Micropropagation, Diversity Study and Detection of Antioxidants in Some Medicinal Zingibers

Micropropagation, diversity study and detection of antioxidants in some medicinal Zingibers

Thesis submitted to the University of North Bengal For the Award of Doctor of Philosophy In Botany

By Malay Bhattacharya

Supervisor Dr. Arnab Sen

Department of Botany University of North Bengal RajaRammohunpur, Siliguri January, 2014

This work is dedicated to my Mother

DECLARATION

I declare that the thesis entitled “Micropropagation, diversity study and detection of antioxidants in some medicinal Zingibers” has been prepared by me under the supervision of Dr. Arnab Sen, Associate Professor of Department of Botany,

University of North Bengal. No part of this thesis has formed the basis for the award of any degree or fellowship previously.

[Malay Bhattacharya] Department of Botany, University of North Bengal Raja Rammohunpur, Siliguri-734013 Date:

ABSTRACT ABSTRACT Zingiberaceae is a moderately sized the rituals, ceremonies and cuisine. family of relatively advanced Due to the strong antiseptic properties, monocotyledons. It is the largest family turmeric has been used as a remedy for of Zingiberales and is one of the ten all kinds of poisonous affections, ulcers largest monocotyledonous families in and wounds. K. galanga rhizome India. The members of this family extract are used as expectorant, occur chiefly in the tropics with the stimulant, diuretic, carminative and greatest concentration in the Indo- stomachic. It is used for the treatment Malayan region of Asia. India is of leprosy, skin diseases, rheumatism, represented by around 22 genera and asthma, cough, bronchitis, ulcers, 178 species. fever, malarial fever, nasal obstruction

The study area includes the foothills of and for various other ailments. Darjeeling and the adjoining plains. In the present study of some medicinal The floral elements of the region Zingibers, three broad objectives (in include various members of the family vitro regeneration, study of molecular Zingiberaceae, of which Zingiber diversity and detection of antioxidant officinale, Curcuma longa and potential) were considered. Studies in Kaempferia galanga are used in these fields were severely lacking in alternative systems of medicine. The the perspective of local cultivars of the whole parts of these plants are genera. aromatic, but it is their underground Selected places of Jalpaiguri and rhizome, fresh or preserved, that are Darjeeling district of West Bengal valuable. Z. officinale is used were visited for collection of worldwide as a cooking spice, germplasm. The collected samples condiment and herbal remedy. The were planted in separate pots placed at dried rhizomes constitute the spice and experimental garden of Department of are esteemed for its flavour, pungency Botany for future use. As, the members and aroma. C. longa occupies an of Zingiberaceae are propagated by important position in the life of Indian rhizomes; various pathogens affecting people as it forms an integral part of the crop are transmitted through this

ii ABSTRACT process. Moreover, conventional BAP (4.33), kinetin (3.44) and zeatin breeding techniques to improve the (3.58). In Z. officinale the highest crops are restricted due to extreme low average shoot height with BAP (6.90 seed set. In vitro culture offers an cm), kinetin (6.06 cm) and zeatin (4.67 alternative method for producing cm) were observed. In C. longa the variations and disease free planting highest average shoot height with BAP materials. Unfortunately, this field of (6.47 cm), kinetin (5.81 cm) and zeatin research has not been explored for the (4.43 cm) were observed, while in K. local cultivars of Zingiberaceous galanga it was BAP (4.31 cm), kinetin plants. (2.82 cm) and zeatin (2.48 cm). Among

In vitro regeneration experiment using the cytokinins tried, BAP gave better rhizome sprouts revealed that, results compared to kinetin and zeatin Murashige and Skoog basal media in regeneration. supplemented with vitamins, sucrose, The regeneration of plantlets also agar and plant growth regulators was varied considerably with different superior to Gamborg B5 media. The combinations of BAP and kinetin. In Z. ideal percentage of sucrose required for officinale culture, maximum number of growth of the sprouts was 30 g/l, when plantlets per explant were obtained in the media was supplemented with 3 or the medium supplemented with 4 mg/l 4 mg/l BAP. BAP + 3 mg/l kinetin (9.60), while the

Efficacy of three important cytokinins maximum plantlet height was obtained like benzyl amino purine, kinetin and in the medium supplemented with 4 zeatin were tested in different mg/l BAP + 3 mg/l kinetin (8.59 cm). concentrations and combinations. It has In C. longa culture the maximum been observed that the growth number of plantlets were obtained in regulators trigger variable responses. In the medium supplemented with 3 mg/l Z. officinale the highest number of BAP + 4 mg/l kinetin (9.20), while the shoots per explant with BAP (8.33), maximum plantlet height was obtained kinetin (5.40) and zeatin (7.20) were in the medium supplemented with 4 observed. In C. longa the highest mg/l BAP + 4 mg/l kinetin (8.36 cm). number of shoots per explant with BAP In K. galanga culture the maximum (9.08), kinetin (6.85) and zeatin (6.22) number of plantlets were obtained in were noted, while in K. galanga it was the medium supplemented with 3 mg/l

iii ABSTRACT

BAP + 4 mg/l kinetin (6.52), while the cultures showed maximum maximum plantlet height was obtained regeneration in the 2nd subculture. In in the medium supplemented with 2 case of K. galanga regeneration, the mg/l BAP + 4 mg/l kinetin (8.23 cm). least number of plantlets were In general plantlet regeneration was produced in the primary culture and it relatively less in the medium declined after the 1st or 2nd subcultures. supplemented with low BAP and Healthy, in vitro grown plantlets with kinetin combination. Good results were good number of roots were selected for obtained when the combined hardening. The regenerated plants Z. concentrations of BAP and kinetin officinale, C. longa and K. galanga were more than 5 mg/l. The plant showed a survival percentage of 94%, growth regulators worked better in 91% and 94% respectively. combinations than that when used Diagnostic tests were performed to alone. The plantlets rooted in the same detect the presence or absence of the medium and they were moderate to pathogen in the plants. In vitro-derived profuse in most of the combinations. plants raised under field conditions did The rate of rooting was found to be not show any disease symptoms until proportional to the number of plantlets. maturity. The rhizomes obtained from Subcultures to obtain maximum field planted tissue culture derived number of healthy shoots were plantlets on storage on sand for 6 experimented by inoculating sets of months did not show any visible root- explants in media having the same rot or shoot-rot. composition. The effects of plant Benzyl Amino Purine showed variable growth regulators on regeneration were effects on the shooting of twelve not the same in primary and secondary different C. longa cultivars. The mean cultures. Comparatively less variation number of shoots formed per explant were observed in number of shoots per were 3.075 (BAP 1 mg/l), 4.983 (BAP explant in the primary and secondary 2 mg/l), 6.891 (BAP 3 mg/l), 6.358 cultures of C. longa than Z. officinale (BAP 4 mg/l) and 5.816 (BAP 5 mg/l). and K. galanga. In all the cases of Z. Maximum regeneration potential was officinale and C. longa regeneration the observed in the cultivar CLS-2A (8.7 least number of plantlets were shoots per explant), while the lowest produced in the primary culture and the regeneration potential was observed in iv ABSTRACT the cultivar Allepy (1.8 shoots per polymorphic. The frequency of explant). polymorphism was found to be 92%. The band size ranged between 274bp to RAPD and ISSR analysis were 1758bp. Similarity coefficient among performed to analyze the genetic the 12 cultivars ranged from 0.523 to relationship among the C. longa 0.904. The lowest similarity was cultivars. In RAPD analysis, the observed between C. longa L. cv Local amplification profiles of the total -Dhupguri and C. longa L. cv Allepy, genomic DNA from the 12 cultivars of while the highest value was recorded C. longa using 14 primers resulted in between C. longa L. cv Suguna and C. production of 170 bands ranging in longa L. cv TC Assam. The between 151 and 1767 bp of which dendrogram constructed on the basis of only 10 were monomorphic. The the data obtained from ISSR analysis percentage of polymorphism was found showed three major groups viz. group I to be 94.11%. The similarity matrix (C. longa cv Local-Lataguri and Local- obtained using the Dice coefficient of Dhupguri); group II (C. longa cv similarity among the 12 cultivars (Prova, Sudarshana and PTC 13) and ranged from 0.560 to 0.857. The lowest group III (C. longa cv (Suguna, TC similarity was observed between C. Assam, Allepy, Kasturi, CLS 2A, longa cv local-Dhupguri and Roma and Suvarna and Roma) were noted. Of C. longa cv local-Dhupguri and these the first group with two local Sudarshana while the highest value cultivars of C. longa formed a distinct was recorded between C. longa cv clade from rest of the cultivars. Suguna and C. longa cv TC Assam. Three distinct groups viz. group I (C. Combined RAPD and ISSR based longa cv Local-Lataguri, Local- analysis of C. longa showed the Dhupguri, Prova, Suvarna, Suguna, highest similarity between the cultivars Kasturi and CLS 2A); group II (C. C. longa L. cv Suguna and C. longa L. longa cv Allepy, PTC13 and Roma) cv TC Assam while the lowest was and group III (C. longa cv Sudarshana) noted between C. longa L. cv Local- were noted. Dhupguri and C. longa L. cv Sudarshana. The highest similarity of ISSR analysis among 12 cultivars of C. the cultivars C. longa L. cv Suguna and longa produced a total of 75 amplified C. longa L. cv TC Assam were also bands by 8 primers of which 69 were

v ABSTRACT noted in the results of RAPD and ISSR method can also be useful for cultivar when calculated separately. The identification. dendrogram showed that, based on the A total of 10 primers were used to similarity indices, two cultivars of C. screen somaclonal variations, out of longa i.e. Suguna and TC Assam which 6 were RAPD and rest 4 were formed a cluster sharing a node at ISSR primers. All the RAPD and ISSR 87.2%. Clustering above a similarity of primers produced distinct and scorable 80% was also formed in between Local bands which were found to be -Lataguri and Local-Dhupguri (84.2%) monomorphic across all the in vitro and Kasturi and CLS 2A (82.7%). raised plantlets and the parent plant Three major groups viz. group I (C. analyzed. This uniformity in the longa cv Local-Lataguri and Local- banding pattern confirms the genetic Dhupguri); group II (C. longa cv fidelity of the in vitro raised Z. Prova, Suguna, TC Assam, Allepy, officinale, C. longa and K. galanga Kasturi, CLS 2A, Suvarna, Roma and plantlets. PTC 13) and group III (C. longa cv The TrnL-TrnF region of the sample Sudarshana) were noted. Of these the (C. longa cv Local-Lataguri) was first and the third group with two local sequenced. The sequencing resulted in cultivars of C. longa and Curcuma long forward and reverse sequence of 730 a cv Sudarshana respectively formed bp and 750 bp respectively. The two distinct clade from rest of the nucleotide BLAST of the forward cultivars. sequence showed a maximum of 100% Comparative account of the DNA identity with C. longa, while the fingerprinting study showed that both reverse sequence showed a maximum RAPD and ISSR markers are efficient of 99% identity with C. longa. revealing 94.11% and 92% Free radical scavenging activity with polymorphism respectively among the DPPH showed that the solvent twelve cultivars of C. longa under fractions of Z. officinale, C. longa and study. These markers may provide a K. galanga exhibited different levels of cheap, rapid and effective means to antiradical activities. Among Z. evaluate the genetic diversity among officinale fractions, Diethyl ether & different C. longa cultivars. As ethyl acetate (1:1) showed the flowering is rare in Zingibers so this maximum (80%) antiradical vi ABSTRACT scavenging activity. In C. longa, fraction (41.30%).

Diethyl ether & ethyl acetate (3:1) Determination of lipid peroxidation showed the maximum inhibition inhibition activity revealed that the percent (77.75%), while in K. galanga bioactive fractions of Z. officinale, C. the acetone fraction showed the longa and K. galanga fractions maximum (66.66%) antiradical protected hepatocytes from damage scavenging activity. due to lipid peroxidation induced in Assay of hydroxyl radical scavenging goat liver homogenate by ferric-ADP activity reveals that in all the cases the and ascorbate in a dose dependent scavenging activities increased with the manner. In Z. officinale the maximum increase in concentrations of the protective function was recorded in extracts. In Z. officinale, the chloroform fraction (30.76%). In C chloroform fraction (43.75%) showed longa the maximum protective function maximum hydroxyl radical scavenging was recorded in Diethyl ether: Ethyl activity. In C. longa, the diethyl ether acetate (3:1) fraction (46.42%), while fraction (40.00%) showed maximum in K. galanga the maximum protective hydroxyl radical scavenging activity, function was recorded in Acetone: while in K. galanga, the acetone Ethanol (3:1) fraction (33.33%). fraction (40.00%) showed maximum In different fractions of Ginger, it was hydroxyl radical scavenging activity. observed that phenolic compounds Results indicate that, all the bioactive were distributed from chloroform to Z. officinale, C. longa and K. galanga aqueous fraction whereas gingeroles fractions have NO scavenging activity. and arbutin related compounds were The scavenging activity increased with mainly restricted in diethyl ether: ethyl decrease in concentrations in all the acetate fractions. bioactive fractions other than the The antiradical activities in the hexane fractions Z. officinale. In Z. methanol and water extracts of officinale the hexane fraction (47.72%) different C. longa cultivars were was most active in NO scavenging variable. In all the cultivars the activity. In C. longa the benzene: methanol soluble fraction showed more chloroform (1:1) fraction (42.22%) was antiradical activity than the water most active in NO scavenging activity, soluble fraction. The maximum while in K. galanga the acetone

vii ABSTRACT antiradical observed in methanol activity observed in water solvent solvent fraction of Roma (64.61%), fractions, was in cultivar Roma while the minimum activity was (39.75%), while the minimum activity observed in the cultivar PTC13 was observed in Kasturi (19.27%) and (26.92%). The maximum antiradical PTC 13 (19.27%).

viii

PREFACE Preface This Ph.D. thesis is a culmination of Botany Department, University of the research undertaken by me at North Bengal for offering me Molecular Genetics Laboratory, necessary help at various phases of my Department of Botany, University of research. North Bengal over a period of almost I thank Dr. A. K. Sit, Senior Scientist, eight years (2005-2013). These years Central Plantation Crops Research have been a challenging trip, with both Institute (CPCRI), ICAR, Mohitnagar, ups and downs. It would not have been Jalpaiguri, West Bengal for providing possible for me to write this thesis the necessary information and support without the help and support of the during the field study. kind people around me. I am grateful to I would like to express my sincere numerous personalities who have thanks to my teachers Dr. (Mrs.) S. contributed towards shaping this thesis. Mahapatra and Dr. S. D. Mahapatra, At the outset, I would like to express my colleagues Dr. (Mrs.) J. S. Pradhan my appreciation to Dr. Arnab Sen, and Mr. S. B. Lama for their valuable Associate Professor, Department of suggestions during the entire phase of Botany, University of North Bengal for the thesis work. his valuable advice, scholarly inputs I acknowledge my lab mates Dr. and consistent encouragement during Saubashya Sur, Dr. Bharat Chandra my entire research endeavour. This feat Basistha, Dr. Debadin Bose, Shri. was possible only because of his Arvind Kumar Goyal, Ms. Tanmayee unconditional support and the Mishra, Ms. Ritu Rai, Ms. Subarna invaluable time provided by him Thakur, Shri. Ayan Roy, Ms. Sanghati despite of his many other academic and Bhattacharya, Shri. Pallab Kar, Shri. professional commitments. As my Arnab Chakroborty, Shri. Manas supervisor, he has constantly forced me Ranjan Saha and Ms. Indrani Sarkar to remain focused on achieving my for extending their support in a very goal. Thank you Sir, for all your special way. I gained a lot from them, valuable help and support. through their personal, scholarly I express my gratitude to all the interactions and their suggestions at teachers and the office staffs of the various points of my research work. I

ix PREFACE will miss if I don’t acknowledge Shri. support. My special thanks to my wife Krishanu Ghosh, Data Entry Operator, Smt. Shampa Bhattacharya for her Bioinformatics Facility and Shri. patience, understanding and allowing Basudev Singha our lab boy. me to spend most of the time on this I owe a lot to my parents, my father thesis. I also like to thank my son Shri. Sudhir Kumar Bhattacharjee and Master Shantoshubhro Bhattacharya mother Smt. Mamata Bhattacharjee whose time I have skillfully stole to who encouraged and helped me at compile the thesis. every stage of my personal and Above all, I owe it all to Almighty God academic life and longed to see this for granting me the wisdom, health and achievement come true. I also thank strength to undertake this research task my grandfather Lt. Suresh Kumar and enabling me to its completion. Bhattacharjee for the blessings Finally, I thank each and everyone who bestowed upon me and miss him at this were directly and indirectly important critical juncture of life to share my in successfully completion of my happiness with him. thesis, as well as I express my apology I am very much indebted to my sisters to all whose name could not be Smt. Sunanda Chakraborty and Smt. mentioned personally one by one. Sulekha Bhattacharya, nephew Sri. For any errors or inadequacies that may Sourav Chakraborty, Sri. Dwijaraj remain in this work, of course, the Bhattacharya and Sri. Harsharaj responsibility is entirely of my own. Bhattacharya for their love and

[Malay Bhattacharya]

TABLE OF CONTENTS

Chapter Description Page # Declaration i Abstract ii Preface ix List of tables xii List of figures xiii List of appendices xv 1 Introduction 1-9 2 Review of Literature 10-59 2.1 History of Zingiber 10 2.2 Systematic position of the family 10 2.3 Classification and taxonomic hierarchy of the genera 10 2.4 Relationship of Zingiberales with other monocot taxa 11 2.5 Habitat of Zingiberaceae 12 2.6 Botanical description of Zingiberaceae 12 2.7 Morphology of the genera 13 2.8 Chemical constituents and their activities 14 2.9 Economic importance and health benefits 16 2.10 In vitro culture studies 22 2.11 Study of molecular diversity 47 2.12 Somaclonal variations 50 2.13 Antioxidant studies 53 3 Materials and Methods 60-82 3.1 Collection of germplasm 60 3.2 Maintenance of germplasm 60 3.3 In vitro culture studies 60 3.4 Diversity studies 65 3.5 Antioxidants studies 76 4 Results and Discussion 83-131 4.1 Germplasm collection 83 4.2 Micropropagation studies 83 4.3 Diversity studies 101 4.4 Antioxidant studies 119 Conclusion 132-133 Bibliography 134-148 Index 149-150 Appendix A1-A7

ABSTRACT xii

LIST OF TABLES

Table Title Page 1.1 Systematic position to the family Zingiberaceae 1 2.1 Placement of Zingiberaceae 11 2.2 Explants used for in vitro regeneration of Zingiber officinale, Curcuma longa 27 and Kaempferia galanga 2.3 Media used for in vitro regeneration of Zingiber officinale, Curcuma longa and 30 Kaempferia galanga 2.4 Plant growth regulator used for in vitro regeneration of Zingiber officinale, Cur- 33 cuma longa and Kaempferia galanga 2.5 Hardening material and survival rate of regenerated plantlets of Zingiber offici- 48 nale, Curcuma longa and Kaempferia galanga 2.6 Somaclonal variations in vitro regenerated plantlets of of Zingiber officinale, 53 Curcuma longa and Kaempferia galanga 3.1 List of RAPD primers used 69 3.2 PCR cycle for RAPD analysis of Curcuma longa cultivars 70 3.3 List of primers used for ISSR analysis 71 3.4 PCR cycle for ISSR analysis of Curcuma longa cultivars 72 3.5 List of trnL-trnF primers used 73 3.6 PCR cycle for amplification of trnL-trnF region 74 3.7 Solvents for silica gel column chromatography of Z. officinale, C. longa and K. 78 galanga 4.1 List of germplasm collected for the study 84 4.2 Days required for shoot and root initiation 85 4.3 Effect of culture medium on regeneration of Z. officinale, C. longa and K. 87 galanga 4.4 Effect of sucrose on regeneration of Z. officinale, C. longa and K. galanga. 88 4.5 Effect of different concentrations of cytokinins 90 4.6 Effect of different combinations and concentrations of BAP and Kinetin on in 94 vitro regeneration of Z. officinale, C. longa and K. galanga. 4.7 List of different cultivars of Curcuma longa showing their purity 102 4.8 Total number and size of amplified bands, number of monomorphic and poly- 104 morphic bands generated and percentage of polymorphism generated by the RAPD primers. 4.9 The similarity matrix obtained using Dice coefficient of similarity among the 12 105 cultivars of C. longa, based on RAPD profiling 4.10 Total number and size of amplified bands, number of monomorphic and poly- 109 morphic bands generated and percentage of polymorphism generated by the ISSR primers. 4.11 The similarity matrix obtained using Dice coefficient of similarity among the 12 110 cultivars of C. longa, based on ISSR profiling 4.12 The similarity matrix obtained using Dice coefficient of similarity among the 12 114 cultivars of C. longa based on combined RAPD and ISSR profiling 4.13 PCR amplicons obtained from RAPD and ISSR markers in in vitro raised plant- 118 lets of Z. officinale, C. longa and K. galanga. xii

LIST OF FIGURES LIST OF FIGURES

Figure Title Page 3.1 Schematic representation of the Tab c-f primer location 73

4.1 Explants used for in vitro studies (a) Zingiber officiinale. (b) Curcuma longa. 84 (c) Kaempferia galanga 4.2 Initiation of shoot bud formation after 6 weeks of inoculation. (a). Zingiber 86 officinale . (b) Curcuma longa . (c) Kaempferia galanga 4.3 Response of Zingiber officinale explants to MS media supplemented with 89 BAP 4 mg/l and different percentages of sucrose. (a) 1% sucrose. (b) 2% sucrose. (c) 3% sucrose. (4) 1% sucrose 4.4 Shooting of Zingiber officinale plantlets in MS media (a) Media supple- 91 mented with BAP 3mg/l. (b) Media supplemented with BAP 3mg/l + Kinetin 2mg/l. 4.5 Shooting of Curcuma longa plantlets in MS media (a) Media supplemented 92 with BAP 2mg/l. (b) Media supplemented with BAP 3mg/l + Kinetin 2mg/l

4.6 Shooting of Kaempferia galanga plantlets in MS media (a) Media supple- 93 mented with BAP 4mg/l. (b) Media supplemented with BAP 4mg/l + Kinetin 3mg/l 4.7 Responses in primary and subsequent subcultures 96

4.8 Hardened plantlets. (a) Zingiber officinale . (b) Curcuma longa . (c) 97 Kaempferia galanga. 4.9 Hardened plantlets of (a) Zingiber officinale , (b) Curcuma longa & (c) 98 Kaempferia galanga . (d) Regeneration of C. longa cultivars. (e) Regenerated plantlet of Z. officinale in primary culture. (f) Rooted plantlets of C. longa prior to hardening. (g) Secondary culture of K. galanga (h). Hardened plantlets of Z. officinale . 4.10 Effect of BAP on regeneration of different Curcuma longa cultivars 100

4.11 A representative RAPD profile of 12 cultivars of Curcuma longa amplified 103 with primers (a) OPN04 & (b) OPA07. Lane M1: 100bp molecular marker; Lane T1-T12 different cultivars of C. longa under study (please refer table 4.1 for the cultivar name); Lane M2: λ DNA/ Eco RI/ Hin dIII double digest DNA ladder 4.12 Dendrogram derived from UPGMA cluster analysis of RAPD markers illus- 106 trating the genetic relationships among the 12 cultivars of C. longa 4.13 Principal coordinate analysis of 12 cultivars of Curcuma longa on RAPD 107 analysis data. (a) 2-dimensional plot and (b) 3-dimensional plot. 4.14 ISSR banding patterns of 12 cultivars of Curcuma longa generated by (a) 108 UBC 815 primer and (b) UBC873. Lane M1: λ DNA/ Eco RI/ Hin dIII double digest DNA ladder; Lane T1-T12 different cultivars of C. longa under study (please refer table 4.1 for the cultivar name); Lane M2:100 bp molecular marker 4.15 Dendrogram generated from the cluster analysis of ISSR markers of 12 C. 111 longa cultivars 4.16 Principal coordinate analysis of 12 cultivars of C. longa based on ISSR analy- 112 sis data. (a) 2-dimensional plot and (b) 3-dimensional plot 4.17 Dendrogram constructed on the basis of data obtained from the combined 115 RAPD and ISSR analysis Continued to next page xiii LIST OF FIGURES

Continued from last page 4.18 Principal coordinate analysis of 12 cultivars of C. longa based on combined 116 RAPD and ISSR analysis data. (a) 2-dimensional plot and (b) 3-dimensional plot 4.19 DNA fingerprinting patterns of in vitro raised (a) Z. officinale (b) C. longa 118 and (c) K. galanga by using RAPD primers. Parent plant (lane1), micropropagated plants (lanes 2-6) and molecular weight markers 0.1-10 kb DNA ladder (M1). 4.20 Free radical scavenging activity of different solvent fractions of Z. oficinale 120 by DPPH 4.21 Free radical scavenging activity of different solvent fractions of C. longa by 121 DPPH 4.22 Free radical scavenging activity of different solvent fractions of K. galanga 122 by DPPH 4.23 Hydroxyl radical scavenging activity of different solvent fractions of K. 124 galanga. 4.24 Nitrous oxide scavenging activity of different solvent fractions of Z. offici- 126 nale , C longa and K. galanga. 4.25 Lipid peroxidation inhibition activity of different solvent fractions of Z. offici- 127 nale , C longa and K. galanga 4.26 Comparative study of free radical scavenging activity of different solvent 129 fractions of Z. officinale , C. longa and K. galanga by DPPH 4.27 Antiradical (% Scavenging activity of DPPH) of different Curcuma longa 130 cultivar

xiv

LIST OF APPENDICES

Title Page # Appendix A Thesis related publications A1 Appendix B Datasheet used for collection of germplasm and recording field data A2 Appendix C Composition of Murashige and Skoog medium A3 Appendix D Composition of Gamborg B5 A4 Appendix E Buffers and chemicals used for DNA fingerprinting studies A5 Appendix F Chemicals and buffers used for antioxidant profiling A6 Appendix G Sequence of TrnL-TrnF region of C. longa cv Local-Lataguri A7

xv Chapter 1 INTRODUCTION

Zingiber officinale Rosc., Curcuma species viz. 49 genera with 1300 longa L. Syn Curcuma domestica Val. species (Datta et al., 1988), 52 genera and Kaempferia galanga L. of the with 1500 species (Sirirugsa, 1999), 53 family Zingiberaceae are rhizomatous genera with over 1200 species (Kress herbs used worldwide in alternative et al., 2002) and 45 genera with 1275 systems of medicine. The members of species (Singh, 2004).

Zingiberaceae have a very old and The systematic position of the family glorious history with numerous has been studied by several references in Sanskrit literature and in taxonomists. However, the general Chinese medical treatise. trend of assigning the systematic Zingiberaceae is a moderately sized position to the family Zingiberaceae is family of relatively advanced depicted in table 1.1. monocotyledons. It is the largest family The members of the family of Zingiberales and is one of the ten Zingiberaceae originated in South east largest monocotyledonous families in Asia. They are distributed mostly in India (Kress et al., 2002). Several tropical and subtropical areas centering authors have quoted different figures South East Asia. The members occur for the total number of genera and chiefly in the tropics with about 52

Table 1.1: Systematic position to the family Zingiberaceae (Joy et al., 1998)

Kingdom: Plantae Sub-kingdom: Phanerogamae Division: Spermatophyta Subdivision: Angiospermae Class: Monocotyledonae Series: Epigynae. Order: Scitaminales Family:Zingiberaceae INTRODUCTION 2 genera and 1400 species with the stoloniferous sessile fingers adds to the greatest concentration in the Indo- cause of its Indian origin. The genus Malayan region of Asia. India is Curcuma has a widespread occurrence represented by 22 genera and 178 in the tropical Asia and Australia. At species (Jain and Prakash, 1995). Sabu present the crop is distributed in India, (2006) reported 9 genera and 70 Pakistan, Malaysia, Indonesia, species in South India. Out of the 52 Myanmar, Vietnam, Thailand, genera and 1500 species found Philippines, Japan, China, Korea, Sri worldwide, 25 genera are found in Lanka, Nepal, South Pacific Islands, Malaysia, 21 in China, 20 in Thailand, East and West African nations, 18 in India, and 11 in Nepal. Caribbean Islands and Central

Zingiber officinale is believed to have America. In India, it is widespread originated in South Asia. It is widely (Purseglove, 1968 and 1981) and it is grown in India, China, Sumatra, cultivated in innumerable agro- Africa, Mexico, Jamaica, Hong Kong, ecological situations right from the Australia, Nigeria, and Japan. The coastal areas to elevations as high as largest producer and exporter of ginger 1880m in the tropics and the sub- is India where it is chiefly produced in tropics of the country. It is also the states of Kerala and Assam. reported to occur widely in Eastern and Western Ghats. India is the largest Purseglove (1968) and Harlan (1975) producer of turmeric in the world believed that the genus Curcuma accounting for 93.7% of the world originated in the Indo-Malayan region. production. About 90% is used Considering the great diversity of the internally and the rest exported, genus represented by over 80 species in earning foreign exchange (Kumar et Indo-Malayan region, it is legitimate to al., 1997). consider that the genus originated in this region. But the fact that over 40 Kaempferia is supposed to have been species indigenous to this country, is originated in East Asia, most probably supportive to its Indian origin. Further, in Burma. The genus is chiefly native many species belonging to two to the tropics and subtropics of Asia subgenera of Curcuma (Valeton, 1918) and Africa (Shirin et al., 2000). Wood and a newly reported unique species (1991) in his study of biogeography s uch as C . vam ana h avi n g and evolution of Kaempferia galanga

INTRODUCTION 3 reported its distribution in Asia, Africa structures with extremely rich floral and Australia. It is grown in India, and faunal diversity have developed Burma, China, Nigeria, Mexico and due to the extreme climatic, edaphic, other neighbouring countries. In India, and physiographic variations. The it is cultivated mainly in Kerala, floral elements of the region include Karnataka, Tamil Nadu and West various members of the family Bengal. Zingiberaceae like Alpinia galanga,

The northern part of the state West Alpinia nigra, Alpinia malaccensis, Bengal i.e. the study area includes the Alpinia zerumbet, Amomum dealbatum, foothills of Darjeeling and the Amomum subulatum, Curcuma longa, adjoining plains. This area experiences Curcuma amada, Cucurma aromatica, both cold winter and warm humid Cucurma caesia, Cucurma zedoaria, summer. Heavy rainfall occurs in this Hedychium coccineum, Hedychium part of Bengal amounting to about coronarium, Hedychium thysiforme, 3000 mm at the foothill regions. The Kaempferia galanga, Kaempferia soil profile of the region is rotunda, Zingiber officinale, Zingiber predominantly shallow to moderately cassumunar, Zingiber zerumbet etc. shallow but also deep at places, well both cultivated and/or in the wild drained, coarse-loamy to gravelly condition. But still the list of the loamy in texture which is rich in zingiberaceous plants remain nutrients, organically rich and acidic in incomplete due to lack of accessibility reaction. Most of the rivers originate to certain regions. Human tribes of here. This region is also well known diverse origin uses the local flora for for its diverse range of vegetation and their traditional medication. It is certain so is one of the richest in India. The that the traditional medicinal regime hill region of the state forms an includes several members of important part of Eastern Himalaya, Zingiberaceae. which is recognized as a Biodiversity The whole parts of Zingiberaceous hotspot in recent times. Many ancient plants are aromatic, but it is their elements have survived in this flora underground rhizome, fresh or while some have differentiated to preserved, that are valuable. Zingiber different races through the ages (Hara, officinale is used worldwide as a 1966). A wide range of vegetation cooking spice, condiment and herbal

INTRODUCTION 4 remedy (Duke and Ayensu, 1985).The bronchitis, dispels cardiac disorders, dried rhizomes constitute the spice and cures vomiting, cough, anorexia, fever, are esteemed for its flavour, pungency anaemia, flatulence, colic, constipation, and aroma. Fresh or green ginger is swelling, elephantiasis and dysuria. consumed as a vegetable, immature Curcuma longa occupies an important ginger preserved in sugar syrup is position in the life of Indian people as mainly used as a desert while it forms an integral part of the rituals, crystallized ginger is used as a sweet ceremonies and cuisine. Due to the meat. It is also used in the production strong antiseptic properties, turmeric of ginger beer, ginger oil and ginger has been used as a remedy for all kinds wine. The essential oil of rhizome is of poisonous affections, ulcers and used in the manufacture of flavouring wounds. It gives good complexion to essences and in perfumery while the skin and so it is applied to face as a oleoresin extracted from the rhizome is depilatory and facial tonic. The drug used for flavouring and in medicines. cures diseases due to diabetes, eye Ginger is used extensively in the diseases, ulcers, anorexia, leprosy, traditional medicine of India, to block purifies blood by destroying the excessive clotting, reduce cholesterol pathogenic organisms, smallpox and and fight arthritis. In different parts of chickenpox. The rhizome juice is also the world ginger is considered as a useful in cold, cough, bronchitis, pungent, warming herb to be used for conjunctivitis and liver affections ailments triggered by cold and damp (Nadkarni, 1954; Kurup et al., 1979; weather. It is considered an aphrodisiac Kolammal, 1979). Turmeric paste (Qureshi et al., 1989), digestive, induce mixed with a little limejuice and sweating, improve the appetite and saltpetre and applied hot, mixing with curb nausea. Ginger root is used for lime is a popular application to sprains treatment of dyspepsia, prophylactic and bruises. In Ayurveda, turmeric has against motion sickness, anti- been used for various medicinal inflammatory, for rheumatic diseases conditions including rhinitis, wound (Ippoushi et al., 2003), carminative healing, common cold, skin infections, (Kumar et al., 1997), stimulant of the liver diseases, as a ‘blood gastro-intestinal tract (Kumar et al., purifier’ (Chainani et al., 2003) an 1997) gastrointestinal disorders, piles, anthelmintic, in asthma, laxative,

INTRODUCTION 5 diruretic, expectorant, febrifuge Ginger and turmeric contain curcumin (Warrier et al., 1994) and urinary tract as well as less oxygenated curcumin diseases. The essential oil of the plant derivatives. Katiyar et al., (1996) is used as antacid, carminative, showed that water or organic solvent stomachic and tonic (Ghani, 1998 and extract of ginger possesses Kirtikar, 1996). antioxidative property, which inhibits

Kaempferia galanga rhizome contains tumour promotion in mouse skin. Thus a volatile oil (Wong et al., 1992) and Zingiber extract is postulated to several alkaloids, starch, proteins, probably contain anti-inflammatory amino acids, minerals and fatty agents with antioxidant activity. matters. Leaves and flowers contain Curcuma is rich in antioxidants in both flavonoids (Ghani, 1998). The rhizome in vitro and in vivo systems (Halim, extract of black thorn are used as 2002) Kaempferia galanga is also a expectorant, stimulant, diuretic, potential sources of antioxidants and/or carminative, stomachic (Rahman et al., cytotoxic agents against tumour cells 2004), leprosy, skin diseases, (Zaeoung et al., 2005). rheumatism, asthma, cough, bronchitis, Zingiber officinale, Curcuma longa ulcers, helminthiasis, fever, malarial and Kaempferia galanga are tropical fever, splenopathy, inflammatory plant adapted for cultivation even in tumour, nasal obstruction, and regions of subtropical climate. Being haemorrhoids. The extract is also used an exhausting crop, they are not to cure nasal block, asthma and cultivated continuously in the same hypertension. The leaf extracts are field but shifting cultivation is applied to sore eyes, sore throat, practiced. Even more as the pathogens rheumatism, swellings, stimulant, of these plants are transmitted by soil expectorant, diuretic and carminative. and seed rhizomes, so cultivating the The Kaempferia oil is utilized in the crops in the same field are not manufacture of perfumes and in curry recommended. flavouring. It is also employed in Plants of Zingiberaceae are propagated cosmetics, mouth- washes, hair tonics through rhizomes. So, various and toiletries (Kumar et al., 1997). pathogens of bacterial and fungal These three plants of Zingiberaceae are origin get transmitted through the seed rich in various secondary metabolites. materials and affect the cultivation of

INTRODUCTION 6 these crops (Sit et al., 2005). The tissue culture methods can be adopted potential pests related to the Zingibers in this field as an alternative means of are bacterial wilt (Pseudomonas plant propagation. Biotechnological solanacearum), soft rot (Pythium tools like production of disease free aphanidermatum), rhizome and root rot planting materials through tissue (Pythium graminicolum), rhizome rot culture can improve the yield of and yellows (Fusarium oxysporum f. rhizome in the field (Sit and sp. Zingiberi), leafblotch (Taphrina Bhattacharya, 2007). But unfortunately m a c u l a n s ) and nematodes this field of research has not been (Meloidogyne spp. and Radopholus explored for the local cultivars of similis) (Hosoki and Sagawa, 1977; de Zingiberaceous plants.

Lange et al., 1987; Kumar et al., 1997). Study of molecular diversity among the Problem areas in Zingibers regenerated plantlets can provide

In traditional method of cultivation the suitable tool for crop improvement. members of Zingiberaceae are Several strategies can be used to assess propagated by rhizomes; providing the the genetic fidelity of in vitro derived chance to various pathogens like clones, but most have limitations. bacteria, fungi and mycoplasma Polymerase chain reaction (PCR) in affecting the crop to be transmitted conjugation with short primers of through the seed materials which cause arbitrary sequences is useful in immense loss in yield. Conventional analyzing the genomic status of plants breeding programmes to improve the (Williams et al., 1990). Randomly crops are restricted to selection due to amplified polymorphic DNA (RAPD) extreme low seed set. So, most crop markers were recently shown to be improvement programs are thus sensitive for detecting variations confined to the conventional methods among individuals between and within like evaluation and selection of species (Carlson, et al., 1991 and Roy naturally occurring variations et al., 1992). There are neither any (Samsudeen et al., 2000 and reports on the gene sequences of the Bhattacharya and Sen, 2006). In vitro local cultivars nor on the relationships culture offers a method for producing of the local cultivars of turmeric with variations and exploring the resultant the established cultivar varieties. variations for crop improvement. So, Nutritional and medicinal values of the

INTRODUCTION 7 genera under study have been worked available cultivars of the genera under by several workers. Most of them have study. Hence, extensive study is concentrated on the extraction of the required in the field to explore the idea rhizome by one or a few organic of using in vitro techniques for solvents. Separation of active isolating useful variants. In vitro components by column regeneration by using rhizome buds of chromatography has not been worked Z. officinale, C. longa and K. galanga out in these genera. More over there as an explant has the potentiality to are no reports on the antiradical produce huge quantity of plantlets activities of the local cultivars of the within a very short period. The plants plant materials. after hardening can be well maintained

Therefore the research needs in field condition and the line, if superior can be further multiplied by Zingiber officinale, Curcuma longa the conventional technique. Moreover, and Kaempferia galanga despite being micropropagated plants are free from well know spice and medicinal plants diseases or pests and show superiority of this region have not been in different aspects. These useful extensively studied. Huge possibilities variations can prove to be helpful in are there to explore the local cultivars providing economic benefit to the in terms of selecting high yielding, farmers and the large farming disease resistant and antioxidant rich communities would adopt this plants. Molecular documentation of the technology to ensure superior planting local cultivars and finding its materials for their fields. relationship with productivity, disease resistance and active principles may Study of floral morphology has been open up new dimensions in exploring the most important criteria for the local cultivars. identification of flowering plants since time immemorial. But, slight variations As the members of Zingiberaceae are within the cultivars cannot be made out vegetative propagated so efforts to by this process. So employing improve them by conventional molecular techniques is important. breeding methods are limited due to the Moreover in rhizomatous plants where problems of heterozygosity and lack of flowering and seed set is low, study of sexual cycle. In this respect little or no molecular diversity becomes more work has been done on the locally

INTRODUCTION 8 important for taxonomic identification. extracts with polar and non polar DNA fingerprinting using RAPD and solvents will be of significance in ISSR primers may prove to be very understanding the in vitro mechanism useful in this process of identification, of action of these formulations. however, no reports are there on the Keeping all the above facts in mind the molecular documentation of the local present study was designed with the cultivars of Zingiberaceae. So, the following objectives: knowledge of the gene sequences of Study of regeneration techniques the local cultivars and their  Collection of germplasm of relationships with other established Zingiber officinale, Curcuma longa cultivars of turmeric will certainly help and Kaempferia galanga. in judging its origin and relatedness with other members.  Maintenance of the germplasm in the experimental garden of the Medicinal plants form an important Department of Botany. part of indigenous medical systems of India. The system is growing  Standardization of in vitro importance in modern system as they regeneration protocol of the genera can treat disease with very little or no with suitable media and plant side effects. Numerous herbs with their growth regulators. curative properties are available in  Hardening of in vitro raised literature but unfortunately, little is plantlets after adequate rooting. known about their antiradical activity.  Comparative study of in vitro Status of the active principles of the regeneration of Curcuma longa Zingiberaceous members of this region cultivars. have neither been isolated and nor Study of molecular diversity being explored. Study of antiradical  Isolation of genomic DNA from activities of plants and separation of fresh and tender leaf samples of the active principle by Curcuma longa cultivars. chromatographic techniques can open new field in the pharmaceutical  Detection of genetic variability and industry and pave the way to treat phylogenetic relationship among diseases like arteriosclerosis, ischemic the cultivars of C. longa by injury, cancer etc. Fractionation of the different PCR based DNA

INTRODUCTION 9

fingerprinting methods. polar and non polar solvents.

 Detection of somaclonal variations  Isolation of the solutes from the among the in vitro regeneration solvents by mild heating.

plantlets of Zingiber officinale,  Detection of free radical, hydroxyl Curcuma longa and Kaempferia radical and nitric oxide scavenging galanga by different PCR based activity of the extracts. DNA fingerprinting methods.  Lipid peroxidation test of the  Sequencing of the taberlet region of extracts. Curcuma longa genome collected  Comparative study of the free from the locality. radical scavenging activities of the Study of antioxidant activity potential solvent fractions of  Soxhalation of the rhizomes to Zingiber officinale, Curcuma longa prepare extracts. and Kaempferia galanga.

 Fractionalization of the extracts  Study of free radical scavenging using silica gel column activity of different Curcuma longa chromatography with different cultivars.

