UNIVERSITY of CALIFORNIA, SAN DIEGO The

UNIVERSITY OF CALIFORNIA, SAN DIEGO

The Characterization of Enhancer Elements Involved in the Spatial Patterning of the Skin

A Thesis submitted in partial satisfaction of the requirements for the degree

Master of Science

Biology

by Andrew Grainger

Committee in charge:

Professor Benjamin Yu, Chair Professor James Kadonaga, Co-chair Professor Ella Tour

2014

The Thesis of Andrew Grainger is approved and it is accepted in quality and form for publication on microfilm and electronically:

______

______Co-Chair

______Chair

University of California, San Diego

2014

iii

Dedication

To my parents Jim & Claire, for always providing the support and encouragement needed for my success.

Table of Contents

Signature Page ……………...... ………………………………………..…………..iii

Dedication ……………………………………………………………………………....………………...…..…...iv

Table of Contents ………………………………………………………………....……………...….…………..v

List of Figures ……………………………………………………………………………....………...…………..vi

Acknowledgments ……………………………………………………………………………….……..……...vii

Abstract of the Thesis .…………………………………………………………....……………….………...viii

I. Introduction …………………………………….…………………………………………………….…………1

II. Results ………………………………….………………..…………………………………………..………...13

III. Discussion ………………………………………………...………………………………………………....37

IV. Materials and Methods ……………………………………...………………………………………….43

References …………………………………………………………………...... ………………………………....56

List of Figures and Tables

Figure 1. Evolutionary conservation of the Keratin Type II Cluster exons between humans, rhesus macaque, mouse, opossum, chicken, and fugu ...... 21

Figure 2: p300 ChIP-Seq data from wild type mouse epidermis, E17.5 (n=1). (A) Initial and filtered read counts, total peaks, and filtered peaks. (B) Total and filtered peak counts at the three keratin cluster loci...... 22

Figure 3: LICR Histone modification data (h3k4me1, h3k27ac) for multiple tissues at the proposed negative site (qPCR probe in green at top) ...... 23

Figure 4: Representative graphs of mice ChIP-qPCR at the Keratin Type II locus exons at E17.5 for h3k4me1 (B) and h3k27ac (C), and at E14.5 for h3k4me1 (D) and h3k27ac (E) ...... 24

Figure 5: Comparison of biological replicate data between e14.5 and e17.5 (n=3 for both) for h3k4me1 (A) and h3k27ac (B)...... 30

Figure 6: CNV loss in psoriasis patients at the gene CDSN ...... 32

Figure 7: Representative graphs of mice ChIP-qPCR for CDSN at E17.5 for h3k4me1 (A) and h3k27ac (B), and at E14.5 for h3k4me1 (C) and h3k27ac (D) ...... 33

Acknowledgements

There are several people I would like to acknowledge for contributions to my research success. First and foremost, I would like to acknowledge my PI, Benjamin

Yu, for guiding and mentoring me for the last three and a half years and helping me become a better scientist.

Secondly, I’d like to acknowledge Shantanu Kumar, who has been invaluable as a person to troubleshoot with and get advice on experiments and protocols. I owe much of my success to his help. I’d also like to acknowledge Christopher Adase, who has helped me come up with a solid ChIP protocol when neither of us knew much of what we were doing in the beginning.

Lastly, I’d like to acknowledge the rest of the Yu lab for making the lab an enjoyable and nurturing environment.

vii

ABSTRACT OF THE THESIS

The Characterization of Enhancer Elements Involved in the Spatial Patterning of the Skin

Andrew Grainger

Master of Science in Biology

University of California, San Diego, 2014

Professor Benjamin Yu, Chair Professor James Kadonaga, Co-Chair

The epidermis is an essential tissue in a large variety of organisms, and differential regulation of keratin genes plays a vital role in maintaining its structural integrity and other various cellular processes. There are a number of diseases associated with changes in keratin gene expression, and so understanding how these keratins are regulated might help in our understanding of their functions in the epidermis. Recent studies have elucidated the large quantities of regulatory elements present in the human genome, many in places we would not have thought for them to exist. Exons of coding genes can contain regulatory elements within them, and might be having regulatory effects on proximal genes. Therefore, the

viii keratin genes, which are collected into two distinctive clusters, could potentially contain regulatory elements in their exons. We investigated this possibility using

ChIP-seq and ChIP-qPCR, and successfully identified 37 potential enhancer elements residing within the exons of keratin genes in the Keratin Cluster II (KCII). We also identified two novel enhancer elements in CDSN, another gene vital for epidermal structural integrity, and discovered that a loss of copy number of these enhancers could potentially contribute to the skin disease psoriasis.

