCC 4644 and

ITCC 4925 could not be detected using SCA14445. Thus, use of a single primer does not always ensure detection of B. bassiana. Use of multiple primers in a single reaction by multiplex PCR increases possibility of detection of various strains. In the present investigation, a multiplex PCR protocol has been standardized by which B. Bassiana strains viz., ITCC 6063, ITCC 4563, ITCC 4644, ITCC 4796 and ITCC 4925 could be successfully detected from soil. Further, detection of three strains viz., ITCC 6063, ITCC 4563 and ITCC 4796 from jute foliage after 45 days of spray implies Fig. 1 Multiplex PCR of different B. bassiana strains from soil in that these strains got established as endophytes within jute jute field. Lane M 50 bp DNA ladder, lane 1 untreated check, lane 2 plants. We have already reported that seed inoculation with ITCC 6063, lane 3 ITCC 4563, lane 4 ITCC 4795, lane 5 ITCC 4644, conidial suspension caused endophytic colonization of B. lane 6 ITCC 4925 Bassiana within jute plant (Biswas et al. 2012). But it is the M 1 2 3 4 5 first report that foliar spray of conidial suspension can also cause endophytic establishment of B. Bassiana within jute plant. Application of B. bassiana as an entomopathogen is known for pest management since the nineteenth century but its introduction into the plant system as an endophyte is a recent approach which is durable, more effective and economic (Akello et al. 2008). Of late, suitable B. bassiana strains are artificially being introduced into plants for controlling pests. Suppression of stemborer (Sesamia calamistis) has been recorded in maize by treating with endophytic B. bassiana isolate (Cherry et al. 2004). Akello et al. (2008) reported that endophytic B. bassiana strain reduced the survival of banana stem weevil (Cosmopolites sordidus) and the damage caused by it in tissue cultured 6 banana plants. Coffee berry borer (Hypothenemus hampei) has also been reported to be controlled by endophytic B. Fig. 2 Multiplex PCR of different B. bassiana strains from jute bassiana (Vega et al. 2008). We have also found that en- foliage. Lane M 50 bp DNA ladder, lane 1 untreated check, lane 2 ITCC 6063, lane 3 ITCC 4563, lane 4 ITCC 4795, lane 5 ITCC 4644, dophytic colonization of B. bassiana strains reduced stem lane 6 ITCC 4925 weevil infestation in white jute (Biswas et al. 2013). However, detection and monitoring of fungal endophytes in host plants is a practical problem. PCR based detection single primer PCR (Gonçalves-de-Albuquerque Sda et al. of endophytes in crop plants is a rapid technique to detect 2014; Shadrach and Warshawsky 2004). The false nega- and monitor the presence of endophytes in host tissues. tives are often revealed in multiplex amplification because There are few reports where endophytic colonization of B. each amplicon provides an internal control for the other bassiana has been detected by PCR (Quesada-Moraga et al. amplified fragments (Edwards and Gibbs 1994). 2006; Ownley et al. 2008; Biswas et al. 2012; Landa et al. We have used three SCAR primers designed by Castrillo 2013), but no multiplex PCR based method is yet reported et al. (2003) for PCR based detection of B. bassiana in jute for detection of different B. Bassiana strains. Detection by (Biswas et al. 2012). Castrillo et al. (2003) reported that multiplex PCR is more assured and reliable than by single