Chapter 2 REVIEW OF LITERATURE

2.1 History of Zingiber Easter Islands.

The members of the family 2.2 Systematic position of the family

Zingiberaceae have a very old and The family Zingiberaceae is the largest glorious history. There are numerous family of Zingiberales and is one of references to ginger and turmeric in the ten largest monocotyledonous Sanskrit literature and in Chinese families in India (Kress et al., 2002). medical treatise. The Sanskrit name The systematic position of the family ‗Singabera‘ gave rise to the Greek has been studied by several ‗Zingiberi‘ and to the Latin ‗Zingiber‘. taxonomists (table:2.1). However, Zinger has been used in India from generally the family Zingiberaceae is Vedic period and is called maha- placed under the order Scitaminales, aushadi implying ‗The great Series Epigynae, Class medicine‘. Ginger is believed to have Monocotyledonae, Subdivision originated in India and was introduced Angiospermae, Division in China at a very early date. It was Spermatophyta, Sub -kingdom known to Europe in the first century Phanerogamy and Kingdom Plantae AD and was mentioned by Dioscorides (Joy et al., 1998). and Pliny. Turmeric is native to 2.3 Classification and taxonomic Southern or South-eastern Asia. It hierarchy of the genera seems to have reached China before the seventeenth century A.D. Turmeric Zingiber is represented by 90 species, spread early throughout the East Indies Curcuma by 80 and Kaempheria by 50 and was carried eastwards across the species (Sirirugsa, 1999). pacific by Polynesians to Hawai and Classifications of the family was first proposed in the 19th century and REVIEW OF LITERATURE 11

Table 2.1: Placement of Zingiberaceae (adopted from Singh, G. (2004). Plant Systematics, 2/E. Ox- ford and IBH Publishing). Bentham & Cron- APGII/AP Hierarchy Takhtajan Dahlgren Thorne Hooker quist Web Magno- Magnolio- Division - - - - liophyta phyta Monocotyle- Angiosper- Class Liliopsida Liliopsida Liliopsida - dons mae Zingiberi- Commelini- Commelini- Subclass - Liliidae - dae dae dae Series*/ Zingiber- Zingiber- Com- Com- superor- Epigynae* - anae anae melinanae melinids der Zingiber- Zingiber- Order - Zingiberales Cannales Zingiberanae ales ales refined by others since that time. Four Zingiberaceae based on DNA tribes (Globbeae, Hedychieae, sequences of the nuclear internal Alpinieae, and Zingibereae) were transcribed spacer (ITS) and plastid recognized, based on morphological matK regions suggest a new features, such as number of locules and classification of the Zingiberaceae that placentation in the ovary, development recognizes four subfamilies and four of staminodia, modifications of the tribes: Siphonochiloideae fertile anther, and rhizome-shoot-leaf (Siphonochileae), Tamijioideae orientation (Kress et al., 2002). Datta (Tamijieae), Alpinioideae (Alpinieae, (1988) in his book recognized two Riedelieae), and Zingiberoideae subfamilies of Zingiberaceae. The first (Zingibereae, Globbeae) (Kress et al., one Costoideae without any tribe and 2002). the second Zingiberoideae, with three 2.4 Relationship of Zingiberales with tribes named as Globbeae, Hedychieae other monocot taxa and Zingibereae. According to him the The eight families of the order genera Curcuma and Kaempferia Zingiberales have nearly always been belongs to Hedychieae and Zingiber recognized at some level of the belongs to Zingibereae. Chase (2004) taxonomic hierarchy. They are easily reported eight families of the order recognized by their inferior ovaries, Zingiberales (Cannaceae, Costaceae, inaperturate pollen (except in Heliconiaceae, Lowiaceae, Costaceae), reduced numbers of Marantaceae, Musaceae, Strelitziaceae functional stamens (except in Ensete and Zingiberaceae). and Ravenala), often highly modified Molecular-phylogenetic analyses of staminodes (often petaloid), and

REVIEW OF LITERATURE 12 essential oils. They formed a clade in cultivated or are grown in wild. They the morphological analysis of mostly grow in damp and humid shady Stevenson and Loconte (1995) and places. They are also found Chase et al. (1995b). infrequently in secondary forest. Some

DNA studies have always species can fully expose to the sun, and demonstrated Zingiberales to be is capable of growing on high monophyletic with high support elevations. (Chase et al., 1995a, b; Givnish et al., 2.6 Botanical description of 1999). The order has a number of Zingiberaceae small families that have been kept Plants of the family Zingiberaceae are distinct from their larger sister families generally herbs, often large, with a as a matter of tradition, but it seems pseudostem of convolute leaf sheaths. clear that Canna (Cannaceae) could The leaves are radical or cauline and easily be included in Marantaceae usually membranous. Sheaths are (Andersson and Chase, 2001), generally large, clasping on stem; Costaceae in Zingiberaceae (Kress et lamina with a strong central nerve and al., 2002), and Orchidantha pinnately closed secondary nerves. (Lowiaceae) in Heliconiaceae (Kress et Petioles are short or absent. Flowers al., 2001). Combining Musaceae with are hermaphrodite, irregular, solitary either Strelitziaceae or Heliconiaceae, or spicate, bracts membranous, as suggested by Dahlgren et al. (1985), bracteoles membranous or toothed or has not been justified on the basis of spathaceous tube, inner segments are molecular studies (Kress et al., 2001). petaloid, connate in a long or short Studies of floral development corolla tube, free or adnate to petaloid (Kirchoff, 1992, Kirchoff and Kunze, staminodes, or 5 perfect with six 1995) have provided important imperfect. Anthers are linear and 2 insights into homologies of the various celled. Ovary is 3 celled, inferior with floral parts of these often highly many ovules, anatropous and axile. modified taxa (Chase, 2004). Style is usually slender with 2 short 2.5 Habitat of Zingiberaceae stylodes, crowning the ovary. Stigma

Members of the Zingiberaceae are the is usually entire or sub entire. Fruit is ground plants of the tropical and sub usually loculicidal- a three valved tropical forests. The plants are capsule, or indehiscent and

REVIEW OF LITERATURE 13 membranous or fleshy, usually sessile and long-stipulate tubers; tubers crowned by the remains of the deep orange yellow within; leaves perianth. Seeds are often arilate, usually oblong, often very large. albumen floury and embryo small Flowers in dense, compound spikes, (Hooker, 1875; Prain, 1903; Datta, crowned by small, coloured bracts; 1988; Joy et al., 1998 ). lower bracts ovate, membranous,

2.7 Morphology of the genera enclosing several bracteoles fugitive flowers, which open in succession. Zingiber officinale Rosc. is herbaceous Sepals 8, connate in a short, cylindric, with elongated, leafy stems and minutely toothed calyx. Petals 3, horizontal, tuberous rootstocks; leaves connate in a corolla with funnel shaped oblong or lanceolate. Flowers in tube; lobes usually ovate or oblong, the spikes, usually radical, less often upper longer and somewhat concave. terminal, very rarely lateral on the Stamens 1 perfect; filaments short; leafy stems; peduncle short or long; anthers uncrested, with contigious cells bracts persistent, usually 1-flowered. spurred at the base; lateral staminodes Sepals 3, connate in a cylindrical, oblong, petaloid, connate with the shortly three lobed calyx. Petals 3, filaments; lip orbicular, with a connate in a corolla with cylindrical deflexed tip. Carpels 3, connate in a 3 tube; lobes lanceolate, the upper celled ovary; ovules numerous, on concave. Stamens 1 perfect; filaments axial placentas; style filiform; stigma 2 short; anther 2-celled; cells contagious, -lipped, the lobes ciliate. Fruits are with a narrow crest as long as tardily dehiscent, globose, themselves; lateral staminodes absent, membranous, 8 valved capsule. Seeds or adnate to the ovate-cuneate lip. are ovoid or oblong, usually arillate Carpels 3, connate in a 3 celled ovary; (Hooker, 1875; Prain, 1903; Datta, ovules many, superposed; placentas 1988; Joy et al., 1998 ). axial; style filiform; stigma small, subglobose. Fruit a long capsule, Kaempferia galanga L. is a stemless dehiscent. Seeds large, globose, arillate herb; rootstock often tuberous; leaves (Hooker, 1875; Prain, 1903; Datta, few, 3-6 inches long, spreading flat on 1988; Joy et al., 1998 ). the ground. Flowers spiked, or radial scapes or at the apex of the leafy stem. Curcuma longa L. is a stemless herb Sepals 3, conate in a short, cylindrical with tuberous rootstocks, bearing

REVIEW OF LITERATURE 14 calyx, which splits spathaceously. al., 1972; Akhila and Tewari, 1984; Petals 3, conate in a corolla with a Joy et al., 1998). It is also rich in long, slender tube; lobes equal, usually secondary metabolites such as spreading. Stamens 1 perfect; oleoresin (Bhagyalakshmi and Singh, filaments short, arcuate; anthers 3 1988). celled; cells discrete, on a wide Ginger owes its characteristic connective, produced above as a organoleptic properties to gingerols. petaloid crest, not spurred below; The odour and much of the flavour of lateral staminodes broad, petaloid; lip ginger is determined by the broad, usually 2-fid. Carpels 3, connate constituents of its steam volatile oil, in a three celled ovary; ovules many, while the pungency is comprised on three axial placentas; style long, mainly of mono and sesquiterpene filiform; stigma turbinate. Fruit an hydrocarbons and oxygenated oblong capsule with thin pericarp. compounds. The monoterpene Seeds are subglobose, with a small and constituents, though present in trace lacerate arillus (Hooker, 1875; Prain, amounts, contribute most of the aroma 1903; Datta, 1988; Joy et al., 1998 ). of a ginger (Bertram and Walbaum, 2.8 Chemical constituents and their 1894; Soden and Rojahn, 1900; activities Schimmel and Co., 1905; Dodge,

The chemistry of Zingiber officinale 1912; Brooks, 1916; Jain et al., 1962; has been the subject of sporadic study Nigam et al., 1964; Kami et al., 1972; since the early nineteenth century. Bednarczyk and Kramer, 1975; Fresh ginger contains approximately Denniff and Whitting, 1976; Thresh, water 80%, protein 2.3%, fat 1%, 1879; Joy et al., 1998). The carbohydrate 12.3%, fibre 2.4% and sesquiterpene hydrocarbons constitute ash 1-2%. Dried ginger contains about the major fraction of the essential oil, 10% moisture and 1-3% of volatile oil out of which β- Zingiberene and ar- of which the chief constituent is a curcumene are found in high sesquiterpene, called zingiberene percentages, about 35-40% and 15- 20% respectively. Cis-sesquithujene (C15H24). The pungent principle of hydrate and Zingiberenol are the two ginger is zingerone (C11H14O3) which is present in the oleoresin. hydrated sesquiterpenes reported (Krishnamurthy et al., 1970; Kami et (Terhune et al., 1975 and Pagutte and

REVIEW OF LITERATURE 15

Kinney, 1982). Several investigations constituents of the rhizomes. A number have been carried out on the non- of sesquiterpenes have been reported volatile pungent principles of ginger. f r o m C . l o n g a , viz., the The major pungent compounds sesquiterpenoids of germacrane, reported are gingerols, shagaols, bisabolane and guainane skeletons dihydrogingerols, hexahydrocurcumin, (Husain et al., 1992). The study of gingerdiols, sesquiterpenes has revealed a new desmethylhexahydrocurcumin, (n)- compound curlone (Kisoy and Hikini, paradol, zingerone and ginger diones 1983). The crystalline colouring matter (Lapworth et al., 1917; Nelson, 1917; curcumin (0. 6%) is diferuloyl methane Nomura, 1918; Nomura and Tsurani, (Mathews et al., 1980). Stigmasterol, 1927; Connell and Sutherland, 1969; cholestrol, β-sitosterol and fatty acids, Connell, 1970; Lapworth and Wykes, mainly straight chain dienoic acids are 1970; Connell and Mclachlan, 1972; reported (Moon et al., 1976). The Yamagishi et al., 1972; Masada et al., essential oil (5.8%) obtained by steam 1973; Denniff and Whitting, 1976; distillation of dry rhizomes have been Macleod and Whiting, 1979; Denniff reported to contain β-phellandrene, d- et al., 1980). Main constituent of sabinene, cineole, borneol, Zingiberene essential oil is d-camphene (Husain et and sesquiterpene ketones (50%). In al., 1992). the analysis of the essential oil,

Curcuma longa contains curcumin, turmerone (29.3%), ar-turmerine alkaloid and an essential oil. Curcuma (23.6%) and sabinone (0.6%) have longa rhizome has 1.8-5.4% curcumin, been identified (Lawrence, 1982). the pigment and 2.5-7.2% of essential The tuberous rhizome of Kaempferia oil (Joy et al., 1998). A ketone and an galanga contains an alkaloid, starch, alcohol are obtained from the volatile gum, fatty matter with a fragrant liquid distillate. Fresh rhizomes yield 0.24% essential oil and a solid white oil containing Zingiberine (Chopra, crystalline substance and mineral 1980). Essential oil of Curcuma matter. The rhizome possesses a contains ar-turmerone, and ar- camphoraceous odour with somewhat curcumene as major constituents. bitter aromatic taste (Joy et al., 1998). Curcumin and related compounds have The essential oil is reported to contain also been reported as major over 54 components of which the

REVIEW OF LITERATURE 16 major constituents are ethyl-trans-p- preserved and dried ginger. Fresh or methoxy, cinnamate 16.5%, green ginger is consumed as a pentadecane 9%, 1,8-cineole 5.7%, and vegetable. Immature ginger preserved borneol 2.7%. Terpenoid constituents in sugar syrup is mainly used as a amounted to 16.4% (Nerle and Torne, desert. Crystallized ginger is used as a 1984; Wong et al., 1992). Isolation of sweet meat. The dried rhizomes diterpenes from Kaempferia species constitute the spice and are esteemed was done by Parwat et al. (1993). The for its flavour, pungency and aroma. It chemistry of Kaempferia was studied is a constituent of curry powder. It is in detail by Tuntiwachwuttikul (1991). also used in the production of ginger Rhizome yields essential oil, which has beer, ginger oil and ginger wine. antifungal activity. Ethyl-p-Methyl O- Pressed ginger is prepared by boiling trans-cinnamate is the main compound tender fleshy peeled rhizomes after in root (Asolkar, 1992). p - which they are boiled and sold in sugar Methoxycinnamic acid and its methyl syrup. Crystallized ginger is produced and ethyl esters have been isolated in the same way, but it is dried and from the essential oil (Rastogi and dusted with sugar. The rhizome yields Mehrotra, 1991) Essential oil from an essential oil, but this lacks the rhizomes contain n-pentadecane, ethyl- pungent principle. It is used in the p - methoxy cinnamate, ethyl manufacture of flavouring essences cinnamate, carene, camphene, borneol, and in perfumery. An oleoresin is also p-methoxystyrene, p -methox y extracted in which the full pungency of cinnamate, p-methoxy-trans-cinnamic the spice is preserved. It is used for acid and cinnamaldehyde. Tuber is flavouring purposes and in medicines. stimulant, expectorant, diuretic and It is estimated that in India, the average carminative (Husain et al., 1992). daily consumption is 8 -10 grams of

2.9 Economic importance and health fresh ginger root (Joy et al., 1998) benefits Ginger is used extensively in

Zingiber officinale is used worldwide ‗Ayurveda‘, the traditional medicine of as a cooking spice, condiment and India, to block excessive clotting, herbal remedy (Duke and Ayensu, reduce cholesterol and fight arthritis. 1985). There are 3 primary products of The Chinese have used ginger for at the ginger rhizomes, namely fresh, least 2500 years as a digestive aid and

REVIEW OF LITERATURE 17 antinausea remedy and to treat as an anti-spasmodic and to promote bleeding disorders and rheumatism; it warming in case of chills (Kapil et al., was also used to treat baldness, 1990). Ginger is valued in medicine as toothache, snakebite, and respiratory a carminative (Kumar et al., 1997) and conditions (Duke and Ayensu, 1985). stimulant of the gastro-intestinal tract In Traditional Chinese Medicine, (Kumar et al., 1997) gastrointestinal ginger is considered a pungent, dry, disorders, piles, bronchitis, antipyrexia warming, yang herb to be used for and treatment of waist pain and ailments triggered by cold, damp rheumatism. It promotes digestive weather. In Malaysia and Indonesia, power, cleanses the throat and tongue, ginger soup is given to new mothers dispels cardiac disorders and cures for 30 days after their delivery to help vomiting, ascites, cough, dyspnoea, warm them and to help them sweat out anorexia, fever, anaemia, flatulence, impurities. In Arabian medicine, colic, constipation, swelling, ginger is considered an aphrodisiac elephantiasis and dysuria. It is also (Qureshi et al., 1989). Some Africans used in diarrhoea, cholera, dyspepsia, believe that eating ginger regularly neurological diseases, diabetes, eye will help repel mosquitoes (Duke and diseases and tympanitis. In traditional Ayensu, 1985). The Greeks wrapped medicine ardraka is extensively used ginger in bread and ate it after meals as for its specific action in rheumatism a digestive aid. Subsequently, ginger and inflammation of liver (Kurup et was incorporated directly into bread al., 1979). and confections such as gingerbread. It is also used in several domestic Ginger was so valued by the Spanish preparations (Warrier et al., 1996) It is that they established ginger plantations used as a household remedy for in Jamaica in the 1600‘s. The indigestion, flatulence, dypepsia, sore physicians of the 19th century relied throat, etc. by adding it to tea. Ginger on ginger to induce sweating, improve with kernal of castor seed is used in the appetite and curb nausea, and as a paralysis and with asafoetida in topical counterirritant. Nowadays, indigestion. In chronic rheumatism, ginger is extensively cultivated from infusion of ginger taken warm just Asia to Africa and the Caribbean and before going to bed, the body being is used worldwide as a nausea remedy, covered with blankets so as to produce

REVIEW OF LITERATURE 18 copious perspiration is often attended cephalalgia, asthma, cough, colic, with the best results. The same diarrhoea, flatulence, anorexia, treatment has also been found dyspepsia, cardiopathy, beneficial in colds or catarrhal attacks pharyngopathy, cholera, nausea, and during the cold stage of vomiting, elephantiasis and intermittent fever. In headache, ginger inflammations. It has protective paste applied to the forehead affords activity on gastric ulcerogenesis. relief. Tooth-ache and face-ache are Organic solvent extract of ginger relieved by the same application. In the rhizomes has also been shown to cause collapse stage of cholera powdered significant inhibition of skin tumour ginger rubbed to the extremities is (Katiyar et al., 1996). found to check the cold perspiration, The essential oil exhibited remarkable improve the local circulation and so repellent activity against both the tends to relieve the agonising cramps kitchen insect Periplaneta americana of that terrible disease. Ginger with and the agricultural pest Bruchas salt taken before meals is praised as a pisorum (Garg and Jain, 1991). carminative, said to clean the tongue Curcuma longa occupies an important and throat, increase the appetite and position in the life of Indian people as produce an agreeable sensation it forms an integral part of the rituals, (Nadkarni, 1998). Ginger juice ceremonies and cuisine. Due to the produces antimotion sickness action by strong antiseptic properties, turmeric central and peripheral anticholinergic has been used as a remedy for all kinds antihistaminic effects (Qian and Liu, of poisonous affections, ulcers and 1992). wounds. It gives good complexion to Clinical studies made by Singhal and the skin and so it is applied to face as a Joshi (1983) and Girij et al., (1984) depilatory and facial tonic. The drug prove that Zingiber officinale reduces cures diseases due to diabetes, eye the serum cholesterol level diseases, ulcers, oedema, anaemia, considerably in hypercholesterolemic anorexia, leprosy and scrofula. It rats. The raw ginger is useful in purifies blood by destroying the anorexia, vitiated conditions dypepsia, pathogenic organisms. A paste of pharyngopathy and inflammations. The turmeric alone, or combined with a dry ginger is useful in dropsy, otalgia, paste of neem (Azadirachta indica)

REVIEW OF LITERATURE 19 leaves, is used to cure ringworm, The fresh rhizome and dried powder obstinate itching, eczema and other are popular remedies for disorders of parasitic skin diseases, and in chicken blood and various skin diseases. It is pox and small pox. The drug is also also externally used for pains and for useful in cold, cough, bronchitis, beautification by fairness. The rhizome conjunctivitis and liver affections juice is used as an anthelmintic as well (Nadkarni, 1954; Kurup et al., 1979; as in asthma and urinary diseases. The Kolammal, 1979). Turmeric paste essential oil of the plant is used as mixed with a little limejuice and antacid, carminative, stomachic and saltpetre and applied hot is a popular tonic (Ghani, 1998; Kirtikar, 1996). application to sprains and bruises. In Curcumin is antiinflammatory. smallpox and chickenpox, a coating of Rhizome is antiprotozoal, spasmolytic, turmeric is applied to facilitate the CNS active, antiparasitic, process of scabbing. The smoke antispasmodic, antibacterial, produced by sprinkling powdered antiarthritic (Husain et al., 1992). The turmeric over burnt charcoal will rhizomes are also anthelmintic, relieve scorpion sting when the part carminative, antiperiodic, emollient, affected is exposed to the smoke for a anodyne, laxative, diruretic, few minutes. Turmeric and alum expectorant, alterative, alexertive, powder in the proportion of 1:20 is febrifuge, opthalmic and tonic blown into the ear in chronic otorrhoea (Warrier et al., 1994). An extract of the (Nadkarni, 1998). ―Haridra Khand‖, a crude drug ‗akon’ containing the compound containing powdered rhizomes exhibited intensive turmeric, sugar and many other preventive activity against carbon ingredients is a well -known tetrachloride induced liver injury in preparation for cold, cough and flu, vivo and in vitro. The liver protecting and for skin diseases (Joy et al., 1998). effects of some analogs of ferulic acid In Ayurveda, turmeric has been used and p-coumaric acid, probable for various medicinal conditions metabolites of the curcuminoids have including rhinitis, wound healing, been also evaluated (Kiso et al., 1983). common cold, skin infections, liver Essential oil from rhizomes is and urinary tract diseases and as a antiseptic, antacid and carminative. ‗blood purifier‘ (Chainani et al., 2003). Effect of the oil on cardiovascular and

REVIEW OF LITERATURE 20 respiratory systems is not marked, contains a volatile oil (Wong et al., therefore, not of much importance 1992) and several alkaloids, starch, from therapeutic point of view. proteins, amino acids, minerals and Chloretic action of the essential oil is fatty matters. Leaves and flowers attributed to p-tolymethyl carbinol. contain flavonoids (Ghani, 1998). The Dye-stuff acts as a cholagogue causing rhizome extract of Kaempferia contraction of the gall bladder. An galanga are used as expectorant, antioxidant property of curcuma stimulant, diuretic, carminative, and powder is due to phenolic character of stomachic (Rahman et al., 2004 and curcumin (Dey, 1980). Kumar et al., 1997). The extract is also

Protective effect of curcuminoids from used to cure nasal block, asthma and C. longa on epidermal skin cells under hypertension. The leaf extracts are free oxygen stress was analysed by applied to sore eyes, sore throat, Bonte et al. (1997). Anti-inflammatory rheumatism, swellings and fevers. activity volatile oil of C. longa leaves The aroma and flavour of the plant is was studied by Iyengar et al. (1994). used in flavouring foodstuffs, Essential oil (0.1 mg/kg) in rats beverages, perfumes and cosmetics showed significantly more marked industries (Rahman et al., 2004). The antiinflammatory effect than cortisone Kaempferia oil is utilized in the acetate (10mg/kg). The uptake, manufacture of perfumes and in curry distribution and excretion of curcumin flavouring. It is also employed in were also studied. Clinical trials cosmetics, mouth- washes, hair tonics showed that plant definitely reduced and toiletries. The pungent, hot, sharp, cough and dyspnoea (Rastogi and bitter and aromatic rhizomes find an Mehrotra, 1991). important place in indigenous

Rhizomes are externally effective as medicine as stimulant, expectorant, insect repellent against houseflies. It is diuretic and carminative. It promotes found to inhibit Clostridium digestion and cures skin diseases, botulinum. Essential oil from rhizome piles, phantom tumors, coughs, showed fungitoxicity (Asolkar et al., oedema, fever, epilepsy, splenic 1992) and nematicidal activity (Kinchi disorders, wounds, asthma and et al., 1993). rheumatism. The rhizomes are used for protecting clothes against insects and Kaempferia galanga L. rhizome

REVIEW OF LITERATURE 21 are eaten along with betel and areca- has been potently active against nut. The rhizomes and leaves are bacterial infections. Indigenous attached to necklaces and added to medical practitioner use these bath water for perfume. The plant is a rhizomes for treatment of scariasis, reputed remedy for all respiratory bacterial infections, tumor and it is ailments like cough, bronchitis and also applied externally for abdominal asthma. The drug is reported to be pain in women and used topically for acrid, hot, bitter and aromatic. It cures treatment of rheumatism (Hirschhornn, skin diseases, wounds and splenic 1983). In Thailand, the dried rhizome disorders. It promotes digestion, has been used as cardiotonic and removes bad odour of the mouth and central nervous system stimulant destroys pathogenic organisms (Aiyer (Mokkhasmit et al., 1971), whereas an and Kolammal, 1964). The rhizomes acetone extract has an effect on and root-stocks are good for dyspepsia, monoamine oxidase inhibition (Noro et leprosy, skin diseases, rheumatism, al., 1983). The 95% ethanol extract of asthma, cough, bronchitis, ulcers, this plant possessed antibacterial helminthiasis, fever, malarial fever, activity against Staphylococcus aureus splenopathy, cephalalgia, and hot water extract against inflammatory tumour, nasal Escherichia coli (George and Pandalai, obstruction, halitosis, strangury, 1949). The rhizome of K. galanga has urolithiasis, and haemorrhoids. The been used for treatment of fungal leaves are used for pharyngodynia, derived-skin diseases as well as ophthalmia, swellings, fever and eczema (Tungtrongjit, 1978). rheumatism (Warrier et al., 1995). The The volatile oil of Kaempferia galanga tubers reduced to powder and mixed exhibited marked activity against with honey are given in case of coughs Gram-positive and Gram negative and pectoral infections. The oil in bacteria; and also against Candida. which they are boiled is useful in albicans, by using agar disc diffusion applying to open the blockages of the method The result revealed that the oil nasal organs (Nadkarni, 1998). Tuber of this plant possessed marked is stimulant, expectorant, diuretic and antimicrobial activity against Gram- carminative (Husain et al., 1992). positive bacteria with the inhibition Kaempferia galanga rhizome extract zones from 12.0-16.0 mm., and 8.0-

REVIEW OF LITERATURE 22

12.0 mm. against Gram-negative occupies the key position. bacteria; whereas it potently inhibited Micropropagation is the process of Candida albicans with an inhibition mass propagation of selected clones zone of 31.0 mm., which was stronger v i a i n v i t r o t e c h n i q u e s . than that of standard antifungal Micropropagation has major Clotrimazole. It is suggested that the supporting role in biotechnology for:- essential oil of this plant may be useful (i) rapid multiplication of rare, exotic for treatment of the diseases caused by and genetically engineered plants, these bacteria and fungi, such as skin (ii) large scale production of superior diseases and diarrhea. The volatile oil propagules and, of Kaempferia galanga especially ethyl-p-methoxycinnamate, could be (iii) conservation of economically used as a biomarker for standardization important ornamental, horticulture of this plant and the results of spp., plantation crops and medicinal bioactivities suggest that the essential plants. oil of Kaempferia. galanga could be Micropropagation is of great used for treatment of some microbial importance to overcome the constraints infections, which also agrees with the like shortage of seed supply, traditional use of this plant in treatment germination problems, long of both fungal and bacterial skin regeneration time, variation due to diseases (Tungtrongjit, 1978). cross pollination etc.

Moreover, Kaempferia. galanga The beginning of research in this area should also be subjected to more can be traced back to the German elaborated bioassay for specific botanist Gottlieb Haberlandt in 1902, pharmacological activities. who worked in Berlin. He conducted Kaempferia galanga even contains the first experiments with isolated insecticidal constituents which were plant cells. As little was known at that isolated by Pandji et al. (1993). time about the nutritional biochemistry

2.10 In vitro culture studies of the hormones essential for growth and differentiation, he could not go Tissue culture is the foundation on very far. Nevertheless, an important which virtually all plant-related concept that a cell is totipotent biotechnology experiments rest. In emerged from his work. Roger plant tissue culture, micropropagation

REVIEW OF LITERATURE 23

Gautheret (1934) in France laid the led to development of shoots and a low foundation of tissue culture studies by ratio to rooting. By the 1960s, a fairly raising indefinitely growing callus good understanding had been gained of from explants of cambium taken from the role of hormones in differentiation, the stem of trees. Paul Nobecuort although coconut milk, whose (1937), also from France, contributed importance had been discovered by significantly to the development of the Van Overbeek and co-workers (1941), tissue culture techniques. In the United also remained a popular constituent of States, Philip White (1934) established media in many investigations, and is so continuing cultures of roots and later even today (Maheshwari, 1996). also from crown galls (Braun and With hormones and coconut milk in White, 1943) and played a key role in the arsenal, work for in vitro culture of development of plant tissue culture plant tissues and their differentiation research (Maheshwari, 1996). was initiated in many laboratories in The key to further progress in tissue the 1950s and 1960s. H E Street in the culture depended on the discovery of United Kingdom, Georges Morel in hormones. Until about 1930, botanists France, Jacob Reinert in Germany, and knew little about hormones. The Frederick Steward in the United States knowledge of auxins representing the led active research groups. Street first major class of plant growth (1957) made key contributions in substances followed soon after the successful culture of excised roots in pioneering work of Frits Went (1926) vitro. Morel (1963 and 1971) made and Kenneth Thimann (1935) and pioneering contributions to the crown- greatly aided the work of the early gall problem as also to the culture of investigators. Later, in the 1950s the monocots and orchids. However, the work of Folke Skoog and co-workers most important studies- concluding the (Miller et al., 1955) led to the first phase of plant biotechnology-were discovery of cytokinins, another made by Steward and Reinert who important class of hormones. A demonstrated totipotency of plant reproducible control on differentiation cells. Using small discs of carrot root from calli through an adjustment of as explants for raising cell suspensions, auxins and cytokinin balance was Steward (1958) showed that even achieved: a high cytokinin-auxin ratio somatic cells could form embryos and

REVIEW OF LITERATURE 24 then complete plants. In parallel, from 1960s‘ and that modern plant Reinert (1959) achieved biotechnology is essentially the embryogenesis in vitro. But outcome of the fusion of tissue culture totipotency was demonstrated in a and molecular biology (Maheshwari, most decisive way by Vasil and 1996).

Hildebrandt (1965). Vasil, while she In vitro clonal propagation is a was working with Hildebrandt in the complicated process requiring many United States employing tobacco, they steps and stages. Murashige (1978a, b) showed that an isolated single cell proposed four distinct stages that can could form an entire plant. By the end be adopted for overall production of the 1950s, plant tissue culture was technology of clones in a commercial already established as a major sub- way. Stages I to III are followed under discipline of plant biology, its in vitro conditions, whereas stage IV is importance and ramifications in accomplished in greenhouse agriculture, horticulture, and on environment. Debergh and Maene, forestry being far too evident for 1981 suggested an additional stage O anyone to ignore (Maheshwari, 1996). for various micropropagating systems. The second phase in 1960s witnessed The major steps for in vitro clonal the development of two special propagation are as follows:- techniques in tissue culture: one Stage O Selection and maintenance of stock plants for relating to production of haploids by culture initiation anther culture and other concerning ↓ Stage I isolation and culture of protoplasts. Initiation and establishment of aseptic culture Guha and Maheshwari (1966) (explants isolation, surface sterilization, washing and establishment on appropriate culture decisively demonstrated the haploid medium) nature of embryos from anther and ↓ Stage II their origin from microspores. The Multiplication of shoots or rapid somatic em- third phase was of studies on genetic bryo formation using a defined culture medium ↓ engineering and the rise of new Stage III biotechnology. The early practitioners Germination of somatic embryos and/or rooting of regenerated shoots in vitro of molecular biology were ↓ microbiologists or biochemists. Stage IV Serious plant molecular biology started Transfer of plantlets to sterilized soil for hardening under green house environment

REVIEW OF LITERATURE 25

The adoption of all these stages not particularly useful stocks is a slow only simplifies the daily operation, process. An in vitro propagation accounting and product cost but also method can alleviate these problems allows for greater ease in (Ma and Gang, 2006). Villamor (2010) communication with other laboratories indicated that lack of healthy planting (Chu and Kurtz, 1990). Thus a materials limit expansion of ginger particular plant can be marketed or production which can be rectified by requested by specifying its stage. the production of healthy planting

2.10.1 Importance of in vitro stock by tissue culture. In Curcuma regeneration longa slow multiplication rate, high susceptibility to rhizome rot and leaf In zingiberaceae plant breeding is spot disease and restricted availability seriously handicapped by poor of elite genotype has necessitated flowering and seed set. So, most crop application of tissue culture technique improvement programs are confined to to alleviate the problems (Singh et al., the conventional methods like 2011). evaluation and selection of naturally occurring variations. In vitro culture 2.10.2 Establishment of culture offers a method for producing The objective of tissue culture is to variations and exploring the resultant successfully place an explant into variations for crop improvement. It aseptic culture by avoiding provides an alternative means of plant contamination and then to provide an propagation and a tool for crop In vitro environments that promotes improvement (Rahman et al., 2004). stable shoot production. The important Moreover overexploitation of aspects of this are explant disinfection, zingiberous crops are making them explant selection and culture medium endangered. In vitro regenerated plants (Hartmann et al., 1997). The success are superior to conventionally of establishment of explant in the propagated plants in respect of culture media is dependent on explant productivity and disease resistance. In selection, sterilization of explant, sterile triploid plants like Curcuma culture conditions, and composition of longa transmission of pathogens from the culture media. generation to generation takes place by The use of tissue culture as a tool for rhizome, and amplification of plant propagation could be particularly

REVIEW OF LITERATURE 26 relevant for vegetatively propagated Choi, 1991; Choi and Kim, 1991; crop plants that resist conventional Khatun et al., 2003; Lincy et al., 2009, asexual propagation (Hackett, 1966) or Sultana et al., 2009), leaf tissue when fast methods of mass (Nirmal Babu et al., 1992, Kackar et propagation of single plant is required. al., 1993; Sultana et al., 2009), The different explants such as axillary immature inflorescence (Nirmal Babu bud, shoot tips, meristem tips, root tips et al., 1992)), ovary (Nirmal Babu et are commonly used. al.,1996) and anther (Samsudeen et al.,

In tissue culture of the members of 2000). Callus produced from the base Zingiberaceae different plant parts like or middle of pseudostem showed better emerging rhizome buds, rhizome responses to differentiation of plantlets pieces, axillary bud, shoot tip, than the callus produced from top or pseudostem, leaves, inflorescence, bottom of the pseudostem (Choi, ovary, anther parts etc are used (table 1991). 2.2). In regeneration of Zingiber Curcuma plantlets were regenerated by officinale, Curcuma longa and using shoot bud (Yasuda et al., 1988; Kaempheria galanga shoot bud/ Kesavachandran and Khader, 1989; rhizome buds were the most Winnar and Winnar, 1 9 8 9 ; extensively used explants. The Balachandran et al., 1990; Shirgurkar, regeneration potential of this part is 2001; Sunitibala et al., 2001; Salvi, et maximum which has made it popular al., 2002; Zapata et al., 2003; Nayak, as explants. Zingiber plantlets were 2004; Rahaman et al., 2004; Gayatri regenerated by using shoot bud and Kavyashree, 2005; Prathanturarug (Hosoki and Sagawa, 1997, Rout and et al., 2003; Tyagi et al., 2007; Naz et Das, 1998, Sit et al., 2005, al., 2009; Behera et al., 2010), Bhattacharya and Sen, 2006 and dormant axillary buds of unsprouted Behera and Sahoo, 2009), dormant rhizomes (Singh et al., 2011), shoot axillary buds of unsprouted rhizomes meristem (Sunitibala et al., 2001; (Mohanty et al., 2008), juvenile shoots Nayak and Naik, 2006), leaf tissue (Ilahi and Jabeen, 1987), leaf (Salvi et al., 2001), Ovary (Nirmal pseudostem (Ikeda and Tanaba, 1989), Babu et al., 1996) and anther shoot tips/meristem (Bhagyalakshmi (Samsudeen et al., 2000). and Singh, 1988; Inden et al., 1988; Kaempheria plantlets were regenerated

REVIEW OF LITERATURE 27 by using shoot bud (Geetha et al., materials should not lose their 1997; Shirin et al., 2000; Lakshmi and biological activity, but only bacterial Mythili, 2003; Swapna et al., 2004; or fungal contaminants should be Chirangini et al., 2005; Rahaman et eliminated. The commonly used al., 2005; Parida et al., 2010; sterilants are bleach, ethanol, sodium Kochuthressia et al., 2012; hypochlorite, mercuric chloride etc. Bhattacharya and Sen, 2013) and leaf The type of sterilant used, tissue (Swapna et al., 2004; Rahaman concentration and time depends on the et al., 2004). nature of explant and species (Razdan,

In the process of sterilization living 1993).

Table 2.2: Explants used for in vitro regeneration of Zingiber officinale, Curcuma longa and Kaempferia galanga Plant parts Reference Zingiber officinale Hosoki and Sagawa, 1977; PIllai and Kumar, 1982; Malamug et al., 1991; Dogra et al., 1994; Sharma et al., 1997; Rout and Shoot bud/rhizome bud Das, 1998; Sit et al., 2005; Bhattacharya and Sen, 2006 and Behera and Sahoo, 2009 Dormant axillary buds of un- Mohanty et al., 2008 sprouted rhizomes Juvenile shoots Ilahi and Jabeen, 1987 Leaf pseudostem Ikeda and Tanaba, 1989 Bhagyalakshmi and Singh, 1988; Inden et al., 1988; Choi, Shoot tips/meristem 1991; Choi and Kim, 1991; Khatun et al., 2003; Lincy et al., 2009 and Sultana et al., 2009 Nirmal Babu et al., 1992; Kackar et al., 1993 and Sultana et Leaf tissue al., 2009 Immature inflorescence Nirmal Babu et al.,1992 Ovary Nirmal Babu et al.,1996 Anther Samsudeen et al., 2000 Curcuma longa Shetty et al., 1982; Yasuda et al., 1988; Keshavachadra and Khader, 1989; Winnar and Winnar, 1989; Balachandran et al., 1990; Sunitibala et al., 2001; Salvi et al., 2002; Zapata et Shoot bud/rhizome bud al., 2003; Nayak, 2004; Rahaman et al., 2004; Gayatri and Kavyashree, 2005; Prathanturarug et al., 2005; Tyagi et al., 2007; Naz et al., 2009 and Behera et al., 2010 Dormant axillary buds of un- Singh et al., 2011 sprouted rhizomes Shoot tips/meristem Nayak and Naik, 2006, Sunitibala et al., 2001 Leaf tissue Salvi et al., 2001 Immature inflorescence Salvi, 2000 Ovary Nirmal Babu et al.,1996 Anther Samsudeen et al., 2000 Kaempheria galanga Geetha et al., 1997; Shirin et al., 2000; Lakshmi and Mythili, 2003; Swapna et al., 2004 and Chirangini et al., 2005, Raha- Shoot bud/rhizome bud man et al., 2005, Kochuthressia et al., 2012 and Bhattacharya and Sen, 2013 Leaf tissue Swapna et al., 2004 and Rahaman et al., 2004

REVIEW OF LITERATURE 28

Various disinfecting chemicals like electrochemical potential of the plant. commercial bleach, 70% ethyl alcohol The nutrient requirements for the and mercuric chloride were used singly growth of different plants are not the or in combinations in the culture of same. Even, it differs for the different Zingibers. In all the cases the explants organs of a same plant. Therefore, a were thoroughly washed under running single media is not suitable for tap water and were trimmed. The buds optimum growth of all plant tissues. were soaked in commercial bleach To overcome this, different nutrient solution for few minutes. Followed by solutions were proposed by different sterilization in Mercuric chloride workers from time to time. (0.1% - 0.2%) for 2 - 10 minutes. The Consequently the most suitable sterilant and time required for the medium for a particular tissue must be regeneration of the members of determined by trial and error. Zingiberaceae depend on the genera In the regeneration of the members of and species. Zingiberacee, Murashige and Skoog‘s 2.10.3 Media and culture conditions (1962) medium was used extensively Successful growth and differentiation with a few exceptions (table 2.3). In of excised plant tissues and organs are regeneration of Zingiber ocfficinale possible if they are supplied with Murashige and Skoog medium nutrients required by it. An artificially (Hosoki and Sagawa, 1977; Ilahi and prepared nutrient medium is called Jabeen, 1987; Bhagyalakshmi and culture medium which is a is a mixture Singh, 1988; Inden et al., 1988; Ikeda of several components like inorganic and Tanaba,1989; Choi and Kim, salts, vitamins, aminoacids, sugars, 1991; Nirmal Babu et al., 1992; growth regulators and solidifying Kackar et al., 1993; Dogra et al., 1994; agents if required. The minerals Sharma et al., 1995; Nirmal Babu et present in the plant tissue culture al., 1996; Sharma et al., 1997; Rout medium are used by the plant cell as and Das, 1998; Samsudeen et al., building blocks for the synthesis of 2000; Khatun et al., 2003; Sit et al., organic molecules or as catalysts. The 2005; Bhattacharya and Sen, 2006; ions of different salts play an important Mohanty et al., 2008; Lincy et al., role in transportation or osmotic 2009; Sultana et al., 2009; Behera and regulation ad in maintaining the Sahoo, 2009; Villamor, 2010), Schenk

REVIEW OF LITERATURE 29 and Hildebrandt (PIllai and Kumar, 2005) were used.

1982), Gamborg (Bhattacharya and In regeneration of Kaempheria, Sen, 2006) and MS major elements, Murashige and skoog medium (Geetha Ringe and Nitsch minor elements et al., 1997; Shirin et al., 2000; (Choi, 1991 and Malamug et al., Lakshmi and Mythili, 2003; Swapna et 1991). Villamor, 2010, studied the al., 2004; Rahaman et al., 2004; effects of MS media strength and Chirangini et al., 2005; Rahaman et sources of nitrogen on shoot and root al., 2005; Kochuthressia et al., 2012; growth Native variety of ginger. The Bhattacharya and Sen, 2013) were results indicated that nitrogen in the used. Shirin et al. (2000), achieved in form of KNO3 significantly improved vitro plantlet production on 0.75 X MS proliferation rate of ginger in vitro, in medium. both full and half strength media. Leaf In the cultures of the members of growth was better in media devoid of Zingiberaceae pH of 5.8 were NH4 NO3 . Root formation was generally maitained in almost all of the significantly better in media without cultures. Rout and Das (1998), in their NH4NO3. experiment to assess the optimum pH For regeneration of Curcuma, found that shoot bud regeneration of Murashige and Skoog medium (Shetty ginger was highest at pH 5.7 - 5.8 and et al., 1982; Yasuda et al., 1988; under 24 hour illumination. Keshavachadra and Khader, 1989; Sugar as a carbon source is mainly Winnar and Winnar, 1 9 8 9 ; supplied in the form of sucrose. Balachandran et al., 1990; Nirmal Sucrose was added at a cocentration of Babu et al.,1996; Salvi, 2000; 3% (w/v) in most of the experiments Samsudeen et al., 2000; Sunitibala et with Zingiberous members al., Shirgurkar et al., 2001; Salvi et al., (Bhattacharya et al., 2014). In 2001; Salvi, et al., 2002; Zapata et al., regeneration of Zingiber officinale 2% 2003; Islam et al., 2004; Nayak, 2004, sucrose (Choi, 1991), 1% to 4% Rahaman et al., 2004; Prathanturarug (Bhattacharya and Sen, 2006) were et al., 2005; Nayak and Naik, 2006; used. Bhattacharya and Sen (2006) Tyagi et al., 2007; Naz et al., 2009; found that 3% sucrose was best for the Behera et al., 2010; Singh et al., 2011) regeneration of Zingiber officinale. In and LSBM (Gayatri and Kavyashree, Curcuma longa Salvi et al. (2002)

REVIEW OF LITERATURE 30 tested different carbohydrates like 10% Sucrose were used in the medium sucrose, fructose, glucose, sugar cubes, for induction of callus and shoots maltose, levulose, market sugar, regeneration of Mantisia wengeri xylose, rhamnose, lactose and soluble respectively (Bhoumick et al., 2010). starch. They found xylose, rhamnose, 3% - 7% sucrose and 5% sucrose was lactose and soluble starch were used for breaking dormancy of the inhibitory in producing shoots. Tyagi axilary buds and subculture et al. (2007) replaced laboratory respectively in the culture of Costus reagent-grade sucrose by locally speciosus (Punyarani and Sharma, available commercial sugar (market 2010). sugar or sugar cubes) as carbon source The media was solidified with 0.7 to and observed no adverse effects on 0.8% (w/v) agar in almost all the shoot regeneration. In regeneration of cultures of zingiberous plants with a related genera of the family, 3% and few exceptions. In regeneration of

Table 2.3: Media used for in vitro regeneration of Zingiber officinale, Curcuma longa and Kaempferia galanga Media Reference Zingiber officinale Hosoki and Sagawa, 1977; Ilahi and Jabeen,1987; Bhagyalakshmi and Singh, 1988; Inden et al., 1988; Ikeda and Tanaba, 1989; Choi and Kim, 1991; Nirmal Babu et al., 1992; Nirmal Babu et al., 1992; Kackar et al., 1993; Dogra et al., 1994; Sharma et al., 1995; Murashige and skoog (1962) Nirmal Babu et al., 1996; Sharma et al., 1997; Rout and Das, 1998; Samsudeen et al., 2000; Khatun et al., 2003; Sit et al,. 2005; Bhattacharya and Sen, 2006, Mohanty et al., 2008; Lincy et al., 2009; Sultana et al., 2009; Behera and Sahoo, 2009 and Villamor, 2010 Schenk and Hildebrandt PIllai and Kumar, 1982 Gamborg Bhattacharya and Sen, 2006 MS major elements, Ringe Choi, 1991 and Malamug et al., 1991. and Nitsch minor elements Curcuma longa Shetty et al., 1982; Yasuda et al., 1988; Keshavachadra and Khader 1989; Winnar and Winnar, 1989; Balachandran et al., 1990; Nirmal Babu et al., 1996; Salvi, 2000; Samsudeen et al., 2000; Sunitibala et al., 2001; Shirgurkar et al., 2001; Salvi et al., Murashige and skoog (1962) 2001; Salvi et al., 2002; Zapata et al., 2003; Islam et al., 2004; Nayak, 2004; Rahaman et al., 2004; Prathanturarug et al., 2005; Nayak and Naik, 2006; Tyagi et al., 2007; NAZ et al., 2009; Be- hera et al., 2010 and Singh et al., 2011 LSBM Gayatri and Kavyashree, 2005 Kaempferia longa Geetha et al., 1997; Shirin et al., 2000; Lakshmi and Mythili, 2003; Swapna et al., 2004; Swapna et al., 2004; Rahaman et al., Murashige and skoog (1962) 2004; Chirangini et al., 2005; Rahaman et al., Kochuthressia et al., 2012; Bhattacharya and Sen, 2013

REVIEW OF LITERATURE 31

Zingiber officinale, 0.5% (Khatun et napthaleneacetic acid, 2,4 - al., 2003), while in Curcuma longa dichlorophenoxyacetic acid, picloram 0.4% and 0.6% agar was successfully etc); cytokinins (zeatin, 6-benzylamino used for gelling the media (Salvi et al., purine, kinetin, thidiazuron etc);

2002). Tyagi et al. (2007) replaced gibberellins (GA1, GA3, GA4, GA7 agar by isabgol as gelling agent in etc); abscissic acid; ethylene etc. A list cultures of Curcuma longa. In the of the plant species and the plant cultures of the other members of the growth regulator used for its family, 0.75 % agar was extensively regeneration are provided in table 2.4. used (Bhattacharya et al., 2014). In the regeneration of Zingibers plant

Many researchers prefer to call plant growth regulators like thidiazuron hormones as plant growth substances (TDZ), 6-benzylamino purine (BA/ or plant growth regulators. Plant BAP), kinetin (kn), 1-napthaleneacetic hormones added to plant tissue culture acid (NAA), indole-3-acetic acid media are taken up and increase the (IAA), TRIA, 2,4 - level within the tissue. Most of the dichlorophenoxyacetic acid (2,4-D) etc increase is however, transient because were extensively used. Organic plant hormones are rapidly inactivated additives like coconut water were used after uptake. Usually only very small as a supplement in some media for the amounts of the applied hormones regeneration of the Zingibers. remain the free form. It has been seen Incubation condition is very important that, for auxins, equilibrium exists for micropropagation. High between the free and conjugated form, temperature is likely to lead to of which only less than 1% being dissociation of the culture media and present in the freeform. The effect of tissue damage while very low hormones not only depends on the rate temperature tissue growth is slow. of uptake from the medium, or on the Moreover some tissue grows in dark stability in the medium and in the while other prefers light conditions. tissue, but also on the sensitivity of the The amount of light also has target tissue (Razdan, 1993). substantial effect on the regeneration.