Introduction

1 2

The human epidermis is a stratified squamous epithelium, composed of proliferating basal and differentiated suprabasal keratinocytes, or the predominant type of cells that act as the body's major barrier against an inhospitable environment (McGrath et al., 2004). The epidermis is differentiated into distinctive layers, the most well studied of which are the basal and suprabasal, which contains the spinous, granular, and stratum corneum; the basal layer is the bottom or closest to the inside of the body and the stratum corneum is the layer exposed to the air. A group of genes identified as the keratin genes fundamentally influence the architecture and mitotic activity of epithelial cells, and are differentially expressed in different layers of the epidermis (Shetty et al., 2012). For example, Keratin 14 (K14) and Keratin 5 (K5) are expressed in the basal layer, while

K1, K6, and K10 are expressed in the spinous layer. The original establishment of the different layers was mostly due to the mapping of changes in keratin gene expressions, and many of these keratin genes are used for immunostaining to observe one specific differentiated layer.

Keratins are defined as intermediate filament forming proteins with specific physiochemical properties produced in any vertebrate epithelia (Bragulla et al.,

2009). Intermediate filaments provide the general scaffold for most cytoskeletons, and in the case of the epidermis provide the structural integrity that maintains intercellular structure. Each keratin gene varies in length and properties, but each works as a means of keeping neighboring cells in a strict orientation. But, outside of this, keratins also perform a multitude of other functions. Aside from providing a

3 scaffold for these epithelial cells to keep a cohesive structure, they also provide a means for the epidermis to sustain various forms of mechanical stress and variations in hydrostatic pressure (Shetty et al., 2012). However, they also play a role in cellular functions as well, involving themselves in cell signaling, transport, compartmentalization, and differentiation (Vaidya and Kanojia, 2007), on top of influencing metabolic processes and cell growth (Coulombe and Wong, 2004; Gu and Coulombe, 2007). The fact that the various keratin genes are differentially expressed in the different layers of the human epidermis implies that these various keratin genes are carrying out varied, albeit not very well known, functions in each of these layers to help enforce differentiation.

While the direct effects of keratin genes on differentiation remain unclear, there has been an exponential increase in the number of epidermal stem cell publications over the last 25 years, and our knowledge of how the epidermis proliferates and regulates itself is expanding (Ghadially, 2012). This started with the discovery of hematopoietic stem cells in 1961 and has rapidly expanded in the last decade or two to include the characterization of a multitude of signaling pathways involved in epidermal stem cell maintenance and cell fate determination.

One such example is the Notch pathway. It is important in the determination of stem cell self-renewal versus differentiation. Expression of the Jagged 1 and 2 ligands as well as the Notch 1 and 2 receptors increases in differentiating keratinocytes of the suprabasal layers, and this is thought to be important for synchronization of differentiation, or the timing in which these layers differentiate, as well as epidermal

4 border formation (Luo et al., 1997; Rangarajan et al., 2001). But while the pathways involved have been identified, the specific changes in them that give rise to the differentiated layers have yet to be seen. The mechanisms that drive differentiation of the basal layer into the spinous, granular, and stratum corneum are not well known, and those responsible for the observed differential expression of the various keratin genes have yet to be discovered. However, this differential expression of keratin genes is not limited solely to the epidermis. There is differential expression of keratin genes depending on the specific keratinized tissue, as teeth and epidermis show distinctively unique keratin expression (Presland and Dale, 2000). Differences in expression are also seen as the embryonic ectoderm differentiates as well as in other fully developed epithelial tissues such as the hair follicle, tongue, sweat glands, mammary, and cornea. This indicates that these keratin genes are being regulated in tissue-specific ways.

These keratin genes are not spread out throughout the genome. They are, for the most part, confined to two of the three distinctive gene clusters known to contain genes expressed in the epidermis: The Keratin Type I Cluster on

Chromosome 11, and the Keratin Type II Cluster on Chromosome 15. The third cluster is the EDC complex on Chromosome 3. Gene clusters are interesting phenomenon, for statistically, these genes should have become separated after 200+ million years of development. However, they remain in a single distinctive segment of the genome. These clusters might arise when two or more genes encode for the same or very similar products and when the passing of all of these genes to offspring

5 is desirable. The easiest way to do this is to clump all of these genes into one general locus within the same chromosome, to prevent loss of one or more during crossing over during meiosis. This clumping allows for coordinate gene regulation by proximal cis regulatory elements that interact with DNA on the same chromosome they are located. Clustering is usually done with genes that provide some fundamental importance to the maintenance of the organism, like in this case the keratin genes, which are necessary for the maintenance of the structural integrity of all epithelia in the human body. One other well-known example of a gene cluster is the HOX gene clusters, which are responsible for controlling the body plan of an embryo along its anterior-posterior axis. These fundamental clusters tend to be highly conserved across species, and one can view the evolutionary conservation of specific point in the genome using an online database such as ECRbase (Loots and

Ovcharenko, 2006). It is through the use of this database that we were able to confirm this conservation within the keratin clusters.