SCAR primer SCA14445 detected B. bassiana GHA gen- primer PCR because more than one target sequence can be erating an amplicon of 445 bp, but it failed to amplify 42 amplified by using multiple primer pairs in a reaction other strains and six isolates from infected Colorado potato mixture (Edwards and Gibbs 1994). We have standardized beetle. However, we observed that SCA14445 amplified a a Multiplex PCR protocol for detecting B. bassiana from different amplicon size (250 bp) in B. bassiana strains in soil as well as jute plant. This method would be helpful for 123 World J Microbiol Biotechnol (2015) 31:675–679 679 biological control of jute pests in particular and insect pests (2013) In-planta detection and monitorization of endophytic of other crops in general which are parasitized by different colonization by a Beauveria bassiana strain using a new- developed nested and quantitative PCR-based assay and confocal B. bassiana strains. The method may also be used in de- laser scanning microscopy. J Invertebr Pathol 114(2):128–138 tection, monitoring and decision making in integrated pest Loncaric I, Donat C, Antlinger B, Oberlerchner J, Heissenberger B, management involving B. bassiana as a biocontrol agent. Moosbeckhofer R (2008) Strain-specific detection of two Aureobasidium pullulans strains, fungal biocontrol agents of fire blight by new, developed multiplex-PCR. J Appl Microbiol 104:1433–1441 Maniania NK (1993) Effectiveness of the entomopathogenic fungus References Beauveria bassiana (Bals.) Vuill. for control of the stem borer Chilo partellus (Swinhoe) in maize in Kenya. Crop Prot Akello J, Dubois T, Coyne D, Kyamanywa S (2008) Endophytic 12(8):601–604 Beauveria bassiana in banana (Musa spp.) reduces banana Murray MG, Thompson WF (1980) Rapid isolation of high molecular weevil (Cosmopolites sordidus) fitness and damage. Crop Prot weight plant DNA. Nucleic Acids Res 8(19):4321–4326 27:1437–1441 Ownley BH, Griffin MR, Klingeman WE, Gwinn KD, Moulton JK, Baric S, Dalla-Via J (2004) A new approach to apple proliferation Pereira RM (2008) Beauveria bassiana: endophytic colonization detection: a highly sensitive real-time PCR assay. J Microbiol and plant disease control. J Invertebr Pathol 98:267–270 Methods 57:135–145 Pandit NC, Som D (1988) Culture of Beauveria bassiana and its Biswas C, Dey P, Satpathy S, Satya P (2012) Establishment of the pathogenicity to insect pests of jute (Corchorus capsularis and fungal entomopathogen Beauveria bassiana as a season long C. olitorius) and mesta (Hibiscus cannabinus and H. sabdariffa). endophyte in jute (Corchorus olitorius) and its rapid detection Indian J Agric Sci 58(1):75–76 using SCAR marker. BioControl 57(4):565–571 Quesada-Moraga E, Landa BB, Munõz-Ledesma J, Jimeńez-Dia´z Biswas C, Dey P, Satpathy S, Satya P, Mahapatra BS (2013) RM, Santiago-Alvarez C (2006) Endophytic colonisation of Endophytic colonization of white jute (Corchorus capsularis) opium poppy, Papaver somniferum, by an entomopathogenic plants by different Beauveria bassiana strains for managing stem Beauveria bassiana strain. Mycopathologia 161(5):323–329 weevil (Apion corchori). Phytoparasitica 41:17–21 Ramasubramanian T, Sarkar SK, Satpathy S, Laha SK, De RK, Castrillo LA, Vandenberg JD, Wraight SP (2003) Strain-specific Gotyal BS, Biswas C (2010) Integrated pest and disease detection of introduced Beauveria bassiana in agricultural fields management for jute and allied fibres. Indian Farming 59(12): by use of sequence-characterized amplified region markers. 33–39 J Invertebr Pathol 82:75–83 Ramesh K, Mohan CM, Lakshmi KA, Padmavathi J, Devi KU (1999) Cherry AJ, Banito A, Djegui D, Lomer C (2004) Suppression of the Beauveria bassiana (Bals.) Vuill. (Hyphomycetes, Monoliales) stemborer Sesamia calamistis (Lepidoptera; Noctuidae) in maize in cotton pest management : a field trial on the cotton leaf roller, following seed dressing, topical application and stem injection Sylepta derogata, Fabricius (Lepidoptera: Pyraustidae). J Ento- with African isolates of Beauveria bassiana. Int J Pest Manag mol Res 23(3):267–271 50(1):67–73 Reddy NP, Alikhan AP, Devi KU, Sharma HC, Reineke A (2009) Edwards MC, Gibbs RA (1994) Multiplex PCR: advantages, devel- Treatment of millet crop plant (Sorghum bicolor) with the opment, and applications. Genome Res 3:S65–S75 entomopathogenic fungus Beauveria bassiana to combat infes- Gonçalves-de-Albuquerque Sda C, Pessoa E Silva R, de Morais RC, tation by the stem borer, Chilo partellus Swinhoe (Lepidoptera: Trajano-Silva LA, Re´gis-da-Silva CG, Brandaõ-Filho SP, de Pyralidae). J Asia Pac Entomol 12(4):221–226 Paiva-Cavalcanti M (2014) Tracking false-negative results in Robe P, Nalin R, Capellano C, Vogel TM, Simonet P (2003) molecular diagnosis: proposal of a triplex-PCR based method for Extraction of DNA from soil. Eur J Soil Biol 39:183–190 leishmaniasis diagnosis. J Venom Anim Toxins Incl Trop Dis Shadrach B, Warshawsky I (2004) A comparison of multiplex and 20:16 monoplex T-cell receptor gamma PCR. Diagn Mol Pathol Hatting JL, Wraight SP, Miller RM (2004) Efficacy of Beauveria 13(3):127–134 bassiana (Hyphomycetes) for control of Russian wheat aphid Vega FE, Posada F, Aime MC, Pava-Ripoll M, Infante F, Rehner SA (Homoptera, Aphididae) on resistant wheat under field condi- (2008) Entomopathogenic fungal endophytes. Biol Control tions. Biol Sci Technol 14(5):459–473 46:72–82 Kirkland BH, Cho E-M, Keyhani NO (2004) Differential suscepti- Wraight SP, Ramos ME (2002) Application parameters affecting field bility of Amblyomma maculatum and A.americanum (Acari: efficacy of Beauveria bassiana foliar treatments against Color- Ixodida) to entomopathogenic fungi Beauveria bassiana and ado potato bettle, Leptinotarsa decemlineata. Biol Control Metarhizium anisopliae. Biol Control 31(3):414–421 23(2):164–178 Kundu BC (1956) Jute—world’s foremost bast fibre, II. Technology, Yamamoto Y (2002) PCR in diagnosis of infection: detection of marketing, production and utilization. Econ Bot 10(3):203–240 bacteria in cerebrospinal fluids. Clin Vaccine Immunol 9(3): Landa BB, Lo´pez-Dıáz C, Jimeńez-Fernańdez D, Montes-Borrego M, 508–514 Munõz-Ledesma FJ, Ortiz-Urquiza A, Quesada-Moraga E

123