The main plant growth regulators used 2.10.4 Regeneration of plantlets in tissue culture are auxins (indole-3- through callusing acetic acid, indole-3-buturic acid, 1- Callus tissue is an unorganized and

REVIEW OF LITERATURE 32 undifferentiated proliferated mass of In tissue culture of Zingiber officinale, cells produced from isolated plant callusing was achieved by Pillai and cells, tissues or organs when grown Kumar (1982) on Schenk and aseptically on artificial nutrient Hildebrandt liquid medium containing medium in glass vials under controlled different concentrations of hormone experimental conditions. Formation of but the calluses were unable to callus tissue is the outcome of cell proliferate. Later on Ilahi and Jabeen expansion and cell division of the cells (1987) succeeded to regenerate of the explants. plantlets from callus supplementing

Initiation of callus culture is done with various concentrations of 2,4-D and juvenile parts like leaf, stem segment, BA. They were able to produce callus roots etc containing meristematic from juvenile shoots of ginger but tissue. Such tissue has a pre-existing failed to produce callus from stem growth momentum. On implantation, explants on MS medium containing the merstematic tissue absorbs the different concentrations of exogeneously supplied nutrients and bioregulators. Choi (1991) observed growth regulators; divide that both shoots and roots formation asynchronously to form the took place on medium containing unorganized mass of tissue. During the NAA (0.1- 1.0 ppm) and BA (1.0 initial growth phase the cells enlarge or ppm). Shoot tips of ginger cv. Kintoki swell to rupture. This indicates the were used to induce callus on medium response of tissue to the medium for containing MS major elements, Ringe callus formation. Some endogeneous and Nitsch minor elements and organic growth substances oozes out through additives, sucrose (2 %), agar (0.8 %) the injured tissue through the cut end with various concentrations of 2, 4-D and stimulates the cell division along (0.5 mg/l) on combination with BA (1 with the penetration of the mg/l). They found that shoot exogeneously supplied hormone and regeneration also occurred in the same nutrients. The unorganized callus medium but best shoot regeneration tissue gradually increases in size and occurred on media containing BA (5 ultimately the whole part of the mg/l) and NAA (1mg/l). Leaf tissues explants starts to divide (Bhattacharya of ginger cultivar Maran produced et al., 2014). callus on revised MS medium with

REVIEW OF LITERATURE 33

Table 2.4: Plant growth regulators (PGR) used for in vitro regeneration of Zingiber officinale, Cur- cuma longa and Kaempferia galanga PGR and other additives Reference Zingiber officinale Hosoki and Sagawa, 1977, Rout and Das 1998 and Sit BA/BAP et al., 2005 Kn Sharma et al., 1997 NAA Dogra et al., 1994 2,4-D Lincy et al., 2009 BAP/BA and Kn. Khatun et al., 2003 Kn and NAA Sharma et al., 1997 Inden et al., 1998; Ikeda and Tanaba, 1989; Choi and BA/BAP and NAA Kim, 1991; Dogra et al., 1994; Behera and Sahoo, 2009 Ilahi and Jabeen, 1987; Choi, 1991; Nirmal Babu et BA/BAP and 2,4-D al., 1992; Samsudeen et al., 2000 Malamug et al., 1991; Nirmal Babu et al., 1992; 2,4-D, BA/BAP and NAA Nirmal Babu et al., 1996 BA/BAP, Kn and Zn Bhattacharya and Sen, 2006 BA/BAP, IAA, and Adenine sulfate Mohanty et al., 2008 2,4-D, IAA, NAA and Dicamda Kackar et al., 1993. BA/BAP, Calcium pantothenate, GA and 3 Sharma et al., 1995 NAA Dicamba, 2,4-D, Kn, BA/BAP and IBA Sultana et al., 2009 BA/BAP, Coconut milk, AA, Glutamine & Bhagyalakshmi and Singh 1988 Activated charcoal Curcuma longa Nadgauda et al., 1978; Winnar and Winnar, 1989; BA/BAP Prathanturarug et al., 2005; Nayak and Naik, 2006; Tyagi et al., 2007; Singh et al., 2011 2,4-D Samsudeen et al., 2000 Shetty et al., 1982; Nayak, 2004; Keshavachadra and BA/BAP and Kn Khader, 1989, NAA and Kn Yasuda et al., 1988 NAA and BA/BAP Behera et al., 2010 BA/BAP, Kn and Coconut water Shirgurkar et al., 2001 Nirmal Babu et al., 1996; Gayatri and Kavyashree, 2,4-D and BA/BAP 2005; Zapata et al., 2003 BA/BAP and Kn, and NAA Islam et al., 2004 BA/BAP, NAA and TDZ Naz et al., 2009 BA/BAP, 2,4-D, NAA and Kn Sunitibala et. al., 2001 BA/BAP, AA, IBA and IAA Rahaman et al., 2004 BA/BAP, 2,4-D, NAA, TDZ and IAA Salvi, 2000; Dicamba, picloram, NAA, BA/BAP, Kn, Salvi et al., 2001 TIBA and 2-4-D BA/BAP, Kn, kn-riboside, Zn, 6-,- dimethylallylaminopurine, Adenine, Adenine Salvi, 2002 sulfate or Metatopolin and NAA Kaempheria galanga BA/BAP and NAA Shirin et al., 2000 2-4-D and BA/BAP Lakshmi and Mythili, 2003 BA/BAP and Kn Kochuthressia et al., 2012 Kn, NAA and BA/BAP . Geetha et al., 1997 IAA, Kn and BA/BAP Chirangini et al., 2005 BA/BAP, Kn and Zn Bhattacharya and Sen, 2013 IAA, BA/BAP, NAA, 2-4-D and Kn Swapna et al., 2004 NAA, IBA, IAA, BA/BAP and Kn. Rahaman et al., 2005 BA/BAP, IAA, IBA, NAA and adenine sul- Parida et al., 2010 phates

REVIEW OF LITERATURE 34 high concentrations of 2, 4-D (9.0–2.6 concentrations of bio-regulators). µM/l) and plantlet formation occurred Samsudeen et al. (2000), regenerated at considerable low concentrations of ginger from anther derived callus 2, 4-D (0.9 µM/l) in combination with culture of ginger. They collected BA (44.4 µM/l) (Nirmal Babu et al., anthers at the uninucleate microspore 1992). It was interestingly noted that stage and the anthers were subjected to the rate of plant regeneration increased a cold treatment (0º) for 7 days. The when the bioregulators were treated anthers were induced to completely removed from the medium develop profuse callus on MS medium in the subsequent subcultures. Nirmal supplemented with 2-3 mg/l 2,4D. Babu et al. (1996) observed the same Plantlets were regenerated on MS result when they found that the media supplemented with 5-10 mg/l embroyoid formation was more BAP 0.2 mg/l 2,4D. pronounced after the removal of In Curcuma longa tissue culture growth regulators from the culture Yasuda et al. (1988) was able to medium after initial embryogenesis. regenerate shoots from rhizome Development of embryos from the explants on MS medium containing ginger callus cv. Eruttupetta on MS NAA (1 ppm) and kinetin (0.1 ppm). medium was done by Kackar et al. Sufficient number of shoots was (1993). They used various obtained from the callus when media concentrations of auxins like 2, 4-D. was supplemented with NAA (0.1 IAA, NAA and dicamda. They found PPM) or BA (0.3 PPM). Sunitibala et dicamda at 2.7 µM/l was most al. (2001) observed multiplication and effective to produce embryos whereas callus induction starting from the IAA, AA failed to produce embryos. rhizome buds and shoot on MS The embryonic culture produced medium. A concentration of 2.5-3.0 plantlets on MS medium containing mg/l of 2,4-dichlorophenoxy-acetic BA (8-9 µM/l) and plantlets were acid (2,4-D) was found to be optimum successfully transferred to the soil. for callus induction. Regeneration of Dogra et al. (1994), cultured callus plantlets from a callus was derived from different plant parts of successfully conducted in MS medium ginger for regeneration of plants on supplemented with standard growth different media containing different hormones. Salvi et al. (2001), initiated

REVIEW OF LITERATURE 35 callus cultures from leaf bases of calluses were subcultured onto a turmeric on Murashige and Skoog's medium containing 0.5 mg/l 2,4-D, 0.2 basal medium supplemented with mg/l BAP and 16.336 mg/l tryptophan dicamba, picloram (2 mg/l) or 1- (80 µM). Plantlets were formed when naphthaleneacetic acid (5 mg/l) in the embryogenic calluses were combination with benzyladenine (0.5 subcultured in MS liquid or solid mg/l). On transfer of callus cultures to medium without hormones and also in medium supplemented with media containing 3 mg/l and 4 mg/l benzyladenine (5 mg/l) in combination BAP alone or 2 mg/l BAP with 0.5 with triiodebenzoic acid or 2,4- mg/l kinetin or 0.5 mg/l IAA. They dichlorophenoxyacetic acid (0.1 mg/l), also encapsulated somatic embryos in green shoot primordia were seen to calcium alginate beads to study the differentiate from the surface of the regeneration potential of such synthetic callus. On transfer of regenerating seeds. Swapna et al. (2004), cultured cultures to half MS media leaf and rhizome explants of supplemented with Kn, shoot Kaempferia on MS medium with primordia developed into well various combinations of indole-3- developed shoots. When shoots were acetic acid, benzyl amino purine, transferred to medium devoid of napthalene acetic acid, 2 -4- phytohormones, complete rooted dichlorophenoxy acetic acid and plants were obtained. kinetin at concentrations ranging from

Regeneration of Kaempferia galanga 0.5 to 2.5 mg/l. They observed high- by callusing and somatic frequency organogenesis and multiple embryogenesis was initiated by shoot regeneration was induced from Vincent et al., 1991 and 1992) from rhizome explants on MS medium the leaf base-derived callus cultures. supplemented with 0.5 mg/l of IAA Lakshmi and Mythili (2003), obtained and 2.5 mg/l of BAP. Rahaman et al. plantlets via somatic embryogenesis in (2004) regenerated plantlets through callus derived from rhizome bud somatic embryogenesis from leaf-base explants. They induced callus in MS derived callus culture of Kaempferia medium supplemented with 1 mg/l 2,4 galanga using different concentrations -D and 0.5 mg/l BAP. Somatic and combinations of growth regulators. embryogenesis was observed when the The highest percentage of callus

REVIEW OF LITERATURE 36 induction was observed on MS glutamine (400 mg/l), activated medium supplemented with 2, 4-D (1.5 charcoal (250 mg/l) and BA (0.4 mg/l) mg/l) and BA (1.0 mg/l). Globular Bhagyalakshmi and Singh (1988). embryos regeneration of plantlets was They showed that meristem derived obtained on MS medium supplemented shoot exhibits consistent multiplication with BA (2.0 mg/l) and NAA (0.1 mg/ on ¾ strength of MS medium l). Chirangini et al. (2005) observed containing sucrose (3 %), ascorbic acid callus induction on the medium (100 mg/l), activated charcoal (100 supplemented with 2.85 µM IAA from mg/l) and BA (5 mg/l). They observed which microshoots was regenerated on that incorporation of kinetin and NAA 2.69 µM NAA and 2.22 µM at various levels with or without BA benzyladenine-enriched medium. and IBA, neither improved plantlet

2.10.5 Direct regeneration of plantlets formation nor enhanced shoot multiplication. The efficacy of direct in Hosoki and Sagawa (1977) reported vitro regeneration of ginger can be direct regeneration of numerous assessed by the comment- ‗one adventitious shoots with roots by explanted shoot tip produced more repeated subculture of rhizome buds of than 4 shoots within 3 weeks and a Zingiber officiale in media containing huge quantity of plantlets which is Murashigge and Skoog major salts and estimated to be about 750,000 or more R i n g e - N i t s c h m i n o r s a l t s can be regenerated from a single supplemented with 1ppm explant within one year on MS benzyladenine. They reported a medium supplemented with BA (5 mg/ maximum of 6 shoots per bud in in l) and NAA (0.5 mg/l)‘ (Inden et al., vitro culture. A maximum of 15 1988). Tissue culture technique could plantlets were obtained by Pillai and significantly contribute towards Kumar (1982), from single explants maximizing the use of high quality when cultured on Schenk and rhizomes for in vitro propagation Hildebrandt liquid medium containing (Ikeda and Tanaba, 1989). They different concentrations of hormone. cultured leaf pseudostem and Shooting in the Wyad Giant variety of decapitated crown sections of ginger ginger was achieved in ¾ M S medium on MS medium containing various containing sucrose (6 %), coconut milk concentrations of BA and NAA. The (20 %), ascorbic acid (100 mg/l),

REVIEW OF LITERATURE 37 pseudostems cultured on solid medium each shoot tip explant in the medium supplemented with BA (1 µM/l) and supplemented with 2.5 mg/l BAP and NAA (0.6 µM/l) produced on an 0.5mg/l Kinetin. average 5 shoots and 15.3 roots. Sit et al. (2005) regenerated ginger cv Whereas decapitated crown sections Garubathan by using sprouted bud in cultured in liquid medium with BA MS medium using different (11µM/l) produced on an average 10 concentrations of BAP. They obtained shoots and 16.3 roots under 16 hr maximum number of viable shoots and fluorescent light. Choi and Kim roots when the buds were treated with (1991), obtained maximum number of 0.1% HgCl2 as surface sterilant for 15 shoots by culturing shoot apex of minutes. It was observed that with the ginger on MS medium containing increase of BAP concentration, the NAA (0.5 mg/l) and BA (5.0 mg/l). multiplication rate increased of shoots Inflorescence of ginger cv. Maran was increased up to a certain level and than cultured by (Nirmal Babu et al., 1992) declined. The rate of shoot for regeneration of plants on MS multiplication was maximum at BAP 4 medium containing BA 10 mg/l and mg/l. Bhattacharya and Sen (2006) 2,4-D (0.2 mg/l). The inflorescence achieved in vitro regeneration of produced vegetative bud without callus disease-free plantlets through tissue formation. BA (2.5 mg/l) and NAA culture. They used Murashige and (0.5 mg/l) was more effective to Skoog and Gamborg media produce more number of shoots from supplemented with different rhizome buds of ginger when on MS concentrations and combinations of medium (Dogra et al., 1994). They cytokinins. Media supplemented with found that the greatest umber roots 4 mg/l benzyl amino purine (8.33 were formed on MS medium shoots/explant) provided the best containing supplemented with NAA (1 regeneration compared to kinetin and mg/l). Khatun et al. (2003), cultured zeatin when they were used alone. aseptic shoot tips of ginger on MS Combination of 4 mg/l BAP and 3 mg/ media containing 3% sucrose, different l Kn (9.60) resulted in maximum concentrations and combinations of number of shoots in their experiment. hormones along with 0.5% agar. They Profuse rooting was observed in the obtained 22 to 25 ginger plantlets from same media.

REVIEW OF LITERATURE 38

Mohanty et al. (2008) developed a et al. (1982) and Keshavachadra and protocol for in vitro propagation of Khader (1989). They cultured ginger (Zingiber officinale) cv. sprouting buds of turmeric on MS Suprava using dormant axillary buds media. They found that MS medium from unsprouted rhizomes. The containing kinetin (1 mg/l) and BA (1 dormant axillary buds embedded in the mg/l) were best for multiplication. rhizome nodes were induced to sprout Winnar and Winnar (1989) obtained 8 when cultured on MS medium multiple shoots from a single explant supplemented with 6-benzyladenine when sprouting buds were cultured on alone or with a combination of and MS medium containing BA (1 mg/l). indole-3-acetic acid. MS basal medium Balachandran et al. (1990) used supplemented with BA (1 mg/l), IAA rhizome buds of different Curcuma (1 mg/l) and adenine sulfate (100 mg/l) species for culture on MS medium. was found optimum for the in vitro The medium was supplemented with multiplication of shoots producing different concentrations of shoots from a single explant within 30 bioregulators. They found that BA (3 days of culture. The multiplication rate mg/l) was optimum for shoot remained unchanged in subsequent multiplication for all the species. subcultures. Microropagation of Rhizome buds of several species of Zingiber officinale Rosc. cv, Suprava Curcuma were cultured, on MS and Suruchi using fresh rhizome medium with varying levels of BAP sprouting bud was conducted by and kinetin by Balachandran et al. Behera and Sahoo (2009) on (1990), to produce multiple shoots. Murashige and Skoog‘s medium They found that a concentration of 3.0 supplemented with different mg/l BAP was optimum for shoot concentrations and combinations of multiplication in all the species. Salvi BAP and NAA for shoot and root et al. (2000), regenerated plantlets induction. The explants cultured on from immature inflorescence of MS basal medium supplemented with Curcuma longa by direct shoot 2.0 mg/l BAP + 0.5gm/l NAA showed development on Murashige and the highest rate of shoot multiplication. Skoog‘s basal medium supplemented

Direct in vitro regeneration of with BA (5 or 10 mg/l) in combination Curcuma longa was reported by Shetty with 2,4-D or NAA and TDZ in

REVIEW OF LITERATURE 39 combination with IAA. Sunitibala et best and produced the highest number al. (2001) observed multiplication and of shoots per explant. Among the callus induction starting from the different carbohydrates tested, sucrose, rhizome buds and shoots on MS fructose, glucose, sugar cubes, medium. A combination of maltose, levulose and market sugar naphthalene acetic acid (1.0 mg/l) with were found to be equally effective for kinetin (1.0 mg/l) or NAA (1.0 mg/l) shoot multiplication and xylose, with 6-benzylaminopurine (2.0 mg/l) rhamnose, lactose and soluble starch was optimum for rapid clonal were inhibitory. Rahaman et al. propagation of turmeric. Salvi et al. (2004), regenerated multiple shoots (2002), proposed a protocol for in vitro from rhizome derived cultures of propagation of turmeric cv `elite' using turmeric on MS medium supplemented young vegetative buds from sprouting with BA (2.0 mg/l). They rhizomes. The shoot buds produced experimented rooting in half strength multiple shoots when cultured on MS MS medium supplemented with solid medium supplemented with various concentrations of AA, IBA and benzyladenine and 1-naphthalene IAA. It was observed that 0.1–1.0 mg/l acetic acid. The effect of various concentrations of any auxin was found cytokinins on shoot multiplication was to be effective but IBA was the best. studied by culturing the shoot tips on Nayak (2004), achieved shoot MS liquid medium supplemented with multiplication and plant regeneration benzyladenine, benzyladenine riboside, from freshly sprouted shoots of kinetin, kinetin riboside, zeatin, 6- Curcuma aromatica on Murashige and dimethylallylaminopurine, adenine, Skoog's medium supplemented with adenine sulfate or metatopolin each at BA alone (1–7 mg/l) or a combination 10 M in combination with 1- of BA(1–5 mg/l) and Kn (0.5–1 mg/l). naphthalene acetic acid (1 M). A concentration of 5 mg/l BA was Significant differences were observed found to be optimum for shoot between the treatments. Liquid multiplication and rooting of shoots. medium was more favourable than Prathanturarug et al. (2005) were agar medium for shoot multiplication. successful in rapid micropropagation Among the various concentrations of of Curcuma longa using bud explants agar tested, 0.4% and 0.6% were the pre- cultured in thidiazuron -

REVIEW OF LITERATURE 40 supplemented liquid medium. Naz et throughout the year. MS media al. (2009) standardized a rapid containing 3 mg/l 6-Benzyladenine and propagation and acclimatization 1 mg/l Indole Acetic acid was found method of three different varieties of optimum for regeneration, turmeric (Faisalabad, Kasur and multiplication and i n vi t r o Bannun) using rhizome bud explants conservation of plantlets. on MS medium supplemented with Geetha et al. (1997) standardised different concentrations and protocols for micropropagation of combinations of cytokinin and auxins. Kaempferia galanga by young The frequency of shoot induction was sprouting buds on Murashige and 70, 60 and 75 in Faisalabad, Kasur and Skoog basal medium supplemented Bannun varieties respectively. The with 0.5 mgl-' kinetin and 1.5% number of shoots per explant increased sucrose solidified with 0.7% agar. In with increased BAP concentration regeneration of Kaempferia galanga while shoot length decreased. Behera using rhizomes as explants by Shirin et et al. (2010) developed a high al. (2000), various concentrations of frequency in vitro plantlet regeneration BAP and a range of auxins were used. method for Curcuma longa L. They achieved in vitro plantlet (cv.Ranga) using fresh sprouting production on 0.75 × MS medium rhizome bud on semisolid Murashige supplemented with 12 μM BAP, 3 μM and Skoog‘s medium supplemented NAA and 3% sucrose. Rahaman et al. with different concentration and (2005), regenerated by using rhizome combinations of BAP and NAA for tips and lateral buds on MS medium shoot and root induction. Explants supplemented with BA, Kn, NAA, cultured on MS basal medium IBA and IAA. 100 percent supplemented with 2.0mg/l regeneration was obtained in MS BAP+0.5gm/l NAA showed highest medium supplemented with BA and rate of shoot multiplication. Singh et NAA. Chirangini et al. (2005), induced al. (2011) proposed a protocol for in microshoots of rhizomatous buds of vitro micropropagation of an elite Kaempferia galanga and K. rotunda genotype of turmeric (cv. suroma) when cultured on MS medium using latent axillary bud explants from supplemented with plant growth unsprouted rhizome, available regulators. Multiple shoots were

REVIEW OF LITERATURE 41 induced on MS medium containing shoot/explants.

5.70 µM IAA alone and a combination 2.10.6 Rooting of plantlets of 0.57 µM IAA plus 4.65 µM kinetin In Zingiber officinale, spontaneous in the case of K. galanga. On the other rooting were observed by Hosoki and hand, the medium supplemented with Sagawa (1977); Sit et al. (2005); 2.69 µM NAA plus 2.22 µM Bhattacharya and Sen (2006); Mohanty benzyladenine was the best for K. et al. (2008). Profuse rooting was rotunda. Parida et al. (2010) worked observed in MS media supplemented on an efficient protocol for rapid with NAA (Nirmal Babu et al., 1992; multiplication and in vitro production 1996 and Dogra et al., 1994) while of leaf biomass in Kaempferia Behera and Sahoo (2009) observed galanga. They used different plant that in vitro shootlets rooted best on to growth regulators like Benzyladenine, the half strength MS basal media Indoleacetic acid, Indolebutyric acid, supplemented with NAA. Napthaleneacetic acid and adenine sulphates for induction of multiple Ikeda and Tanaba (1989) observed that shoots using lateral bud of rhizome as pseudostems cultured on solid medium explants. The highest rate of shoot supplemented with BA and NAA multiplication (11.5 ± 0.6) shoot/ produced an average number of roots. explant as well as leaf biomass Whereas decapitated crown sections production (7.4 ± 0.3) gram/explant cultured in liquid medium with BA was observed on Murashige and Skoog produced more number of roots. Choi medium supplemented with (1991) reported that rooting of in vitro Benzyladenine (1 mg/l) and shootlets was enhanced by the addition Indoleacetic acid (0.5 mg/l). An of 2 gm activated charcoal per litre. protocol for multiple shoot induction In Curcuma longa rooting was of Kaempferia galanga using rhizome observed in MS media devoid of segment explants was established by phytohormones (Salvi et al., 2001) Kochuthressia et al. (2012) on while Shetty et al. (1982), Murashige and Skoog medium Keshavachadra and Khader (1989), supplemented with BA (2.0 mg/ml) Balachandran et al. (1990) and Nayak and Kn (1.0 mg/ml) exhibited (2004) found that the plants rooted on regeneration rate up to 10.85±1.34 the same medium with same hormonal

REVIEW OF LITERATURE 42 concentrations. shoots.

NAA for induction of roots were In tissue culture of Zingiber officinale necessary (Salvi, 2000) and Behera et decrease of proliferation rate on each al. (2010) observed better rooting on subculture even after one year was not half-strength MS basal media observed by Inden et al. (1988), supplemented with NAA. Sharma et al. (1997) and Mohanty et

In Kaempferia galanga, Geetha et al. al. (2008). But, Choi (1991) observed (1997) standardised protocols for decrease in Shoot regeneration production of multiple shoots and well capability after third subculture while developed roots in medium gradual decrease in the rate of plantlet supplemented with 0.5mg/l production after second subculture was naphthaleneacetic acid and 1.0 mg/l 6- observed by Sit et al. (2005). benzylaminopurine. Swapna et al. In Curcuma longa the regenerated (2004), observed simultaneous shoots were further multiplied by sub shooting and rooting on MS medium culturing on fresh medium after 30 supplemented with IAA and BAP. days (Naz et al., 2009).

Chirangini et al. (2005) observed that In Kaempferia, the number of shoots the microshoots produced roots per explants gradually increased when irrespective of their method of the primary cultures were subcultured regeneration while Kochuthressia et al. at two weeks interval (Rahaman et al., (2012) and Bhattacharya and Sen 2005). But a constancy in the rate of (2013) observed spontaneous rooting multiplication and leaf biomass of shoots on the same medium used for production of Kaempheria remained shoot development. unchanged in subsequent subcultures 2.10.7 Subculture of plantlets when cultured on same media

Subculture of plantlets is an efficient formulations (Parida et al., 2010). method to increase the number of Bhattacharya and Sen (2013) reported plantlets in very short time. During the that the number of plantlets declined process of subculture decrease in after one or two subcultures. number of shoots per explant were 2.10.8 Microrhizome production observed in some cases while in others Microrhizomes are very convenient for there were no decline in the number of packing and transportation besides its

REVIEW OF LITERATURE 43 advantage in germplasn conservation vitro microrhizome in Curcuma longa. and exchange (Parthasarathy and They found that half strength MS basal Sasikumar, 2006). Thus this process medium supplemented with 80 g/l has gained special importance in the sucrose was optimal for microrhizome biotechnology of Zingiberous crops. production. Cytokinin like BAP had an

In Zingiber officinale, Sharma et al. inhibitory effect on microrhizome (1995) produced microrhizomes of production with a total inhibition at from tissue culture derived shoots by concentration of 35.2 M. The transferring them to liquid MS medium microrhizome production depended on supplemented with 8 mg/l BAP and 75 the size of the multiple shoots used. g/l sucrose. Microrhizome formation Sunitibala et al. (2001) incubated started after 20 days of incubation in plantlets in a medium containing stationary cultures at 25+1° in the different concentrations of sucrose dark. Rout et al. (2001) experimented supplemented with NAA (0.1 mg/l) cultural variations such as photoperiod, and Kn (1.0 mg/l) at 27 +/- 2 degrees carbohydrate, nutrient composition, C under an 8 h photoperiod for and growth regulators were tested for induction of rhizomes. In vitro rhizome the maximum yield of microrhizomes. formation was observed in media Among the different photoperiods containing 6 and 8% sucrose. used, a 24 hour photoperiod helped in Microrhizomes were induced at the the formation of more rhizomes when base of the in vitro derived shoots compared with other photoperiods. upon transfer to medium containing They achieved shoot multiplication of various combinations and Zingiber officinale cv. V3S8 by concentrations of sucrose and BA and meristem culture on MS basal medium grown under varying photoperiods supplemented with BA, IAA and Nayak (2004). MS basal medium with adenine sulfate and 3% (w/v) sucrose. mg/l BA, 60 g/l sucrose and an 8 hour In vitro rhizome formation from in photoperiod was optimum for vitro-raised shoots was achieved on induction of microrhizomes within 30 MS medium supplemented with BA, days of culture. Microrhizome IA A, and 3-8% (w/v) sucrose after 8 formation was found to be controlled week of culture by the concentrations of BA and sucrose as well as photoperiod during Shirgurkar et al. (2001) produced in

REVIEW OF LITERATURE 44 culture. Islam et al. (2004) published varied from 1-4 and the weight varied an improved in vitro microrhizome from 50 mg to 580 mg. They observed induction system in Curcuma longa L. that factors such as concentration of Freshly sprouted axillary buds were sucrose and BA in the medium, as well used as initial explants and multiplied as photoperiod and their interaction, through established in vitro systems. were found to have a significant effect Multiplied shoots were excised and in the induction of microrhizomes. In subcultured on hormone free medium their observation sucrose was most for four weeks to induce effective in rhizome formation, microrhizome. Effects of light, sucrose followed by photoperiod and BA in the and growth regulators on in vitro medium. microrhizome production have been Microrhizome formation was observed studied. Nine per cent sucrose was in Kaempferia galanga within one found to be the most suitable for month of microshoot culture microrhizome production, when incubation in the medium incubated in the dark. Various supplemented with 6-9% sucrose with concentrations of BA and Kn, and either 22.2 µM benzyladenine or 23.25 NAA were tested. BA (12.0 μM) and µM kinetin. These microrhizomes NAA (0.3 μM) were found suitable for produced shoots when transferred to the induction of microrhizomes. fresh microshoot induction medium Nayak and Naik (2006), produced within 2-3 weeks of incubation. The microrhizomes from tissue culture microshoots produced roots Rajan et al. (2005), reported in vitro irrespective of their method of microrhizome production on MS regeneration Chirangini et al. (2005). medium supplemented with BAP, 2.10.9 Hardening of plantlets NAA and ancymidol along with 10% One of the major obstacles in the sucrose. They derived shoots of application of tissue culture methods Curcuma longa by transferring them to for plant propagation has been the the liquid medium of Murashige and difficulty in successful transfer of Skoog supplemented with 13.3mM BA plantlets from the laboratory to the and 6% sucrose, and culturing with a field (Wardle et al., 1983). The reasons reduced photoperiod of 4 hours daily. for such a difficulty appear to be The number of buds per microrhizome related to the dramatic change in the

REVIEW OF LITERATURE 45 environmental conditions. The mixture containing peat: sponge rock: environment of the culture vessel is vermiculite in ratio of 2:1:1 (Hosoki one of low light intensity, with very and Sagawa, 1977), vermiculite high humidity (generally 100%) and medium supplemented with a solution poor root growth, while the greenhouse containing half of normal and/or field conditions are typified by concentration of MS medium (Inden et very high light intensity, low humidity al., 1988), vermiculite medium (Choi, and microflora (Desjardins et al., 1991), garden soil, sand and 1987). Several workers have vermiculite in equal proportions developed protocols to overcome some (Samsudeen et al., 2000) and garden of these constraints. These reasons for soil and sand in the proportion of 1:1 such a difficulty appear to be related to (Bhattacharya and Sen, 2006). Varied the dramatic change in the survival rate of the hardened plantlets environmental conditions. were reported. Low (Hosoki and

In hardening of regenerated tissue Sagawa, 1977), 80% (Nirmal Babu et cultured plantlets of the family al., 1992), 85% (Samsudeen et al., Zingiberaceae hardening of 2000), 94 % (Bhattacharya and Sen, regenerated plantlets can be achieved 2006) and 95% (Behera and Sahoo, very easily. Different hardening 2009) survival was reported under materials like peat moss and river field conditions. Khatun et al. (2003), sand, sterilized potting soil, achieved 100% and Mohanty et al. vermiculite and soil, soil and compost, (2008) achieved 96% survival rate in soil, sand, soil with mycorrhiza, soil field when the plantlets were directly without mycorrhiza, organic soil and transferred to the fields. sand etc have been used (table 2.5). Keshavachadra and Khader (1989) The success rate of hardening depends transferred five weeks old culture of upon the hardening material and the the rooted Curcuma longa to pots condition of the regenerated plantlet. covered with polythene bags and kept High rate of survival of regenerated under shade. Two weeks later the plantlets have been achieved in field in plants were well established. The in all the cases. vitro raised plantlets of Curcuma were

The Zingiber officinale plantlets were hardened in sterilized soil in paper successfully transferred to a pot cups (Salvi, 2000; Salvi et al., 2002)

REVIEW OF LITERATURE 46 and Sand: Soil: Peat in ratio of 1:1:1 plants were free from ginger yellows (Naz et al., 2009). Hardened plantlets (Fusarium oxysporum f. sp. zingiberi) were successfully transferred to the were developed by Sharma et al. field with 70 % (Rahaman et al., (1997). The well-developed rhizomes 2004), 90 % (Salvi et al., 2001), 90 to obtained from the tissue-cultured 95% (Salvi, 2000, Salvi et al., 2002), plants did not rot during storage of up high percentage (Zapata et al., 2003), to 6 months, thus indicating that the 90% (Gayatri and Kavyashree, 2005), method is also effective in checking 70-80% (Naz et al., 2009) and 95% storage rot caused by F. oxysporum f. (Behera et al., 2010) survival rate. sp. zingiberi. Bhattacharya and Sen

Geetha et al. (1997) hardened (2006) transferred rhizome pieces of regenerated Kaempferia plantlets in ginger to PDA to observe fungal mixture of Sand, garden soil and growth on the medium, visual vermiculite (1:1:1). Hardened plantlets observations on the presence of ginger of Kaempferia galaga produced by yellows symptoms and detection of the callus culture showed normal storage number of rotted rhizomes after roots and were acclimatized and storage on river sand were performed subsequently transferred to field with to detect the presence or absence of the 90-95% (Geetha et al., 1997) and 85% pathogen in tissue culture-derived survival (Rahaman et al., 2004) while clones. regenerated plants by rhizome bud Gayatri and Kavyashree (2005), proliferation were hardened and isolated root rot disease tolerant clones established on the field with 85% of turmeric variety Suguna by using success (Rahaman et al., 2005). Field continuous in vitro selection technique survival of 80-90% (Chirangini et al., against pure culture filtrate of Pythium 2005) and 95 % was observed by graminicolum. Callus was challenged (Parida et al., 2010). with pure culture filtrate of P.

2.10.10 Pathogen and nematode graminicolum to isolate viable callus elimination within 30 days of culture, which was further subjected to pure culture filtrate The elimination of nematode infection treatment. After three cycles of from the rhizomes of ginger has been treatment, they obtained, four cell lines reported by de Lange et al. (1987). which are tolerant to culture filtrate Pathogen free in vitro derived ginger

REVIEW OF LITERATURE 47 was isolated through continuous in genetic basis using different genetic vitro selection and subcultured on markers such as, 4C nuclear DNA regeneration medium fortified with content and random amplified BAP (4mg/l) along with the control polymorphic DNA. A significant non-selected callus to obtain complete variation of 4C DNA content was plantlets through discontinuous in vitro recorded in ginger at an intraspecific selection technique. The data obtained level with values ranging from 17.1 to from their experiment revealed a ratio 24.3pg. RAPD analysis revealed a of 225:49 tolerant: susceptible in vitro differential polymorphism of DNA clones retrieved from tolerant callus. indicating genetic variations that can 2.11 Study of molecular diversity be significant in ginger improvement

Study of molecular diversity among programs. Lee et al. (2007) reported the regenerated plantlets can provide isolation and characterization of eight suitable tool for crop improvement. polymorphic microsatellite markers for Several strategies can be used to assess Zingiber officinale. A total of 34 the genetic fidelity of in vitro derived alleles were detected across the 20 clones, but most have limitations. accessions, with an average of 4.3 Using the polymerase chain reaction alleles per locus. Values for observed (PCR) in conjugation with short and expected heterozygosities ranged primers of arbitrary sequences from 0 to 1.0 and from 0.23 to 0.67, (Williams et al., 1990). Randomly respectively. The heterozygote deficits amplified polymorphic DNA (RAPD) were observed at three loci. At the markers were shown to be sensitive for significance threshold (P< 0.05) of the detecting variations among individuals eight loci, seven were found to have between and within species (Carlson et deviated from Hardy–Weinberg al., 1991 and Roy et al., 1992). equilibrium, whereas significant linkage disequilibria were observed 2.10.1 Diversity study in zingibers between 10 pairs of loci. Their data Nayak et al. (2005) assessed the indicates the existence of moderate genetic diversity of 16 cultivars of level of genetic diversity among the ginger using cytological and molecular ginger accessions genotyped with eight markers. The variation among 16 markers. promising cultivars on differential Syamkumar and Sasikumar (2007) rhizome yield was proved to have a

REVIEW OF LITERATURE 48

Table 2.5: Hardening material and survival rate of regenerated plantlets of Zingiber officinale, Cur- cuma longa and Kaempferia galanga Potting mixtire Survival rate Reference Zingiber officinale Peat: sponge rock: vermiculite Low Hosoki and Sagawa, 1977 (2:1:1) Vermiculite medium supple- — Inden et al., 1988 mented with 1/2 MS Vermiculite — Choi, 1991 Garden soil and sand (1:1) 80% Nirmal Babu et al., 1992 Garden soil, sand and farm 80 % Nirmal Babu et al., 1996 yard manure (1:1:1) Garden soil, sand and vermicu- 85% Samsudeen et al., 2000 lite (1:1:1) Not used i.e. direct field trans- 100% Khatun et al., 2003 fer Garden soil and sand (1:1) — Sit et al., 2005 Garden soil and sand (1:1) — Sit and bhattacharya, 2007 Garden soil and sand (1:1) 94 % Bhattacharya and Sen, 2006 Not used i.e. direct field trans- 96% Mohanty et al., 2008 fer Vermiculite 95% Behera and Sahoo, 2009 Curcuma longa Salvi, 2000; Salvi et al., 2002; Sterilized soil 90 to 95% Salvi, 2001 Sterile soil and agrolite (1:1) High Zapata et al., 2003 Not used i.e. direct field trans- 70 % Rahaman et al., 2004 fer — 90% Gayatri and Kavyashree, 2005 Sand : Soil : Peat (1:1:1) 70-80% NAZ et al., 2009 Vermiculite 95% Behera et al., 2010 Kaempferia galaga Sand, garden soil and vermicu- 90-95% Geetha et al., 1997 lite (1:1:1) Garden soil, compost and sand 90% Rahaman et al., 2004 (2:2:1) Soil and organic manure 85% Rahaman et al., 2004 — 85% Rahaman et al., 2005 Not stated in abstract 80-90% Chirangini et al., 2005 Soil, cowdung and sand mix- 95 % Parida et al., 2010 ture (1:1:1) Garden soil and sand (1:1) 94 Bhattacharya and Sen, 2013 performed molecular genetic of which 352 were polymorphic and fingerprints of 15 Curcuma species out of the 91 bands produced by the 8 using Inter Simple Sequence Repeats ISSR markers, 87 were polymorphic. (ISSR) and Random Amplified Dendrograms were constructed based Polymorphic DNA (RAPD) markers to on the unweighted pair group method elucidate the genetic diversity/ using arithmetic averages. The relatedness among the species. Thirty- maximum molecular similarity nine RAPD primers yielded 376 bands observed between two of the Curcuma

REVIEW OF LITERATURE 49 species namely Curcuma raktakanta size of amplicons ranging from 230 to and Curcuma montana is suggestive of 3000 bp in size. The polymorphism the need for relooking the separate ranged from 45 to 100 with an average status given to these two species. of 91.4%. The 6 ISSR primers

Jan et al. (2011) performed molecular produced 66 bands across 60 genetic fingerprints of indigenous genotypes of which 52 were turmeric genotypes of Pakistan using polymorphic with an average of 8.6 Randomly Amplified Polymorphic polymorphic fragments per primer. DNA marker to elucidate the genetic The number of amplified bands varied diversity among them. Ten decamer- from 1 to 14 with size of amplicons primers generated 95 RAPD ranging from 200 to 2000 bp. The fragments, of which 92 fragments were percentage of polymorphism using polymorphic with 96.84% of ISSR primers ranged from 83 to 100 polymorphism. Amplified fragment with an average of 95.4%. Nei‘s sizes ranged from 200 to 3640 bp. Pair dendrogram for 60 samples using both -wise Nei and Li‘s similarity RAPD and ISSR markers coefficient value ranged from 0.00 to demonstrated an extent of 62% 0.71 for 20 genotypes of turmeric. correlation between the genetic similarity and geographical location. Singh et al. (2012) examined the The result of Nei‘s genetic diversity genetic diversity among turmeric generated from the POP gene analysis accessions from 10 different agro- shows relatively low genetic diversity climatic regions comprising 5 cultivars in turmeric accessions of South eastern and 55 accessions. They used random ghat, Western undulating zone with amplified polymorphism DNA and 0.181 and 0.199 value whereas highest inter simple sequence repeat to assess genetic diversity (0.257) has been the genetic diversity in turmeric observed in Western central table land. genotypes. RAPD analysis of 60 genotypes yielded 94 fragments of Techaprasan et al. (2009) studied which 75 were polymorphic with an genetic variation and species average of 6.83 polymorphic authentication of 71 Kaempferia fragments per primer. Number of accessions found indigenously in amplified fragments with RAPD Thailand were examined by primers ranged from 3 to 13 with the determining chloroplast psbA-trnH and

REVIEW OF LITERATURE 50 partial petA-psbJ spacer sequences. in undifferentiated callus,

Ten closely related species ii) differences in the ability to organize (Boesenbergia rotunda, Gagnepainia and form organs in vitro, godefroyi, G. thoreliana, Globba iii) changes manifested among substrigosa, Smithatris myanmarensis, differentiated plants, and S. supraneanae, Scaphochlamys biloba, S. minutiflora, S. rubescens, iv) chromosomal changes. and Stahlianthus sp) were also Somaclonal variation has been included. After sequence alignments, reviewed at length (Scowcroft and 1010 and 865 bp in length were Larkin, 1988), and has proven useful in obtained for the respective chloroplast plant improvement (Jain et al., 1998; DNA sequences. Intraspecific Jain and De Klerk, 1998) and could be sequence variation was not observed in of much interest to the horticultural Kaempferia candida, K. angustifolia, breeders. In Chrysanthemum, little K. laotica, K. galanga, K. pardi sp variation is observed in plants derived nov., K. bambusetorum sp nov., K. from shoot tips (Khalid et al., 1989). albomaculata sp nov., K. minuta sp Most of the variation is observed in nov., Kaempferia sp nov. 1, and G. plants originating from protoplasts, thoreliana. In contrast, intraspecific which is termed as protoclonal sequence polymorphisms were variation (Kawata and Oono, 1997; observed in various populations of K. Jain, 1997; Jain and De Klerk, 1998). fallax, K. filifolia, K. elegans, K. Plants regenerating from unorganized pulchra, K. rotunda, K. marginata, K. callus vary more than those from parviflora, K. larsenii, K. roscoeana, organised callus, whereas no or hardly K. siamensis, and G. godefroyi. any variation occurs when plants are

2.12 Somaclonal variations regenerated directly without anintermediate callus phase (Bouman Somaclonal variation involves all and De Klerk, 1996). Exploitation of forms of variation among regenerated somaclonal variation through callus plants derived from tissue culture culture might become a source for new (Larkin and Scowcroft, 1981; Jain et cultivars if this method is combined al., 1998; Jain and De Klerk, 1998) with strategic and efficient in vitro such as: selection pressures (Gudin and i) physical and morphological changes