Because the keratin genes provide the main structural support for the epidermis and other cornified tissues, or hardened epithelial tissues composed of proteins cross-linked into a rigid scaffold (Koster and Roop, 2007), changes in their expression can lead to a variety of diseases. An autosomal dominant mutation in K5 and K14 causes epidermolysis bullosa simplex, in which blistering of the hands and feet occurs (Shetty et al., 2012). A mutation in K1 and K10 causes epidermolytic ichthyosis, where blistering, erosions, and peeling of the skin occur as well as scaling in hyperkeratotic areas. There are a variety of other characterized diseases that

6 have been linked to mutations or alterations in keratin gene expression, among which is the quite common psoriasis, in which scaly, reddened patches or plaques form on anywhere from minor localized patches to the entire body. Therefore, the knowledge of how the keratin genes are regulated would be of great importance to figuring out their functions in the epidermis.

One distinctive possibility for a mechanism regulating these genes is cis regulatory elements, or more specifically enhancer elements. Enhancers are short segments of DNA that can be bound by proteins to help increase transcription levels of genes (Lodish et al, 2008). These bound proteins then work in conjunction with a mediator complex to promote transcription of a gene locus by RNA Polymerase II and its related transcription factor binding domains. It has been shown that enhancer elements preferentially regulate proximal genes (Blow et al., 2010), so it is a plausible hypothesis that the enhancer elements regulating the keratin genes are contained within these conserved keratin clusters, particularly because the most highly conserved regions of the keratin clusters are the exonic regions.

There are multiple ways to identify enhancer elements, but the most widely used method is Chromatin Immunoprecipitation (ChIP). This method works by cross-linking proteins and histones to the DNA which they are bound to, isolating a specific protein or histone using antibodies, and observing the sequences of the DNA that was bound to these precipitated proteins. There is a large variety of markers that have been identified and used for identifying enhancer elements, but the most accurate and widely proven marker is for p300 (Heintzman et al., 2007), a histone

7 acetyl transferase that appears to bind solely to enhancer elements with very high specialty. Heintzman et al (2007) went through a variety of possible proteins and histone modifications at DNAse hypersensitive sites in an attempt to discover one that could accurately predict enhancer elements, and p300 was the one that came out as the most specific. There are other histone modifications that both they and others have identified as well (Ong and Corces, 2012), including but not limited to h3k4me1 (Heintzman et al., 2007) and h3k27ac (Creyghton et al., 2010).

Using these enhancer markers, many studies have successfully identified tissue specific enhancer elements (Blow et al, 2010; Creyghton et al., 2010; Visel et al., 2009; Rada-Iglesias et al., 2011). Using a genome-wide sequencing version of

ChIP (ChIP-seq) to identify every single sequence throughout the genome pulled down by a ChIP assay of p300, Blow et al. (2010) were able to identify enhancer elements specific to the heart. They then took a selection of these heart enhancers from E11.5 mouse embryos and did lac-z staining for the tissues these enhancers were expressed in, and found that they were restricted to the heart almost entirely.

In addition, they not only saw it was restricted to just the heart, they also saw by sectioning that these enhancers are limited to specific sections of the heart. This implies that p300 ChIP-seq is a viable method for finding tissue-specific enhancer elements, and would be a good preliminary screen for potential enhancer elements in the keratin clusters.

Creyghton et al. (2010) use other histone modifications, namely h3k4me1 and h3k27ac, to prove tissue specificity of enhancer elements. Their work confers

8 with Heintzman et al. (2007) in showing h3k4me1 as a good enhancer marker, as well as Blow et al. (2010) in showing tissue-specific enhancer elements. They used tissue specific transcription factors to group their identified enhancers into possible tissue-specific ones, then use these groups to establish h3k27ac as a marker for active enhancers. This is important because it shows that there are indeed a number of different ways that one can go about identifying elements, and that one is not limited to one protein, p300. Therefore, when characterizing the keratin enhancer elements, we will use not only p300, but h3k4me1 and h3k27ac as well.

Rada-Iglesias et al (2011) used ChIP-seq of p300, h3k4me1, h3k27ac, h3k27me3, and h3k4me3 from human embryonic stem cells (hESC) to accurately predict tissue specific, and in this case developmentally-specific, enhancer elements.

Their ChIP-seq data was validated by ChIP-qPCR, and shows that it is a viable way of validating previously obtained ChIP-seq data. They also use a GFP-based reporter assay for observing tissue-specificity in vivo, showing an alternative yet effective method for observing enhancer elements in an organism. Ultimately, Rada-Iglesias et al show that one can discover developmental specific enhancer elements using histone modification data, and that these changes can be seen not only using ChIP-

Seq, but by using ChIP-qPCR as well, a more cost effective if slightly more laborious method of characterizing potential enhancer elements. Therefore, the validation of

ChIP-seq data on potential keratin cluster enhancer elements can be done using

ChIP-qPCR for h3k4me1 and h3k27ac.

Bonn et al. (2012) used FACS sorting to isolate nuclei from a specific tissue, then performed CHIP on these for a variety of enhancer markers, including h3k4me1, h3k27ac, h3k79me3, for a promoter marker h3k27me3, and Pol II. They looked at these different markers on mesodermal-specific tissue at different developmental time points, and were able to observe changes in transcription factor binding, DNA Pol II activity at specific enhancer sites, and addition and removal of active enhancer markers (h3k27ac, h3k79me3) at the developmental time points where these enhancers were or were not supposed to be active, respectively. They establish a good basis for what an active enhancer should look like on a chromatin modification level, and they provide evidence that enhancer modification can be transient depending upon the state of the cells in which they need to be either expressed or silenced. From this, showing differential expression in a specific layer during development has led us to looking at the various potential keratin enhancer elements in the epidermis at different time points to see if any of these enhancers could potentially be both developmentally and layer specific.

Mercer et al. (2013) use a different method, DNAse-hypersensitivity, to observe possible regulatory elements throughout the human genome using a large number of cell lines. They observed that exons had an enrichment of hypersensitivity, so they looked at a large number of ChIP-seq data reads for a large variety of promoter, enhancer, and boundary element-specific proteins and histone marks and found that they were enriched for these too. This implies that exons are sometimes performing regulatory functions. They then used a technique called

10 chromatin interaction analysis by paired-end tag sequencing (ChIA-PET) on these sites, and found them proximal to promoters, enhancers, and boundary elements.

This data lead to the conclusion that exons could possibly be performing some regulatory functions, as well as establishes a good technique to observe the 3-D structure of the DNA to see which sequences are interacting with each other. Thus, when we are identifying our potential enhancer elements in the keratin clusters, we will be focusing on keratin gene exons specifically to see whether some are performing regulatory functions.

All of these studies give solid evidence that tissue-specific enhancers can be identified, and that there are lots of histone modifications and proteins that can be used to help identify them, with lots of different assays that can be used to confirm the predicted sites. Not all of the methods and histone modifications from these papers will be used, but there are enough potential experiments for us to be able to adequately investigate and identify potential enhancer elements involved in the spatial patterning of the skin that are contained within the keratin gene clusters.

Little is known in terms of how these keratin genes are differentially regulated in the different layers of the epidermis, and so it is my goal to elucidate at least some of the elements responsible. The initial step is to do a p300 ChIP-seq on mouse embryo epidermis, due to the large number of investigators that have managed to find tissue-specific enhancers this way, and identify some potential targets within these keratin clusters. Since the cluster, and more specifically the exons of the keratin genes within these clusters, is so highly conserved, the exons themselves will be the

11 primary targets of interest since it has been shown that exons can act as regulatory elements. Once these have been identified, the authenticity of the ChIP-seq will be validated by doing ChIP-qPCR for other established enhancer markers, namely h3k4me1 and h3k27ac. These ChIP-qPCRs can be performed both on E17.5 mouse epidermis, when the epidermis is fully developed, and on E14.5 mouse epidermis, when only the basal, or undifferentiated layer, is present, to help discern whether the elements I am looking at are involved in the differentiated or undifferentiated layers of the epidermis. This can also be used to view a shift in the acetylation and methylation at specific points during development, and possibly allow me to gain some insight as to when these exonic enhancers are active. With this general knowledge, others can perform differentiation assays using a GFP-based minimal promoter vector containing these enhancer regions in NHEK cells, or an immortal human keratinocyte cell line, to verify whether the qPCR data is true. Other possible experiments to perform in the future could include performing ChIA-PET or a similar technique to observe which enhancer elements are interacting with which genes, to help elucidate the exact targets of the exonic enhancer elements.

With knowledge of the regulation of these keratin clusters in a normal healthy mouse, we can then turn to observing changes in these elements during various epidermal disease states. Through the changes in regulatory elements, we might be able to gain some insight as to how the keratin genes are being affected, or affecting other targets, specifically other signaling pathways known to be involved

12 in epidermal differentiation. With this knowledge, we might then be able to begin identifying targets and creating methods for therapy.

II.

Results

13 14

The Keratin II Cluster Contains Exonic Enhancer Elements:

To verify that the keratin genes are indeed within conserved clusters, the evolutionary conservation database ECR browser was used to observe each cluster across a wide variety of species, spanning from mammals to birds and fish. Of the two keratin clusters, the Keratin type II cluster (KCII) showed the best conservation across humans, rhesus macaque, mouse, opossum, chicken, and fugu, so this cluster was the one chosen to further investigate (Figure 1). Notably, the most highly conserved regions between species, and more specifically the mammals, are the keratin gene exons, while the intergenic regions tend to vary vastly between species.

This indicates that possible regulatory elements controlling basic keratin gene expression and aiding in the formation of similar epithelial structures in mammals could likely reside in the exons themselves. Mercer et al. (2013) showed that enhancer elements can possibly exist within exons, so it was with this hypothesis the keratin type II cluster exons were screened for potential enhancer elements.

The initial screening was performed using a ChIP-Seq for the histone acetyl- tranferase p300 on wild type E17.5 mouse epidermis (n=1). After filtering, the total peak count was 149,553 (Figure 2a). To further eradicate improbable enhancer elements, the peaks were filtered to include only those with a size between 500bp and 2kb. These sizes were chosen because these are the average sizes shown in in vivo studies to be required for enhancer activity (Visel et al (2009), Rada-Inglesias et al. (2011)). We then looked specifically at the peaks within the three keratin clusters,

15 both total and those that resided within exons. For the Keratin type II cluster, 54 of these peaks resided within exons, and so it is these peaks that we focused on.