REVIEW OF LITERATURE 51

Mouchotte, 1996). The selected species. Hirochika et al. (1996) somaclones should be genetically reported that certain types of stable in seed and vegetatively retrotransposons are activated as the propagated crops for routine induction tissue cultures get older and the of genetic variability through tissue regenerated plants show an increase in culture, and this aspect should be retrotransposon copy numbers leading thoroughly checked before using them to off-types. in regular crop improvement programs. Plantlets derived from in vitro culture Somaclonal variation is unpredictable might exhibit somaclonal variation in nature and can be both heritable (Larkin and Scowcroft, 1981) which is (genetic) and non - h e r i t a b l e often heritable (Breiman et al., 1987). (epigenetic) in regenerated plants. Other reports claim that useful DNA methylation causes genetic morphological, cytological, and instability in somaclones, which molecular variations may be generated probably comes from epigenetic in vitro (Larkin et al., 1989). Any changes (Jain, 2001). Since somaclonal system which significantly reduces or variation can broaden the genetic eliminates tissue culture generated variation in number of crop plants, a variations can be of much practical broader range of plant characteristics utility. The variations may be due to can be altered, including plant height, several factors (Vasil, 1987 and 1988), yield, no. of flower/plant, early such as genotypes used (Breiman et flowering, resistance to diseases, al., 1987), pathways of regeneration, insects and pests and salt. The and parameters employed for assessing reduction, and even the total loss of the effect of in vitro culture, such as regeneration ability, is a general gross morphology and cytology phenomenon observed during (Swedlund and Vasil, 1985), field undifferentiated cell culture. The assessment, and molecular studies somaclonal variation creates problem (Breiman et al., 1989; Chawdhury et for micropropagators by the production al., 1994; Shenoy and Vasil, 1992). of off-types in clonally propagated Several strategies can be used to assess plants. This can be controlled by the genetic fidelity of in vitro derived reducing the subcultures and the age of clones, but most have limitations (table the cultures, depending on the plant 2.6). Karyological analysis, for

REVIEW OF LITERATURE 52 example, cannot reveal alterations in plant material to assess the genetic specific genes or small chromosomal fidelity. All RAPD profiles from rearrangements (Isabel et al., 1993). micropropagated plants were Isozyme markers provide a convenient monomorphic and similar to those of method for detecting genetic changes, field grown control plants. No but are subject to ontogenic variations. variation was detected within the They are also limited in number, and micropropagated plants. only DNA regions coding for soluble The genetic stability of proteins can be sampled. Using the micropropagated clones of ginger was polymerase chain reaction (PCR) in evaluated by Mohanty et al. (2008) at conjuction with short primers of regular intervals of 6 months up to 24 arbitrary sequence (Williams et al., months in culture using 1990), randomly amplified cytophotometric estimation of 4C polymorphic DNA (RAPD) markers nuclear DNA content and random were shown to be sensitive for amplified polymorphic DNA analysis. detecting variations among individuals Cytophotometric analysis revealed a between and within species (Carlson et unimodal distribution of the DNA al., 1991 and Roy et al., 1992). RAPD content with a peak corresponding to markers have been used successfully to the 4C value (23.1 pg), and RAPD assess genetic stability among somatic analysis revealed monomorphic bands embryos in spruce species (Isabel et showing the absence of polymorphism al., 1993 and 1996) and among in all fifty regenerants analyzed, thus micropropagated plants of poplar (Rani confirming the genetic uniformity. et al., 1995). Random Amplified Polymorphic DNA Balachandran et al. (1990) reported analysis of eight regenerated plants of morphologically uniform in vitro turmeric using 14 primers when raised plantlets. Rout et al. (1998), separated on non -denat uri ng used random amplified polymorphic polyacrylamide gels showed 38 novel DNA markers to evaluate the genetic bands. About 51 bands present in the stability of micropropagated plants of control were absent in the regenerants. Zingiber officinale cv. V3S18. They The result indicates that variation at used fifteen arbitrary decamers to DNA level has occurred during in vitro amplify DNA from in vivo and in vitro culture (Salvi et al., 2001). The

REVIEW OF LITERATURE 53 chances of somaclonal variations are the insult of ROS, which however are more in case of callus regenerated efficiently taken care of by the highly plants than through direct in vitro powerful antioxidant system of the cell regeneration. Micropropagated without any untoward effect. When the turmeric showing stable drug yielding balance between ROS production and potential also proved to have genetic antioxidant defense is lost ‗oxidative basis of stability as revealed by RAPD stress‘ results which through a series of based molecular profiling (Singh et al., events, deregulates the cellular 2011). function leading to various

Parida et al. (2010) confirmed the pathological conditions. The free genetic fidelity of the Kaempferia radical mediated oxidative stress galanga regenerants by using random results in oxidation of membrane amplified polymorphic DNA marker. lipoproteins, glycoxidation and reduction of DNA resulting cell death. 2.13 Antioxidant studies Free radicals have been implicated as 2.13.1 Reactive oxygen species the cause of several diseases such as Oxygen is the vital for aerobic life liver cirrhosis, atherosclerosis, cancer, processes. However, about 5% or more diabetes etc. and compounds that can of the inhaled O2 is converted to scavenge free radicals have great reactive oxygen species (ROS) such as potential in ameliorating these disease - O2 , H2O2, and ·OH by univalent processes (Wilson, 1998). Many plant reduction of O2 (Bandyopadhyay et al., extracts and phytochemicals have been 1999). Thus cells under aerobic shown to have antioxidant/free radical condition are always threatened with scavenging properties (Larson, 1988

Table 2.6: Somaclonal variations in vitro regenerated plantlets of of Zingiber officinale, Curcuma longa and Kaempferia galanga In vitro regen- Somaclonal Plant species Technique used Reference eration variation Zingiber officinale — RAPD Not found Rout et al., 1998 cv. V3S18 Curcuma longa Callus mediated RAPD Found Salvi et al., 2001 Curcuma longa cv — RAPD Not found Salvi et al., 2002 ‗elite‘ 4C nuclear DNA — Mohanty et al., Zingiber officinale content and Not found 2008 RAPD analysis Kaempferia galanga Rhizome buds RAPD Not found Parida et al., 2010 Curcuma longa — RAPD Not found Singh et al., 2011 Manihot esculenta Apical meristems RAPD Not found Angel et al., 1996

REVIEW OF LITERATURE 54 and Tripathi et al., 1996). approach used is preventing damage to

The different forms of reactive oxygen autooxidizable materials is to species are all capable of causing incorporate chemical additives in the oxidative damage to proteins, DNA, formulation to deactivate the species and lipids. that initiate or promote destructive oxidation reactions. Autooxidation 2.13.2 Antioxidants reactions are normally initiated by Free radicals that may cause damage or species capable of producing free dysfunction in either living or radicals, which then undergo rapid nonliving systems could presumably subsequent reactions with molecular be prevented from exerting their oxygen leading to damage. Protective harmful effects by several means. additives may be light absorbing Either physical or chemical techniques compounds, metal ion complexing could, in principle be employed to agents, free radical scavengers, limit the potential damage. peroxide destroying compounds or 2.13.2.1 Preventive antioxidation singlet oxygen quenchers.

Living organisms employ several such 2.13.3 Antioxidant studies strategies. One approach is simply to 2.13.3.1 Antioxidants in plants avoid oxygen altogether. Many Plants possess efficient antioxidant microorganisms live in environments defense systems (Blokhina et al., 2003; that are either totally anoxic or limited Bhattacharjee, 2005; Smirnoff, 2008; in oxygen concentration. Other life Inze and Motagu, 2004; Arora et al., forms eschew sunlight and occupy 2002; Mittler, 2002) to scavenge the permanently dark environments, such ROS and protect the plants from as the ocean depths, subsurface layers destructive reactions. A regulated of the soil, or caves. The surface of balance between oxygen radical many animals that do live in presence production and their destruction is of sunlight and oxygen are either dark required to maintain metabolic in colour or highly reflective, or both, efficiency and functions under both presumably at least in part because of optimal and stress conditions. There the potentially toxic effects of light. are many sites of ROS production in 2.13.2.2.Chemical antioxidation the plant cell such as mitochondria, The most common and useful chloroplasts, glyoxysomes and cytosol,

REVIEW OF LITERATURE 55 which are highly controlled and tightly plants with low antioxidative capacity coupled to prevent release of (Arora et al., 2002). Plants contain intermediate products (Inze and antioxidative system in all subcellular Motagu, 2004). Under stress compartments including the apoplastic conditions if the production of ROS space which show large changes exceeds plants‘ capacity to detoxify during the life cycle of plant them, a breakdown in control and germination, emergence of young coupling occurs. This leads to a foliage, expansion, maturity, process, dysfunction leaking ROS. The senescence and death. These defence main cellular component susceptible to systems are composed of: damage by free radicals are proteins 1. hydrophilic (ascorbate, glutathione, (oxidation), lipids (peroxidation of phenolic compounds, flavooids, unsaturated fatty acids in membranes cucurmin) and lipophilic (α- which leads to membrane tocopherol, carotenoids, lycopene) permeability), carbohydrates metabolites with antioxidative (oxidation produces dicarbonyls which properties. react with the damaged proteins by 2. protective enzymes dealing directly crosslinking and condensation with toxic oxidants (superoxide reactions) and nucleic acids (purine dismutase, peroxidases and and pyrimidine bases are potential catalases) and enzymes helping to targets for oxidative damage leaving maintain the pool of antioxidants in strands intact but modifications of their reduced state sugar residues may lead to strand (monodehydroascorbate reductase, breakage). dehydroascorbate reductase, Plants have evolved different glutathione reductase). phytochemicals and enzymes as High local concentrations of antioxidant defense to maintain growth antioxidants play a major role in and metabolism. Antioxidants are deactivation of O2, whereas high produced in leaves and protect the activities of protective enzymes are plant from damage by quenching free mainly responsible for detoxification radicals. Plants with high antioxidative . of long living oxy-products such as O2 capacity are more tolerant to herbicide- - and H2O2. Protective enzymes and induced photooxidative stresses than antioxidants are constitutively present

REVIEW OF LITERATURE 56 in plants and the capacity of this species belonging to nine genera and system is not constant but responds to three tribes. Of the 26 species, leaves intrinsic and extrinsic factors such as of Etlingera species had the highest environmental factors or total phenolic content and ascorbic developmental determinants (Inze and acid equivalent antioxidant capacity. Motagu, 2004). Eleven of the 14 species had

2.13.4 Antioxidant studies in significantly higher total phenolic Zingibers content and/or ascorbic acid equivalent antioxidant capacity in leaves than in The rhizomes of tropical zingibers like rhizomes. In terms of Ferrous ion- Zingiber officinale, Curcuma longa chelating ability, six of the eight and Kaempferia galanga are rich species clearly showed higher values various secondary metabolites. Ginger in leaves than in rhizomes. The most and turmeric contain curcumin as well outstanding was the Ferrous ion- as less oxygenated curcumin chelating value of Alpinia galanga derivatives. Katiyar et al. (1996) leaves which was more than 20 times showed that water or organic solvent higher than that of rhizomes. Of the extract of ginger possesses five species of Etlingera, leaves of antioxidative property, which inhibits Etlingera elatior displayed the tumour promotion in mouse skin. Thus strongest tyrosinase inhibition activity, zingiber extract is postulated to followed by leaves of Etlingera probably contain anti-inflammatory fulgens and E. maingayi. Values of agents with antioxidant activity. their inhibition activity were Curcuma is rich in antioxidants in both significantly higher than or comparable in vitro and in vivo systems (Halim, to the positive control. Besides 2002). Kaempferia galanga is also a promising tyrosinase inhibition ability, potential sources of antioxidants and/or leaves of these three Etlingera species cytotoxic agents against tumour cells also have high antioxidant activity and (Zaeoung et al., 2005). Chan et al. antibacterial properties. (2008) performed an extensive work to study the total phenolic content, Ginger is rich in secondary metabolites Ferrous ion-chelating abilities and like oleoresin, essential oil and ascorbic acid equivalent antioxidant different polyphenols (Bhagyalaxmi capacity of leaves of 26 Zingiber and Singh, 1988). Ginger, the rhizome

REVIEW OF LITERATURE 57 of Zingiber officinale is one of the generation activity was observed in the most common constituents of diets benzene fraction The liver protective worldwide and is reported to possess function was maximum in diethyl ether antioxidant properties. The pungent and ethyl acetate (1:1) fraction. The phenolic constituent of ginger, [6]- bioactive fraction of diethyl ether and gingerol, inhibited LPS-induced NOS ethyl acetate (1:1) showed the expression and production of NO and reactivity against Natural Product- other RNS species in macrophages and Polyethylene Glycol reagent (NP/PEG) blocked peroxynitrite -induced from which it may be concluded that oxidation and nitration reactions in zinger flavonoids have some vitro (Ippoushi et al., 2003). These contributory roles in scavenging free results suggest that [6]-gingerol is a radical activity. potent inhibitor of NO synthesis and Methanol extracts, water extracts and also an effective protector against volatile oils of the fresh rhizomes of peroxynitrite-mediated damage. Zingiber officinale have been assessed Anti-inflammatory activities of silica for free radical scavenging activity gel chromatography fractions of ginger against 1,1-diphenyl-2-picrylhydrazyl have also been tested using an in vitro (DPPH) radical by Zaeoung et al. PGE2 assay. Results showed that most ( 2 0 0 5 ) . 6 - s h o g a o l , 6 - of the fractions containing gingerols dehydrogingerdione (or 1 - and/or gingerol derivatives were dehydrogingerdione) and 6-gingerol excellent inhibitors of LPS-induced were isolated from the methanol PGE2 production (Jolad et al., 2004). extract of Zingiber officinale.

Bhattacharya et al. (2009), investigated Curcumin, the active principle of the free radical, hydroxyl radical and turmeric, is commonly used as a nitric oxide scavenging activity along coloring agent in foods, drugs and with lipid peroxidation capability of cosmetics, and has a wide range of different solvent fractions of ginger. effects. Curcumin is known to act as an Out of the 34 fractions studied, 10 antioxidant, antimutagen and fractions showed free radical anticarcinogen (Anto et al., 1994). scavenging activity ranging from Curcumin was the most potent 5.88% to 80%. 5 different peaks were compound for free radical scavenging obtained. The maximum NO activity and also has therapeutic

REVIEW OF LITERATURE 58 properties for some human diseases essential oils Curcuma longa by means (Srimal and Dhawan, 1973). of GC and GC–MS. Antioxidant and Bleomycin (BLM) is an antibiotic and radical-scavenging properties were radiomimetic glycopeptide that is tested by means of 1,1-diphenyl-2- routinely used in cancer chemotherapy picrylhydrazyl (DPPH) assay and b- as an antineoplastic agent. BLM is carotene bleaching test. In the DPPH mutagenic in diverse genetic assays assay major effectiveness, with a (Povirk and Austin, 1991) and is radical inhibition ranging from 59.6 ± thought to exert its genotoxic effects 0.42 to 64.3 ± 0.45%, while in the b- through free radical production and the carotene bleaching test Curcuma longa induction of oxidative damage to DNA (72.4 ± 0.51%) were obtained.

(Lown and Sim, 1977). Butkhup and Methanol extracts, water extracts and Samappito (2011) studied the volatile oils of the fresh rhizomes of antioxidant activity of Cucurma longa. Curcuma longa, was assessed for free Anticancer activity of the rhizomes of radical scavenging activity against 1,1- turmeric was evaluated in vitro using diphenyl-2-picrylhydrazyl (DPPH) tissue culture methods and in vivo in radical and cytotoxic activity against mice using Dalton's lymphoma cells MCF7 (breast adenocarcinoma) and grown as ascites form. Turmeric LS174T (colon adenocarcinoma) cell extract inhibited the cell growth in lines by Zaeoung et al. (2005). Chinese Hamster Ovary (CHO) cells at Methanol extract of Curcuma longa a concentration of 0.4 mg/ml and was exhibited the most pronounced radical cytotoxic to lymphocytes and Dalton's scavenging activity with an EC 50 lymphoma cells at the same value of 9.7 μg/ml, whereas the water concentration. The active constituent extracts and volatile oils showed weak was found to be 'curcumin' which activity. All volatile oils and the showed cytotoxicity to lymphocytes methanol extract of Curcuma longa and Dalton's lymphoma cells at a showed strong activity against MCF7 concentration of 4 micrograms/ml that and LS174T with IC50 less than 50 indicated that turmeric extract and μg/ml. ar-Turmerone, curcumin, curcumin reduced the development of demethoxycurcumin and animal tumours (Kuttan et al., 1985) bisdemethoxycurcumin were isolated

Sacchetti et al. (2005) evaluated the from the methanol extract of Curcuma

REVIEW OF LITERATURE 59 longa was the most potent compound as et h yl -p -methoxycinnamate for free radical scavenging activity. (31.77%), methylcinnamate (23.23%), Demethoxycurcumin was found to be carvone (11.13%), eucalyptol (9.59%) the most active compound against and pentadecane (6.41%), respectively.

LS174T with an IC50 value of 0.8 μg/ Rajendra et al. (2011), studied the ml and 6-shogaol was the most potent antioxidant activities of the extracts of compound against MCF7 with an IC50 Kaempheria galanga. The results value of 1.7 μg/ml. Roy and revealed the presence of sterols, Raychaudhury (2004) studied the Triterpenoids and resins in petroleum antiradical activity of in vitro ether extract, sterols, Triterpenoids, regenerated Curcuma longa. Flavanoids and resins in chloroform Tewtrakul et al. (2005) extracted extract, Steroids, Triterpenoids, volatile oil of dried rhizome of alkaloids, Flavanoids, carbohydrates, Kaempferia galanga obtained by water resins and proteins in methanolic distillation was determined for its extract. The water extract showed the chemical components using gas presence of saponins, carbohydrates chromatography and mass and proteins. However the tannin spectrometry (GC-MS). The major content was not detected from any of chemical constituents were identified the rhizome extracts.

Chapter 3 MATERIALS AND METHODS

3.1 Collection of germplasm part of the rhizomes were kept in the

Selected places of Jalpaiguri and green house of the department for Darjeeling district of West Bengal like regeneration and genetic diversity Lataguri, Dhupguri, Mohitnagar, studies. Gorubathan etc. were visited for the 3.3. In vitro culture studies germplasm collection of Zingiber 3.3 1. Media for in vitro culture officinale, Curcuma longa and The Z. officinale, C. longa and K. Kaempferia galanga. The field work galanga sprouts were cultured on was carried on during the harvest. Murashige & Skoog (Murashige and Essential field data related to different Skoog, 1962) basal media (Refer genera and cultivars were recorded in Appendix C for composition) and data sheets during the field study Gamborg B5 (Gamborg et al., 1968) (Refer Appendix B) which included media (Refer Appendix D for date and time of collection, habit, composition). The media were habitat and area of the vegetation. Plant supplemented with vitamins, sucrose, materials thus collected were planted in agar and plant growth regulators. the experimental garden for further Sucrose was used as the carbon source study. at the rate of 30 g/l, and agar-agar was 3.2 Maintenance of germplasm use to solidify the media at the rate of 8 The collected samples of the genera g/l. Filter sterilized benzyl amino under study were planted in separate purine (BAP 1, BAP 2, BAP 3, BAP 4 pots placed at experimental garden of and BAP 5 mg/l) (Sigma, Cat# B3408) Department of Botany for future use. A were added to the media after MATERIALS AND METHODS 61 autoclaving. BAP 4 mg/l + Kinetin 1, 2, 3 and 4 mg/l Sucrose was used as the carbon source 3.3.2 Sucrose for in vitro culture at the rate of 30 g/l and agar-agar was To assess ideal percentage of sucrose use to solidify the media at the rate of 8 required for growth of Z. officinale, C g/l. Plant growth regulators were added longa and K galanga, the sprouts were to the media after autoclaving. cultured on Murashige & Skoog 3.3.4 Secondary culture (Murashige and Skoog, 1962) basal media supplemented with vitamins, Subcultures to obtain maximum agar and cytokinins. Sucrose as the number of healthy shoots were carbon source was added at the rate of experimented by inoculating sets of 10, 20, 30 and 40 g/l. Benzyl amino explants in media. The regenerated purine was added to the media at the juvenile plantlets were collected from rate of 3 and 4 mg/l. the culture vessels and were subcultured in the Murashige & Skoog 3.3.3 Cytokinins on regeneration (Murashige and Skoog, 1962) media Efficacy of three important cytokinin supplemented with same like benzyl amino purine, kinetin and concentrations of sucrose, vitamins, zeatin were tested for the regeneration agar and plant growth regulators as of Z. officinale, C. longa and K. used in the media of primary culture. galanga. The sprouts were cultured on The MS media were supplemented Murashige and Skoog (Murashige and with cytokinines like benzyl amino Skoog, 1962) basal media purine at a concentration of 3 and 4 supplemented with vitamins, sucrose, mg/l for all the three genera. In agar and cytokinins in different addition to this the C. longa and K. concentrations and combinations. galanga explants were cultured on MS Cytokines viz. benzyl amino purine, media supplemented cytokinins like kinetin and zeatin were added at benzyl amino purine at different concentrations of 1, 2, 3, 4 and 5 mg/l. combinations and concentration as Combinations of benzyl amino purine shown below:- and kinetin were experimented in the BAP 3 mg/l + Kin 3 mg/l following concentrations:- BAP 3 mg/l + Kin 4 mg/l BAP 1 mg/l + Kinetin 1, 2, 3 and 4 mg/l BAP 3 mg/l + Kin 5 mg/l BAP 2 mg/l + Kinetin 1, 2, 3 and 4 mg/l Sucrose was used as the carbon source BAP 3 mg/l + Kinetin 1, 2, 3 and 4 mg/l

MATERIALS AND METHODS 62 at the rate of 30 g/l and agar-agar was  Sprouts were washed several times use to solidify the media at the rate of 8 with double distilled water to g/l. Plant growth regulators were added remove the traces of extran. to the media after autoclaving.  The explants were taken to laminar 3.3.5 Preparation of explants air flow cabinet and were dipped in 3.3.5.1 Sprouting of explants solution of Mercuric chloride [0.1 to 0.5 % (w/v)] (Merck India, Cat#  The rhizomes of Zingiber officinale 17524) for 10 minutes. cv Gorubathan, Curcuma longa cv Local (collected from Lataguri) and  The treated explants were washed Kaempferia galanga cv local were several times with sterile double washed thoroughly under running distilled water and dipped in 70% tap water to remove the soil from Ethyl alcohol for 1 minute. their surface.  The traces of Ethyl alcohol were  They were treated with Diathane M removed by washing them with 45 (1% in water) for 1 hour and sterile double distilled water for 5 were kept on trays filled with sand times. for sprouting.  The open ends of the explants were  The rhizomes sprouted within 2-4 cut off before inoculating in the weeks and the sprouts were used as culture media. explants.  Under aseptic condition of laminar 3.3.5.2 Sterilization of explants and air flow cabinet, the 1 to 2 mm of inoculation the basal region of the sprouts were gently placed on the gelled agar  The young sprouts (1 to 2 cm) of media of culture vessels. Zingiber officinale, Curcuma longa and Kaempferia galanga were 3.3.6. Growth conditions washed under running water to The inoculated culture vessels were remove the sand of the germinating kept at a temperature of 25 ± 2oC. tray. Photoperiod of 16 hours with a light

 The sprouts were dipped in the intensity of 2000-2500 Lux were solution of 1% Extran for 10 provided by cool white fluorescent minutes. tubular lamps.

MATERIALS AND METHODS 63

3.3.7. Subculture of plantlets Subsequently they were transferred

The plantlets regenerated from primary to bigger pots and then to the and secondary cultures were taken out garden. of the culture tubes without causing 3.3.9 Detection of disease free much damage to the plantlets. The rhizomes shoots were separated from each other Three diagnostic tests were performed and the dry or brown parts were to detect the presence or absence of the cleaned under aseptic conditions. They pathogen:- were reinoculated in the media 1. Rhizome pieces of these clones containing the same concentration and were transferred to PDA media (Potato combinations of plant growth -40%, Dextrose-2.5% and Agar-1.5%) regulator. and observed for 8 to 10 days for 3.3.8 Hardening of plantlets fungal growth on the medium; Healthy, in vitro grown plantlets of 2. Visual observations on the presence Zingiber officinale, Curcuma longa of symptoms were recorded throughout and Kaempferia galanga with good the growing season; number of roots were selected for 3. Rhizomes harvested from the tissue hardening. The plantlets were taken culture-derived plants were stored in out and washed carefully to remove river sand, and the number of rotted all traces of agar sticking to the and healthy rhizomes was recorded roots. after 6 months of storage. The individual plantlets were 3.3.10. In vitro regeneration of separated from each other and were different turmeric cultivars then transplanted into polycups containing a mixture of garden soil 3.3.10.1. Media for regeneration and sand (1:1). Regeneration potential of Curcuma longa cultivars was assessed. The They were kept covered with sprouts were cultured on Murashige & plastic bags with holes to provide Skoog (Murashige and Skoog, 1962) 60-70% relative humidity. basal media. The media were The plastic bags were removed supplemented with vitamins, and after 7-10 days and were sprinkled cytokinins. Sucrose was used as the with water on every alternate day.

MATERIALS AND METHODS 64 carbon source at the rate of 30 mg/l. washed under running water to The pH of media were adjusted to 5.7 remove the soil of the germinating on electronic pH meter by adding 0.1 tray.

(N) NaOH or HCl to the media. The  The sprouts were dipped in the culture media were solidified with agar solution of 1% Extran for 10 -agar at a concentration of 8 g/l. The minutes. media were sterilized at 121 ⁰C for 20  Sprouts were washed several times minutes at 1.08 Kg/cm2 pressure. with double distilled water to Sterilized media were transferred to remove the traces of extran. Laminar air flow cabinet and after a few minutes filter sterilized plant  The explants were taken to laminar growth regulators benzyl amino purine air flow cabinet and were dipped in (BAP 1, BAP 2, BAP 3, BAP 4 and solution of Mercuric chloride [0.1 BAP 5 mg/l) were added. The media to 0.5 (w/v)] for 10 minutes. were poured into sterile culture vessels.  The treated explants were washed 3.3.10.2. Preparation of explants of several times with sterile double turmeric cultivars distilled water and dipped in 70% Ethyl alcohol for 1 minute.  The rhizomes of different turmeric cultivars were washed several times  The traces of Ethyl alcohol were under running tap water to remove removed by washing them with the soil from their surface. sterile double distilled water for 5 times.  They were treated with Diathane M 45 (1% in water) for 1 hour and  The open ends of the explants were were kept on trays filled with sand cut off before inoculation in the for sprouting. culture media.

 The rhizomes sprouted within 2-4  1 to 2 mm of the basal region of the weeks and the sprouts were used as sprouts was gently placed on the explants. solidified agar media of culture vessels under aseptic condition on 3.3.10.3 Sterilization of explants and laminar air flow cabinet. inoculation 3.3.10.4 Growth conditions  The young sprouts (1 to 2 cm) of the genera under study were Please refer to section 3.3.6 for details.

MATERIALS AND METHODS 65

3.4 Diversity studies  An equal volume of chloroform

3.4.1 Isolation of genomic DNA from (Merck India, Cat#822265):isoamyl leaves of Curcuma longa - alcohol(Merck India, Cat#8.18969.1000) (24:1) was The leaves of all the 12 cultivars of C. added to the incubated Oakridge. longa were collected from the experimental garden of the laboratory.  The contents of the tubes were All these samples were washed to mixed by inversion for 15 min. remove dirt and other debris. After  The tubes were spin at 6,500 RPM cleaning, all these samples were taken at 25ºC for 15 min in a centrifuge for PCR based diversity studies. (REMI make, Model No.C-24) at Considering various factors, method of 25⁰C. The upper aqueous layer was Bousquet et al. (1990) was opted with transferred to a fresh Oakridge slight modifications. Isolation of DNA tube. from the leaves was carried out with  0.6 volume of ice cold Isopropanol following procedures: (Merck India, Cat#17813) was  Sliced leaf samples (6gm) of added to the upper aqueous phase. turmeric were ground to fine  The tubes were kept overnight at - powder in prechilled mortar and 20ºC. pestle with liquid nitrogen.  After overnight incubation, the  The ground samples were carefully mixture was centrifused at about transferred to prewarmed (at 65ºC) 6,500 rpm (5,000 xg) for 30 freshly prepared 18 ml CTAB DNA minutes at 4ºC. extraction buffer (Refer Appendix  The supernatant was discarded and E for composition) contained in an the pellet was washed in 70% Oakridge tube (Tarsons, ethanol. Cat#541040).  The pellet was dried in vacuum and  The Oakridge tubes containing dissolved in 500µl of 1X TE buffer ground samples dipped in DNA (pH 7.4) (Refer Appendix E for extraction buffer were incubated at composition). 65ºC in a water bath for 2 hours with occasional mixing by gentle  An equal volume of equilibrated swirling. phenol (pH 8.0) (Sigma,

MATERIALS AND METHODS 66

Cat#P4557-400ML), was added to contaminants like RNA, protein and the tube and was mixed well. polysaccharides. It is essential to

 The tubes after adding phenol were remove them as they hamper the centrifuged at 13,000 rpm (10,000 further downstream processing. xg) for 15 minutes. CTAB buffer eliminates polysaccharides from DNA to a large  The upper phase was collected. extent, but in isolated DNA from the  The upper phase was dissolved in leaves of Zingiberaceous plants starch equal volume of C:I and mixed residues are found intact with the well for 5 min. isolated DNA even after CTAB and  The mixture was centrifuged at phenol: chloroform treatment. 10,000 RPM at 20ºC for 15 min at Therefore peg purification of DNA is room temperature. necessary for complete elimination of

 The upper phase was collected in a polysaccharides. The RNA was fresh tube. removed by treating the sample with RNase enzyme. Extraction with  1/10 volume 3M Sodium acetate phenol: chloroform following RNase (SIGMA, Cat#S-9513) was added treatment was also employed for to the upper phase and mixed well. eliminating RNA and most of proteins.  Double volume of ice cold ethanol Following protocols were used to (BDH Cat#10107) was added to the purify DNA. mixture and keep 1 hour at -20ºC. 3.4.2.1 PEG purification of isolated  After incubation the mixture was DNA centrifuged (REMI make) at 13,000  30% W/V solution of PEG [Refer RPM at 4ºC for 30 min. Appendix E for composition] was  The supernatant was discarded and added to 1000µl of 1X TE buffer the pellet was washed in 70% (pH 7.4) containing DNA in a ethanol. microcentrifuge tube. The tube was  Finally, the pellet was dried in incubated at 0ºC for 14 hrs.

vacuum and dissolve in T E buffer.  The incubated mixture was 3.4.2 Purification of DNA centrifuged at 12,000 rpm (REMI

Crude DNA contains Major make, Model No.C-24) at 4ºC for

MATERIALS AND METHODS 67

30 min. min (sometimes C:I and P:C:I was

The pellet obtained was repeated twice to remove traces of resuspended in 500µl of 1X TE phenols mixed with DNA pellets) buffer. at room temperature.

To this resuspended pellet, 0.1 The aqueous phase was then volume of 3M sodium acetate (pH transferred to a fresh 5.5) and 2.5 volume of ice cold microcentrifuge tube (Tarsons, absolute ethanol was added for Cat#500010). DNA precipitation. Each sample was mixed with 1/10th

The mixture of solution was volume of 3M sodium – Acetate incubated overnight at -20ºC and and double volume of chilled after incubation it was centrifuged Ethanol and stored overnight in - at 13,000 rpm (13,500 xg) for 30 20°C for DNA to precipitate. minutes at 4ºC. The tubes with DNA sample were

Transparent DNA pellet was centrifuged at 13000 RPM for 30 obtained which was washed with minutes at 4°C. The supernatant 70% ethyl alcohol, air dried and was discarded; the pellets were finally dissolved in 500µl of 1XTE washed with 80% Ethanol and (pH 7.4) buffer completely dried as described above. 3.4.2.2 RNaseA treatment The completely dried DNA pellets RNaseA (50µg/ml) (SIGMA, were dissolved in 100µl 1X TE Cat#R-4875) was added to the buffer and stored at -20°C for genomic DNA dissolved in 500µl quantification. of 1X TE buffer (pH 7.4) and it was incubated at 37ºC for 1 hr in a Dry 3.4.3 Quantification of Curcuma water bath (GeNei TM make, longa DNA Cat#107173). Reliable measurements of DNA concentration are important for many Equal volume of Chloroform: applications in molecular biology Isoamyl alcohol (500µl) was then including amplification of target DNA mixed to each sample and by polymerase chain reaction and centrifuged at 10000 RPM for 10 complete digestion of DNA by

MATERIALS AND METHODS 68 restriction enzymes. DNA techniques. quantification is generally carried out 3.4.3.2 Gel analysis by spectrophotometric measurements  Agarose gel (0.8%, gelling or by agarose gel analysis. Both the temperature 36°C) (SIGMA, methods were employed in the present Cat#A9539) was casted in 0.5X study. TBE (Tris-Borate-EDTA) buffer 3.4.3.1 Spectrophotometric (Refer Appendix E for measurement composition) containing 0.5µg/ml  Spectrophotometer (Thermo UV1 Ethidium bromide (Himedia, spectrophotometer, Thermo Cat#RM813) on gel platform Electron Corporation, England, (100X70mm) (Tarsons, Cat#7024).

UK) was calibrated at 260nm as  Sample DNA (5µl) mixed with 3 µl well as 280nm by taking 600µl 1X of 6X gel loading dye (Refer TE buffer in a cuvette. Appendix E for composition) was  DNA (6µl diluted in 594µl of 1X loaded.

TE) was taken in the cuvette, mixed  Lambda DNA/EcoRI/HindIII properly and the optical density double digest (1µl) [GeNeiTM, (OD) was recorded at both 260nm Cat#106000] was loaded as and 280nm. molecular marker to determine the  DNA concentration was estimated molecular size of the adjacent by employing the following genomic DNA.

formula:  The gel was run at 40V for 1hr in a Amount of DNA (ng/ μ l ) Mini Submarine Gel OD 50 dilution factor Electrophoresis Unit (Tarsons,  260 1000 Cat#7030) with Electrophoresis  The quality of DNA was judged Power Supply Unit (Tarsons, from the OD values recorded at Cat#7090).

260nm and 280nm. The DNA  After the run time was over the gel showing A260/A280 ratio around 1.8 was visualized under UV light on a was chosen for further PCR UV Transilluminator (GeNeiTM, amplification using RAPD and Cat#SF850). ISSR markers and PCR-RFLP

MATERIALS AND METHODS 69

 The DNA quality was judged by Table 3.1: List of RAPD primers used Primer ID Sequence (5’-3’) presence of a single compact band OPA01 CAGGCCCTTC at the corresponding position to λ OPA03 AGTCAGCCAC OPA04 AATCGGGCTG DNA/EcoRI/HindIII double digest OPA05 ATTTTGCTTG OPA07 GAAACGGGTG indicating high molecular weight of OPA08 GTGACGTAGG OPA11 CAATCGCCGT the DNA. OPA17 GACCGCTTGT OPA20 GTTGCGATCC  The quantity of the DNA was OPB01 GTTTCGCTCC OPF09 CCAAGCTTCC estimated by comparing the sample OPG19 GTCAGGGCAA OPH04 GGAAGTCGCC DNA with the control by eye OPN04 GACCGACCCA OPN13 AGCGTCACTC judgment. OPN19 GTCCGTACTG OPA 02 TGCCGAGCTG  The pure DNA thus obtained was OPA 06 GGTCCCTGAC OPA09 GGGTAACGCC used for various fingerprinting OPA10 GTGATCGCAG studies. MGL01 GCGGCTGGAG MGL02 GGTGGGGACT MGL03 GTGACGCCGC 3.4.4 Gel photography: MGL04 GGGCAATGAT MGL05 CTCGGGTGGG The gel was placed over the TM transilluminator (Bangalore GeNei ™) 10 mer primers (GeNei ) were and photograph was taken using using screened for RAPD analysis (table an indigenously built gel 3.1). documentation system fitted with 3.4.5.2 RAPD-PCR amplification Cannon SLR camera (EOS350D) and 3.4.5.2.1 PCR mix for RAPD Marumi orange filter (58 mm YA2, In a sterile 0.2ml thin wall PCR tube Marumi, Japan). The software used (Tarsons, Cat#500050); 25µl of PCR was EOS utility. mixture was taken. For reaction 3.4.5 RAPD analysis of Curcuma mixture, the components were added in longa cultivars the following order: 3.4.5.1 Primer used  Pyrogen free water- To a final Polymerase Chain Reaction (PCR) volume of 25µl amplifications were performed with the  PCR master Mix 2X (GeNeiTM genomic DNA of the twelve different Cat# 610602200031730 Pl. No. cultivars of Curcuma longa by MME22): 12.5µl decamer primer. A total of 25 random  Primer -1.25µl (0.25 µM)

MATERIALS AND METHODS 70

 Template DNA -2µl (25ng) horizontal gel containing in 1.5% (w/v)

 One negative control was prepared. agarose (Sigma cat No A9414) gel and A tube with PCR mix but without 7µl Ethedium Bromide (3,8-Diamino-5 DNA. -ethyl-6-phenylphenanthridinium bromide) i.e. EtBr (Sigma cat No. 3.4.5.2.2 PCR amplification E1510). PCR was performed in thermal cycler For preparation of agarose gell, 1.5 (Perkin-Elmer make). Amplification g of agarose was dissolved in 100 ml of programme consisted of one initial double H2O and warmed until agarose cycle of denaturation at 94ºC for 4 min, powder got dissolved completely. After primer annealing at 37ºC for 1min., few minutes, 7µl of EtBr (0.5µg/ml) primer extension at 72ºC for 2min; was added to it and mixed gently, then followed by denaturation temperature it was poured over the gel casting tray at 94ºC for 1 minute, annealing with comb inserted to it. After the gel temperature at 37ºC for 1 minute, was solidified, the comb was removed extension temperature at 72ºC for 2 and the gel was shifted to the gel minutes and final denaturation at 94ºC loading tray (Tarsons) containing 0.5X for 1min., primer annealing at 37ºC for TBE (Tris Borate EDTA) buffer (pH- 1min. and primer extension at 72ºC for 8). A DNA ladder (λ DNA/EcoRI/ 10 min (table: 3.2). Total of 45 cycles HindIII double digest) (GeNeiTM, were run for amplification of DNA Cat#106000) and 100 bp DNA ladder samples isolated from Curcuma longa (GeNeiTM, Cat#612652670501730) using 10 mer RAPD primers. were used as a molecular size marker. 3.4.5.3 Agarose-gel electrophoresis of Simultaneously, 12µl of PCR products RAPD-PCR products: were mixed with 4µl of 6X Gel loading To check the efficiency of RAPD-PCR dye of Bromophenol Blue solution products, 12µl of PCR products mixed individually in all 12 (11 + 1control) with 4µl of 6X Gel loading dye (Refer samples, mixed thoroughly and loaded Appendix E for composition) were gently in the individual wells of the examined through electrophoresis on gel. Negative control was loaded in the

Table 3.2: PCR cycle for RAPD analysis of Curcuma longa cultivars Cycle Denaturation Primer annealing Primer extension 1 94ºC for 4min. 37ºC for 1min 72ºC for 2min. 2-44 94ºC for 1min. 37ºC for 1min., 72ºC for 2min. 45 94ºC for 1min. 37ºC for 1min. 72ºC for 10 min.

MATERIALS AND METHODS 71 last well. The power pack (Bangalore 3.4.6.2 ISSR-PCR amplification

GeNei ™) was set at 50V for 2.4 hrs. In a 0.2ml sterile PCR tube (Tarsons, All PCR reactions were run at least Cat#500050), 25µl of PCR mixture thrice. was taken, for which the components 3.4.5.4 Gel photography RAPD-PCR were added in the following order: products  Pyrogen free water- To a final The agarose gel after electrophoresis of volume of 25µl

RAPD-PCR products was placed over  PCR master Mix 2X (GeNeiTM Cat# the UV transilluminator (Bangalore 610602200031730 Pl. No. TM GeNei , Cat#107161) and photograph MME22): 12.5µl was taken using using an indigenously  Primer -1.25µl (0.25 µM) built gel documentation system fitted with Cannon SLR camera (EOS350D)  Template DNA -2µl (25ng) and Marumi orange filter (58 mm  One negative control tube was YA2, Marumi, Japan). The software prepared. PCR mix without DNA. used was EOS utility. The PCR reactions were performed on 3.4.6 ISSR (Inter Simple Sequence a Perkin-Elmer Thermocycler. The repeat) analysis of Curcuma longa amplification cycle consisted of the

3.4.6.1Primer used following specifications:

A total of 15 ISSR primers were Amplification program (table 3.4) screened for 12 different cultivars of consisted of one initial cycle of Curcuma which are listed in table.3.3. denaturation at 94ºC for 5 min, primer Table 3.3: List of primers used for ISSR analy- annealing at 52ºC for 1min., primer sis extension at 72ºC for 2min; followed Primer ID Sequence (5’-3’) UBC810 (GA)8T by denaturation temperature at 94ºC for UBC815 (CT)8G 45 seconds, annealing temperature at UBC818 (CA)8G UBC822 (TC)8A 52ºC for 1 minute, extension UBC824 (TC)8G UBC825 (AC)8T temperature at 72ºC for 1 minutes and UBC841 (GA)8YC UBC856 (AC)8YA final denaturation at 94ºC for 45 UBC873 (GACA)4 UBC807 (AG)8T seconds, primer annealing at 52ºC for UBC808 (AG)8C 1min. and primer extension at 72ºC for UBC811 (GA)8C UBC813 (CT)8T 7 min. Total of 35 cycles were run for UBC834 (AG )8YT UBC836 (AG)8YA

MATERIALS AND METHODS 72

Table 3.4: PCR cycle for ISSR analysis of Curcuma longa cultivars Cycle Denaturation Primer annealing Primer extension 1 94ºC for 5min. 52ºC for 1min. 72ºC for 2min. 2-34 94ºC for 45 seconds 52ºC for 1min. 72ºC for 1min.

35 94ºC for 45 seconds 52ºC for 1min. 72ºC for 7 min. amplification of DNA samples isolated 8). A DNA ladder (λ DNA/EcoRI/ from Curcuma using ISSR primers. HindIII double digest) (GeNeiTM,

3.4.6.3 Agarose-gel electrophoresis of Cat#106000) and 100 bp DNA ladder TM ISSR-PCR products (GeNei , Cat#612652670501730) were used as a molecular size marker. To check the efficiency of ISSR-PCR Simultaneously, 12µl of PCR products products, 12µl of PCR products mixed were mixed with 4µl of 6X Gel loading with 4µl of 6X Gel loading dye (Refer dye of Bromophenol Blue solution Appendix E for composition) were individually in all 12 (11 + 1control) examined through electrophoresis on samples, mixed thoroughly and loaded horizontal gel containing in 1.5% (w/v) gently in the individual wells of the agarose (Sigma cat No A9414) gel and gel. Negative control was loaded in the 7µl Ethedium Bromide (3,8-Diamino-5 last well. The power pack (Bangalore -ethyl-6-phenylphenanthridinium GeNei ™) was set at 50V for 2.4 hrs. bromide) i.e. EtBr (Sigma cat No. All PCR reactions were run at least E1510). thrice. For preparation of agarose gell, 1.5 g 3.4.6.4 Gel photography of ISSR-PCR of agarose was dissolved in 100 ml of products double H2O and warmed until agarose powder got dissolved completely. After The agarose gel after electrophoresis of few minutes, 7µl of EtBr (0.5µg/ml) ISSR-PCR products was placed over was added to it and mixed gently, then the UV transilluminator (Bangalore TM it was poured over the gel casting tray GeNei , Cat#107161) and photograph with comb inserted to it. After the gel was taken using using an indigenously was solidified, the comb was removed built gel documentation system fitted and the gel was shifted to the gel with Cannon SLR camera (EOS350D) loading tray (Tarsons) containing 0.5X and Marumi orange filter (58 mm TBE (Tris Borate EDTA) buffer (pH- YA2, Marumi, Japan). The software used was EOS utility.