To verify whether these potential enhancer elements were real, the presence of multiple enhancer markers must be present at these sites. Two other well established markers are the histone modifications H3K4me1 and H3K27ac

(Creyghton et al. (2010), Heintzman et al. (2007)), so the presence of these two at the peaks in the KCII cluster would validate that the data obtained from the p300

ChIP-Seq was correct. To do this, ChIP-qPCR was performed for H3K4me1 and

H3K27ac on wild type E17.5 mice. In addition, because Bonn et al. (2012) observed that enhancer elements can change across various stages of development, ChIP- qPCR was performed for these same histone modifications at an earlier time point in epidermal development, E14.5. At this stage, no differentiated layers are present, only the proliferative basal layer, and therefore the activity of enhancer elements could potentially differ.

The biggest difficulty in analyzing this ChIP-qPCR data comes from establishing a proper negative control, since there were no well-established qPCR negative controls for either histone modification. For ChIP-Seq, most of the time the analysis programs establish an average median negative from the inputted data, and the reads at a specific location are compared to this to determine whether it is real or not. This as well as having a large number of reads at the same location contribute to determining whether the protein of interest was present at this location with high accuracy. This is not the case with qPCR. Since it is not genome

16 wide, there needs to be a specific area picked and tested with primers that can be used as a negative. Therefore, picking the right place is very important when analyzing your data, because as Ferguson et al, 2010 show, choosing different reference genes to normalize to can have drastic effects on the interpretation of your data. For a ChIP-qPCR, two important criteria needed to be met for a negative control: one, it needed to have absolutely no presence for the histone markers we used in the ChIP (h3k4me1 and h3k27ac), and two, this lack of histone marks needed to remain constant throughout various developmental time points. Using these two criteria, the x48 and x50 regions, which are in the Flg2 and Hrnr genes on

Chromosome 3 respectively, were chosen. Both show absolutely no h3k4me1 and h3k27ac signal from the 22 different embryonic and tissue-specific ChIP-seq LICR-

Histone data sets available on UCSC Genome Browser, which means that they should not pull down any DNA when doing a ChIP for either histone marker (Figure 3).

Thus, they are good candidates for a negative control.

Of the 54 potential peaks in the KCII cluster, 48 were probed using qPCR

(Figure 4a). ChIPs of three biological replicates were done at each developmental time point for both histone modifications, and each of these biological replicates was run in technical triplicate when qPCR was performed. Fold change is determined by normalizing the percent input of the histone modification at the specific site to the negative controls x48 and x50. An enhancer element was called to be validated if p<.05 when comparing the biological replicates at the potential enhancer site to the negative control x48.

In the E17.5 samples, of all 48 sites probed, 37 are called as tentative enhancers. 7 very probable candidates, which showed statistical significance in both histone markers in both E17.5 and E14.5, 5 probable candidates called in both histone marks in E17.5 only, 11 probable that were called in one histone marker for both E14.5 and E17.5, and 14 possible candidates that were called in one histone marker in E17.5 only (Figure 4b, c). In the E14.5 samples, of the 48 total, 18 are considered potential enhancers. All 18 called in E14.5 were called in E17.5 as well

(Figure 4d, e). In total, 37 of the 48 potential enhancer elements as called by the p300 ChIP-seq are most likely valid, with 7 being definite. These seven are present at Krt83 exon 5, Krt81 exon 6, Krt81 exon 9, Krt 82 exon 5, Krt82 exon 9, Krt75 exon

9, and Krt79 exon 5.

These same 48 locations were then compared across the two developmental time points, E17.5 and E14.5, to determine whether any of these potential enhancers changed in presence or activity during development. Percent input for each site was normalized to the negative controls (x48 and x50) and graphed

(Figure 5a, b). Change in development was called where p<.05 when comparing

E17.5 to E14.5. Of the 48 potential enhancer sites, 14 showed a significant loss of presence in E17.5 when compared to E14.5 in either H3K4me1 or H3K27ac. Of these

14, 12 were present at the locations of validated enhancers. Two of these were present in both histone modifications, and these two are at the locations of definite enhancers, or Krt83 exon 5 and Krt81 exon 6 specifically.

Psoriasis Patients Show a Loss of CNV at Potential Enhancers:

In addition to looking at the three keratin clusters in the p300 ChIP-seq data for potential enhancers, a few other genes known to be active specifically in epidermal tissues were looked at as well in order to possibly identify other regulatory elements. Two possible enhancer elements were identified within CDSN, which in humans is coded on the opposite strand of a gene called Psors1c1, or psoriasis susceptibility 1 candidate 1, which has been shown by GWAS studies to be correlated in some manner with psoriasis. CDSN, or corneodesmosin, is a desmosomal protein involved in keratinocyte cohesion and desquamation, and reinforces cell-cell cohesion within the upper epidermis and the stratum corneum

(Orru et. Al (2005)). Our lab has looked at this gene in normal and psoriasis patients, and found that at the CDSN locus, specifically in exon 2 where we looked, there is a loss of copy number in psoriasis patients (68%, n=28). This data, combined with the p300 ChIP-seq, might indicate a loss of at least one enhancer element in at least one allele in psoriasis patients, and therefore we decided to investigate this as a case of potential misregulation of genes due to the loss of an enhancer, which could be leading to epidermal diseases.

We expanded the qPCR probing regions from the initial single probe in Exon

2, including a second exon 2 probe, two exon 1 probes, and a probe at the 5’ end of the gene in order to try and gain some scope of the boundaries of this deletion.

Completely new psoriasis patients were used, and the percentage of genomic DNA present was calculated by normalizing to YWHZ, a gene shown by a previous

19 member of the lab to have no copy number variation between normal individuals.

After calculation of the percentages for control patients with no psoriasis, a psoriasis patient with a percentage of less that 75% was called to have some loss in copy number due to this value being the minimum value required to reach statistical significance when compared to the control. A total of 38 new psoriasis patients and

16 controls were probed for at least one exon of CDSN. In psoriasis patients, Ex1 showed 35.2% of individuals having some loss of copy number (n = 34), Ex1b showed 47% (n=15), Ex2(2) showed 67.7% (n=31), and Ex2(3) showed 55.3%

(n=38), while the 5’ probe showed only 13% (n=15) (Figure 6a). Of these five sites, only those within exon 1 and exon 2 of CDSN show a significant number of patients with a loss of CNV. Of the total 38 patients, 8 show no loss of CNV in either exon 1 or exon 2, and 9 show a loss of CV in both. The average percentage at each site was calculated for normal individuals, individuals with psoriasis but no called loss in

CNV, and individuals with a loss of CNV (Figure 6b). In all instances, those patients called to have a loss of CNV show a statistically significant decrease in genomic DNA present (p <.05).

To see whether these two potential enhancer elements near and in CDSN are real, the same biological replicate ChIPs performed for the KCII cluster enhancer validations were used to probe these CDSN sites. Both E17.5 and E14.5 time points were used to see whether, if validated, these enhancers changed over development.

The percent input at each site was normalized to the negative controls (x40 and x50). Enhancers were called with p<.05 (n=3 with technical triplicates for both time

20 points). Of the 4 sites probed, two are definitely enhancers, specifically CDSN 5’ and

CDSN Ex2(3) (Figure 7). These two coincide with the two p300 peaks observed in the CHIP-Seq data. There was no significant change in either histone marker at any of the probed CDSN sites.

Figure 1: Evolutionary conservation of the Keratin Type II Cluster exons between humans and (in ascending order): rhesus macaque, mouse, opossum, chicken, and fugu (fish)

E17.5 WT

Read # (Initial) 17,581,447

Read # (Filtered; PHRED score = 25) 11,948,167

Total Peaks 149,553

Peaks 0.5-2kb 92095

Peaks < 700bp 71,475

Peaks > 2kb 10,868

Kertain Cluster Peak Counts

Krt Type I Cluster Peaks Total 133

Krt Type I Cluster Peaks (.5-2kb) 94

Krt Type I Cluster Exonic Peaks (.5-2kb) 50

Krt Type II Cluster Peaks Total 104

Krt Type II Cluster Peaks (.5-2kb) 86

Krt Type II Cluster Exonic Peaks (.5-2kb) 54

Figure 3: LICR Histone modification data (h3k4me1, h3k27ac) for multiple tissues and developmental time points at the proposed negative site x48 (qPCR probe in green at top)

(A)

Gene Exon Site Name Chromosome Probe Probe End Start mLor ex2 x49 chr3 91884760 91884985 mFlg2 ex2-3 x47 chr3 93017278 93017494 mFlg2 ex4-5 x48 chr3 93018803 93019030 mHrnr ex3 x50 chr3 93130161 93130374 krt80 UTR and x32 chr15 101179394 101179606 downstream

Krt80 ex5-7 x31 chr15 101182608 101182775

Krt7 ex2 x11 chr15 101243800 101244799

Krt7 ex6 x12 chr15 101250905 101251031

Krt7 ex7 x13 chr15 101253701 101253927

Krt83 ex5-7 x39 chr15 101264372 101264537

Krt83 ex3-4 x38 chr15 101265007 101265125

1700011A15Rik ex3-5 and 3' x45 chr15 101283290 101283504 UTR

Krt81 ex9 and 3' x34 chr15 101289213 101289421 UTR

Krt81 ex4-7 x33 chr15 101291058 101291200

Krt86 ex8-9 x43 chr15 101309843 101310005

Gm6042 ex2 x44 chr15 101337072 101337302

Krt84 ex9 x42 chr15 101356153 101356342

Krt84 ex5-6 x41 chr15 101359000 101359223

Krt84 ex1 x40 chr15 101362792 101362992

Krt82 ex7-8 x37 chr15 101372139 101372377

Krt82 ex4-5 x36 chr15 101375396 101375617

Krt82 ex2 x35 chr15 101378684 101378898

Figure 4: Representative graphs of mice ChIP-qPCR at the Keratin Type II locus exons at E17.5 for h3k4me1 (B) and h3k27ac (C), and at E14.5 for h3k4me1 (D) and h3k27ac (E). Representative graphs are a single biological replicate done in technical triplicate representing an N of 3 (all done in technical triplicate). Enhancers were called if p<.05 when comparing biological replicates at this site to x48 (negative control). Chromosomal locations of each exon are annotated (A).