MATERIALS AND METHODS 73

batch file following the software Table 3.5: List of trnL-trnF primers used Primer Sequence (5’-3’) package NTSYSpc. Tab c CGAAATCGGTAGACGCTACG Tab f ATTTGAACTGGTGACACGAG 3.4.8 PCR of trnL-trnF region of 3.4.7 Fingerprinting data analysis Curcuma longa

Each polymorphic band was regarded 3.4.8.1 Primers used as a binary character and was scored as Tab c-f in (Taberlet et al., 1991) region 1 (presence) or 0 (absence) for each of the Curcuma longa genome was sample and assembled in a data matrix. amplified. The primer sequences were A similarity matrix on the basis of used on the basis of the known band sharing was calculated from the sequence from the Taberlet region of binary data using Dice coefficient (Nei the other plant species (table 3.5). A & Li, 1979). Similarities were schematic representation of the primer graphically expressed using the group location is shown in figure 3.2. average agglomerative clustering to 3.4.8.1.1 PCR mix for amplification of generate dendrograms. The analysis trnL-trnF region was done using the software package In a 0.2ml sterile PCR tube (Tarsons, NTSYSpc (version 2.0) (Rohlf, 1998). Cat#500050), 25µl of PCR mixture Correspondence analysis (2D and 3D was taken, for which the components plot) of right vectors from the binary were added in the following order: data was performed to graphically  Pyrogen free water- To a final summarize associations among the volume of 25µl varieties. Analysis was done through a

 PCR master Mix 2X (GeNeiTM Cat#

trn F (GAA) F trn

trn T (UGU) trn exon 5' L (UAA) trn exon 3' L (UAA) trn

a → c → e → ← b ← d ← f Figure 3.1: Schematic representation of the Tab c-f primer location

MATERIALS AND METHODS 74

610602200031730 Pl. No. MME22): products, 10µl of PCR products mixed 12.5µl with 3µl of 6X Gel loading dye (Refer

 Primer -1.25µl (0.25 µM) Appendix E for composition) were examined through electrophoresis on  Template DNA -2µl (25ng) horizontal gel containing in 1.8% (w/v)  One negative control tube was agarose (Sigma cat No A9414) gel and prepared. PCR mix without DNA. 7µl Ethedium Bromide (3,8-Diamino-5 3.4.8.1.2 PCR amplification of trnL- -ethyl-6-phenylphenanthridinium trnF region bromide) i.e. EtBr (Sigma cat No.

PCR was performed in thermal cycler E1510). (Perkin-Elmer make). Amplification 3.4.8.3 Gel photography of trnL-trnF programme consisted of one initial region-PCR products cycle of denaturation at 95ºC for 5 min, The agarose gel after electrophoresis of primer annealing at 50ºC for 45s, PCR products was placed over the UV primer extension at 72ºC for 2min; transilluminator (Bangalore GeNeiTM, followed by denaturation temperature Cat#107161) and photograph was at 95ºC for 45 seconds, annealing taken using using an indigenously built temperature at 50ºC for 45s, extension gel documentation system fitted with temperature at 72ºC for 2 minutes and Cannon SLR camera (EOS350D) and final denaturation at 95ºC for 45 Marumi orange filter (58 mm YA2, seconds, primer annealing at 50ºC for Marumi, Japan). The software used 45s and primer extension at 72ºC for 7 was EOS utility. min (table:3.6). Total of 35 cycles were 3.4.9 Sequence analysis run for amplification of DNA samples isolated from Curcuma using trnL-trnF Two (1 forward and 1 reverse) primers. sequences were received from the Chromous Biotech, Bangalore. The 3.4.8.2 Agarose-gel electrophoresis of resultant sequences were individually trnL-trnF region-PCR products compared with the equivalent To check the efficiency of PCR sequences from a range of Curcuma

Table 3.6: PCR cycle for amplification of trnL-trnF region Cycle Denaturation Primer annealing Primer extension 1 95ºC for 5min. 50ºC for 45s 72ºC for 2min. 2-34 95ºC for 45 seconds 50ºC for 45s 72ºC for 2min. 35 95ºC for 45 seconds 50ºC for 45s 72ºC for 7 min.

MATERIALS AND METHODS 75 longa and other members of subculture of shoots derived from its Zingiberaceae present in sequence single explant of primary culture. After banks using Basic Local Alignment two subcultures about 50 plantlets of Search Tool (BLAST) (Altschul et al., each genus were regenerated. For 1990) obtained from National Centre hardening plantlets with good number for Biotechnology Information (NCBI) of roots were selected. They were web site (http://blast.ncbi.nlm.nih.gov/ taken out and washed carefully to Blast.cgi). remove all traces of agar sticking to the

3.4.9.1 Sequence submission in public roots. The individual plantlets were domain then transplanted into polycups containing a mixture of garden soil and The sequences of Curcuma longa were sand (1:1). They were kept covered documented with the help of Sequin with plastic bags with holes to provide Application Version 12.30 Standard 60-70% relative humidity. The plastic Release [Nov 13, 2012] for Database bags were removed after 7-10 days and submission to GenBank providing were sprinkled with water on every necessary information’s like, definition alternate day. Finally they were of the sequence (i.e. the specific region transferred to bigger pots. of the genome), source of the sequence (chloroplast DNA in this case; name of 3.4.10.2. Isolation of genomic DNA the plant species along with its from the in vitro regenerated plantlets taxonomic position, date and place of The genomic DNA of in vitro leaves collection, tissue type etc.). was isolated using Genelute Plant

3.4.10. Somaclonal variations among Genomic DNA kit (Sigma Cat# G2N- the in vitro regenerated plantlets 70) as follows:

3.4.10.1 In vitro culture 100mg leaves of hardened in vitro regenerated plantlets were ground The standard protocol of into fine powder `in a small mortar micropropagating Zingiber officinale, and pestle using liquid nitrogen. Curcuma longa and Kaempferia galanga plants through shoot bud The ground plant tissue was then explant culture were used for the lysed using 350µl of lysis solution regeneration of plantlets. In all the (Part A) and 50µl of lysis solution genera, plantlets were developed from (Part B) and mixed thoroughly by

MATERIALS AND METHODS 76

inversion and incubated at 65ºC for  Finally 100µl of elution solution 10 min. (pre-warmed at 65ºC) was added to

 After incubation 130µl the column and centrifuged at precipitation solution was added, 12,000 rpm (13,500 xg) for 1 min. mixed by inversion and incubated The filtrated contained the pure on ice for 5 min to pellet debris. genomic DNA. The supernatant was transferred to 3.4.10.3 RAPD analysis

blue filtration column and Please refer to section 3.4.5 for details. centrifuged at 12,000 rpm (13,500 3.4.10.4 ISSR analysis xg) for 1 min. Please refer to section 3.4.6 for details.  To the filtrate 700µl of binding solution was added and mixed 3.5 Antioxidants studies thoroughly by inversion. The 3.5 1 Extraction of plant material

mixture was then transferred to  Rhizomes of Z. officinale, C. longa binding column (prepared by or K. galanga were collected from adding 500µl of column the experimental garden at full preparation solution to the binding maturity. column and spinning for 1 min and  The rhizomes were thoroughly discarding the flow-through) and washed under running tap water to centrifuged for 1 min at 12,000 rpm remove the dirt and garden soil. (13,500 xg) and the flow through  The dry scaly leaves were removed was discarded. The process was and the dry epidermal layers were repeated with the remaining peeled off. mixture. The column was then transferred to a new collection tube.  The rhizome pieces were washed with distilled water.  Then 500µl of wash solution (containing ethanol) was added to  30 g of the sliced rhizomes of each the column and centrifuge at genera were taken and were 12,000 rpm (13,500 xg) for 1 min. crushed in a mechanical grinder.

The column was then transferred to  The crushed rhizome was subjected a new collection tube. The process to soxhalation and exhaustively was repeated where the spinning extracted with methanol for 8 time was increased to 3 minutes.

MATERIALS AND METHODS 77

hours.  The dried fractions were dissolved

 The extracts were evaporated at in 10 ml methanol. 50oC to make to a final volume of 3  The methanol insoluble fractions if ml. any were dissolved in the solvent

3.5.2 Preparation of solvent fractions by which it was extracted.

 Column chromatography was  All the fractions were stored in o performed using a glass column airtight tubes at 25 ± 2 C. apparatus (local made) filled with 3.5.3 Free radical scavenging activity

silica [Merck, 200-400 mesh] at a Free radical scavenging activities of height of 50cm. different fractions were tested in  3 ml of the extracts were poured on models for different radicals’ viz. the silica column. antiradical activity, hydroxyl radical

 A series of non polar to polar and nitric oxide. Effect on lipid solvents (table:3.7) like hexane, peroxidation was evaluated on goat benzene, chloroform, diethyl ether, liver homogenate. The reaction ethyl acetate, acetone, ethanol, mixtures of different assays are given methanol and water in different below. ratio were passed through the silica 3.5.3.1 Assay of antiradical activity column to obtain the fractions of with DPPH

Zingiber and Curcuma. In case of Antiradical activities of different Kaempferia non polar to polar fractions of Z. officinale, C. longa and solvents (table:3.7) like K. galanga were measured by a chloroform, diethyl ether, ethyl decrease in absorbance at 517 nm of acetate, acetone, ethanol, methanol methanolic solution of coloured DPPH and water in different ratio were brought about by the sample. passed through the silica column to 3.5.3.1.1 Reaction mixture of the obtain the fractions. extracts  The solvent fractions of Zingiber, Reaction mixtures were prepared by Curcuma and Kaempferia thus adding100 µl of the Zingiber officinale, obtained were vacuum evaporated Curcuma longa and Kaempferia at low temperature to make them galanga extracts to 2900 µl, DPPH dry.

MATERIALS AND METHODS 78

Table 3.7: Solvents for silica gel column chromatography of Z. officinale, C. longa and K. galanga Fraction Solvent I Quantity Solvent II Quantity Total 1 Hexane 200 ml ------200 ml 2 Hexane 150 ml Benzene 50 ml 200 ml 3 Hexane 100 ml Benzene 100 ml 200 ml 4 Hexane 50 ml Benzene 150 ml 200 ml 5 Benzene 200 ml ------200 ml 6 Benzene 150 ml Chloroform 50 ml 200 ml 7 Benzene 100 ml Chloroform 100 ml 200 ml 8 Benzene 50 ml Chloroform 150 ml 200 ml 9 Chloroform 200 ml ------200 ml 10 Chloroform 150 ml Diethyl ether 50 ml 200 ml 11 Chloroform 100 ml Diethyl ether 100 ml 200 ml 12 Chloroform 50 ml Diethyl ether 150 ml 200 ml 13 Diethyl ether 200 ml ------200 ml 14 Diethyl ether 150 ml Ethyl acetate 50 ml 200 ml 15 Diethyl ether 100 ml Ethyl acetate 100 ml 200 ml 16 Diethyl ether 50 ml Ethyl acetate 150 ml 200 ml 17 Ethyl acetate 200 ml ------200 ml 18 Ethyl acetate 150 ml Acetone 50 ml 200 ml 19 Ethyl acetate 100 ml Acetone 100 ml 200 ml 20 Ethyl acetate 50 ml Acetone 150 ml 200 ml 21 Acetone 200 ml ------200 ml 22 Acetone 150 ml Ethanol 50 ml 200 ml 23 Acetone 100 ml Ethanol 100 ml 200 ml 24 Acetone 50 ml Ethanol 150 ml 200 ml 25 Ethanol 200 ml ------200 ml 26 Ethanol 150 ml Methanol 50 ml 200 ml 27 Ethanol 100 ml Methanol 100 ml 200 ml 28 Ethanol 50 ml Methanol 150 ml 200 ml 29 Methanol 200 ml ------200 ml 30 Methanol 150 ml Water 50 ml 200 ml 31 Methanol 100 ml Water 100 ml 200 ml 32 Methanol 50 ml Water 150 ml 200 ml 33 Water 200 ml ------200 ml solution. The mother stocks of the (3 mg/µl) were added to 2900 µl of extracts were at a concentration of 3 DPPH solution. The reaction mixtures mg/µl. were kept undisturbed for 30 minutes.

3.5.3.1.2 Measurement and calculation Decrease in the absorbance in presence of the different fractions was noted Antiradical activity was measured by a after 30 min in a Spectrophotometer decrease in absorbance at 517 nm of (Thermo UV1 spectrophotometer, methanolic solution of coloured DPPH Thermo Electron Corporation, brought about by the sample (Vani et England, UK). Percentages of DPPH al., 1997 and Ravishankar et al., 2002). scavenging activity were calculated as: A fresh solution of DPPH was prepared - {1-(optical density of sample/optical by adding 0.00394g of DPPH to 100 density of control) x 100} ml of methanol. 100 µl of the fractions

MATERIALS AND METHODS 79

+3 3.5.4 Determination of IC50 generated from the Fe /ascorbate/

The fractions showing maximum EDTA/H2O2 system. The hydroxyl antiradical responses were diluted to radical attacks deoxyribose, which different concentrations and their results in thiobarbituric acid reacting antiradical activities were observed. substance (TBARS) formation. The reaction mixture contained deoxyribose IC50 was calculated from graphical presentation of concentration verses (2.8 mM), FeCl3 (0.1mM), EDTA radical scavenging activity. Antiradical (0.1mM), H2O2(1mM), ascorbic acid activity was measured by a decrease in (0.1mM), KH2PO4 – KOH buffer (20 absorbance at 517 nm of methanolic mM) and various concentrations of solution of coloured DPPH. A stock extract (The reaction mixture of solution of DPPH (100µm) in methanol contained 3, 30 and 300 mg/ml of fresh was prepared. 100 µl of the fractions (3 rhizome of Z. officinale, C. longa and mg/µl) were added to 2900 µl of DPPH K. galanga in a final volume of 1 ml. solution. The reaction mixtures were The reaction mixtures were incubated o kept undisturbed for 30 minutes. for 1 hour at 37 C. Deoxyribose Decrease in the absorbance in presence degradation was measured as TBARS of the different fractions was noted at 532 nm. Percentage inhibition was after 30 min in a Spectrophotometer calculated as:- (Thermo UV1 spectrophotometer, {1-(optical density of sample/optical Thermo Electron Corporation, density of control) x 100}

England, UK). Percentages of DPPH 3.5.6 Assay of nitric oxide scavenging scavenging activity were calculated as: activity - {1-(optical density of sample/optical Nitric oxide scavenging activity was density of control) x 100} measured following Bagul et al. 3.5.5Assay of hydroxyl radical (2005). Sodium nitroprusside (10mM) scavenging activity in phosphate buffered saline was mixed Hydroxyl radical scavenging assay was with 3, 30 and 300 mg/ml of fresh measured according to Elizabeth and rhizome of Z. officinale, C. longa and Rao (1990). Scavenging activity was K. galanga dissolved in methanol. The measured by studying the competition mixture was incubated at room between deoxyribose and the test temperature for 150 minute. The same compounds for hydroxyl radical reaction mixture without the sample

MATERIALS AND METHODS 80 but equivalent amount of solvent -butanol and pyridine (15:1 v/v) were served as control. After incubation, 0.5 added to the mixtures and shaken ml Griess reagent (1% sulphanilamide, vigorously. The mixtures were

2% H3PO4 ad 0.1% naphthylene centrifuged. The absorbance of the diamine dihydrochloride) was added to organic layer was measured at 532 nm. the mixture. The absorbance of the Percentage inhibition was calculated as chromophore formed during {1-(optical density of sample/optical diazotization of nitrite with density of control) x 100}. The sulphanilamide and subsequent percentage inhibition of lipid coupling with naphthylene diamine peroxidation was determined by was read at 546 nm. Percentage comparing the result of the test inhibition was calculated as :- compounds with those of controls.

{1-(optical density of sample/optical 3.5.8 Detection of compounds density of control) x 100}. The bioactive fractions were analyzed

3.5.7 Determination of lipid on Silica Gel 60 F254 –precoated TLC peroxidation activity plates (0.25 mm thickness). 1 mg. of

Inhibition of lipid peroxidation activity component was dissolved in 1 ml. was worked out following the protocol methanol; 10 µl was used for TLC. of Ohkawa et al. (1979). The same Compounds were separated through reaction mixture without the extracts hexane-diethyl ether (40:60) solvent was used as control. The lipid peroxide and detected under UV light (254 nm) formed was measured by TBARS. and ammonia vapour. For spraying, Incubation mixtures (0.4 ml) were Bartons reagent, Berlin blue reagent, treated with sodium dodecyl sulphate Iodine reagent, NP/PEG reagent and (SDS-8.1%, 0.2 ml), thiobarbituric acid Phenol reagents were used. (TBA-0.1%, 1.5 ml) and acetic acid 3.5.9 Comparative study of antiradical (20%, 1.5 ml, pH -3.5). The total activity of the genera volume was made up to 4 ml with 3.5.9.1 Extraction of plant material distilled water. The mixture was kept Rhizomes of Z. officinale, C. longa and in water bath at 100oC for 1 hour. After K. galanga were collected from the 1 hour the incubated mixture was experimental garden at full maturity. cooled to room temperature. 1 ml of The rhizomes were thoroughly washed distilled water and 5 ml of mixture of n

MATERIALS AND METHODS 81 under running tap water to remove the Reaction mixtures were prepared by dirt and garden soil. The dry scaly adding 300 µl of the extracts (1 mg/µl) leaves were removed and the dry Antiradical activity was measured by a epidermal layers were peeled off. The decrease in absorbance at 517 nm of rhizome pieces were washed with methanolic solution of coloured DPPH distilled water. brought about by the sample (Vani et

 3 g of the sliced rhizomes of each al., 1997 and Ravishankar et al., 2002). genera were taken and were A fresh solution of DPPH was prepared crushed in a mortar and pestle. by adding 0.00394g of DPPH to 100 ml of methanol. 300 µl of the fractions  The crushed rhizomes were (1 mg/µl) were added to 2700 µl of separately extracted with 10 ml of DPPH solution. The reaction mixtures diethyl ether : ethyl acetate (3:1), were kept undisturbed for 30 minutes. diethyl ether : ethyl acetate (1:1) Decrease in the absorbance in presence and acetone for 48 hours at room of the different fractions was noted temperature. after 30 min in a Spectrophotometer  The extracts were evaporated at (Thermo UV1 spectrophotometer, o 50 C. Thermo Electron Corporation,  The dry extracts were dissolved in England, UK). Percentages of DPPH methanol to make to a final volume scavenging activity were calculated as: of 1ml. {1-(optical density of sample/optical

 All the fractions were stored at 25 density of control) x 100} ± 2oC. 3.5.10 Assay of antiradical activity of

3.5.9.2Assay of comparative turmeric with DPPH antiradical activity of Zingiber Antiradical activity of the rhizome of officinale, Curcuma longa and Curcuma longa cultivars were Kaempferia galanga subjected to DPPH to detect their

Comparative antiradical activities of degree of free radical scavenging different fractions of Z. officinale, C. activity. longa and K. galanga were measured 3.5.10.1 Preparation of rhizome by a decrease in absorbance at 517 nm extracts of methanolic solution of coloured Rhizomes of different Curcuma longa DPPH brought about by the sample.

MATERIALS AND METHODS 82 cultivars were collected from the 3.5.10.2 Measurement and calculation experimental garden at full maturity. Reaction mixtures were prepared by The rhizomes were thoroughly washed adding 100 µl extracts (1 mg/µl) of the under running tap water to remove the Curcuma longa cultivar. Activity was dirt and garden soil. The dry scaly measured by absorbance at 517 nm of leaves were removed and the dry methanolic solution of coloured DPPH epidermal layers were peeled off. The (Vani et al., 1997 and Ravishankar et rhizome pieces were washed with al., 2002). A fresh solution of DPPH distilled water. was prepared by adding 0.00394g of 20 g of dry rhizomes of different DPPH to 100 ml of methanol. 100 µl of turmeric varieties were cut into small the fractions (1 mg/µl) were added to pieces and crushed in a mechanical 2900 µl of DPPH solution. The grinder. The crushed plant materials reaction mixtures were kept were divided into two parts, dipped in undisturbed for 30 minutes. Decrease methanol and water. The extracts in the absorbance in presence of the dipped in methanol and water was kept different fractions was noted after 30 undisturbed for 48 hours. The extracts min in a Spectrophotometer. were centrifuged at 6000 RPM for 10 Percentages of DPPH scavenging minutes. The supernatants were activity were calculated as {1-(optical collected. The supernatants were density of sample/optical density of diluted to make a concentration of 1 control) x 100}. mg/µl.

Chapter 4 RESULTS AND DISCUSSION 4.1 Germplasm collection meristems and can grow into plantlets.

Collection of samples from different These properties of the sprouts were places of Darjeeling (Gorubathan), considered for using them as explant. Jalpaiguri (Lataguri, Dhupguri and Further, addition of culture medium Mohitnagar) and other districts of West containing inorganic and organic Bengal resulted in the collection of nutrients along with ambient growth Zingiber officinale, Curcuma longa conditions enhances the growth. The and Kaempferia galanga (table 4.1). In superiority of using rhizome buds has all the cases the rhizomes were been expressed in regeneration of Z. collected from the fields just after officinale (Balachandran et al., 1990; harvest. The rhizome samples were Shirgurkar et al., 2001; Sit et al., 2005; planted in separate plots at the Bhattacharya and Sen, 2006), C. longa experimental garden of Department of (Nadagouda et al., 1978; Kuruvinshetti Botany, University of North Bengal and Iyer, 1981; Shetty et al., 1982; and were maintained for the Sunitibala et al., 2001; Salvi, et al., downstream experiments. 2002; Rahaman et al., 2004; Gayatri and Kavyashree, 2005; Behera et al., 4.2 Micropropagation studies 2010 ) and K. galanga (Shirin et al., 4.2.1 Explant selection 2000; Swapna et al., 2004; Chirangini In Micropropagation studies rhizome et al., 2005; Bhattacharya and Sen, sprouts measuring 1-2 cm were used as 2013). explants for in vitro regeneration of 4.2.2 Establishment of aseptic culture Zingiber officinale, Curcuma longa The Zingiber officinale, Curcuma and Kaempferia galanga (figure 4.1). longa and Kaempferia galanga The rhizome sprouts have active explants responded within 2-3 weeks RESULTS AND DISCUSSION 84

Table 4.1: List of germplasm collected for the study. Sample ID Name Collected from Z Zingiber officinale Rosc. cv Gorubathan Gorubathan T 1 Curcuma longa L. cv Local Lataguri T 2 Curcuma longa L. cv Local Dhupguri Central Plantation Crops Research T 3 Curcuma longa L. cv Prova Institute, Mohitnagar, Jalpaiguri T 4 Curcuma longa L. cv Suguna " T 5 Curcuma longa L. cv TC Assam " T 6 Curcuma longa L. cv Allepy " T 7 Curcuma longa L. cv Kasturi " T 8 Curcuma longa L. cv CLS2A " T 9 Curcuma longa L. cv Suvarna " T 10 Curcuma longa L. cv Roma " T 11 Curcuma longa L. cv Sudarshana " T 12 Curcuma longa L. cv PTC 13 " Zonal Horticulture Department, Mohit- K Kaempferia galanga L. cv Local nagar, Jalpaiguri of inoculation in the culture medium. al., 1990; Dekker et al., 1991; Bacterial, fungal contamination and Shirgurkar et al., 2001; Sunitibala et browning of explants occurred within al., 2001; Salvi et al., 2002; Rahman et the 1st three weeks of culture al., 2004). inoculation. 28%, 37% and 32% of Z. In the present study 0.1% to 0.5% officinale, C. longa and K. galanga mercuric chloride followed by 70% explant respectively were discarded ethanol was used to surface sterilize the after 21 days of culture. In ginger a explants. Different authors have high degree of contamination was reported, differential response of reported by Hosoki and Sagawa mercuric chloride used for different (1977). The difficulty in establishment durations, to get contaminant free of contamination-free in vitro cultures cultures. Raju et al. (2005) was of Curcuma longa was also reported by successful using 0.1 per cent HgCl2 for several groups (Nadgauda et al., 1978; 15 minutes, while, Rahman et al. Yasuda et al., 1988; Balachandran et (2004) used 0.1 per cent HgCl2 for 14

(a) (b) (c) Figure 4.1: Explants used for in vitro studies (a) Zingiber officiinale. (b) Curcuma longa. (c) Kaempferia galanga

RESULTS AND DISCUSSION 85 minutes to establish aseptic cultures in chloride. Concentrations of mercuric turmeric. These findings are in chloride above 2mg//l delayed conformity with the results obtained by sprouting while concentrations below it de Lange et al. (1987) in ginger were not be able to properly sterilize regeneration. In our experiments with the inoculums. So, surface sterilization medicinal zingibers surface with 0.2% mercuric chloride for ten sterilization with 0.2% mercuric minutes followed by 70% ethanol for chloride for ten minutes followed by one minute was considered best for all 70% ethanol for one minute showed the genera under study. extremely low rate of contamination. 4.2.3 Initiation of shoots and roots Similar results were observed in Z. Shoot and root initiation are influenced officinale (Sit et al., 2005 and by the quantity of growth regulators Bhattacharya and Sen, 2006) C. longa supplied to the medium, if other (Naz et al., 2009) and K. galanga growth conditions are kept constant (Bhattacharya and Sen, 2013) tissue (table 4.2 and figure 4.2). In culture. Though early sprouting and regeneration of Z. officinale, C. longa less browning of the explant buds and K. galanga by using rhizome bud occurred when the explants were as an explant at least 21±4, 19±2 and treated with lower concentration of 25±3 days respectively were required mercuric chloride but the percentage of bacterial and fungal contaminations Table 4.2: Days required for shoot and root initiation. Results are average of 30 replicates. were very high. Almost similar effect BAP Duration of initiation (Days) of mercuric chloride was observed in (mg/L) Shoot Root Zingiber officinale regeneration of the three genera- 1 60±2 68±6 2 45±4 51±5 Zingiber officinale, Curcuma longa 3 38±4 42±5 and Kaempferia galanga. It was 4 24±3 38±7 5 21±4 36±6 observed that, the number of days Curcuma longa 1 56±4 61±4 required for shoot and root initiation 2 43±3 47±5 3 32±3 36±5 increased with the increase in the 4 21±2 28±4 5 19±2 27±6 concentration of mercuric chloride. Kaempferia galanga This may be due to cell death of 1 64±5 71±5 2 48±6 53±4 explants during surface sterilization 3 43±4 49±7 4 28±2 36±4 with higher concentrations of mercuric 5 25±3 34±3

RESULTS AND DISCUSSION 86 for shoot initiation while 36±6, 27±6 4.2.4 Micropropagation medium and 34±3 days respectively were Medium formulations form one the required for initiation of root important basis for tissue culture respectively. In ginger plantlets experiments. Regeneration of plantlets regeneration a maximum number of varied with the medium and plant days required for shoot and root growth regulators (table 4.3). initiation was 60±2 and 68±6 Regeneration of Zingiber officinale, respectively. In turmeric plantlets using Murashige & Skoog medium regeneration a maximum number of supplemented with 4 mg/l BAP days required for shoot and root showed the maximum rate of shooting initiation was 56±4 and 61±4 (8.33) and rooting (20.06) per explant, respectively, while in K. galanga it was whereas, in the Gamborg B5 medium 64±5 and 71±5 respectively. In the maximum shooting (4.67) was cultures of C. longa, Rahman et al. observed when the medium was (2004) observed shoot initiation around supplemented with 4 mg/l BAP and 3 weeks after inoculation. maximum rooting was observed (5.80) In this study, it was observed that with with 2 mg/l BAP. In regeneration of the increase of concentrations of Curcuma longa, Murashige & Skoog growth regulator (BAP), the duration medium supplemented with 3 mg/l for shoot and root initiation decreased. BAP showed the maximum rate of At the same time, in all the cases the shooting (9.08) and rooting (13.39) per time duration required for the initiation explant, whereas, in the Gamborg B5 of roots were more than that of the time medium, maximum shooting (6.19) required for the initiation of shoots. was observed when the medium was

(a) (b) (c)

Figure 4.2: Initiation of shoot bud formation after 6 weeks of inoculation. (a). Zingiber officinale. (b) Curcuma longa. (c) Kaempferia galanga

RESULTS AND DISCUSSION 87

Table 4.3: Effect of culture medium on regeneration of Z. officinale, C. longa and K. galanga. Average of 20 replicates. BAP Zingiber officinale Curcuma longa Kaempferia galanga (mg/l) Shoots* Roots# Shoots* Roots# Shoots* Roots# Murashige and Skoog medium 1 2.73±0.25 5.87±0.25 3.50±0.19 6.31±0.41 1.91±0.12 2.84±0.36 2 4.66±0.05 8.40±0.33 6.11±0.43 8.64±0.28 2.03±0.10 4.63±0.41 3 6.26±0.57 13.20±0.18 9.08±0.57 13.39±0.36 3.17±0.11 6.15±0.44 4 8.33±0.41 20.06±0.22 8.41±0.28 12.48±0.14 4.33±0.11 6.83±0.23 5 6.50±0.34 18.21±0.17 7.80±0.71 10.56±0.29 3.00±0.12 5.65±0.21 Gamborg B5 medium 1 1.45±0.25 3.48±0.47 2.81±0.32 4.36±0.32 1.56±0.26 3.24±0.19 2 2.40±0.33 5.80±0.28 4.63±0.40 5.15±0.46 1.85±0.34 4.61±0.24 3 3.20±0.16 4.73±0.25 6.19±0.53 5.65±0.18 2.64±0.27 5.16±0.30 4 4.67±0.25 3.00±0.43 6.55±0.14 6.13±0.27 3.28±0.14 4.84±0.49 5 3.47±0.34 2.40±0.32 5.63±0.23 4.14±0.18 2.78±0.11 4.02±0.38 Shoots*= Shoot per explant and Roots#= Roots per explant supplemented with 3 mg/l BAP and regenerate pathogen-free ginger maximum rooting (6.13) with 4 mg/l plantlets.

BAP. The response of Kaempferia 4.2.5 Sucrose on regeneration galanga to MS medium supplemented Regenerated Zingiber officinale, with 4 mg/l BAP showed the maximum Curcuma longa and Kaempferia rate of shooting (4.33) and rooting galanga plantlets subcultured in MS (6.83) per explant, whereas, in the medium supplemented with different Gamborg B5 maximum shooting (3.28) percentage of sucrose and BAP showed was observed when the medium was variable number of shoots and roots supplemented with 4 mg/l BAP and (table 4.4). The three genera under maximum rooting (5.16) with 3 mg/l study, showed better regeneration in BAP. The results reveal that Murashige the medium supplemented with 3% and Skoog medium showed sucrose and 3 to 4 mg/l BAP. Z. comparatively better results than officinale explants produced maximum Gamborg B5 in regeneration of number of shoots in the medium plantlets in Z. officinale, C. longa and supplemented with 3% sucrose and 4 K. galanga. Therefore, Murashige and mg/l BAP (8.33), while the maximum Skoog medium was considered for all shoot height was observed in the downstream tissue culture experiments. medium supplemented with 4% Superiority of Murashige and Skoog sucrose and 4 mg/l BAP (6.03). The medium over Gamborg B5 medium rate of shooting in Z. officinale is was also reported by Bhattacharya and depicted in the figure 4.3. In Sen (2006) in their experiments to

RESULTS AND DISCUSSION 88 regeneration of C. longa explants, mg/l BAP (5.54). The rate of rooting maximum number of shoots were increased with the concentrations of observed in the medium supplemented sucrose. Profuse rooting was observed with 3% sucrose and 3 mg/l BAP in the medium supplemented with high (9.08), while the maximum shoot percentage of sucrose. The experiments height was observed in the medium revealed that the quantity of sucrose in supplemented with 3% sucrose and 4 the medium has a profound effect on mg/l BAP (5.54). The explants of K. the rate of regeneration as well as on galanga, produced maximum number the growth of the plantlets. The of shoots in the medium supplemented plantlets turned pale or white in the with 3% sucrose and 4 mg/l BAP medium supplemented with 1% and (4.33), while the maximum shoot 2% sucrose, this may be due to height was observed in the medium deficiency of elementary carbon. supplemented with 3% sucrose and 4 Though sucrose have important role in

Table 4.4: Effect of sucrose on regeneration of Z. officinale, C. longa and K. galanga. (Average of 20 replicates after 10 weeks of inoculation). Regenerated plantlets BAP (mg/l) Sucrose (%) Shoots* Height** Roots*** Zingiber officinale 1 1.53±0.34 1.73±0.07 very low 2 2.60±0.43 2.79±0.08 low 3 mg/l 3 6.26±0.57 4.61±0.13 profuse 4 4.87±0.25 5.21±0.21 profuse 1 2.06±0.25 1.15±0.05 very low 2 3.73±0.34 3.33±0.14 low 4 mg/l 3 8.33±0.41 5.78±0.17 profuse 4 5.20±0.43 6.03±0.16 profuse Curcuma longa 1 2.34±0.65 1.85±0.32 Low 2 5.67±0.34 2.71±0.42 Low 3 mg/l 3 9.08±0.57 4.11±0.65 Profuse 4 8.87±0.23 3.98±0.13 Profuse 1 3.65±0.44 2.64±0.11 Very low 2 6.48±0.28 4.32±0.48 Low 4 mg/l 3 8.41±0.28 5.54±0.29 Profuse 4 7.78±0.77 5.28±0.37 Profuse Kaempferia galanga 1 1.58±0.45 2.34±0.17 Very low 2 2.73±0.56 3.68±0.54 Very low 3 mg/l 3 3.17±0.11 4.31±0.16 Low 4 2.98±0.14 4.22±0.33 Profuse 1 1.86±0.32 2.32±0.18 Very low 2 3.14±0.24 3.47±0.52 Very low 4 mg/l 3 4.33±0.11 3.97±0.19 Profuse 4 4.04±0.43 3.68±0.19 Profuse Shoots*= Number of shoots per explant, Height**= Plantlet height (cm) and Roots***= Number of shoots per explant

RESULTS AND DISCUSSION 89

(a) (b) (c) (d)

Figure 4.3: Response of Zingiber officinale explants to MS media supplemented with BAP 4 mg/l and different percentages of sucrose. (a) 1% sucrose. (b) 2% sucrose. © 3% sucrose. (4) 1% sucrose. regeneration but show reduced rate of observed with BAP at a concentration shooting at higher concentrations. of 5 mg/l. In the medium supplemented

4.2.6 Plant growth regulators on with kinetin, the maximum numbers of regeneration plantlets/explant (5.40) as well as maximum height (6.06 cm) was 4.2.6.1 Cytokinin on regeneration observed at 4 mg/l. The highest Cytokinins like Benzyl amino purine, numbers of plantlets/explant (7.20) Kinetin and Zeatin were added to the regenerated with zeatin were at 5 mg/l, medium at different concentrations to whereas, the maximum height (4.67 observe their effects on regeneration. It cm) was at zeatin concentration 4 mg/l. has been observed that the growth In regeneration of Curcuma longa regulators trigger variable responses (figure 4.5a), the maximum numbers of (table 4.5). In micropropagation of plantlets/explant (9.08) were observed Zingiber officinale (figure 4.4a) the in the medium supplemented with BAP maximum numbers of plantlets/explant at a concentration of 3 mg/l while the (8.33) were observed in the medium maximum height (6.47 cm) was found supplemented with BAP at a with BAP at a concentration of 5 mg/l). concentration of 4 mg/l while the In the medium supplemented with maximum height (6.90 cm) was

RESULTS AND DISCUSSION 90

Height#

2.67± 0.61 3.05± 0.07 4.31± 0.16 3.97± 0.19 3.40± 0.11 1.81± 0.04 2.26± 0.18 2.56± 0.12 2.74± 0.08 2.82± 0.21 1.99± 0.23 2.21± 0.06 2.42± 0.11 2.48± 0.11 2.44± 0.22

Kaempferia galanga

Plantlets*

4.33±0.11 3.00±0.12

1.91± 0.12 2.03± 0.10 3.17± 0.11 2.15± 0.20 3.21± 0.31 3.44± 0.08 2.13± 0.21 1.94± 0.16 2.25± 0.10 3.58± 0.41 2.28± 0.31 2.27± 0.38 1.63± 0.34

Height#

2.53± 0.28 3.21± 0.47 4.11± 0.65 5.54± 0.29 6.47± 0.32 2.20± 0.36 3.31± 0.39 5.04± 0.48 5.81± 0.36 5.02± 0.35 1.34± 0.38 1.93± 0.49 2.55± 0.19 3.58± 0.27 4.43± 0.23

Curcuma longa

Zeatin

Kinetin

3.50±0.19 6.11±0.43 9.08±0.57 8.41±0.28 7.80±0.71

Plantlets*

4.59±0.49

2.58± 0.23 4.39± 0.26 6.11± 0.47 6.85± 0.44 6.59± 0.79 3.26± 0.32 6.22± 0.43 5.90± 0.76 5.43± 0.42

Benzylamino purine

Height#

2.51±0.26 3.55±0.27 4.61±0.13 5.78±0.17 6.90±0.54 2.11±0.28 3.19±0.14 4.20±0.10 6.06±0.38 4.99±0.20 1.15±0.15 2.13±0.19 2.97±0.21 3.87±0.07 4.67±0.06

Zingiberofficinale

2.73±0.25 4.66±0.50 6.26±0.57 8.33±0.41 6.50±0.34 1.86±0.34 2.66±0.34 3.73±0.25 5.40±0.25 4.86±0.34 1.93±0.34 2.46±0.25 3.80±0.49 5.33±0.10 7.20±0.65

Plantlets*

1 2 3 4 5 1 2 3 4 5 1 2 3 4 5

regulator

Plantgrowth

Table4.5: of concentrations different Effect cytokininsof 20of Average replicates Plantlets*=Plantlets perHeight#=Height explant; of plantlets (cm)

RESULTS AND DISCUSSION 91 kinetin both maximum numbers of Callusing of the explants was observed plantlets/explant (6.85) and height in the medium supplemented with 4 (5.81 cm) were achieved at 4 mg/l. The and 5 mg/l BAP. highest numbers of plantlets/explant Among the cytokinins tried, BAP gave (6.22) regenerated with zeatin were at better results compared to Kinetin and 3 mg/l whereas the maximum height Zeatin in regeneration of Zingiber (4.43 cm) was at zeatin 5 mg/l. officinale, Curcuma longa and The maximum numbers of Kaempferia Kaempferia galanga. BAP was more galanga (figure 4.6a) plantlets/explant effective than kinetin and zeatin in all (4.33) were observed in the medium the cultures when they were used supplemented with BAP at a alone. Our result finds similarity with concentration of 4 mg/l while the several workers. BAP was found to be maximum height (4.31cm) was found very much effective in the generation with BAP 3 mg/l. In the medium of ginger tissue culture (Hosoki and supplemented with kinetin the Sagawa, 1977; Bhagyalakshmi and maximum numbers of plantlets/explant Singh, 1988; Ikeda and Tanaba, 1989; (3.44) were observed at 3 mg/l and the Kackar et al., 1993; Sit et al., 2005; maximum height (2.82cm) at 5mg/l. Bhattacharya and Sen, 2006), turmeric The highest numbers of plantlets/ tissue culture (Winnar and Winnar, explant (3.58) regenerated with zeatin 1981; Shetty e t a l . , 1 9 8 2 ; were at 2 mg/l whereas the maximum Keshavachandran and Khader, 1989; height (2.48cm) was at zeatin 4 mg/l. Balachandran et al., 1990; Rahman et

(a) (b)

Figure 4.4: Shooting of Zingiber officinale plantlets in MS media (a) Media supplemented with BAP 3 mg/l. (b) Media supplemented with BAP 3 mg/l + kinetin 2 mg/l

RESULTS AND DISCUSSION 92 al., 2004; Dipti et al., 2005 and Panda considerably with different et al., 2007) and in tissue culture of K. concentrations and combinations of galanga (Lakshmi and Mythili, 2003 BAP and Kinetin (table 4.6). In and Bhattacharya and Sen, 2013). Zingiber officinale (figure 4.4b)

Lower concentrations of cytokinin culture, maximum number of plantlets/ produced less number of shoots from explant were obtained in the medium the explants while it declined above a supplemented with 4 mg/l BAP + 3 critical level. The decline in the rate of mg/l Kinetin (9.60) followed by 4 mg/l shooting above a critical level of BAP +2 mg/l Kinetin (8.94), while the cytoikinins may be due to some maximum plantlet height was obtained inhibitory effect produced by higher in the medium supplemented with 4 concentrations of cytokinins. Similar mg/l BAP + 3 mg/l Kinetin (8.59) results showing gradual increase and followed by 3 mg/l BAP + 4 mg/l decline in the number of shoots after a Kinetin (8.38). Similar results were certain level of cytokinins was obtained by Khatun et al., (2003). observed in ginger tissue culture However, other combinations like BAP (Balachandran et al., 1990 and Sit et and NAA (Inden et al., 1988; Choi al., 2005, Bhattacharya and Sen, 2006). 1991; Choi and Kim, 1991; Dogra et al., 1994; Behera and Sahoo, 2009), 4.2.6.2 Combinations of cytokinins on BAP and 2, 4-D (Nirmal Babu et al., regeneration 1992) and BAP, IAA and adenine The regeneration of plantlets varied sulfate (Mohanty et al., 2008) were

(a) (b)

Figure 4.5: Shooting of Curcuma longa plantlets in MS media (a) Media supplemented with BAP 2 mg/l. (b) Media supplemented with BAP 3 mg/l + kinetin 2 mg/l

RESULTS AND DISCUSSION 93 also effective. (Rahaman et al., 2004) and

In Curcuma longa (figure 4.5b) culture Thidiazuron (Prathanturarug et al., the maximum number of plantlets were 2005) were also effective. obtained in the medium supplemented In Kaempferia galanga (figure 4.6b) with 3 mg/l BAP + 4 mg/l Kinetin culture the maximum numbers of (9.20) followed by 3mg/l BAP + 3 mg/l plantlets were obtained in the medium Kinetin (8.64), while the maximum supplemented with 3 mg/l BAP + 4 plantlet height was obtained in the mg/l Kin (6.52) followed by 2 mg/l medium supplemented with 4 mg/l BAP + 4 mg/l Kin (6.06), while the BAP + 4 mg/l Kinetin (8.36 cm) maximum plantlet height was obtained followed by 3 mg/l BAP + 4 mg/l in the medium supplemented with 2 Kinetin (8.19 cm). Similar results mg/l BAP + 4 mg/l Kin (8.23 cm) showing high efficacy of BAP and followed by 3 mg/l BAP + 3 mg/l Kin Kinetin were observed by Shetty et al. (8.15 cm).

(1982); Keshavachadra and Khader Regeneration of plantlets gradually (1989). Other combinations of plant increased with increase in hormone growth hormones like BAP and NAA concentrations while it declined above (Yasuda et al., 1988; Behera et al., a certain concentrations. Similar results 2010), BAP and IAA (Singh et al., were observed by Lakshmi & Mythili 2011), BAP and NAA or NAA and (2003). Combinations of BAP and IAA kinetin (Sunitibala et al., 2001), IBA (Swapna et al., 2004 and Parida et al.,

(a) (b)

Figure 4.6: Shooting of Kaempferia galanga plantlets in MS media (a) Media supplemented with BAP 4 mg/l. (b) Media supplemented with BAP 4 mg/l + kinetin 3 mg/l

RESULTS AND DISCUSSION 94

aver-

are

Height#

0.71± 0.12 1.62± 0.36 2.21± 0.16 2.74± 0.12 4.31± 0.24 5.41± 0.12 6.81± 0.16 8.23± 0.20 6.28± 0.12 7.14± 0.38 8.15± 0.16 7.41± 0.21 5.86± 0.16 6.39± 0.28 7.09± 0.09 6.26± 0.26

The values The

Kaempferia galanga

K. galanga.K.

Plantlets*

2.56± 0.11 2.73± 0.12 3.38± 0.41 3.93± 0.30 3.13± 0.35 4.33± 0.27 4.51± 0.15 6.06± 0.24 4.76± 0.11 5.75± 0.72 6.00± 0.29 6.52± 0.22 5.48± 0.39 5.76± 0.20 5.53± 0.26 5.43± 0.45

and

C. longaC.

, ,

Height#

2.13±0.29 3.32±0.55 5.44±0.32 6.15±0.43 2.76±0.40 3.82±0.32 5.97±0.31 6.88±0.46 4.02±0.43 4.91±0.50 6.25±0.36 8.19±0.39 6.18±0.41 7.08±0.29 8.12±0.31 8.36±0.20

Z. Z. officinale

Curcuma longa

regeneration of

Plantlets*

2.38±0.31 2.80± 0.37 3.63± 0.57 4.13± 0.60 2.59± 0.21 3.31± 0.43 4.12± 0.56 5.40± 0.44 6.70± 0.47 7.46± 0.34 8.64± 0.66 9.20± 0.47 7.90± 0.45 8.48± 0.41 7.53± 0.52 7.19± 0.50

in vitro

Height#

1.99±0.13 3.56±0.35 5.78±0.55 6.27±0.40 2.72±0.12 3.55±0.12 5.98±0.16 7.02±0.20 4.04±0.07 4.38±0.50 7.07±0.69 8.38±0.13 4.59±0.22 7.53±0.28 8.59±0.19 7.09±0.61

Zingiberofficinale

2.13±0.25 3.06±0.41 5.33±0.34 5.66±0.41 3.26±0.25 5.73±0.52 7.13±0.25 6.93±0.47 5.87±0.19 7.13±0.23 7.40±0.43 8.53±0.41 8.40±0.30 8.94±0.57 9.60±0.59 7.40±0.16

Plantlets*

1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4

Kinetin

1 2 3 4

BAP

Plant growthregulator (mg/l)

Table of differentEffect :4.6. combinations and concentrations BAPof and Kinetin on 20of age replicates Plantlets*=Plantlets perHeight#=Height explant; of plantlets (cm)

RESULTS AND DISCUSSION 95

2010), BAP and NAA (Shirin et al., primary and secondary cultures (figure 2000; Rahaman et al., 2004; Rahaman 4.7). Comparatively less variations et al., 2005 and Chirangini et al., 2005) were observed in number of shoots/ and IAA and kinetin (Chirangini et al., explant in the primary and secondary 2005) were also found good. cultures of Curcuma longa than

In general plantlet regeneration was Zingiber officinale and Kaempferia relatively less in the medium galanga. supplemented with low BAP and In all the cases of Zingiber officinale Kinetin combination. Good results and Curcuma longa regeneration the were obtained when the combined least number of plantlets were concentrations of BAP and Kinetin produced in the primary culture and the were more than 5 mg/l. The plant cultures showed maximum growth regulators worked better in regeneration in the 2nd subculture. The combinations than that when used regeneration potential decreased from alone. The plantlets rooted in the same 3rd subculture of Zingiber officinale medium and they were moderate to and Curcuma longa. profuse in most of the combinations. In case of Kaempferia galanga The rate of rooting was found to be regeneration the least number of proportional to the number of plantlets. plantlets were produced in the primary Similar results of proportional rooting culture and it declined after the 1st or to the number of plantlets were 2nd subcultures. The regeneration observed by (Khatun et al., 2003) in potential decreased in 2nd subculture ginger tissue culture. Rout et al. (2001) (Kinetin 3 mg/l, BAP 2mg/l + Kinetin observed that in ginger regeneratoion, 4 mg/l, BAP 3 mg/l + Kinetin 3 mg/l the medium having kinetin alone or in and BAP 3 mg/l + Kinetin 4 mg/l) and combination with Adenine sulphate 3rd subculture (BAP 4 mg/l). showed a low rate of shoot The increase in the number of plantlets multiplication and inhibited shoot in the secondary cultures can be due to elongation as compared to BA alone or the adaptations of the explants to the BAP + Adenine sulphate. culture medium and diminishing effect 4.2.7 Primary and secondary cultures of sterilant. The gradual decline in the The effects of plant growth regulators rate of regeneration with subculture on regeneration were not the same in can be due to ageing of the explants

RESULTS AND DISCUSSION 96

BAP 3 + Kinetin 4

BAP 3 + Kinetin 3

3rd subculture3rd BAP 2 + Kinetin 4

BAP 4 galanga Kaempferia

Kinetin 3 2nd subculture2nd

BAP 3 + Kin 5

BAP 3 + Kin 4

BAP 3 + Kin 3 Genera and concentrations (mg/l) concentrations and Genera 1st subculture1st

Curcuma longa Curcuma

BAP 4

BAP 3

BAP 4 Primary culturePrimary

BAP 3 Zingiber officinale Zingiber

8 6 4 2 0

12 10

Shoots per explant per Shoots Figure Figure 4.7:in Responses andprimary subsequentsubcultures

RESULTS AND DISCUSSION 97 and decline in their totipotency. 80% (Nirmal Babu et al., 1992), 85% Mohanty et al. (2008) reported that the (Samsudeen et al., 2000), 94% multiplication rate remained (Bhattacharya and Sen, 2006) and 95% unchanged in subsequent subcultures (Behera & Sahoo, 2009) were of ginger, but, in most of the previously reported in Zingiber experiments with Zingibers it declined officinale. after a few subcultures. Khatun et al. (2003), achieved 100% 4.2.8 Hardening of plantlets and Mohanty et al. (2008) achieved

The ultimate success of in vitro 96% survival rate in field when the propagation lies in the successful plantlets were directly transferred to establishment of plant in the soil. In the fields. vitro-derived plantlets with a well- Survival rate of 90 to 95% (Salvi, developed root and shoot system were 2000, Salvi et al., 2002), 90% (Salvi et successfully transferred to pots in al., 2001), high percentage (Zapata et potting mixture (figure 4.8), and after al., 2003), 70% (Rahman et al., 2004), hardening were transferred to the field. 90% (Gayatri and Kavyashree, 2005), The regenerated plants Zingiber 70-80% (Naz et al., 2009); 95% officinale, Curcuma longa and (Behera et al., 2010) survival rate.

Kaempferia galanga showed a survival Geetha et al. (1997) hardened percentage of 94%, 91% and 94% the regenerated Kaempferia galanga polycups respectively. 100% survival plantlets in mixture of Sand, garden rates were observed in the field soil and vermiculite (1:1:1). Hardened environment. High survival rate of plantlets of Kaempferia galaga

(a) (b) (c) Figure 4.8: Hardened plantlets. (a) Zingiber officinale. (b) Curcuma longa. (c) Kaempferia galanga.

RESULTS AND DISCUSSION 98

(b)

(a) (c)

(d) (e)

(f) (g)

(h) Figure 4.9: Hardened plantlets of (a) Zingiber officinale, (b) Curcuma longa & (c) Kaempferia galanga. (d) Regeneration of C. longa cultivars. (e) Regenerated plantlet of Z. officinale in primary culture. (f) Rooted plantlets of C. longa prior to hardening. (g) Secondary culture of K. galanga (h). Hardened plantlets of Z. officinale.

RESULTS AND DISCUSSION 99 produced by callus culture showed containing the micropropagation normal storage roots and were derived rhizomes. While, 79%, 74% acclimatized and subsequently and 58% of the pieces of conventional transferred to field with 90-95% Z. officinale, C. longa and K. galanga (Geetha et al., 1997) and 85% survival rhizomes respectively showed mycelia (Rahaman et al., 2004) while growth. regenerated plants by rhizome bud 4.2.10 Regeneration of Curcuma proliferation were hardened and longa cultivars established on the field with 85% Cytokinin (Benzyl Amino Purine) success (Rahaman et al., 2005). Field showed variable effects on the shooting survival of 80-90% (Chirangini et al., of twelve different Curcuma longa 2005) and 95% was observed by cultivars (figure 4.10). The mean (Parida et al., 2010). number of shoots formed per explant 4.2.9 Production of disease free were 3.075 (BAP 1 mg/l), 4.983 (BAP plantlets 2 mg/l), 6.891 (BAP 3 mg/l), 6.358 In vitro-derived plants raised under (BAP 4 mg/l) and 5.816 (BAP 5 mg/l). field conditions did not show any Out of the twelve cultivars two disease symptoms until maturity. The cultivars (local from Dhupguri and rhizomes obtained from field planted Suguna) showed maximum number of tissue culture derived plantlets on plantlets per explant at BAP storage on sand for 6 months did not concentration of 2mg/l, nine (cultivar show any visible root-for or shoot-rot local from Lataguri, Prova, TC Assam, whereas, conventionally obtained Kasturi, CLS 2A, Suvarna, Roma, Zingiber officinale, Curcuma longa Sudarshana and PTC 13) at the level of and Kaempferia galanga rhizomes 3mg/l BAP concentration and the rest stored on sand for 6 months showed one (Allepy) at level of 4 mg/l BAP infection about 61%, 46% and 53% concentration while minimum number respectively. Rhizome pieces of of shoots per explant were produced in micropropagated and conventional eleven (cultivars local from Lataguri, plants were transferred onto PDA to Prova, Suguna, TC Assam, Allepy, examine the infection, if any. Mycelia Kasturi, CLS 2A, Suvarna, Roma, growths were not observed on medium Sudarshana and PTC 13) at 2 mg/l after 8 – 10 days of incubation BAP concentration and rest one

RESULTS AND DISCUSSION 100 T12 T11

BAP 5 BAP

T10 T9 BAP 4 BAP T8 cultivars T7 BAP 3 BAP

T6 (please refer table 4.1 for the species and varieties name) and varieties species the for 4.1 table refer (please

Curcuma longaCurcuma

cultivars cultivars

T5 BAP 2 BAP

T4 Curcuma longa T3 BAP 1 BAP T2 T1

9 8 7 6 5 4 3 2 1 0

Plantlets per explant per Plantlets Figure Figure 4.10: of BAPEffect on regeneration of different

RESULTS AND DISCUSSION 101

(cultivar local from Dhupguri) at the confirms the inhibitory effect of BAP level of 5mg/l BAP concentration. at higher concentrations.

Maximum regeneration potential was 4.3 Diversity studies observed in the cultivar CLS-2A (8.7 4.3.1 DNA extraction, purification shoots/explant) followed by the and quantification cultivar local from Lataguri (8.2 DNA from the leaves of Zingiber shoots/explant) with BAP 3 mg/l. The officinale, Curcuma longa and lowest regeneration potential was Kaempferia galanga were isolated observed in the cultivar Allepy (1.8 using the standard protocol of shoots/explant) followed by the Bousquet et al. (1990) with minor cultivar Prova (2.5 shoots/explant) at modifications. The DNA-CTAB BAP 1 mg/l. complex gave a very good network of The highest regeneration rate was whitish precipitate of nucleic acid observed at BAP concentration 3 mg/l which was used for further downstream in most of the cultivars. Similar to our processing. The agarose gel analysis of results, Panda et al. (2007) reported the DNA thus obtained showed distinct that, MS medium supplemented with and clear bands. 3.0 mg/l BAP is the best hormonal DNA extracted from plant tissue concentration for multiple shoot includes contaminants like RNA, production in Curcuma longa (cv- protein, polysaccharides etc. which Roma). Behera et al. (2010) observed severely hampers the downstream that explants of Curcuma longa cv. process. Thus, Purification of DNA is Ranga) explants cultured on MS basal very essential. The RNA was removed medium supplemented with 2.0mg/l by treating the sample with RNase BAP+0.5gm/l NAA showed highest enzyme. Extraction with phenol: rate of shoot multiplication. Highest chloroform following RNase treatment shoot proliferation of turmeric was was also employed for eliminating observed at BAP 1 mg/l (Winnar and most of proteins. CTAB buffer Winnar, 1981) BAP 3 mg/l (Dipti et eliminated polysaccharides from DNA al., 2005, Balachandran et al., 1990). to a large extent, but in isolated DNA The rate of shoot formation increased from the leaves of Zingiberaceous gradually up to a certain level of BAP plants starch residues were found intact concentration and then declined. This

RESULTS AND DISCUSSION 102 with the isolated DNA even after DNA was estimated by comparing the CTAB and phenol: chloroform sample DNA with the control by eye treatment. So, peg purification of DNA adjustment. The combination of the was necessary for complete elimination above three steps (extraction, of polysaccharides. purification and quantification)

Spectophotometric and agarose gel allowed the extraction of sufficient analysis methods were used to quantify amount of pure DNA from the leaves the DNA extracted from Zingiber for PCR amplification. officinale, Curcuma longa and 4.3.2 RAPD analysis of C. longa

K a e m p f e r i a g a l a n g a . The genomic DNA of twelve different Spectrophotometric analysis of the cultivars of Curcuma longa were DNA showed A260/A280 ratio in analyzed using 25 different primers between 1.82 to 2.00 (table 4.7). For having 10mer length. Of the 25 primers PCR based molecular documentation screened 14 resulted in producing methods, quantification of DNA was distinct and scorable bands (table 4.8). done based on the formula mentioned The amplification profiles of the total in the materials and methods section. genomic DNA from the 12 cultivars of By gel analysis the quality of DNA C. longa using 14 primers resulted in was judged by the presence of single production of 170 bands ranging in compact and clear band at the between 151 and 1767bp of which only corresponding position of the 10 were monomorphic, while rest were molecular marker λ DNA/EcoRI/ polymorphic (table 4.8). The HindIII double digest. The quantity of percentage of polymorphism was found to be 94.11%. The number of bands Table 4.7: List of different cultivars of Cur- cuma longa showing their purity generated by each RAPD primes ranged in between 09 (OPA02, OPN04 Sample ID A260/ A280 (Purity) T 1 1.98 & OPN13) and 19 (OPA01). The cause T 2 1.82 T 3 1.88 for the high level of polymorphism T 4 1.86 could be intra-specific variation as T 5 1.78 T 6 1.90 reported by Nayak et al. (2006), who T 7 1.96 T 8 1.89 found similar outcome from RAPD T 9 1.79 T 10 2.00 analysis of 17 cultivars of turmeric. Jan T 11 1.92 et al. (2011) and Singh et al. (2012), T 12 1.84

RESULTS AND DISCUSSION 103 observed 96.84% and 91.4% Similarity coefficient among the 12 polymorphism respectively in RAPD cultivars ranged from 0.560 to 0.857. of different accessions of turmeric. The lowest similarity was observed Nayak et al. (2005) observed 69.66% between C. longa cv local-Dhupguri polymorphism in 16 cultivars of ginger and Roma and C. longa cv local- with RAPD analysis. Dhupguri and Sudarshana while the

A representative of RAPD profiles of highest value was recorded between C. the 12 cultivars of C. longa generated longa cv Suguna and C. longa cv TC using OPA04, where all the bands Assam. The dendrogram constructed generated are polymorphic and OPA07 on the basis of the data obtained from which also depicts two monomorphic RAPD analysis is depicted in figure band is presented in figure 4.11. The 4.12 Based on the similarity indices, similarity matrix obtained using the the dendrogram showed two cultivars Dice coefficient of similarity (Nei and of C. longa cv Suguna and TC- Assam Li, 1979) depicted in table 4.9. clustered together sharing a node at

Figure 4.11: A representative RAPD profile of 12 cultivars of Curcuma longa amplified with primers (a) OPN04 & (b) OPA07. Lane M1: 100bp molecular marker; Lane T1-T12 different cultivars of C. longa under study (please refer table 4.1 for the cultivar name); Lane M2: λ DNA/EcoRI/HindIII double digest DNA ladder

RESULTS AND DISCUSSION 104

1159 1201 1317 1465 1767 1408 1514 1642 1511 1369 1476 1410 1350 1512

------

151 257 349 357 386 238 647 443 646 372 581 335 354 412

Band size (bp)

morphism morphism generated by the RAPD

oly

80%

94.11

100% 100% 100% 100% 100% 100% 100% 100%

87.5%

77.77% 93.33% 90.90% 77.77%

morphism

Percentage poly-of

7 8 9 7

19 10 13 14 14 12 10 14 11 12

160

Polymorphic bands

0 2 0 0 0 1 2 0 1 2 0 0 2 0

bands

Monomorphic

9 9 9

19 10 13 14 15 10 12 11 16 11 12

170

fied

Total ampli- bands

3’)

(5’

Sequence

GTTTCGCTCC

CAGGCCCTTC GTTGCGATCC CCAAGCTTCC GTCCGTACTG

GGTCCCTGAC AGCGTCACTC

TGCCGAGCTG

AGTCAGCCAC

GGGTAACGCC GGAAGTCGCC GACCGACCCA

GTCAGGGCAA

GAAACGGGTG

TOTAL

OPF09

OPB01

OPA01 OPA02 OPA03 OPA07 OPA09 OPA20 OPG19 OPH04 OPN04 OPN13 OPN19

OPA OPA 06

Primer Primer ID

Table 4.8.Total number and size of amplified bands, number of monomorphic and polymorphic bands generated and percentage of p primers.

RESULTS AND DISCUSSION 105

T12

1.000

T11

1.000 0.648

T10

1.000 0.626 0.714

1.000 0.736 0.714 0.714

, based on RAPD profiling

1.000 0.758 0.626 0.626 0.670

C. longaC.

1.000 0.846 0.714 0.670 0.604 0.648

1.000 0.725 0.703 0.725 0.681 0.615 0.813

1.000 0.769 0.802 0.802 0.824 0.692 0.626 0.758

1.000 0.857 0.714 0.769 0.747 0.791 0.681 0.593 0.659

1.000 0.802 0.813 0.626 0.703 0.725 0.835 0.637 0.659 0.637

1.000 0.703 0.615 0.670 0.593 0.626 0.692 0.670 0.560 0.560 0.582

1.000 0.824 0.791 0.725 0.780 0.637 0.670 0.758 0.736 0.604 0.582 0.670

The similarity matrix obtained using Dice coefficient of similarity among the 12 of cultivars

T1 T2 T3 T4 T5 T6 T7 T8 T9

T10 T11 T12

Table:4.9: For details IDsample of (T1T12) to please refer table 4.1

RESULTS AND DISCUSSION 106

C. C. longa.

cultivars of cultivars of

FIigure 4.12: derived UPGMADendrogram from cluster analysis of RAPD illustrating themarkers genetic relationships theamong For details IDsample of (T1T12) to please refer table 4.1

RESULTS AND DISCUSSION 107

(a)

(b) Figure 4.13: Principal coordinate analysis of 12 cultivars of Curcuma longa on RAPD analysis data. (a) 2-dimensional plot and (b) 3-dimensional plot. For details of sample ID (T1 to T12) please refer table 4.1

RESULTS AND DISCUSSION 108

85.7%. Similar clusters were also position of C. longa cv Sudarshana observed between C. longa cv Kasturi distinc from other cultivars indicate its and C. longa cv CLS 2A; C. longa cv genetic divergence.

Prova and C. longa cv Suvarna; C. 4.3.3 ISSR analysis of C. longa longa cv Local-Lataguri and C. longa Phylogenetic relationship among 12 cv Local-Dhupguri and two south cultivars of Curcuma longa collected Indian varities, C. longa cv Allepy and from different places were analyzed by C. longa cv PTC13 sharing nodes with DNA based techniques. Fifteen ISSR similarity of 84.6%, 83.5%, 82.4% and primers were initially used, out of 81.3% respectively. Three distinct which only 8 primers were able to groups viz. group I comprising C. produce distinct, scorable bands (table longa cv Local-Lataguri, Local- 4.10) and were selected for further Dhupguri, Prova, Suvarna, Suguna, study. Among the primers used, the Kasturi and CLS 2A; group II primer UBC818 produced only 02 comprising C. longa cv Allepy, PTC13 bands while UBC824 and UBC873 and Roma and group III comprising C. amplified the highest number of bands longa cv (Sudarshana) were noted. The i.e. 12. A total of 75 amplified bands

Figure 4.14: ISSR banding patterns of 12 cultivars of Curcuma longa generated by (a) UBC 815 primer and (b) UBC873. Lane M1: λ DNA/EcoRI/HindIII double digest DNA ladder; Lane T1-T12 different cultivars of C. longa under study (please refer table 4.1 for the cultivar name); Lane M2:100bp molecular marker

RESULTS AND DISCUSSION 109 were produced by the 8 primers of -Dhupguri and C. longa L. cv Allepy, which 69 were polymorphic. The while the highest value was recorded frequency of polymorphism was found between C. longa L. cv Suguna and C. to be 92%. The band size ranged longa L. cv TC Assam. The between 274bp to 1758bp. A dendrogram constructed on the basis of representative of ISSR profile of the 12 the data obtained from ISSR analysis is cultivars of turmeric generated with the depicted in figure 4.15. The primers UBC815 and UBC 873 are dendrogram showed that based on the depicted in figure 4.14. Singh et al. similarity indices, two cultivars of C. (2012) observed 95.4% polymorphism longa i.e. Suguna and TC Assam with ISSR analysis of Curcuma longa formed a cluster sharing a node at accessions collected from different 90.4%. Clustering above a similarity of agroclimatic conditions. 80% was also formed in between Local

The similarity matrix obtained using -Lataguri and Local-Dhupguri (88.0%) the Dice coefficient of similarity (Nei and CLS 2A and Suvarna (88.0%). and Li, 1979) depicted in table 4.11. Three major groups viz. group I Similarity coefficient among the 12 comprising C. longa cv (Local- cultivars ranged between 0.523 to Lataguri and Local-Dhupguri), group II 0.904. The lowest similarity was comprising C. longa cv (Prova, observed between C. longa L. cv Local Sudarshana and PTC 13) and group III Table 4.10: Total number and size of amplified bands, number of monomorphic and polymorphic bands generated and percentage of polymorphism generated by the ISSR primers.

Bands amplified Primer Sequence Percentage of Band ID (5’-3’) polymorphism size (bp) Total Monomorphic Polymorphic

UBC810 (GA)8T 10 0 10 100% 512-1234

UBC815 (CT)8G 9 0 9 100% 434-1758

UBC818 (CA)8G 2 1 1 50% 490-656

UBC822 (TC)8A 8 2 6 75% 600-1550

UBC824 (TC)8G 12 1 11 91.66% 387-1642

UBC825 (AC)8T 11 0 11 100% 355-1567

UBC856 (AC)8YA 11 1 10 90.90% 274-1500

UBC873 (GACA)4 12 1 11 91.66% 368-1153

TOTAL 75 6 69 92.00%

RESULTS AND DISCUSSION 110

T12

1.000

T11

1.000 0.714

T10

1.000 0.738 0.690

1.000 0.857 0.690 0.738

, profiling based on ISSR

1.000 0.880 0.785 0.619 0.619

C. longaC.

1.000 0.785 0.666 0.666 0.642 0.595

1.000 0.714 0.690 0.714 0.761 0.690 0.642

1.000 0.809 0.666 0.595 0.619 0.714 0.642 0.595

1.000 0.904 0.809 0.714 0.642 0.666 0.761 0.690 0.642

1.000 0.714 0.666 0.666 0.666 0.595 0.619 0.666 0.738 0.642

1.000 0.714 0.619 0.523 0.523 0.571 0.690 0.666 0.666 0.595 0.595

1.000 0.880 0.738 0.690 0.595 0.547 0.547 0.666 0.690 0.690 0.619 0.571

The similarity matrix obtained using Dice coefficient of similarity among the 12 of cultivars

T1 T2 T3 T4 T5 T6 T7 T8 T9

T10 T11 T12

Table4.11: For details IDsample of (T1T12) to please refer table 4.1

RESULTS AND DISCUSSION 111

cultivars

C. longaC.

Figure Figure 4.15: Dendrogram generated the cluster analysisfrom ISSRof 12of markers For details IDsample of (T1T12) to please refer table 4.1

RESULTS AND DISCUSSION 112

(a)

(b) Figure 4.16: Principal coordinate analysis of 12 cultivars of C. longa based on ISSR analysis data. (a) 2-dimensional plot and (b) 3-dimensional plot. For details of sample ID (T1 to T12) please refer table 4.1

RESULTS AND DISCUSSION 113 comprising C. longa cv (Suguna, TC Local-Lataguri and Local-Dhupguri Assam, Allepy, Kasturi, CLS 2A, (84.2%) and Kasturi and CLS 2A Suvarna and Roma) were noted. Of (82.7%). Three major groups viz. these the first group with two local group I comprising C. longa cv (Local- cultivars of C. longa formed a distinct Lataguri and Local-Dhupguri), group II clade from rest of the cultivars. comprising C. longa cv (Prova,

4.3.4 Combined RAPD and ISSR Suguna, TC Assam, Allepy, Kasturi, based analysis of C longa CLS 2A, Suvarna, Roma and PTC 13) and group III comprising C. longa cv Similarity coefficients of the 12 (Sudarshana) were noted. Of these the cultivars of Curcuma longa based on first and the third group with two local 170 RAPD and 75 ISSR loci ranged in cultivars of C. longa and the cultivar between 0.571 and 0.872 (table 4.12). Sudarshana respectively formed two The highest similarity was found distinct clade from rest of the cultivars. between the cultivars C. longa L. cv Suguna and C. longa L. cv TC Assam Detection of high polymorphism is of while the lowest was noted between C. considerable significance. longa L. cv Local-Dhupguri and C. Amplification of large number of longa L. cv Sudarshana. The highest polymorphic bands indicate that the similarity of the cultivars C. longa L. primer sets used in this study could be cv Suguna and C. longa L. cv TC of significance for assessment of Assam were also noted in the results of genetic diversity in turmeric cultivars. RAPD and ISSR when calculated The high genetic diversity among the separately. local and other cultivars also confirms the correlation between the Cluster analysis performed from the geographical distance and genetic combined data sets of both RAPD and similarity between the individuals. ISSR markers generated a dendrogram as illustrated in figure 4.17. The 4.3.5 Comparative account of the dendrogram showed that, based on the DNA fingerprinting study similarity indices, two cultivars of A detailed study of DNA fingerprinting Cucuma longa i.e. Suguna and TC showed that among various techniques Assam formed a cluster sharing a node used in this study like RAPD and ISSR at 87.2%. Clustering above a similarity markers. Both RAPD and ISSR of 80% was also formed in between markers proved to be efficient

RESULTS AND DISCUSSION 114

T12

1.000

T11

1.000 0.669

T10

1.000 0.661 0.706

1.000 0.774 0.706 0.721

, profiling based on ISSR

1.000 0.796 0.676 0.624 0.654

C. longaC.

1.000 0.827 0.699 0.669 0.616 0.631

1.000 0.721 0.699 0.721 0.706 0.639 0.759

1.000 0.781 0.759 0.736 0.759 0.699 0.631 0.706

1.000 0.872 0.744 0.751 0.714 0.751 0.706 0.624 0.654

1.000 0.774 0.766 0.639 0.691 0.684 0.766 0.646 0.684 0.639

1.000 0.706 0.616 0.624 0.571 0.609 0.691 0.669 0.593 0.571 0.586

1.000 0.842 0.774 0.714 0.721 0.609 0.631 0.729 0.721 0.631 0.593 0.639

The similarity matrix obtained using Dice coefficient of similarity among the 12 of cultivars

T1 T2 T3 T4 T5 T6 T7 T8 T9

T10 T11 T12

Table4.12: For details IDsample of (T1T12) to please refer table 4.1

RESULTS AND DISCUSSION 115

e e ID (T1T12) refer to please table 4.1

mpl Figure Figure 4.17: constructedDendrogram basis on the dataof obtained the from combined RAPD analysis.and ISSR For details sa of

RESULTS AND DISCUSSION 116

(a)

(b)

Figure 4.18: Principal coordinate analysis of 12 cultivars of C. longa based on combined RAPD and ISSR analysis data. (a) 2-dimensional plot and (b) 3-dimensional plot. For details of sample ID (T1 to T12) please refer table 4.1

RESULTS AND DISCUSSION 117 revealing 94.11% and 92% Chromous Biotech Pvt. Ltd, Bangalore polymorphism respectively among the for both the forward and reverse twelve cultivars of Curcuma longa primers individually. The sequencing under study. These molecular resulted in forward and reverse techniques revealed a quick and sequence of 730bp and 750bp. In the effective means to establish the genetic present study the nucleotide BLAST relationships between the cultivars on was performed for each of the the basis of their molecular differences sequence obtained to find out the under the light of the statistical analysis homology with the sequences already using software like NTSYSpc. The present in the GenBank. The nucleotide fourteen RAPD primers (table 4.8) and BLAST showed 99 to 100% identity eight ISSR primers (table 4.10) with the Curcuma sequence already revealing 94.11% and 92% available in the GenBank. The forward polymorphism respectively may prove sequence showed a maximum of 100% to be promising markers obtained from identity with Curcuma longa, Curcuma this study. These markers may provide roscoeana, Curcuma colorata, a cheap, rapid and effective means to Curcuma purpurascens and Curcuma evaluate the genetic diversity among soloensis while the reverse sequence different C. longa cultivars . As showed a maximum of 99% identity flowering is rare in Zingibers so this with Curcuma longa, Curcuma method can also be useful for cultivar colorata, Curcuma purpurascens, identification. Curcuma xanthorrhiza, Curcuma

Thus, DNA fingerprinting study of soloensis, Curcuma zedoaria, Curcuma Curcuma longa can prove to be ochrorhiza, Curcuma heyneana, effective and promising in assessing Curcuma elata, Curcuma aromatica, genetic variations among the cultivars Curcuma aurantiaca, Curcuma commonly found in North Bengal. australasica, Curcuma aeruginosa, Curcuma alismatifolia, Stahlianthus 4.3.6 Sequencing of PCR product involucratus, Curcuma roscoeana, A sample (Curcuma longa cv Local- Curcuma phaeocaulis, Curcuma Lataguri) was sequenced from amada, Curcuma petiolata, Curcuma Table 4.13: List of the GenBank accessions for TrnL-TrnF region of C. longa Sl. No Plant species GenBank accession number 1 Curcuma longa cv. local-Lataguri KC404804 2 Curcuma longa cv. local-Lataguri KC404823

RESULTS AND DISCUSSION 118 gracillima, Curcuma thorelii, Paracautleya bhatii, Curcuma harmandii, Smithatris suprIaneanae, Roscoea bhutanica and Scaphochlamys kunstleri. After authentication, the sequences were submitted to the (a) GenBank (Refer Appendix: G). The list of GenBank accession number and the sequence are given in table 4.13.

4.3.7 Somaclonal variation among the in vitro raised plantlets (b) A total of 10 primers (which already successfully amplified the genomic DNA of all the 12 cultivars) were used to screen somaclonal variations, out of which 6 were RAPD and rest 4 were ISSR primers. (c) Figure 4.19: DNA fingerprinting patterns of in All the RAPD and ISSR primers vitro raised (a) Z. officinale (b) C. longa and (c) K. galanga by using RAPD primers. Par- produced distinct and scorable bands ent plant (lane1), micropropagated plants (table 4.13) The number of bands (lanes 2-6) and molecular weight markers 0.1- 10 kb DNA ladder (M1). varied with the plant material. In case longa, RAPD and ISSR produced 62 of Z. officinale, RAPD and ISSR and 38 scorable bands respectively. primers produced respectively 58 and The RAPD bands ranged from 151- 35 scorable bands. The RAPD bands 1767bp, while the ISSR bands from ranged from 204 to 1582bp, while the 274-1758bp. RAPD and ISSR ISSR bands from 305 to 1647bp. In C. produced 55 and 33 scorable bands

Table 4.13: PCR amplicons obtained from RAPD and ISSR markers in in vitro raised plantlets of Z. officinale, C. longa and K. galanga. Primer details Z. officinale C. longa K. galanga No of primer used 6 6 6 Total bands 58 62 55 RAPD No. of monomorphic bands 58 62 55 Band size (bp) 204-1582 151-1767 185-1604 No of primer used 4 4 4 Total bands 35 38 33 ISSR No. of monomorphic bands 35 38 33 Band size (bp) 305-1647 274-1758 220-1647

RESULTS AND DISCUSSION 119 respectively in K. galangal. The RAPD non-specific amplification (Bornet and bands ranged from 185-1604bp, while Branchard, 2001). Both the the ISSR bands from 220-1647bp. A fingerprinting techniques have their representative of RAPD and ISSR own advantages and disadvantages. profile is depicted in figure 4.19. All Thus, keeping this in mind both RAPD the bands generated in Z officinale, primers and ISSR markers were used to Curcuma longa and Kaempferia screen the clonal stability of in vitro g a l a n g a were found to be raised plantlets of the genera under monomorphic across all the in vitro study. This analysis showed that there raised plantlets and the parent plant was virtually no genetic variation analyzed irrespective of whether among the micropropagated plantlets RAPD primers or ISSR markers were of Z officinale, C longa and K galanga. used. This uniformity in the banding Therefore, it can be concluded that in pattern confirms the genetic fidelity of vitro raised plants avoided the genomic the in vitro raised Zingiber officinale, aberrations and did not lead to any Curcuma longa and Kaempferia somaclonal variation. galanga plantlets. 4.4 Antioxidant studies

Though both RAPD primers and ISSR 4.4.1 Free radical scavenging activity markers helps in detecting with DPPH polymorphism, ISSR markers The solvent fractions of Zingiber dominates the RAPD primers. ISSR officinale (figure. 4.20), Curcuma markers showed high polymorphism longa (figure 4.21) and Kaempferia and have good reproducibility because galanga (figure 4.22) exhibited of the presence of large number of SSR different levels of antiradical activities. region as compared to RAPD (Ray et Out of the 34 solvent fractions of Z. al., 2006). Moreover, ISSR markers are officinale 33 solvent fractions were much larger in size than RAPD which dissolved in methanol. The hexane are decamers and hence has higher fraction had both methanol soluble and annealing temperature. Higher methanol insoluble parts. The methanol annealing temperature is considered to insoluble part was dissolved in hexane. result in greater consistency where as 33 solvent fractions of C. longa and 25 lower annealing temperature might solvent fractions obtained from K. produce artefact amplicons because of galanga were finally dissolved in

RESULTS AND DISCUSSION 120 methanol. maximum inhibition percent (80%) of

10 Zingiber officinale fractions antiradical scavenging activity. In [Hexane (dissolved in hexane), similar experiments, antioxidative Benzene, Chloroform, Chloroform : activities of water and organic solvent diethyl ether (1:1), Chloroform : were observed by Katiyar et al. (1996) diethyl ether (1:3), Diethyl ether, and Bhattacharya et al. (2009). Diethyl ether : ethyl acetate (3:1), Antioxidant properties of ginger were Diethyl ether : ethyl acetate (1:1), also reported by Ippoushi et al. (2003), Diethyl ether : ethyl acetate (1:3), Jolad et al. (2004) Zaeoung et al. Ethyl acetate and Ethyl acetate : (2005), Chan et al. (2008). acetone (1:1)] showed DPPH 31 Curcuma longa fractions [Hexane, scavenging activity ranging from Hexane : benzene (3:1), Hexane : 5.88% to 80%. Five different peaks benzene (1:1), Hexane : benzene (1:3), were obtained when the inhibition Benzene, Benzene : chloroform (3:1), percent of different fractions were Benzene : chloroform (1:1), Benzene : plotted (figure. 4.20). Diethyl ether & chloroform (1:3), Chloroform, ethyl acetate (1:1) showed the Chloroform : diethyl ether (3:1),

90 80 70 60 50 40 30

20 Antiradical activity (%) activity Antiradical 10

Ethanol Ethanol : methanol Ethanol Ethanol : methanol Ethanol : methanol

Methanol

Benzene :chloroform Benzene :chloroform Benzene :chloroform

Chloroform

Ethanol

Hexane Hexane

Acetone

Benzene Hexane Hexane

Acetone :ethanol Acetone :ethanol Acetone :ethanol

Hexane Hexane : benzene Hexane Hexane : benzene Hexane : benzene

Ethyl Ethyl acetate :acetone Ethyl Ethyl acetate :acetone Ethyl acetate :acetone

Water

Chloroform Chloroform : diethyl ether Chloroform Chloroform : diethyl ether Chloroform : diethyl ether

Ethyl Ethyl acetate Diethyl ether

Methanol Methanol : water Methanol Methanol : water Methanol : water

Diethyl ether: ethyl acetate Diethyl ether: ethyl acetate Diethyl ether: ethyl acetate

hexane

methanol

- - -

1:1 3:1 1:3

3:1 1:1 1:3

- - -

1:3 3:1 1:1

- - -

1:3 3:1 1:1

- - -

1:3 3:1 1:1

- - -

1:1 3:1 1:3

- - -

3:1 1:1 1:3

Solvent fractions of Zingiber officinale

Figure 4.20: Free radical scavenging activity of different solvent fractions of Z. oficinale by DPPH

RESULTS AND DISCUSSION 121

Chloroform : diethyl ether (1:1), were obtained when the inhibition Chloroform : diethyl ether (1:3), percent of different fractions were Diethyl ether, Diethyl ether : ethyl plotted (figure. 4.21). Diethyl ether & acetate (3:1), Diethyl ether : ethyl ethyl acetate (3:1) showed the acetate (1:1), Diethyl ether : ethyl maximum inhibition percent (77.75%) acetate (1:3), Ethyl acetate, Ethyl of antiradical scavenging activity. acetate : acetone (3:1), Ethyl acetate : Seven fractions [Benzene: Chloroform acetone (1:1), Acetone, Acetone : (1:1), Chloroform: Diethyl ether (1:3), ethanol (3:1), Acetone : ethanol (1:1), Diethyl ether, Diethyl ether: Ethyl Acetone : ethanol (1:3), Ethanol, acetate (3:1), Diethyl ether: Ethyl Ethanol : methanol (3:1), Ethanol : acetate (1:1), Diethyl ether: Ethyl methanol (1:1), Ethanol : methanol acetate (3:1) and Acetone: Ethanol (1:3), Methanol, Methanol : water (1:1) showed activity more than 10 (3:1), Methanol : water (1:1), and percent. Antioxidant activity of Methanol water (1:3)] showed DPPH Curcuma longa has been observed by scavenging activity ranging from Srimal and Dhawan (1973), 3.75% to 77.75%. Six different peaks Nagabhushan and Bhide (1992), Anto

90 80 70 60 50 40 30

20 Antiradical activity (%) activity Antiradical 10

Ethanol Ethanol : methanol Ethanol : methanol Ethanol : methanol

Methanol

Benzene :chloroform Benzene :chloroform Benzene :chloroform

Chloroform

Ethanol

Acetone

Hexane Hexane Benzene

Acetone :ethanol Acetone :ethanol Acetone :ethanol

Hexane Hexane : benzene Hexane Hexane : benzene Hexane : benzene

Ethyl Ethyl acetate :acetone Ethyl acetate :acetone Ethyl Ethyl acetate :acetone

Water

Chloroform Chloroform : diethyl ether Chloroform : diethyl ether Chloroform : diethyl ether

Diethyl ether Ethyl acetate

Methanol Methanol : water Methanol Methanol : water Methanol : water

Diethyl ether: ethyl acetate Diethyl ether: ethyl acetate Diethyl ether: ethyl acetate

methanol

- - -

3:1 1:1 1:3

1:3 3:1 1:1

- - -

3:1 1:1 1:3

- - -

3:1 1:1 1:3

- - -

1:1 1:3 3:1

- - -

3:1 1:1 1:3

- - -

3:1 1:1 1:3

Solvent extracts of Curcuma longa

Figure 4.21: Free radical scavenging activity of different solvent fractions of C. longa by DPPH

RESULTS AND DISCUSSION 122 et al. (1994), Halim (2002) Roy and acetone- 1:1, Ethyl acetate : acetone- Raychaudhury (2004) Sacchetti et al. 1:3, Acetone, Acetone : ethanol- 3:1, (2005), Zaeoung et al. (2005) and Acetone : ethanol- 1:1, Acetone : Butkhup and Samappito (2011). ethanol- 1:3, Ethanol, Ethanol :

25 Kaempferia galanga fractions methanol-3:1, Ethanol : methanol-1:1, showed DPPH scavenging activity Ethanol : methanol-1:3, Methanol, ranging from 9.52% to 66.66%. Except Methanol : water-3:1, Methanol water- the water fraction all other fractions 1:1, Methanol : water-1:3 and Water] [Chloroform, Chloroform : diethyl showed DPPH scavenging activity ether-3:1, Chloroform : diethyl ether- greater than 42.85%. Three peaks were 1:1, Chloroform : diethyl ether-1:3, obtained when the inhibition percent of Diethyl ether, Diethyl ether : ethyl different fractions were plotted (figure acetate-3:1, Diethyl ether : ethyl 4.22). The acetone fraction showed the acetate-1:1, Diethyl ether : ethyl maximum inhibition percent (66.66%) acetate-1:3, Ethyl acetate, Ethyl of antiradical scavenging activity. acetate : acetone- 3:1, Ethyl acetate : Similar activities were observed by Zaeoung et al. (2005), Tewtrakul et al.

20 Antiradical activity (%) activity Antiradical 10

Ethanol Ethanol : methanol Ethanol Ethanol : methanol Ethanol : methanol

Methanol

Chloroform

Ethanol

Acetone

Acetone :ethanol Acetone :ethanol Acetone :ethanol

Ethyl Ethyl acetate :acetone Ethyl acetate :acetone Ethyl acetate :acetone

Water

Chloroform Chloroform : diethyl ether Chloroform Chloroform : diethyl ether Chloroform : diethyl ether

Diethyl ether Ethyl Ethyl acetate

Methanol Methanol : water Methanol : water Methanol : water

Diethyl ether: ethyl acetate Diethyl ether: ethyl acetate Diethyl ether: ethyl acetate

- - -

3:1 1:1 1:3

1:3 3:1 1:1

- - -

3:1 1:1 1:3

- - -

3:1 1:1 1:3

- - -

1:3 3:1 1:1

- - -

3:1 1:1 1:3

Solvent extracts of Kaempferia galanga Figure 4.22: Free radical scavenging activity of different solvent fractions of K. galanga by DPPH

RESULTS AND DISCUSSION 123

(2005) and Rajendra et al. (2011), in (figure 4.23). Concentrations their studies with the extracts of dependent hydroxyl radical scavenging Kaempheria galanga. activity was observed. In all the cases the hydroxyl radical scavenging 4.4.2 IC50 of the fractions activities increased with the increase in The fractions showing the maximum concentrations of the extracts. antiradical activity was diluted to different concentrations and the diluted In Zingiber officinale, the chloroform fraction was subjected to DPPH assay fraction (43.75%) showed maximum for antiradical activity. Diethyl ether & hydroxyl radical scavenging activity ethyl acetate (1:1) fraction of Z. followed by hexane fraction (39.13%) officinale (80% antiradical activity), insoluble in methanol and diethyl ether Diethyl ether & ethyl acetate (3:1) & ethyl acetate (1:3) fraction (39.13%) fraction of C. longa (77.5% antiradical at a concentration of 300 mg/ml. The activity) and Acetone fraction of K. minimum hydroxyl radical inhibition galanga (66.66% antiradical activity) activity was recorded in hexane fraction insoluble in methanol and were used to determine the IC50. The Diethyl ether: Ethyl acetate (1:1) IC50 differed considerably in the fractions studied. The bioactive fraction at a concentration of 3 mg/ml. fractions of Z. officinale, C. longa and In Curcuma longa, the diethyl ether K. galanga showed a concentration fraction (40.00%) showed maximum dependent DPPH radical scavenging hydroxyl radical scavenging activity activity with IC50 of 8 mg/ml, 55.80 followed by Benzene: Chloroform mg/ml and 280 mg/ml respectively at (1:1) fraction (36.00%) and diethyl fresh weight basis. ether: ethyl acetate (1:1) fraction

4.4.3 Assay of hydroxyl radical (32.00%) at a concentration of 300 mg/ scavenging activity ml. The minimum hydroxyl radical inhibition activity was recorded in Degradation of deoxyribose mediated Diethyl ether: Ethyl acetate (3:1) by hydroxyl radicals generated by the 3+ fraction (8.00%) at a concentration of 3 Fe / ascorbate/EDTA/H2O2 system mg/ml. was also inhibited by the 6, 5 and 4 bioactive fractions of Z. officinale, C. In Kaempferia galanga, the acetone longa and K. galanga respectively fraction (40.00%) showed maximum hydroxyl radical scavenging activity

RESULTS AND DISCUSSION 124

Ethanol : Methanol (1:3)

Acetone : Ethanol (3:1)

Acetone Kaempferia

Ethyl acetate : Acetone (1:3) 300 mg/ml300

Acetone : Ethanol (1:1)

Diethyl ether : Ethyl acetate (1:1) K. galanga..K.

Diethyl ether : Ethyl acetate (3:1) and

Curcuma C longaC Diethyl ether , 30 mg/ml30

Benzene : Chloroform (1:1) Z. Z. officinale Solvent fractions Solvent

Diethyl ether : Ethyl acetate (1:3)

Diethyl ether : Ethyl acetate (1:1)

Diethyl ether : Ethyl acetate (3:1) 3 mg/ml3 Chloroform Zingiber

Benzene

Hexane

50 40 30 20 10

Scavenging percentage Scavenging Figure Figure 4.23:radical Hydroxyl scavenging activity differentof solvent fractions of

RESULTS AND DISCUSSION 125 followed by Ethyl acetate : Acetone NO synthesis.