Krt75 ex5 x20 chr15 101400577 101400780

Krt6b ex5-9 x10 chr15 101521677 101522241

Krt6a ex6-7 x9 chr15 101538794 101539607

krt5 ex7 ex7 x8 chr15 101540600 101541199

krt5 ex3-5 x7 chr15 101540760 101540971

krt5 ex2 ex2 x6 chr15 101541969 101542138

krt5 ex1 ex1 x5 chr15 101543061 101543279

krt71 ex7 x16 chr15 101566977 101567201

krt71 ex2 x15 chr15 101570477 101570694

Krt74 ex8-9 x19 chr15 101584731 101584982

Krt74 ex7 x18 chr15 101587010 101587235

Krt73 ex9 x17 chr15 101626206 101626428

krt1 ex1 x1 chr15 101676337 101676500

Krt76 ex9 x23 chr15 101715271 101715413

Krt4 ex7-9 x3 chr15 101749503 101749636

Krt79 ex8-9 x29 chr15 101760159 101760360

Krt79 ex7 x28 chr15 101761109 101761330

Krt79 ex5-6 x26 chr15 101762183 101762348

Krt78 ex7-8 x25 chr15 101778299 101778525

Krt78 ex2 x24 chr15 101783273 101783508

Krt8 ex5-8 x14 chr15 101829204 101829371

CDSN 5' CDSN 5' chr17 35686712 35686933

CDSN Ex1 CDSN Ex1 chr17 35689090 35689257

CDSN Ex2 CDSN Ex2(2) chr17 35692596 35692881

CDSN Ex2 CDSN Ex2(3) chr17 35692957 35693138

Figure 4: Continued

(B)

Representative H3K4Me1 E17.5 30

10 Fold Change (17.5/x48x50)

x6 x9 x8 x7 x5 x1 x3

x40 x47 x48 x50 x32 x31 x11 x12 x13 x38 x39 x45 x34 x33 x43 x44 x42 x41 x37 x36 x35 x21 x20 x10 x16 x15 x19 x18 x17 x23 x29 x28 x26 x25 x24 x14 x49

Figure 4: Continued

(C)

Representative H3K27Ac E17.5 16

Fold Change (17.5/x48x50) 4

x6 x9 x8 x7 x5 x1 x3

x40 x47 x48 x50 x32 x31 x11 x12 x13 x38 x39 x45 x34 x33 x43 x44 x42 x41 x37 x36 x35 x21 x20 x10 x16 x15 x19 x18 x17 x23 x29 x28 x26 x25 x24 x14 x49

Figure 4: Continued

(D)

Representative H3K4Me1 E14.5 11 10 9 8 7 6 5 4 3

Fold Change (14.5/x48x50) 2 1

x6 x9 x8 x7 x5 x1 x3

x13 x40 x47 x48 x50 x32 x31 x11 x12 x38 x39 x45 x34 x33 x43 x44 x42 x41 x37 x36 x35 x21 x20 x10 x16 x15 x19 x18 x17 x23 x29 x28 x26 x25 x24 x14 x49

Figure 4: Continued

(E)

Representative H3K27Ac E14.5 12 11 10 9 8 7 6 5 4

3 Fold Change (14.5/x48x50) 2 1

x6 x9 x8 x7 x5 x1 x3

x13 x40 x47 x48 x50 x32 x31 x11 x12 x38 x39 x45 x34 x33 x43 x44 x42 x41 x37 x36 x35 x21 x20 x10 x16 x15 x19 x18 x17 x23 x29 x28 x26 x25 x24 x14 x49

Figure 4: Continued

(A)

H3K4Me1 30 * 25

Normalized Percent Input * * 5 * * *

x9 x8 x7 x6 x5 x1 x3

x33 x37 x24 x47 x48 x50 x32 x31 x11 x12 x13 x38 x39 x45 x34 x43 x44 x42 x41 x40 x36 x35 x21 x20 x10 x16 x15 x19 x18 x17 x23 x29 x28 x26 x25 x14 x49 Avg (14.5/Neg) Avg (17.5/Neg)

Figure 5: Comparison of biological replicate data between e14.5 and e17.5 (n=3 for both) for h3k4me1 (A) and h3k27ac (B). Percent input of each was normalized over the negative controls (x48 and x50). Change in development was called where p<.05 when comparing E17.5 to E14.5. Chromosomal locations of each exon are annotated (see Figure 4a)