(1:3) fraction (32.00%) and Acetone : In C. longa the benzene: chloroform Ethanol (3:1) fraction (32.00%) at a (1:1) fraction (42.22%) was most concentration of 300 mg/ml. The active in NO scavenging activity minimum hydroxyl radical inhibition followed by diethyl ether: ethyl acetate activity was recorded in Ethanol: (3:1) fraction (33.33%) and diethyl Methanol (1:3) fraction (8.00%) at a ether fraction (28.88%) at a concentration of 3 mg/ml. concentration of 300 mg/ml. The 4.4.4 Assay of nitric oxide scavenging minimum NO scaveging activity was activity observed in diethyl ether: ethyl acetate

Results indicate that, all the bioactive (1:1) fraction (6.66%) at a Zingiber officinale, Curcuma longa concentration of 3 mg/ml. Similar NO and Kaempferia galanga fractions have scavenging activity of Curcuma longa NO scavenging activity (figure 4.24). has been observed by Ippoushi et al. The scavenging activity increased with (2003). decrease in concentrations in all the In K. galanga the acetone fraction bioactive fractions other than the (41.30%) was most active in NO hexane fractions Z. officinale. scavenging activity followed by Ethyl

In Z. officinale the hexane fraction acetate: Acetone (1:3) fraction (47.72%) was most active in NO (36.95%) and Acetone: Ethanol (3:1) scavenging activity followed by fraction (28.26%) at a concentration of chloroform fraction (43.75%) and 300 mg/ml. The minimum NO hexane fraction (43.18%) at scaveging activity was observed in concentrations of 3 mg/ml, 300 mg/ml Acetone: Ethanol (3:1) fraction and 30 mg/ml respectively. the (17.39%) at a concentration of 3 mg/ minimum NO scavenging activity was ml. observed in Diethyl ether: Ethyl acetate 4.4.5 Determination of lipid (1:1) fractions (11.36%) at peroxidation inhibition activity concentrations of 3mg/ml and 30 mg/ The bioactive fractions of Z. officinale, ml. Similar results were obtained by C. longa and K. galanga fractions Ippoushi et al. (2003) and Bhattacharya protected hepatocytes from damage et al. (2009). These results suggest that due to lipid peroxidation induced in ginger extracts are potent inhibitor of

RESULTS AND DISCUSSION 126

Ethanol : Methanol (1:3)

Acetone : Ethanol (3:1)

Acetone Kaempferia

Ethyl acetate : Acetone (1:3) 300 mg/ml300

Acetone : Ethanol (1:1)

Diethyl ether : Ethyl acetate (1:1)

Diethyl ether : Ethyl acetate (3:1) galanga.K. and Curcuma

Diethyl ether

C longaC , , 30 mg/ml30 Benzene : Chloroform (1:1)

Solvent fractions Solvent Z. Z. officinale

Diethyl ether : Ethyl acetate (1:3)

Diethyl ether : Ethyl acetate (1:1)

Diethyl ether : Ethyl acetate (3:1) 3 mg/ml3

Chloroform Zingiber

Benzene

Hexane

50 40 30 20 10

Scavenging percentage Scavenging Figure Figure 4.24:Nitric oxide scavenging ofactivity differentsolvent fractions of

RESULTS AND DISCUSSION 127

Ethanol : Methanol (1:3)

Acetone : Ethanol (3:1)

Acetone Kaempferia

Ethyl acetate : Acetone (1:3) 300 mg/ml300

Acetone : Ethanol (1:1)

Diethyl ether : Ethyl acetate (1:1) K. galanga.K.

Diethyl ether : Ethyl acetate (3:1) and

Curcuma C longaC Diethyl ether , 30 mg/ml30

Benzene : Chloroform (1:1) Z. officinale Solvent fractions Solvent

Diethyl ether : Ethyl acetate (1:3)

Diethyl ether : Ethyl acetate (1:1)

Diethyl ether : Ethyl acetate (3:1) 3 mg/ml3 Chloroform Zingiber

Benzene

Hexane

50 40 30 20 10

Scavenging percentage Scavenging Figure Figure 4.25:Lipid peroxidation inhibition ofactivity differentsolvent fractions of

RESULTS AND DISCUSSION 128 goat liver homogenate by ferric-ADP function was recorded in Acetone: and ascorbate in a dose dependent Ethanol (3:1) fraction (33.33%) manner (figure 4.25). followed by acetone fraction (30.00%)

In Z. officinale the maximum and Ethyl acetate : Acetone (1:3) protective function was recorded in fractions (26.66%) at a concentration chloroform fraction (30.76%) followed of 300 mg/ml. The minimum activity by Hexane, Benzene and Diethyl was observed in Ethanol : Methanol ether : Ethyl acetate (3:1) fractions (1:3) fraction (6.66%) at concentrations (23.07%) and Diethyl ether : Ethyl of 3 mg/ml. acetate (1:1) fraction (19.23%) at 300 4.4.6 Comparison of antiradical mg/ml. the minimum activity was activity observed in Diethyl ether : Ethyl Comparative study of antiradical acetate (1:1) fraction (7.69%) at activities of the genera were conducted concentrations of 3 mg/ml and 30 mg/ (figure 4.26). The Diethyl ether: ethyl ml. Diethyl ether: ethyl acetate (1:3) acetate (1:1) and Diethyl ether: ethyl showed similar hepatocyte protective acetate (3:1) fractions of Z. officinale activity in all the concentrations. and C. longa are more potential than Similar results were observed by Jolad the two fractions of K. galanga. The et al., (2004) and Bhattacharya et al. most potential fractions are Diethyl (2009). ether: ethyl acetate (1:1), Diethyl ether: In C longa the maximum protective ethyl acetate (3:1) and Acetone in Z. function was recorded in Diethyl officinale (80.88%), C. longa (61.76%) ether : Ethyl acetate (3:1) fraction and K. galanga (13.23%) respectively. (46.42%) followed by Diethyl ether The maximum inhibition was recorded fractions (42.85%) at a concentration in Diethyl ether: ethyl acetate (1:1) of 300 mg/ml and Diethyl ether : Ethyl fraction of Z. officinale (80.88%) while acetate (3:1) fraction (35.71%) at the lowest inhibition was shown by concentration of 30 mg/ml. The Diethyl ether: ethyl acetate (3:1) minimum activity was observed in fraction of K. galanga (4.41%). In Diethyl ether: Ethyl acetate (1:1) general the Diethyl ether: ethyl acetate fraction (7.69%) at concentrations of 3 (1:1) and Diethyl ether: ethyl acetate mg/ml and 30 mg/ml. (3:1) fractions of Z. officinale and C.

In K. galanga the maximum protective longa are much more active in

RESULTS AND DISCUSSION 129

90 Diethyl ether : Ethyl acetate (3:1) Diethyl ether : Ethyl acetate (1:1) Acetone 80

Antiradical activity (%) activity Antiradical 20

0 Zingiber Curcuma Kaempferia

Figure : 4.26: Comparative study of free radical scavenging activity of different solvent fractions of Z. officinale, C. longa and K. galanga by DPPH scavenging free radicals in comparison antioxidants in Alpinia nutans (Habsah to the K. galanga fractions. et al., 2003), Galium fissurense

4.4.7 Detection of compounds (Delioram 2003) and many other medicinal plants. When the distribution of polyphenols was analyzed in different fractions 4.4.8 Antiradical activities of C. longa Ginger, it was observed that phenolic cultivars compounds were distributed from The antiradical activities in the chloroform to aqueous fraction methanol and water extracts of whereas gingeroles and arbutin related different Curcuma longa cultivars were compounds were mainly restricted in variable (figure 4.27). In all the diethyl ether: ethyl acetate fractions. varieties the methanol soluble fraction The bioactive fraction, di ethyl ether & showed more antiradical activity than ethyl acetate (1:1) showed the the water soluble fraction. The sensitivity against NP/PEG from which arithmetic means of the antiradical it may be concluded that ginger activities of the ten varieties in their flavonoids have some contributory methanol and water soluble fractions roles in scavenging antiradical activity. were 43.03% and 26.60% respectively. Polyphenols and flavonoids have The cultivars like Suguna, T. C. Assam already been reported to act as potent Suvarna and Roma, were above the

RESULTS AND DISCUSSION 130

T12

T11 T10 T9 T8

AntiradicalWater activity (please refer table 4.1 species for the and varieties name) cultivars

cultivars cultivars

Curcuma longaCurcuma Curcuma longa T5 T4 T3 Antiradicalactivity Methanol T2 T1

70 60 50 40 30 20 10

% Scavenging activity Scavenging % Figure Figure 4.27: : (% Antiradical Scavenging ofactivity DPPH) different of

RESULTS AND DISCUSSION 131 average in antiradical activities in their of Roma (64.61%) followed by methanol soluble fraction while the Suvarna (60.00%) and T. C. Assam local cultivar collected from Dhupguri, (60.00%) cultivars, while the minimum Suguna, CLS 2A and Roma were activity was observed in the cultivar above the average in antiradical PTC13 (26.92%). The maximum activities of their water soluble antiradical observed in water solvent fraction. Antiradical activities of four fraction was in cultivar Roma (39.75%) cultivars viz. Local collected from followed by the cultivar Suguna Lataguri (26.50%), T C Assam (27.71%) while the minimum activity (25.31%), Suvarna (26.52%) and was observed in Kasturi (19.27%) and Sudarshana (25.38%) were marginally PTC 13 (19.27%). The maximum and lower than the average antiradical minimum antiradical activity was activities. The maximum antiradical showed by the cultivar Roma and observed in methanol solvent fraction PTC13 respectively.

CONCLUSION

The study area is situated in Darjeeling The rhizomatous plants of district and adjoining plains. This Zingiberaceae are vegetative region is well known for its majestic propagated, carrying the pathogen from beauty and is an ideal place for health. generation to the other. A large It serves as one of the richest and quantity of the crop is lost in the field interesting botanical regions in the every year due to pathogens. whole of Indian subcontinent and thus, Improvement of these plants by has been a central point of natural and conventional hybridization techniques floristic attraction for tourists and are not possible due to lack of nature lovers. Its rich flora and fauna is flowering and seed set. Most crop of paramount significance for the improvement programs are restricted to nature lovers and biologists. A wide selection of improved cultivars. range of vegetation structures with Therefore extensive study was required extremely rich plant and animal in the field to explore the idea of using diversity has developed due to the in vitro techniques for improvement of extreme climatic, edaphic, and the crop. In vitro regeneration by using physiographic variations. Many ancient rhizome buds of Z. officinale, C. longa floristic elements have survived in this and K. galanga as an explant has the flora while some have differentiated to potentiality to produce huge quantity of different races through the ages. The plantlets within a very short period. floral elements of the region include The plants after hardening can be well various members of the family maintained in field condition and the Zingiberaceae, of which Curcuma lines if superior can be further longa, Kaempferia galanga and multiplied by the conventional Zingiber officinale are cultivated in this technique. Moreover, micropropagated region. plants are free from diseases or pests

CONCLUSION 133 and show superiority in different about 85% of traditional medicine aspects. Standardization of mass involves the use of plant extracts. propagation protocol of the genera Almost every civilization has a history through in vitro technique has been of medicinal plant use. Interest in achieved. phytomedicine has exploded in the last

Identification of potential cultivar by few years. The resurgence of public morphological studies has some interest in plant-based medicine limitations. Slight variations within the coupled with rapid expansion of cultivars cannot be made out by the pharmaceutical industries has study of floral morphology. So necessitated an increased demand for employing molecular techniques is medicinal plant research. Assessment important. DNA fingerprinting using of antiradical activities of the local RAPD and ISSR primers may prove to cultivars is important in this be very useful in this process of perspective. Chromatographic identification. Keeping this limitation separation of antioxidant rich fractions in mind, molecular documentation of has been achieved. Fractionation of the the local cultivars of Curcuma longa extracts with polar and non polar was worked out. The knowledge of the solvents has significance in gene sequences of the local cultivars understanding the in vitro mechanism and their relationships with other of action of these formulations. This established cultivars of turmeric will may open new field in the certainly help in judging its origin and pharmaceutical industry and pave the relatedness with other members. way to treat several diseases.

Medicinal plants have been the Proper utilization of natural resources subjects of man's curiosity since time is important to boost the local economy immemorial. Approximately 80% of too. Sustainable and eco-friendly use of the people in the world's developing resources by modern techniques can countries rely on traditional medicine achieve the result and pave the way for for their primary health care needs, and development.

BIBLIOGRAPHY

Aiyer, K. N., & Kolammal, M. (1964). plants. InCryopreservation of Plant Pharmacgnosy of Auyrvedic drugs, Germplasm I Springer Berlin Heidelberg. Trivandrum. 9,122. Balachandran, S. M., Bhat, S. R., & Chandel, Akhila, A., & Tewari, R. (1984). Chemistry of K. P. S. (1990). In vitro clonal ginger, A review. Current Research in multiplication of turmeric (Curcuma spp.) Medicinal & Aromatic Plants. Plants, 6(3), and ginger (Zingiber officinale Rosc.). 143-156. Plant Cell Reports, 8(9), 521-524. Altschul, S. F., Gish, W., Miller, W., Myers, E. Bandyopadhyay, U., Das, D., & Banerjee, R. W., & Lipman, D. J. (1990). Basic local K. (1999). Reactive oxygen species, alignment search tool. Journal of molecular oxidative damage and pathogenesis. biology, 215(3), 403-410. Current Science, 77, 658-666. Andersson, L., & Chase, M. W. (2001). Bednarcyzk, A. A., & Kramer, A. (1975). Phylogeny and classification of Identification and evaluation of the flavour Marantaceae. Botanical Journal of the significant components of ginger essential Linnean Society, 135(3), 275-287. oil. Chem. Sens., 1, 377. Anto, R.J., Kuttan, G., Kuttan, R., Babu, Behera, K. K., & Sahoo, S. (2009). Effect of K.V.O., & Rajasekharan, K.N. (1994). A plant growth regulator on micropropagtion comparative study on the pharmacological of ginger (Zingiber officinale Rosc.) cv- properties of natural curcuminoids, Amala Suprava and Suruchi. Journal of Research Bulletin, 14, 60-65. Agricultural Technology, 5(2), 271-280. Arora, A., Sairam, R. K., & Srivastava, G. C. Behera, K. K., Pani, D., & Sahoo, S. (2010). (2002). Oxidative stress and antioxidative Effect of Plant Growth Regulator on in system in plants. Current Science, 82(10), vitro Multiplication of Turmeric (Curcuma 1227-1238. longa L. cv. Ranga). International Journal Asolkar, L.V., Kakkar, K. K. & Chakre, O. J. of Biological Technology, 1(1), 16-23. (1992). Second Supplement to Glossary of Bertram, F. and Walbaum, H. (1894). Ginger Indian Medicinal Plants with Active oil. Journal. Prakt. Chemistry., 49, 15. Principles Part I (A-K). (1965-81). Bhagyalakshmi B., & Singh N. S (1988). Publications and Informations Directorate Meristem culture and propagation of a (CSIR), New Delhi. 414p. variety of ginger (Zingiber officinale Rosc.) Bagul, M. S., Kanaki, N. S., & Rajani, M. with a high yield of oleoresin. Journal of (2005). Evaluation of free radical Horticulture Science. 63, 321-327. scavenging properties of two classical Bhattacharjee, S. (2005). Reactive oxygen polyherbal formulations. Indian journal of species and oxidative burst, Roles in stress, experimental biology, 43(8), 732-736. senescence and signal. Current Science, 89 Bajaj, Y. P. S. (1995). Cryopreservation of (7). germplasm of medicinal and aromatic Bhattacharya, M., & Sen, A. (2006). Rapid in

BIBLIOGRAPHY 135

vitro multiplication of disease-free Zingiber sexual tissues of trees using polymerase officinale rosc. Indian journal of plant chain reaction. Canadian Journal of Forest physiology, 11(4), 379-384. Research, 20(2), 254-257. Bhattacharya, M., & Sen, A. (2013). In vitro Bramwell, D. (1990). The role of in vitro regeneration of pathogen free Kaempferia cultivation in the conservation of galanga L.-a rare medicinal plant. Research endangered species. Conservation in Plant Biology, 3(3), 24-30. techniques in botanic gardens, 3-15. Bhattacharya, M., Goyal, A. K., & Mishra, T. Braun, A. C., & White, P. R. (1943). (2014). In vitro regeneration of some lesser Bacteriological sterility of tissues derived known medicinal Zingibers, a review. from secondary crown-gall tumors. Bhattacharya, M., Mandal, P., & Sen, A. Phytopathology, 33, 85-100. (2009). In vitro detection of antioxidants in Breiman, A., Felsenburg, T., & Galun, E. different solvent fractions of Ginger (1989). Is Nor region variability in wheat (Zingiber officinale Rosc.).Indian Journal invariably caused by tissue culture? Theor. of Plant Physiology, 14(1), 23-27. Appl. Genet. 77, 809.814. Bhowmik S S D, Kumaria S & Tandon P, Breiman, A., Rotem-abarbanell, D., Karp, A., Conservation of Mantisia spathulata & Shaskin, H. (1987). Heritable somaclonal Schult. and Mantisia wengeri Fischer, Two variation in wild barley (Hordeum critically endangered and endemic spontaneum). Theoretical and Applied Zingibers of Northeast India, Seed Genetics, 71, 637.643. Technology, 32(2010) 57 - 62. Brooks, B.T. (1916). Zingiberol. J. Am. Chem. Blokhina, O., Virolainen, E., & Fagerstedt, K. Soc., 38,430. V. (2003). Antioxidants, oxidative damage Butkhup L. & Samappito S. (2011). In vitro and oxygen deprivation stress, a review. free radical scavenging and antimicrobial Annals of botany, 91(2), 179-194. activity of some selected Thai medicinal Bonte, F., Noel Hudson, M.S., Wepierre, J., & plants. Research Journal of Medicinal Plant Meybeck, A. (1997). Protective effect of 5(3), 254-265. curcuminoids from Curcuma longa L. on Carlson, J. E., Tulsieram, L. K., Glaubitz, J. C., epidermal skin cells under free oxygen Luk, V. W. K., Kauffeldt, C., & Rutledge, radical stress. Planta Medica, 63(3), 265- R. (1991). Segregation of random amplified 286. DNA markers in F1 progeny of conifers. Bornet, B., & Branchard, M. (2001). Theoretical and Applied Genetics, 83(2), Nonanchored inter simple sequence repeat 194-200. (ISSR) markers, reproducible and specific Chainani-Wu, N. (2003). Safety and anti- tools for genome fingerprinting. Plant inflammatory activity of curcumin: a Molecular Biology Reporter, 19(3), 209- component of tumeric (Curcuma longa). 215. The Journal of Alternative & Bouman H and De Klerk GJ. (1996) Complementary Medicine, 9(1), 161-168. Somaclonal variation in biotechnology of Chan, E. W. C., Lim, Y. Y., Wong, L. F., ornamental plants. In, Geneve R, Preece J, Lianto, F. S., Wong, S. K., Lim, K. K., & Merkle S, editors. Biotechnology of Lim, T. Y. (2008). Antioxidant and ornamental plants. UK: CAB International; tyrosinase inhibition properties of leaves pp. 165–183. and rhizomes of ginger species. Food Bousquet, J., Simon, L., & Lalonde, M. (1990). Chemistry, 109(3), 477-483. DNA amplification from vegetative and Chan, E. W. C., Lim, Y. Y., Wong, S. K., Lim,

BIBLIOGRAPHY 136

K. K., Tan, S. P., Lianto, F. S., & Yong, M. Chowdhury, M. K. U., Vasil, V., & Vasil, I. K. Y. (2009). Effects of different drying (1994). Molecular analysis of plants methods on the antioxidant properties of regenerated from embryogenic cultures of leaves and tea of ginger species. Food wheat (Triticum aestivum L.). Theoretical Chemistry, 113(1), 166-172. and Applied Genetics, 87(7), 821-828. Chase, M. W. (2004). Monocot relationships: Chu, I. Y. E., Kurtz, S. L., Ammirato, P. V., an overview. American Journal of Botany, Evans, D. A., Sharp, W. R., & Bajaj, Y. P. 91(10), 1645-1655. S. (1990). Commercialization of plant Chase, M. W., Duvall, M. R., Hills, H. G., micropropagation. Handbook of plant cell Conran, J. G., Cox, A. V., Eguiarte, L. E., culture. Volume 5. Ornamental species, pp Hartwell, J., Fay, M. F., Caddick, L. R., 126-164. Cameron, K. M., & Hoot. S. (1995a.) Connell, D.W. (1970). Natural pungent Molecular phylogenetics of Lilianae. In P. products. III. The paradols and associated J. Rudall, P. J. Cribb, D. F. Cutler, & C. J. compounds. Australian Journal of Humphries [eds.], Monocotyledons: Chemistry, 23, 369. systematics & evolution, . Royal Botanic Connell, D.W., & Mclachlan, R. (1972). Gardens, Kew, London, UK. pp 109–137 Natural pungent compounds. IV. Chase, M. W., Stevenson, D. W., Wilkin, P., & Examination of the gingerols, shogaols, Rudall, P. J. (1995b.) Monocot systematics: paradols and related compounds by thin a combined analysis. In P. J. Rudall, P. J. layer and gas chromatography. Journal of. Cribb, D. F. Cutler, and C. J. Humphries Chromatography, 67, 29. [eds.], Moncotyledons: systematics and Connell, D.W., & Sutherland, M.D. (1969). A evolution, Royal Botanic Gardens, Kew, re-examination of gingerol, shogaol and London, UK. pp 685–730 zingerone, the pungent principles of ginger. Chawdhury, M.K.U., Vasil, V., & Vasil., I.K. Australian. Journal of. Chemistry, 22,1033. (1994). Molecular analysis of plants Dahlgren, R. M. T., Clifford, H. T., & Yeo. P. regenerated from embryogenic cultures of F. (1985). The families of the wheat (Triticum aestivum L.). Theoretical monocotyledons: structure, evolution and and Applied Genetics, 87,821.828. taxonomy. Springer, Berlin, Germany. Chirangini, P., Sinha, S. K., & Sharma, G. J. Datta, S. C. (1988). Systematic botany. New (2005). In vitro propagation and Age International. microrhizome induction in Kaempferia de Lange J.H., Willers P., & Nel M.I. (1987). galanga Linn. and K. rotunda Linn. Indian Elimination of nematodes from ginger Journal of Biotechnology, 4(3), 404-408 (Zingiber officinale Rosc.) by tissue Choi, S. K. (1991) Studies on the clonal culture. Journal of Horticultural Science, multiplication of ginger through the in vitro 62, 249 – 252. cuttings. Research Reports of the Rural Debergh, P. C., & Maene, L. J. (1981). A Development Administration, 38, 33-39. scheme for commercial propagation of Choi, S. K., & Kim, D. C. (1991). The study on ornamental plants by tissue culture. Science the clonal multiplication of ginger through Horticulture, 14, 335–345. in vitro culture of shoot apex. Dekker, A.J., A.N. Rao and C.J. Goh. 1991. In Biotechnology, 33, 40-45. vitro storage of multiple shoot cultures of Chopra, R. N., Nayar, S. L. and Chopra, I. C. gingers of ambient temperatures of 24-29⁰ 1980. Glossary of Indian Medicinal Plants. C. Scient. Hort., 47, 157-168. CSIR, New Delhi. Delioram Orhan D (2003) Novel Flavanone

BIBLIOGRAPHY 137

Glucoside with Free Radical Scavenging cultures of soybean root cells. Experimental Properties from Galium fissurense. Cell Research, 50(1), 151-158. Pharmaceutical Biology. 41, 475-478. Garg, S.C. & Jain, R. (1991). The essential oil Denniff, P., & Whitting, D.A. (1976). of Zingiber officinale Rosc. – a potential Biosynthesis of (6)- gingerol; pungent insect repellent. Journal of Economic principle of Zingiber officinale. J. Chem. Botany and Phytochemistry, 2 (1-4), 21-24. Soc., Chem. Communication.18,711. Gautheret RJ (1934). Culture du tissus Denniff, P., Macleod, I., & Whiting, D.A. cambial. C. R. Hebd. Séances. Acad. Sci., (1980). Studies in the biosynthesis of (6)- 198, 2195-2196. gingerol, pungent principles of ginger Gayatri, M. C., & Kavyashree, R. (2005). (Zingiber officinale). J. Chem. Soc., Perkin Selection of turmeric callus tolerant to Trans, 1, 2637. culture filtrate of Pythium Graminicolum Desjardins Y A, Goselin & Yellow S. (1987). and regeneration of plants. Plant cell, tissue Acclimatization of In vitro straw berry and organ culture, 83(1), 33-40.

plantlets in CO2 enriched environment and Geetha, S. P., Manjula, C., John, C. Z., Minoo, supplementary lighting, Journal of D., Nirmal Babu, K., & Ravindran, P. N. American Society of Horticulture Science, (1997) Micropropagation of Kaempferia 112, 846-852. spp. (K galanga L. and K rotunda L.) Dey, A. C. 1980. Indian Medicinal Plants Journal of Spices and Aromatic Crops, 6 Used in Ayurvedic Preparations. Bishen (2), 129-135 Singh, Mahendra Pal Singh, Dehra Dun- George, M. and Pandalai, K.M. (1949). 248001. Investigations on plant antibiotics part IV. Dipti, T., Ghorade, R. B., Swati, M., Pawar, B. further search for antibiotic substances in V. & Ekta, S., (2005), Rapid multiplication Indian medicinal plants. Indian Journal of of turmeric by micropropagation. Annual Medicinal Research, 37, 169-181. plant Physiology, 19, 35-37. Ghani, A. (1998). Medicinal plants of Dodge, F.D. (1912). Ginger oil. Proc. 8th. Int. Bangladesh chemical constituents and uses. Congr. Appl. Chem. Washington., 6, 77. Asiatic Society of Bangladesh. Dogra, S. P., Koria, B. N., & Nad Sharma, P. Girij, J., Sakthi Devi, T.K., & Meerarani, T.S. P. (1994). In vitro clonal propagation of (1984). Effect of ginger on serum ginger (Zingiber officinale Rosc.). chbolesterol levels. Indian Journal Horticultural Journal, 7, 45-50. Nutrition & Diet. 21 (2), 433-436. Duke, J. A., & Ayensu, E. S. (1985). Medicinal Givinish, T. J., Evans, T. M., Pires, J. C., & Plants of China. Medicinal Plants of the Sytsma, K. J. (1999). Polyphyly and World. Vol. 1. Algonac, MI. convergent morphological evolution in Commelinales and Commelinidae: Elizabeth K and Rao M N A (1990). Oxygen evidence from rbcL sequence data. radical scavenging activity of curcumin. Molecular Phylogenetics andEvolution 12, International Journal of Pharmacognosy, 360–385. 58, 237-240. Gopalakrishna, V., Reddy, M.S., & Fay, M. F. (1992). Conservation of rare and Vijayakumar, T. (1997). Response of endangered plants using in vitro methods. turmeric to FYM and fertilisation. Journal In Vitro Cellular & Developmental Biology of Research Angaru. 25 (3), 58-59. -Plant, 28(1), 1-4. Goyal, R.K., & Korla, B.N. (1993). Changes in Gamborg, O. L., Miller, R., & Ojima, K. the quality of turmeric rhizomes during (1968). Nutrient requirements of suspension

BIBLIOGRAPHY 138

storage. Journal of Food Science and mutations induced by tissue culture. Proc Technology, 30 (5), 362-364. Natl Acad Sci USA., 93, 7783-7788. Gudin S., & Mouchotte J. (1996). Integrated Hirschhorn, H.H. 1983. Botanical remedies of research in rose improvement: a breeder's the former dutch east Indies (Indonesia). J. experience. Acta Horticulture, 424, 285– Ethanopharmacol.72, 123-156. 292. Hooker J. D. (1872 – 1997). The Flora of Guha, S., & Maheshwari, S. C. (1966). Cell British India. Vol. I – VII. London. division and differentiation of embryos in Hosoki, T., & Sagawa, Y. (1977). Clonal the pollen grains of Datura in vitro. Nature, propagation of ginger (Zingiber officinale 212, 97-98. Roscoe) throught tissue culture. Hort. Haberlandt,G.(1902). Kulturversuche mit Science, 12, 451-452 isolerten Pflanzenzellen. Sber. Akad. Wiss. Husain, A., Virmani, O. P., Popli, S. P., Misra, Wein 111, 69-92. L. N., Gupta, M. M., Srivastava, G. N. Habsah M, Nordin Lajis H, Ali A M, Sukari M Abraham, Z., & Singh, A. K. (1992). A, Hin Y Y, Kikuzaki H and Nakatani N Dictionary of Indian Medicinal Plants. (2003) The Antioxidative Components from CIMAP, Lucknow, India.546p. Alpinia nutans. Pharmaceutical Biology. Hussain, H. E. M. A. (2002). Hypoglycemic, 41, 7-9. hypolipidemic and antioxidant properties of Hackett, W. P. (1966). Application of tissue combination of Curcumin from Curcuma culture to plant propagation. Proceedings of longa, Linn, and partially purified product International Plant Propagation Society, fromAbroma augusta, Linn. in pp. 88-92. streptozotocin induced diabetes. Indian Halim, E., & Hussain, M A (2002). journal of clinical biochemistry, 17(2), 33- Hypoglycemic, hypolipidemic and 43. antioxidant properties of combination of Ikeda, L. R., & Tanabe, M. J. (1989). In vitro curcumin from Curcuma longa Linn. and subculture applications for ginger. partially purified product from Abroma Horticultural Science, 24, 142-143. angusta Linn. in streptozotocin induced Ilahi, I., & Jabeen, M. (1987). diabetes. Indian Journal of Clinical Micropropagation of Zingiber officinale L. Biochemistry. 17, 33- 43 Pakisthan Journal of Botany, 19, 61-65. Halliwell, B., & Gutteridge, JMC (1990). Inden, H., Asahira, T., & Hirano, A. (1988). Methods Enzymol. 186, I-85. Micropropagation of ginger. In Symposium Hara, H. (1966) The flora of Eastern on High Technology in Protected Himalaya. University of Tokyo Press, Cultivation 230 (pp. 177-184). Tokyo, Japan. Inze, D., & Van Montagu, M. Harlan, J.R. (1975). Crops and Man. American (2004). Oxidative stress in plants. CRC Soc. Agro. Crop Sci. Press. Hartamann, H. F., Kester, D. E., Dauies, F. D. Ippoushi K, Azuma K, Ito H, Horie H, Jr., & Geneve, R. L. (1997). Plant Higashio H. (2003) [6]-Gingerol inhibits Propagation – Principles and Practices, nitric oxide synthesis in activated J774.1 6th Ed. Prentice Hall of India Private Ltd., mouse macrophages and prevents New Delhi, pp. 549-611. peroxynitrite-induced oxidation and Hirochika, H., Sugimoto, K., Otsuki, Y., nitration reactions. Life Science, 73, 3427– Tsugawa, H., & Kanda, M. (1996). 37. Retrotransposons of rice involved in Isabel, N., Boivin, R., Levasseur, C., Charest,

BIBLIOGRAPHY 139

P. M., Bousquet, J., & Tremblay, F. M. improvement (Vol. 32). Springer. (1996). Occurrence of somaclonal variation Jan, H. U., Rabbani, M. A., & Shinwari, Z. K. among somatic embryo-derived white (2011). Assessment of genetic diversity of spruces (Picea glauca, Pinaceae). American indigenous turmeric (Curcuma longa L.) journal of botany, 1121-1130. germplasm from Pakistan using RAPD Isabel, N., Tremblay, L., Michaud, M., markers. Journal of Medicinal Plants Tremblay, F. M., & Bousquet, J. (1993). Research, 5(5), 823-830. RAPDs as an aid to evaluate the genetic Jolad S. D, Lantz, R. C, Solyom, A. M., Chen, integrity of somatic embryogenesis-derived G. J., Bates, R. B., & Timmermann, B. N. populations of Picea mariana (Mill.) BSP. (2004) Fresh organically grown ginger Theoretical and Applied Genetics, 86(1), 81 (Zingiber officinale): composition and -87. effects on LPS-induced PGE2 production. Islam M. A., Kloppstech K., & Jacobsen H. J. Phytochemistry, 65, 1937–1954. (2004) Efficient Procedure for In vitro Joy, P. P., Thomas J., Mathew, S., and Skaria, Microrhizome Induction in Curcuma longa B. P. (1998). Zingiberaceous Medicinal L. (Zingiberaceae) – A Medicinal Plant of and Aromatic Plants. Tropical Asia Plant Tissue Cult. 14(2), 123- Kackar, A., Bhat, S. R., Chandel, K. P. S., & 134, Malik, S. K. (1993). Plant regeneration via Iyengar, M.A., Rama Rao, M.P., Gurumadhava somatic embryogenesis in ginger. Plant Rao, S., & Kamath, M.S. (1994). cell, tissue and organ culture, 32(3), 289- Antiinflammatory activity of volatile oil of 292. Curcuma longa L. leaves. Indian drugs, 31 Kalpana, M., & Anbazhagan, M. (2009). In (1), 528-531. vitro production of Kaempferia galanga Jain S. K., & Prakash, V (1995). Zingiberaceae (L.)-an endangered medicinal plant. Journal in India: Phytogeography and Endemism. of Phytology, 1(1), 56-61. Rheedea 5(2),154-169. Kami, T., Nakayama, M., & Hayashi, S. Jain, J. C., Verma, K. R., & Bhattacharya, S.C. (1972). Volatile constituents of Zingiber (1962). Terpenoids. XXVIII. GLC analysis officinale. Phytochemistry, 11, 3377. of monoterpenes and its applications to Kapil, U., Sood, A. K., & Gaur, D. R. (1990). essential oil. Perfum. essent. Oil Rec., 53, Maternal beliefs regarding diet during 678. common childhood illnesses. Indian Jain, S. M. (1997). Micropropagation of pediatrics, 27(6), 595-599. selected somaclones of Begonia and Katiyar S.K., Agarwal, R., & Mukhtar H. Saintpaulia. Journal of Biosciences,22(5), (1996). Inhibition of hunger promotion in 585-592. cancer mouse skin by ethanol extract of Jain, S. M. (2001). Tissue culture-derived Zingiber officinale rhizome. Cancer variation in crop improvement. Euphytica, Research, 56(5), 1023 – 1030 118(2), 153-166. Kawata, M., & Oono, K. (1997). Protoclonal Jain, S. M., & De Klerk, G. J. (1998). variation in crop improvement. In: Jain SM, Somaclonal variation in breeding and Brar DS, Ahloowalia BS, editors. propagation of ornamental crops. Plant Somaclonal variation and induced mutation Tissue Culture and Biotechnology. 4, 63-75. for crop improvement. The Netherlands: Jain, S. M., Brar, D. S., & Ahloowalia, B. S. Kluwer Acad. Publ., 135–48. (Eds.). (1998). Somaclonal variation and Keshavachandran, R., & Khader, M. A. (1989). induced mutations in crop Tissue culture propagation of turmeric.

BIBLIOGRAPHY 140

South Indian Horticulture, 37, 101-102. (2002). The phylogeny and a new Khalid, N., Davey, M. R., & Power, J. B. classification of the gingers (1989). An assessment of somaclonal (Zingiberaceae): evidence from molecular variation in Chrysanthemum morifolium: data. American Journal of Botany, 89 (10), the generation of plants of commercial 1682-1696. value. Sci Hortic., 38, 287–94. Kress, W. J., Prince, L. M., Hahn, W. J., & Khatun, A., Nasrin, S., & Hossain, M. T. Zimmer, E. A. (2001). Unraveling the (2003). Large scale multiplication of ginger evolutionary radiation of the families of the (Zingiber officinale Rosc.) from shoot-tip Zingiberales using morphological and culture. On Line Journal of Biological molecular evidence. Systematic Biology, 50 Sciences, 3(1-8), 59-64. (6), 926-944. Kinchi, F., Goto, Y., Sugimoto, N., Akao, N., Krishnamurthy, N., Nambudiri, E. S., Mathew, Kondo, K., & Tsuda, Y. (1993). A. G., &Lewis, Y. S. (1970). Essential oil Nematicidal activity of turmeric: of ginger. Indian Perfumer, 14(1), 1-3 Synergestic action of curcuminoids. Kumar, N., Kader Abdul., Rangaswami, P and Chemical and Pharmaceutical Bulletin, 41 Irulappan, (1997). Spices, plantation crops, (9), 1640-1643. medicinal and aromatic plants. Oxford & Kirchoff, B. K. (1992). Ovary structure and IBH publishing Co. Pvt. Ltd. New Delhi. pp anatomy in the Heliconiaceae and 20.05. Musaceae (Zingiberales). Canadian Journal Kurup, P. N. V., Ramdas, V. N. K., & Joshi, P. of Botany 70, 2490– 2508. (1979). Handbook of Medicinal Plants, Kirchoff, B. K., & H. Kunze. (1995). New Delhi. Inflorescence and floral development in Kuruvinshetti, M. S. & Iyer, R. D. (1981). An Orchidantha maxillarioides (Lowiaceae). evaluation of tissue culture technologies in International Journal of Plant Science, 156, coconut and turmeric. Proceedings of the 159–171. Fourth Annual Symposium on Plantation Kirtikar K.R. and Basu, B.D. (1996) Indian Crops, pp 101-106. Medicinal Plants.E. Blatter,. J. F. Caius Kuttan, R., Bhanumathy, P., Nirmala, K., & and Mahaskar (Eds.), Lalit Mohan Basu, George, M. C. (1985). Potential anticancer Allahabad, India. IV:2422-2423. activity of turmeric (Curcuma longa). Kiso Y., Suzuki Y., Watanabe N., Oshima Y., Cancer letters, 29(2), 197-202. & Hikino, H. (1983). Antihepatotoxic Lakshmi, M., & Mythili, S. (2003). Somatic principle of Curcuma longa. Planta med., embryogenesis and regeneration of callus 48, 45. cultures of Kaempferia galanga–medicinal Kisoy, Suzuki, Y., & Hikini, H. (1983). plant. J. Medicinal and Aromatic Plants, Sesquiterpenoid of Curcuma longa 25, 947-951. rhizomes. Phytochemistry, 22, 396 Lapworth, A., & Wykes, F.H. (1970). The Kochuthressia, K. P., John Britto, S., & pungent principles of ginger. Part II: Jaseentha, M. O. (2012). In vitro Synthetic preparation of zingerone, methyl multiplication of Kaempferia galanga L. an zingerone and some related compounds. J. endangered species. International Research Chem. Soc., 790. Journal of Biotechnology, 3(2), 27-31. Lapworth, A., Pearson, I.K. and Royle, F.A. Kolammal, M. (1979). Pharmacognosy of (1917). The pungent principles of ginger. Ayurvedic drugs. Trivandrum. No. 10. Part I: The chemical characters and decomposition prodcts of thresh’s Kress, W. J., Prince, L. M., & Williams, K. J.

BIBLIOGRAPHY 141

―gingerol‖. J. Chem. Soc., 777. Maheshwari, S. C. (1996). The Emergence of Larkin, P. J., & Scowcroft, W. R. (1981). Plant Biotechnology and Brief Survey of Somaclonal variation—a novel source of the Current International scene. In Plant variability from cell cultures for plant Tissue Culture. Ed. A. S. Islam. Oxford & improvement. Theoretical and Applied IBH Publishing Co. Pvt. Ltd. P. 84-96. Genetics, 60(4), 197-214. Malabadi, R. B., Mulgand, G. S., Nataraja, K. Larkin, P. J., Banks, P. M., Bhati, R., Brettell, (2005). Effect of triacotanol on the R. I. S., Davies, P. A., Ryan, S. A., ... & micropropagation of Costus speciosus Tanner, G. J. (1989). From somatic (Koen.) Sm. using rhizome thin sections. In variation to variant plants: mechanisms and vitro Cell Dev Biol Plant, 41, 129-132. applications. Genome, 31(2), 705-711. Malamug, J. J. F., Inden, H., & Asahira, T. Larson R. A. (1988). Phytochemistry, 4, 969- (1991). Plantlet regeneration and 978. propagation from ginger callus. Scientia horticulturae, 48(1), 89-97. Lawrence, B. M. (1982). Progress in essential oils. Perfumer Flavorist, 7, 45. Masada, Y., Maue, T. Hashimoto, K. Fujioka, M., & Shirakr, K. (1973). Studies of the Lee, S. Y., Fai, W. K., Zakaria, M., Ibrahim, pungent principle of ginger by GC-MS. J. H., Othman, R. Y., Gwag, J. G., ... & Park, Pharm. Soc., 94, 735. Y. J. (2007). Characterization of polymorphic microsatellite markers, Mathews, H. W. D., Luu, B. and Ourisson, G. isolated from ginger (Zingiber officinale (1980). Chemistry and biochemistry of Rosc.). Molecular Ecology Notes, 7(6), Chinese drugs. Part. VI. Cytotoxic 1009-1011. components of Zingiber zerubet, Curcuma z e d o a r i a a n d C. domestica . Lincy, A. K., & Sasikumar, B. (2010). Phytochemistry., 19, 2643. Enhanced adventitious shoot regeneration from aerial stem explants of ginger using Mendelsohn, R., & Balick, M. J. (1995). The TDZ and its histological studies. Turkish value of undiscovered pharmaceuticals in Journal of Botany, 34, 21-29. tropical forests. Economic Botany, 49(2), 223-228. Lincy, A. K., Remashree, A. B., & Sasikumar, B. (2009). Indirect and direct somatic Miller, C., Skoog, F., von Saltza, M. H., & embryogenesis from aerial stem explants of Strong, F. M. (1955). Kinetin, acell ginger (Zingiber officinale Rosc.). Acta division factor from deoxyribonucleic acid. Botanica Croatica, 68(1.), 93-103. J. Amer. Chem. Soc., 77, 1392 Lown, W.J., & Sim, S.K. (1977). The Mittler, R. (2002). Oxidative stress, mechanism of the bleomycin-induced antioxidants and stress tolerance. Trends in cleavage of DNA. Biochem. Biophys. Res. plant science, 7(9), 405-410. Comm. 77, 1150-1157. Mohanty, J. P., Nath, L. K., Bhuyan, N., & Ma, X., & Gang, D. R. (2006). Metabolic Mariappan, G. (2008). Evaluation of profiling of in vitro micropropagated and antioxidant potential of Kaempferia rotunda conventionally greenhouse grown ginger linn. Indian journal of pharmaceutical (Zingiber officinale). Phytochemistry, 67 sciences, 70(3), 362-364 (20), 2239-2255. Mokkhasmit, M.,Swatdimongkol, K., & Macleod, L., & Whiting, .A. (1979). Stages in Satrawah, P. (1971). Study on toxicity of the biosynthesis of (6)- gingerol in Zingiber Thai Medicinal Plants. Bull. Dept. Med. officinale. J. Chem. Soc., Chem. Commun., Sci., 12 2/4, 36-65. 1152. Moon, C. K., Park, N. S., & Koh, S. K. (1976).

BIBLIOGRAPHY 142

Studies on the lipid components of 56. Curcuma longa.1. The composition of fatty Nayak, S. (2000). In vitro multiplication and acids and sterols. Soul Techukkyo Yakhak microrhizome induction in Curcuma Nonmujip., 1, 105; Chem. Abstr., 1977, aromatica Salisb. Plant growth regulation, 87,114582. 32(1), 41-47. Morel, G (1963). La culture in vitro du Nayak, S. (2004). In vitro multiplication and meristeme apical de certaines orchidees. microrhizome induction in Curcuma CR Hebd. Seances Acad. Sci., 256, 4955- aromatica Salisb. Plant Growth 4957 Regulation. 32, 41-47 Morel, G. (1971). Deviations du metabolism Nayak, S., & Naik, P. K. (2006). Factors azote des tissus de crown-gall. Colloq. Int. affecting in vitro microrhizome formation C. N.R.S., 193, 463-471. and growth in Curcuma longa L. and Murashige, T. (1978a). The impact of plant improved field performance of tissue culture on agriculture. Frontiers of micropropagated plants. Science Asia, 32, plant tissue culture, 15, 26. 31-37. Murashige, T. (1978b). Principles of rapid Nayak, S., Naik, P. K., Acharya, L., propogation, In : Propagation of Higher Mukherjee, A. K., Panda, P. C., & Das, P. Plants Through Tissue Culture a Bridge (2005). Assessment of genetic diversity Between Research and Application (K. among 16 promising cultivars of ginger Huges, R. Henke and M. Constantin, Eds.) using cytological and molecular markers. Z Technology Information Centre, USDE Naturforsch [C], 60, 485-492. Oak, Ridge, pp. 14-24. Naz, S. H. A. G. U. F. T. A., Ilyas, S., & Javad Murashige, T., & Skoog, F. (1962). A revised Ali, A. (2009). In vitro clonal multiplication medium for rapid growth and bioassay with and acclimatization of different varieties of tobacco tissue cultures. Plant Physiology, turmeric (Curcuma longa L.). Pak. J. Bot, 15, 473-497. 41(6), 2807-2816. Nadgauda, R. S., Mascarenhas, A. F., Hendre, Nei, M., & Li, W. H. (1979). Mathematical R. R., & Jagannathan, V. (1978). Rapid model for studying genetic variation in multiplication of turmeric (Curcuma longa terms of restriction endonucleases. Linn.) plants by tissue culture. Indian Proceedings of the National Academy of Journal of Experimental Biology, 16(16), Sciences, 76(10), 5269-5273. 120-122. Nelson, E. K. (1917). Gingerol and paradol. J. Nadkarni, A. K. 1954. Indian Materia Medica, Am. Chem. Soc., 39, 1466. Bombay. pp. 408,1476. Nerle, S. K., & Torne, S. G. (1984). Studies in Nadkarni, K. M. 1998. Indian Medicinal Plants Kaempferia galanga L. Indian Drugs, 21 and Drugs- with their Medicinal Properties (6), 236 and Uses. Asiatic Publishing House New Nigam, M.C., Nigam, I.C., Levei, L. and Delhi. 450p.. Handa, K.L. 1964. Essential oil and their Nagabhushan, M. and Bhide, S.V. (1992). constituents. XXI. Detection of new trace Curcumin as an inhibitor of cancer. J. Am. components in oil of ginger (Zingiber Coll. Nutr. 11, 192-198. officinale). Can. J. chem., 42, 2610. Naik, G. R. (1998). Micropropagation studies Nirmal Babu, K., Samsudeen, K., & in medicinal and aromatic plants. Role of Ravindran, P. N. (1992). Direct biotechnology in medicinal and aromatic regeneration of plantlets from immature plants. Hyderbad: Ukaz publications, 50- inflorescence of ginger (Zingiber officinale

BIBLIOGRAPHY 143

Rosc.) by tissue culture, 1(1), 55-58 Biotechnology of Curcuma. CAB Reviews. Nirmal Babu, K., Samsudeen, K., Ranthambal, Perspective in Agriculture, Veternary M., & Ravindran, P. N. (1996). Science and Nutrition and Natural Embryogenesis and plant regeneration from Resources, 20, 1-9. ovary derived callus cultures of ginger (Z. Parwat, U., Tuntiwachwuttikul, P., Taylor, officinale Rosc.). Journal of Spices and W.C.Engelhardt, L.M., Skelton, B.W., & Aromatic Crops,5, 134-138. White, A.H. (1993). Diterpenes from Nobecuort, P (1937). Cultures en serie de Kaempferia species. Phytochemistry, 32 tissus vegetaux sur milieu artificiel. C .R. (4), 991-997. Hebd. Seances. Acad. Sci. 200, 521-523. Pillai, S. K., & Kumar, K. B. (1982). Note on Nomura, H. 1918. The pungent principles of the clonal multiplication of ginger in vitro. ginger. Part.I : A new ketone zingerone. J. Indian J. Agric. Sci., 52, 397-399. Chem. Soc. p.769. Povirk, L. F. & Austin, M. J. F. (1991). Nomura, H., & Tsuranii, S. (1927). The Genotoxicity of bleomycin. Mutat. Res. pungent principles of ginger. Part IV. 257, 127-143. Synthesis of shogaol. Proc.hup. Acad. Prain, D.(1903). Bengal Plants, Calcutta. Tokyo, 3, 159. Prathanturarug, S., Soonthornchareonnon, N., Noro, T., Miyase, T., Kuroyanagi, M.,Ueno, Chuakul, W., Phaidee, Y., & Saralamp, P. A., & Fukushima, S. (1983). Monoamine (2005). Rapid micropropagation of oxidase inhibitor from the rhizomes of Curcuma longa using bud explants pre- Kaempferia galanga L. Chem. Pharm. Bull. cultured in thidiazuron-supplemented liquid 31(8), 2708- 2711. medium. Plant cell, tissue and organ Okhawa H, Ohishi N, Yagi K. (1979). Assay of culture, 80(3), 347-351. lipid peroxide in animal tissue by Prathanturarug, S., Soonthornchareonnon, N., thiobarbituric acid reaction. Anal Biochem. Chuakul, W., Phaidee, Y., & Saralamp, P. 95, 351-8. (2003). High - frequency shoot Paguette, L. A., & Kinney, W. A. (1982). multiplication in Curcuma longa L. using Synthesis of Zingiberenol. Tetrahedron thidiazuron. Plant cell reports, 21(11), 1054 Lett. p. 131. -1059. Panda MK., Mohanty S, Subudhi E, Acharya Punyarani, K., & Sharma, J. (2010) L, Nayak S (2007) Assessment of genetic Micropropagation of Costus speciosus stability of micropropagated plants of (Koen.) Sm. Using Nodal Segment Culture, Curcuma longa L. by cytophotometry and Not Sci Biol, 258-62. RAPD analysis. Int. J. Integr. Biol. 1, 189- Purseglove, J. W. (1968). Tropical crops 195. Monocotyledons. Longman, London. Pandji, C., Grimm, C., Wray, V., Witte, L., & Purseglove, J.W., Brown, E.G., Green, C.L. & Proksch, P. (1993). Insecticidal constituents Robbin. (1981). Spices. Vol. II. Longman, from four species of Zingiberaceae. New York, Turmeric. pp. 532-580. Phytochemistry, 34 (2), 415-419. Qian, D.S. and Liu, Z. (1992). Pharmacologic Parida, R., Mohanty, S., Kuanar, A., & Nayak, studies of antimotion sickness, actions of S. (2010). Rapid multiplication and in vitro ginger. Chinese Journal of Integrated production of leaf biomass in Kaempferia Traditional and Western Medicine, 12 (2), galanga through tissue culture. Electronic 92-94. Journal of Biotechnology, 13(4), 5-6. Qureshi, S., Shah, A. H., Tariq, M., & Ageel, Parthasarathy, V. A., & Sasikumar, B. (2006). A. M. (1989). Studies on herbal

BIBLIOGRAPHY 144

aphrodisiacs used in Arab system of Roxb. and Curcuma zedoaria Rosc. from medicine. The American journal of Chinese rhizome bud explants. Journal of Plant medicine, 17, 57-63. Biochemistry and Biotechnology, 14, 61-63. Rahaman, M. M., Amin, M. N., Ahamed, T., Rani, V., Parida, A., & Raina , S.N., (1995). Ahmad, S., Habib, I., Ahmed, R., ... & Ah, Random amplified polymorphic DNA M. R. (2005). In vitro rapid propagation of (RAPD) markers for genetic analysis in black thorn (Kaempferia galanga L.): A micropropagated plants of Populus deltoids rare medicinal and aromatic plant of Marsh. Plant Cell Rer. 14, 459-462. Bangladesh. Journal of Biological Sciences, Rastogi R. P., & Mehrotra, B. N. Compendium 5(3), 300-304. of Indian medicinal plants, vol 2 (Central Rahaman, M. M., Amin, M. N., Ahamed, T., Drug Research Institute (CDRI), Lucknow, Ali, M. R., & Habib, A. (2004). Efficient India) 1991, 81–84. plant regeneration through somatic Ravishankara M N, Shrivastava L, Padh H and embryogenesis from leaf base derived Rajani M; 2002. evaluation of antioxidant callus of Kaempferia galanga L. Asian properties of root bark of Hemidesmus Journal of Plant Sciences, 3(6), 675-678. indicus. Phytomedicine. 9, 153. Rahman, M. M., Amin, M. N., Jahan, H. S., & Ray, T., Dutta, I., Saha, P., Das, S., & Roy, S. Ahmed, R. (2004). A Valuable Spice Plant C. (2006). Genetic stability of three in Bangladesh. Asian Journal of Plant economically important micropropagated Sciences, 3(3), 306-309. banana (Musa spp.) cultivars of lower Indo- Rajagopalan, A., & Gopalakrishnan, P. K. Gangetic plains, as assessed by RAPD and (1985). Growth, yield and quality of ISSR markers. Plant Cell, Tissue and Kaempferia galanga as influenced by Organ Culture, 85(1), 11-21. planting time and types of seed material. Razdan N. M. K. (1993). An introduction to Agric. Res. J. Kerala, 23 (1), 83 plant tissue culture, Oxford and IBH Rajagopalan, A., Viswanathan, T. V., & publishing company Pvt. Ltd., New Delhi, Gopalakrishnan, P. K. (1989). pp. 32-36. Phytochemical analysis and nutrient uptake Reinert, J. (1959) Uber die Kontrolle der studies on Kaempferia galanga L. South Morphogenese und die Induktion von Indian Hort., 37 (1), 34 Adventiveembryonem an Gewebekulturen Rajan V. R. (2005) Micropropagation of aus Karroten. Planta, 53, 318-333. turmeric (C. longa L.) by in vitro Rohlf, F. J. (1998). NTSYS-pc version 2.0. microrhizome. In: Edison S, Ramana KV, Numerical taxonomy and multivariate Sasikumar B, Babu KN, Eapen SJ, editors. analysis system. Exeter software, Setauket, Proceedings of the National Seminar on New York. Biotechnology of Spices, Medicinal and Rout, G. R., & Das, P. (1997). In vitro Aromatic Plants. Indian Institute of Spices organogenesis in ginger (Zingiber officinale Research, Kozhikode, India, pp. 25–8. Rosc.). Journal of herbs, spices & Rajendra, C. E., Magadum, G. S., Nadaf, M. medicinal plants, 4(4), 41-51. A., Yashoda, S. V., & Manjula, M. (2011). Rout, G. R., Das, P., Goel, S., & Raina, S. N. Phytochemical Screening of The Rhizome (1998). Determination of genetic stability of of Kaempferia galanga. International micropropagated plants of ginger using Journal of Pharmacognosy and random amplified polymorphic DNA Phytochemical Research, 3(3), 61-63. (RAPD) markers. Botanical Bulletin of Raju, B., Anita, D. & Kalita, M. C. (2005). In Academia Sinica, 39, 23-27 vitro clonal propagation of Curcuma caesia

BIBLIOGRAPHY 145

Rout, G. R., Palai, S. K., Samantaray, S., & officinale Rosc.),75 (4), 447-450. Das, P. (2001). Effect of growth regulator Schimmel and Co. Ginger oil. Ber. Schimmel, and culture conditions on shoot 38, 1905. multiplication and rhizome formation in Scowcroft, W. R., & Larkin, P. J. (1988). ginger (Zingiber officinale Rosc.) in vitro. Somaclonal variation. Applications of Plant In Vitro Cellular & Developmental Biology Cell and Tissue Culture, 21-35. -Plant, 37(6), 814-819. Selvaraj, D., Sarma, R. K., & Sathishkumar, R. Roy, A., Frascaria, N., Mackay, J., & (2008). Phylogenetic analysis of chloroplast Bousquet, J. (1992). Segregating random matK gene from Zingiberaceae for plant amplified polymorphic DNAs (RAPDs) in DNA barcoding.Bioinformation, 3(1), 24. Betula alleghaniensis. Theoretical and Applied Genetics, 85(2-3), 173-180. Sharma, T. R., & Singh, B. M. (1995). In vitro microrhizome production in Zingiber Roy, S., & Raychaudhuri, S. S. (2004). In vitro officinale Rosc. Plant cell reports, 15(3-4), regeneration and estimation of curcumin 274-277. content in four species of Curcuma. Plant Biotechnology, 21(4), 299-302. Sharma, T. R., & Singh, B. M. (1997). High- frequency in vitro multiplication of disease- Sabu, M. (2006). Zingiberaceae and Costaceae free Zingiber officinale Rosc. Plant Cell of south India. Kerala: Indian Association Reports, 17(1), 68-72. for Angiosperm Taxonomy 282p. ISBN 8190163701 En Geog, 6. Shenoy, V. B., & Vasil, I. K. (1992). Biochemical and molecular analysis of Sacchetti, G., Maietti, S., Muzzoli, M., plants derived from embryogenic tissue Scaglianti, M., Manfredini, S., Radice, M., cultures of napier grass (Pennisetum & Bruni, R. (2005). Comparative evaluation purpureum K. Schum). Theoretical and of 11 essential oils of different origin as Applied Genetics, 83(8), 947-955. functional antioxidants, antiradicals and antimicrobials in foods. Food chemistry, 91 Shetty, M. S. K., Haridasan, P., & Iyer, R. D. (4), 621-632. (1982). Tissue culture studies in turmeric. Proceedings of the National Seminar on Salvi, N. D., George, L., & Eapen, S. (2000). Ginger and Turmeric, Central Plantation Direct regeneration of shoots from Crops Research Institute, Kasargod, pp. 39- immature inflorescence cultures of 41. turmeric. Plant cell, tissue and organ culture, 62(3), 235-238. Shirgurkar, M. V., John, C. K., & Nadgauda, R. S. (2001). Factors affecting in vitro Salvi, N. D., George, L., & Eapen, S. (2001). microrhizome production in turmeric. Plant Plant regeneration from leaf base callus of Cell, Tissue and Organ Culture, 64(1), 5- turmeric and random amplified 11. polymorphic DNA analysis of regenerated plants. Plant cell, tissue and organ culture, Shirin, F., Kumar, S., & Mishra, Y. (2000). In 66(2), 113-119. vitro plantlet production system for Kaempferia galanga, a rare Indian Salvi, N. D., George, L., & Eapen, S. (2002). medicinal herb. Plant Cell, Tissue and Micropropagation and field evaluation of Organ Culture, 63(3), 193-197. micropropagated plants of turmeric. Plant Cell, Tissue and Organ Culture, 68(2), 143- Singh, G. (2004). Plant Systematics, 2/E. 151. Oxford and IBH Publishing. Samsudeen, K., Nirmal Babu, K., & Minoo, D. Singh, N. S. (1988). Meristem culture and (2000). Plant regeneration from anther micropropagation of a variety of ginger derived callus cultures of ginger (Zingiber (Zingiber-officinale Rosc) with a high-yield

BIBLIOGRAPHY 146

of oleoresin. Journal of Horticultural to carrot plant. American journal of Science, 63(2), 321-327. Botany. 45, 709-713. Singh, S., Kuanar, A., Mohanty, S., Subudhi, Street HE (1957). Excised root culture. Biol. E., & Nayak, S. (2011). Evaluation of Rev., 32, 117-155. phytomedicinal yield potential and Sultana, A., Hassan, L., Ahmad, S. D., Shah, molecular profiling of micropropagated and A. H., Batool, F., Islam, M. A., ... & conventionally grown turmeric (Curcuma Moonmoon, S. (2009). In vitro regeneration longa L.). Plant Cell, Tissue and Organ of ginger using leaf, shoot tip and root Culture (PCTOC), 104(2), 263-269. explants. Pak. J. Bot, 41(4), 1667-1676. Singh, S., Panda, M. K., & Nayak, S. (2012). Sunitibala, H., Damayanti, M. and Sharma, G. Evaluation of genetic diversity in turmeric J. (2001). In vitro propagation and rhizome (Curcuma longa L.) using RAPD and ISSR formation in Curcuma longa Linn. markers. Industrial Crops and Products, 37 Cytobios, 105 (409), 71-82. (1), 284-291. Swapna, T. S., Binitha, M., & Manju, T. S. Singhal, P. C., & Joshi, L. D. (1983). Glycemic (2004). In vitro multiplication in and cholesterolemic role of ginger and til. J. Kaempferia galanga Linn. Applied Sci. Res. Plant.Med., 4 (3), 32-34. biochemistry and biotechnology, 118(1-3), Sirirugsa, P. (1999). Thai Zingiberaceae: 233-241. Species diversity and their uses. World Swedlund, B., & Vasil, I. K. (1985). (total), 52, 1-500. Cytogenetic characterization of Sit, A. K., & Bhattacharya, M. (2007). Field embryogenic callus and regenerated plants Evaluation of In vitro Regenerated Ginger of Pennisetum americanum (L.) K. Plantlets under Sub-Himalayan Terai Schum. Theoretical and Applied Region of West Bengal. Environment and Genetics, 69(5-6), 575-581. Ecology, 25(2), 322. Syamkumar, S., & Sasikumar, B. (2007). Sit, A. K., Bhattacharya, M., & Chenchaiah, K. Molecular marker based genetic diversity C. (2005). Effect of benzyl amino purine on analysis of Curcuma species from India. in vitro shoot multiplication of ginger Scientia Horticulturae, 112(2), 235-241. (Zingiber officinale Rosc.) cv Garubathan. Taberlet, P., Gielly, L., Pautou, G., & Bouvet, Journal of Plantation Crops, 33(3), 184. J. (1991). Universal primers for Smirnoff, N. (Ed.). (2008). Antioxidants and amplification of three non-coding regions reactive oxygen species in plants. Wiley. of chloroplast DNA. Plant Molecular com. Biology, 17(5), 1105-1109. Soden, H.V. and Rojahn, W. 1900. Ginger oil. Techaprasan, J., Klinbunga, S., Ngamriabsakul, Pharm. Ztg., 45, 414. C., & Jenjittikul, T. (2009). Genetic Srimal, R. C., & Dhawan, B. N. (1973). variation of Kaempferia (Zingiberaceae) in Pharmacology of diferuloylmethane Thailand based on chloroplast DNA (psbA- (curcumin), a non - s t e r o i d a l trnH and petA-psbJ) sequences. Genetics antiinflammatory agent. J. Pharm and molecular research: GMR, 9(4), 1957- Pharmacol., 25, 447. 1973. Stevenson, D. W., & Loconte, H. (1995). Terhune, S. J., Hogg, J.W., Bromstein, A.C. {Cladistic analysis of monocot families}. and Lawrence, B.M. (1975). Four new sesquiterpene analogues of common Steward FC (1958) Growth and organized monoterpenes. Can. J. chem., 53, 3285. development of cultured cells. III. Interpretation of the growth from free cells Tewtrakul, S., Yuenyongsawad, S., Kummee,

BIBLIOGRAPHY 147

S., & Atsawajaruwan, L. (2005). Chemical constituents. Pharmaceutical biology, 35 components and biological activities of (5), 313-317. volatile oil of Kaempferia galanga Linn. Vasil V and Hildebrandt, AC (1965). Songklanakarin J Sci Technol, 27(Suppl 2), Differentiation of tobacco plants from 503-7. single isolated cells in microcultures. Thimann KV (1935). On the plant growth Science.150, 889-892. hormone produced by Rhizopus suinus. J. Vasil, I. K. (1987). Developing cell and tissue Biol. Chem., 109, 279-291. culture systems for the improvement of Thresh, J.C. (1879). Proximate analysis of the cereal and grass crops. Journal of Plant rhizome of of Zingiber officinale and Physiology, 128(3), 193-218. comparitive examination of typical Vasil, I. K. (1988). Progress in the regeneration specimens of commercial gingers. Pharm. and genetic manipulation of cereal crops. J., 10, 171. Nature Biotechnology, 6(4), 397-402. Tripathi, L., & Tripathi, J. N. (2003). Role of Vieira, R. F., & Skorupa, L. A. (1992, July). biotechnology in medicinal plants.Tropical Brazilian medicinal plants gene bank. Journal of Pharmaceutical Research, 2(2), In WOCMAP I-Medicinal and Aromatic 243-253. Plants Conference: part 4 of 4 330. pp. 51- Tripathi, Y. B., Chaurasia, S., Tripathi, E., 58. Upadhyay, A., & Dubey, G. P. (1996). Villamor, C. (2010). Influence of media Bacopa monniera Linn. as an antioxidant: strength and sources of nitrogen on mechanism of action. Indian Journal of micropropagation of ginger, Zingiber Experimental Biology, 34(6), 523-526. officinale Rosc. E-International Scientific Tungtrongjit, K. 1978. Pramuan Suphakhun Ya Research Journal, 2(2), 150-155. Thai. 2nd Edition. Bangkok. Vincent, K. A., Bejoy, M., Hariharan, M., & Tuntiwachwuttikul, P. 1991. The chemistry of Mary, M. K. (1991). Plantlet regeneration Kaempferia. Zingiberaceae Workshop, from callus cultures of Kaempferia galanga Prince of Songkla University, Hat Yai, Linn.-A medicinal plant.Indian Journal of Thailand.p.10. Plant Physiology, 34(4), 396-400. Tuntiwachwuttikul, P. 1991. The chemistry of Vincent, K. A., Mathew, K. M., & Hariharan, Kaempferia. Zingiberaceae Workshop, M. (1992). Micropropagation of Prince of Songkla University, Hat Yai, Kaempferia galanga L.—a medicinal plant. Thailand. pp.10. Plant Cell, Tissue and Organ Culture, 28 Tyagi, R. K., Agrawal, A., Mahalakshmi, C., (2), 229-230. Hussain, Z., & Tyagi, H. (2007). Low-cost Wardle, K., Dobbs, E. B., & Short, K. C. media for in vitro conservation of turmeric (1983). In vitro acclimatization of (Curcuma longa L.) and genetic stability aseptically cultured plantlets to humidity assessment using RAPD markers. In vitro [Chrysanthemum, cauliflower, Brassica Cellular & Developmental Biology-Plant, oleracea, Botrytis group]. Journal- 43(1), 51-58. American Society for Horticultural Science, Valeton, T. H. (1918). New notes on the 108. Zingiberaceae of Java and Malaya. Bull. Warrier, P. K., Nambiar, V. P. K. and Jard. Buitenzorg, 2 (27), 1-81. Ramankutty, C. (1994). Indian Medicinal Vani, T., Rajani, M., Sarkar, S., & Shishoo, C. Plants. Orient Longman Ltd., Madras. J. (1997). Antioxidant properties of the Warrier, P. K., Nambiar, V. P. K. and ayurvedic formulation triphala and its Ramankutty, C. (1995). Indian Medicinal

BIBLIOGRAPHY 148

Plants. Orient Longman Ltd., Madras. of Kaempferia galanga L. Flavour and Warrier, P. K., Nambiar, V. P. K. and fragrance journal, 7(5), 263-266. Ramankutty, C. (1996). Indian Medicinal Wood, T.H. (1991). Biogeography and the Plants. Orient Longman Ltd., Madras. evolution of the Zingiberaceae. Went, F. W., (1926). On growth accelerating Zingiberaceae Workshop, Prince of substances in the coleoptiles of Avena Songkla University, Hat Yai, Thailand.pp.6 sativa. Proc. K. Ned. Acad. Wet. Ser. C. 30, -7. 10-19 Yamagishi, T., Hayashi, K. and Mitsuhashi, M. White, P. R. (1934). Potentially unlimited (1972). Isolation of hexahydrocurcumin growth of excised tomato root tips in a dihydrogingerol and two additional pungent liquid medium. Plant Physiol., 9, 585-600. principle from ginger. Chem. Pharm .Bull., 20, 2291. Williams, J. G., Kubelik, A. R., Livak, K. J., Rafalski, J. A., & Tingey, S. V. (1990). Yasuda, K.T. Tsuda. and Sugaya, A. (1988). DNA polymorphisms amplified by arbitrary Multiplication of Curcuma species by tissue primers are useful as genetic markers. culture. Planta Medica, 54, 75-79. Nucleic acids research, 18(22), 6531-6535. Zaeoung, S., Plubrukarn, A., & Keawpradub, Wilson, R. L. (1998). Free radicals and tissue N. (2005). Cytotoxic and free radical damage, mechanistic evidence from scavenging activities of Zingiberaceous radiation studies. In: Biochemical rhizomes. Songklanakarin In vitro Journal Mechanisms of Liver Injury, Academic of Science and Technology, 27(4), 799-812. Press, New York, p123. Zapata, E. V., Morales, G. S., Lauzardo, A. N. Winnar, W. D. and Winnar, D., 1989, Turmeric H., Bonfil, B. M., Tapia, G. T., Sánchez, A. successfully established in tissue culture. D. J., ...... & Aparicio, A. J. (2003). Information Bulletin Research Institute, regeneration and acclimatization of plants 193, 1-2. of Turmeric (Curcuma longa L.) in a hydroponic system. Biotecnol Apl, 20, 25- Wong, K. C., Ong, K. S., & Lim, C. L. (1992). 31. Compositon of the essential oil of rhizomes

INDEX INDEX

A Data analysis 73 Acetone 77, 78, 81, 120, 121, 122, Dendrogram 73, 103, 106, 109, 111, 113, 115 123,124,125, 126, 127, 128, 129 Dhupguri 60, 131 Alpinia galanga 3, 56 Diethyl ether 77, 78, 81, 120, 121,122, Alpinia malaccensis 3 123,124,125, 126, 127, 128, 129 Alpinia nigra 3 Diversity 2, 3, 6, 8, 60, 65, 101, 113, 117 Alpinia zerumbet 3 DNA 9, 73, 113, 117, 118 Amomum dealbatum 3 DPPH scavenging activity 78, 79, 81, 82, 120, Amomum subulatum 3 121, 122 Angiospermae 1, 11 Antioxidant 5, 7, 9, 20, 53, 54, 55, 56, 58, 59, E 76, 119, 120, 121, 129 Epigynae 1, 11 Auxin 23, 31, 34, 39, 40, Ethanol 77, 78 Ethedium Bromide B Ethyl acetate 77, 78, 120, 121, 122, BAP 31, 33, 34, 35, 37, 38, 40, 42, 43, 44, 46, 123,124,125, 126, 127, 128, 129 60, 61, 64 85, 86, 87, 88, 89, 90, 91, 92, 93, Explants 22, 23, 24, 25, 26, 27, 31, 32, 34, 35, 95, 96, 99, 100, 101 36, 38, 39, 40, 41, 42, 43, 61, 62, 64, 83, Benzene 77, 78, 120, 121,122, 123,124, 127, 84, 85, 87, 88, 89, 91, 92, 95, 101 128 Biodiversity 3 F Fingerprinting 9, 73, 113, 117, 118 C Fraction 77, 78, 79, 80, 81, 82, 119, 120, 121, Callus 22, 26, 30, 31, 32, 34, 35, 37, 38, 46, 122, 123, 124, 125, 128, 129, 131 50, 52, 53, 91, 97 Free radical 9, 53, 54, 55, 57, 58, 77, 82, 119, Chemical constituents 59 120, 121, 122, 129 Chloroform 77, 78 Coconut milk 23, 33, 36 G Column chromatography 77, 78 Gamborg media 28, 30, 60, 86, 87 Correspondence analysis 73 GenBank 75, 117, 118 CTAB 65, 66 Genomic DNA 9, 73, 113, 117, 118 Cucurma aromatic 3 Germplasm 8, 60, 83, 84 Cucurma caesia 3 Gorubathan 60, 131 Cucurma zedoaria 3 Cultivars 9, 47, 49, 50, 60, 63, 64, 65, 69, 70, H 71, 72, 99, 101, 102, 103, 105, 106, 108, Habitat 12 109, 110, 111, 112, 113, 114, 116, 117, Hardening 7, 8, 24, 44, 45, 48, 63, 75, 97, 98 118, 129, 130, 131 Hedychium coccineum 3 Curcuma amada 3 Hedychium coronarium 3 Curcuma longa 1, 3, 4, 5, 7, 8, 9, 13, 15, 18, Hedychium thysiforme 3 20, 25, 26, 27, 29, 30, 33, 34, 38, 39, 40, Hexane 77, 78 41, 42, 43, 44, 45, 48, 53, 58, 60, 61, 62, Himalaya 3 63, 65, 67, 69, 70, 71, 72, 73, 75, 77, 78, History 1, 10 79, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, Hotspot 3 91, 92, 93, 94, 95, 96,97, 98, 99, 100, 102, Hydroxyl radical 9, 57, 77, 79, 123, 124, 125 103, 104, 105, 106, 107, 108, 111, 112, 113, 114, 115, 116, 117, 120, 121, 122, I 125, 126, 127, 128, 129, 130, 131 IC 79, 123 Cytokinin 23, 31, 37, 39, 43, 61, 63, 89, 90, 91, In vitro 5, 6, 7, 8, 9, 19, 22, 23,24, 25, 92, 99 27,29,23, 33, 36, 37, 38, 39, 40, 41, 43, 44, 45, 46, 47, 50, 51, 52, 53, 55, 56, 57, 58, D 59, 60, 61, 63, 75, 84, 94, 97, 99, 118, 119 Darjeeling 3, 60, 83 India 1, 2, 3, 4, 8, 10, 16, 18, 62, 65, 108

INDEX 150

ISSR 8, 47, 48, 49, 68, 71, 72, 76, 108, 109, 102, 103, 104, 108, 109, 113, 117, 118, 119 110, 111, 112, 113, 114, 115, 116, 117, Principal coordinate analysis 107, 112, 116 118, 119 R J RAPD 6, 8, 47, 49, 52, 53, 68, 69, 70, 71, 76, Jalpaiguri 60, 83, 84 102, 103, 104, 105, 107, 113, 116, 117, 118, 119 K Regeneration 9, 22, 25, 26, 27, 28, 29, 30, 31, Kaempferia galanga 1, 3, 4, 5, 7, 8, 9, 13, 15, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 18, 20, 25, 26, 27, 29, 30, 33, 34, 38, 39, 44, 46, 51, 60, 61, 63, 75, 83, 85, 86, 87, 40, 41, 42, 43, 44, 45, 48, 53, 58, 60, 61, 88, 89, 92, 93, 94, 95, 99, 100, 101 62, 63, 75, 77, 81, 82, 83, 84, 85, 86, 87, Rhizomes 4, 5, 6, 9, 15, 16, 17, 19, 55, 67, 57, 88, 89, 90, 91, 92, 93, 94, 95, 96,97, 98, 99, 58, 60, 62, 63, 64, 83, 99 100, 102, 119, 120, 121, 122, 125, 126, RNase 66, 67, 101 127, 128, 131 Rooting 8, 23, 24, 37, 49, 41, 42, 86, 87, 88, 95 Kaempferia rotunda 3 Kinetin 31, 34, 35, 36, 37, 38, 39, 40, 44, 61, S 89, 90, 91, 92, 94, 95 Scavenging 9, 53, 57, 58, 76, 77, 78, 81, 82, 119, 120, 121, 122, 123, 124, 126 L Scitaminales 1, 11 Lataguri 60, 131 Sequencing 9, 117 Lipid peroxidation 9, 57, 77, 80, 125, 127 Sodium acetate 66, 67 Somaclonal variation 9, 50, 51, 52, 53, 75, 118, M 119 Media 8, 23, 25, 28, 29, 30, 31, 32 33, 35, 36, Soxhalation 77 37, 38, 40, 41, 42, 43, 60, 61, 62, 63, 64, Spermatophyta 1, 11 89, 91, 92, 93 Sterilization 24, 25, 26, 27, 62, 64, 85 Mercuric chloride 27, 62, 64, 84, 85 Subculture 32, 35, 36, 38, 42, 46, 51, 61, 63, Methanol 57, 58, 59, 77, 78, 79, 81, 82, 119, 75, 87, 95, 96, 97 120, 121, 122, 123, 124, 125, 126, 127, Sucrose 29, 30, 32, 36, 37, 37, 40, 43, 44, 60, 128, 129, 130, 131 61, 63, 87, 88, 89 Micropropagation 22, 39, 40, 83, 86, 89, 99 Systematic position 1, 10 Microrhizomes 42, 43, 44 Mohitnagar 60, 83, 84 T Monocotyledonae 1, 11 Taberlet 9, 73 Monomorphic 52, 102, 103, 104, 109, 118, 119 Taxonomists 1, 8, 10 Morphology 13, 51 TBE 68, 70, 72 Murashige and Skoog 28, 29, 30, 34, 38, 39, Template 70, 71, 74 40, 41, 44, 60, 61, 63, 87 Toxicity 20, 58 Transilluminator 68, 69, 71, 72 N TrnL-trnF 73, 74, 117 NAA 31, 32, 33, 34, 35, 36, 37, 38, 40, 41, 42, 43, 44 V Nitric oxide 9, 57, 77, 79, 125, 126 Variability 9, 50 Non polar 8, 9, 77 North Bengal 83, 117 Z Zeatin 31, 37, 61, 89, 90, 91 P Zingiber cassumunar 3 Pathogen 4, 5, 6, 18, 21, 25, 46, 63, 87 Zingiber officinale 1, 3, 4, 5, 7, 8, 9, 13, 15, 18, PCR 6, 9, 47, 52, 65, 68, 69, 70, 71, 72, 73, 74, 20, 25, 26, 27, 29, 30, 33, 34, 38, 39, 40, 102, 117, 118 41, 42, 43, 44, 45, 48, 53, 58, 60, 61, 62, PEG 66, 80, 102, 129 63, 75, 77, 81, 82, 83, 84, 85, 86, 87, 88, Phanerogamy 1, 11 89, 90, 91, 92, 93, 94, 95, 96,97, 98, 99, Phenol 66, 67, 80, 101, 102 100, 102, 119, 120, 121, 122, 125, 126, Polar 8, 9, 77 127, 128, 131 Polymorphic 6, 47, 48, 49, 52, 53, 102, 103, Zingiber zerumbet 3 104, 108, 109, 113 Zingiberaceae 1, 3, 6, 7, 8, 10, 11, 12, 25, 26, Primer 6, 8, 47, 49, 52, 69, 70, 71, 72, 73, 74, 28, 29, 45

ABSTRACT APPENDIX-A

Thesis related publication till January, 2014

Bhattacharya, M., & Sen, A. (2006). Rapid in vitro multiplication of disease-free Zingiber officinale Rosc. Indian journal of plant physiology, 11(4), 379-384.

Bhattacharya, M., & Sen, A. (2013). In vitro regeneration of pathogen free Kaempferia galanga L.-a rare medicinal plant. Research in Plant Biology, 3(3), 24-30.

Bhattacharya, M., Mandal, P., & Sen, A. (2009). In vitro detection of antioxidants in different solvent fractions of Ginger (Zingiber officinale Rosc.). Indian Journal of Plant Physiology, 14(1), 23-27.

ABSTRACT 2

APPENDIX-B Datasheet for collection of germplasm and recording field data

Collection Data sheet Sample no.:

A. Collection information : 1. Collection site : 2. Date : 3. Time : 4. Scientific name : Local name : B. Habits: 1. Tree/Shrub/Herb : 2. Flowering time : Propagation: C. Habitat and area of the vegetation: 1. Rainfall : 2. Altitude : 3. Temperature : 4. Topography : 5. Vegetation type : Management :

Collected by Malay Bhattacharya Research Scholar Molecular Genetics Laboratory Department of Botany University of North Bengal

ABSTRACT 3 APPENDIX-C

Composition of Murashige and Skoog medium (Hi media Cat# PT018)

Macroelements

KH2PO4 170.00

KNO3 1900.00

MgSO4 180.54

NH4NO3 1650.00 Microelements

CoCl2,6H2O 0.025

CuSO4,5H2O 0.025 FeNaEDTA 36.70

H3BO3 6.20 KI 0.83

MnSO4,H2O 16.90

Na2MoO4,2H2O 0.25

ZnSO4,7H2O 8.60 Vitamins Glycine 2.00 Myoinositol 100.00 Nicotinic acid 0.50 Pyridoxine HCl 0.50 Thyamine HCl 0.10

To it was added 3% sucrose (Hi media Cat# RM134), 0.332 mg/l CaCl2 (Merck India Cat# 61764405001730). pH was adjusted to 5.6±0.1 and the volume was made up to 1000ml with double distilled water. It was then autoclaved for 20 minutes at 121ºC and 15psi and cooled and plant growth regulators are added (if any) as per requirement. Note: In case of solid media agar (Hi media Cat#RM026) is added at the rate of 0.8%.

ABSTRACT 4 APPENDIX-D

Composition of Gamborg B5 (Hi media Cat# )

Macroelements

(NH4)2SO4 134mg/l

CaCl2H2O 150mg/l

MgSO4.7H2O 246mg/l

KNO3 2,528mg/l Microelements

H3BO3 3.0mg/l

CoCl2.6H2O 0.025mg/l

CuSO4.5H2O 0.025mg/l

FeSO4.7H2O 27.8mg/l

MnSO4.H2O 10mg/l KI 0.75mg/l

Na2MoO4.2H2O 0.25mg/l

NaH2PO4.H2O 150mg/l

ZnSO4.7H2O 2.0mg/l

Na2EDTA.2H2O 37.2mg/l Vitamins i-Inositol 100mg/l Pyridoxine HCl 1.0mg/l Nicotinic Acid 1.0mg/l Thiamine HCl 10.0mg/l

To it was added 3% sucrose (Hi media Cat# RM134). pH was adjusted to 5.6±0.1 and the volume was made up to 1000ml with double distilled water. It was then autoclaved for 20 minutes at 121ºC and 15psi and cooled and plant growth regulators are added (if any) as per requirement. Note: In case of solid media agar (Hi media Cat#RM026) is added at the rate of 0.8%.

ABSTRACT 5 APPENDIX-E Buffers and chemicals used for DNA fingerprinting studies

 CTAB- buffer 100mM Trizma Base (Sigma, Cat# T1503) (pH-8.0) 20mM EDTA (Merck India, Cat# 60841801001730) (pH-8.0) 1.4 M NaCl (Merck India, Cat#60640405001730) 2% (w/v) CTAB (Hexadecyl cetyl trimethyl ammonium bromide) (Sigma, Cat# H6269) 12.11g of molecular grade Trizma base was dissolved in 400 ml double distilled water, pH was adjusted to 8.0 and was divided into two parts of equal volume. To one part 7.44g EDTA was added and to the other part 81.8g NaCl and 20g CTAB. Both the parts were than mixed and the final volume was made up to 1000ml with double distilled water prior to autoclaving. The buffer was autoclaved at 121ºC and 15 psi for 20 mins and stored at room temperature for further use. Note: Add 1% PVP (Polyvinylpyrrolidone) (Sigma, Cat #P5288) and 0.3% β-mercaptoethanol (Sigma, Cat# M3148) just before use.  5X TBE (Tris-borate-EDTA) buffer Trizma base (Sigma, Cat# T1503) = 27 gm Boric acid (Sigma, Cat# 15663)= 13.75 gm 0.5M EDTA (pH 8.0)=1.86 gm All the reagents were dissolved separately and finally mixed together and the final volume was made up to 1000ml with double distilled water prior to autoclaving. The buffer was autoclaved at 121ºC and 15 psi for 20 mins and stored at room temperature for further use.  1X TE: Tris- Cl (pH 8.0) (i.e. 10Mm) =0.6055gm EDTA (pH 8.0) (i.e. 1mM) =0.186 gm Both the reagents were dissolved separately and finally mixed together and the final volume was made up to 1000ml with double distilled water prior to autoclaving. The buffer was autoclaved at 121ºC and 15 psi for 20 mins and stored at room temperature for further use.  3M Sodium Acetate (Sigma, Cat# S9513): The required amount of sodium acetate i.e.12.31 g was dissolved in 50ml double distilled water prior to autoclaving. The solution was autoclaved at 121ºC and 15 psi for 20 mins and stored at room temperature for further use.  6X gel loading buffer: TYPE 3: Stored at 4ºC. 0.25% Bromophenol blue (Sigma, Cat# B0126) 0.25% Xylene cyanol FF (Sigma, Cat# X4126) 30% Glycerol (Merck India, Cat#61756005001730) in water  RNase A: The RNase A enzyme (Sigma, Cat# R4875) was dissolved at a concentration of 10mg/ml in 0.01M sodium acetate (Sigma, Cat# S9513) (pH 5.2). The solution was heated at 100ºC for 15 minutes in a water bath and allowed to cool slowly to room temperature. The pH was adjusted by adding 1/10 volume of 1M Tris- Cl (pH 7.4) and stored at -20ºC for further use. Note: Both 0.01M sodium acetate and 1M Tris-Cl were prepared and autoclaved at 121ºC and 15 psi for 20 mins prior to use.

ABSTRACT 6 APPENDIX-F Chemicals and buffers used for antioxidant profiling

 2-deoxy-D-ribose (Himedia, Cat# RM452)  Acetone (Merck India, Cat# 60001405001730)  Aluminium Chloride (Sd Fine, Cat# 37073) (10%)  Ammonia (Merck India, Cat# 17500)  Ascorbic acid (Himedia, Cat# CMS1014)  Benzene (Merck India, Cat# 60178325001730)  Butanol (Merck India, Cat# 17419)  Butylated hydroxytoluene (BHT) (SD fine chem Limited, Cat# 38067)  Cathechin (Sigma, Cat#C0567)  Chloroform (Merck India, Cat# 82226505001730)  Diethyl ether (SD fine chem Limited, #38132)  DPPH (Himedia, Cat# RM2798)  Ethyl acetate (SD fine chem Limited, 20108)  Ethylenediamine tetra acetic acid (EDTA) (Merck India, Cat# 60841801001730))  Ferric chloride (Himedia, Cat# RM1379)  Ferrous sulphate (Merck India, Cat# 62840005001046)  Folin Ciocalteu’s reagents (SRL, Cat# 062015)  Gallic acid (Himedia, Cat# RM233)  Glacial acetic acid (SD fine chem Limited, Cat# 37013)  Hexane (SD fine chem Limited, Cat# 38485)  Hydrochloric acid (Merck India, Cat# 61762505001730)  Hydrogen peroxide (Merck India, Cat# 61765305001730) (2mM)  Iodine solution (SD fine chem Limited, Cat# 25008AM)  Methanol (Merck India, Cat# 60600905001730)  Naphthyl ethylene diamine dihydrochloride (Himedia, Cat# RM1073)  Orthophosphoric acid (SD fine chem Limited, Cat# 20173)  Phosphate buffer (0.2M) pH 6.6  a. Potassium dihydrogen phosphate (Merck India, Cat# 60487305001730)  b. Dipotassium hydrogen phosphate (Merck India, Cat#61788005001730)  Phosphate buffer (pH 7.4)  a. Potassium dihydrogen phosphate (Merck India, Cat#60487305001730)  b. Potassium hydroxide (Merck India, Cat#60503305001730)  Potassium chloride (Merck India, Cat# 61779205001730)  Potassium ferrocyanide (Merck India, Cat# 61843605001730) (1%)  Quercetin (Himedia, Cat# RM6191)  Silica gel (SD fine chem Limited, 200-300 mesh size)  Sodium acetate (Sigma, Cat# S9513) (5%)  Sodium Carbonate (Merck India, Cat# 61778705001730) (20%)  Sodium hydroxide (Merck India, Cat# 6184305001730) (1mM)  Sodium Nitrite (Himedia, Cat# RM417) (5%)  Sodium nitroprusside (Merck India, Cat# 61761501001730 )  Sulphanilamide (Himedia, Cat# RM1558)  Thiobarbituric acid (TBA) (Himedia, Cat# RM1594)  Trichloro acetic acid (Qualigens, Cat# 28445) (10%)

ABSTRACT 7 APPENDIX-G Sequence of TrnL-TrnF region of C. longa cv Local-Lataguri GenBank accession Sequence number

CCTGCTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAAT- TTAAAATGGGCAATCCTGAGCCAAATCCTTAGTTTGATAAACC TTAGTTTTATCAAACTAGAAAAAAAAAAGGATAGGTGCAGAG ACTCAATGGAAGCTGTTCTAACGAATGAAGTTGACTACGTTTC GTCGGTAGTTGGAATCCGTCTATCAAAATTACAGAAAAGATGT TCCTATATACCTAATACATACGTATACATACTGACATATCAAA TCAAACGATTAATCATGACTCGAATCCATTATATTATATGGAT AATTATAATATGAAAAATTCAGAATTAGAGTTATTGTGAATCC AGTCCGATGGAAGTTGAAAGAAGAATTGAATATTCAATTCAA KC404804 TTATTAAATCATTCATTCCAGAGTTTGATAGATCTTTTGAAAA ACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTAC ATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAA TCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCC CCAATAAAAAGGTAATTTTACTTCCTAAATATTTATCCTCCTTT TTTTTTTCATCAGCGATTCAGTTCAAACAAAATTCACTATCTTT CTCATTCACTCCACTCTTTCACAACACAAATGTATCCGAACTA AAATCCTTGGATCTTATCCCAATTTCGATAGATACAATACCTC TACAAATAAACATATATGGGCA

TACGTTTCGTCGGTAGTTGGAATCCGTCTATCAAAATTACA- GAAAAGATGTTCCTATATACCTAATACATACGTATACATACTG ACATATCAAATCAAACGATTAATCATGACTCGAATCCATTATA TTATATGGATAATTATAATATGAAAAATTCAGAATTAGAGTTA TTGTGAATCCAGTCCGATGGAAGTTGAAAGAAGAATTGAATA TTCAATTCAATTATTAAATCATTCATTCCAGAGTTTGATAGATC TTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTC CCCTTTTACATGTCAATACCGACAACAATGAAATTTATAGTAA KC404823 GAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTC CCTCTATCCCCAATAAAAAGGTAATTTTACTTCCTAAATATTTA TCCTCCTTTTTTTTTTCATCAGCGATTCAGTTCAAACAAAATTC ACTATCTTTCTCATTCACTCCACTCTTTCACAACACAAATGTAT CCGAACTAAAATCCTTGGATCTTATCCCAATTTCGATAGATAC AATACCTCTACAAATAAACATATATGGGCAAATAATCTCTATT ATTGAATCATTCACAGTCCGTATCATTATCCTTACGCTTACTAG TTAAATTTTTTACTACTTTTTAGTCCCTTTAATTGACATAGACA CAAACACTACACCAGGATGATGCATGGGAAATGGTCGGGAT