(B)

H3K27Ac 12 * 10

8 *

6 * * * * 4

Normalized Percent Normalized Percent Input 2 * * * *

x9 x8 x7 x6 x5 x1 x3

x33 x37 x24 x49 x47 x48 x50 x32 x31 x11 x12 x13 x38 x39 x45 x34 x43 x44 x42 x41 x40 x36 x35 x21 x20 x10 x16 x15 x19 x18 x17 x23 x29 x28 x26 x25 x14

Avg (14.5/Neg) Avg (17.5/Neg)

Figure 5: Continued

(A)

5' Ex1 Ex1b Ex2(2) Ex2(3) Total Patient Number 15 34 15 31 38 Number Patients 2 12 7 21 21 <75% Percentage Patients 13.33333 35.29412 46.66667 67.74194 55.26316 <75%

(B)

Number Total Psoriasis patients 38 Loss in only ex1 or ex2 21 Loss in both ex1 and ex2 9 No loss 8

(C)

Average Percent 160 140 120 100 80 * * * *

Percent 60 * 40 20 0 5' Ex1 Ex1b Ex2(2) Ex2(3)

Control Psoriasis w/ no CNV Psoriasis w/ CNV

Figure 6: CNV loss in psoriasis patients at the gene CDSN. (A) Percentage of psoriasis patients showing a loss of CNV at the two exons of CDSN and the 5’ region. All genomic percentages at sites normalized to YWHZ. (B) The number of patients containing called losses in one or both exons. (C) Average percent loss of control individuals, individuals with psoriasis but no called loss of CNV, and individuals with a loss of CNV (p < .05).

(A)

E17.5 H3K4Me1 9 8 7 6 5 4 3 2

1 Normalized Percent Percent Normalized Input 0

Figure 7: Representative graphs of mice ChIP-qPCR for CDSN at E17.5 for h3k4me1 (A) and h3k27ac (B), and at E14.5 for h3k4me1 (C) and h3k27ac (D). Representative graphs are a single biological replicate done in technical triplicate representing an N of 3 (all done in technical triplicate). Enhancers were called if p<.05 when comparing biological replicates at this site to x48 (negative control).

(B)

E17.5 H3K27Ac 12

2 Normalized Percent Normalized Percent Input 0

Figure 7: Continued

(C)

E14.5 H3K4Me1 7 6 5 4 3 2

1 Normalized Percent Normalized Percent Input 0

Figure 7: Continued

(D)

E14.5 H3K27Ac 2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4

Normalized Percent Input 0.2 0

Figure 7: Continued

III.

Discussion

Regulatory elements are mostly considered to reside within intergenic segments of non-coding DNA, and a high variability in these regions between species might implicate a drastic change in regulatory element presence across different organisms. More recently however, the implication that exons can contribute some regulatory function could provide some basis for conserved regulatory elements being present. This means that clusters such as the Keratin clusters could contain some regulatory elements that are acting to coordinate gene regulation, and could in theory help contribute to the preservation of the clusters during evolution. As we have shown in this work, the exons of these two keratin clusters are indeed highly conserved, and so the potential for conserved exonic regulatory elements exists.

A ChIP-seq for the enhancer-associated protein p300 identified a number of potential regulatory elements that are present in the fully developed mouse epidermis, both intergenic and exonic, giving a good initial pool of potential enhancers that are possibly regulating the keratin genes. Yet, this initial screen does not provide definitive proof, and the presence of multiple enhancer markers needs to be established for an enhancer to be real. While p300 is quite specific to enhancer elements and is a reliable marker for determining where enhancers exist, it is not perfect and is thus not sufficient in itself. While slightly less specific markers than p300, the presence of both h3k4me1 and h3k27ac over-lapping the called p300 enhancers provides a much more conclusive picture of which enhancer elements are present. We chose to do site-specific observation of the presence of these two

39 markers by using ChIP-qPCR rather than ChIP-seq, since the initial screen provided us with a relatively small number of potential exonic enhancers in the Keratin type

II cluster. Of the sites probed, thirty-seven showed the presence of one of these two markers that overlapped the called p300 exonic enhancers, and seven of these showed presence of both. This indicated that these seven, residing within Krt83,

Krt81, Krt82, Krt75, and Krt79, are definitively enhancer elements that exist within these conserved keratin genes. The other called enhancers overlapping the p300 peaks are very probable but not conclusively present. To help further validate the presence of these enhancers, and to gain some insight as to their roles in the various layers of the epidermis, in vitro differentiation assays are currently being performed on NHEK cells using a minimal promoter GFP vector to view enhancer expression both before and after differentiation of human keratinocytes. Also, in vivo studies using said minimal promoter GFP vector are being performed using a novel cyst model in mice to view enhancer activity in a layer-specific manner.

While the genes that these enhancers act on remains unknown, potential future experiments observing DNA proximity such as Hi-C or ChIA-PET (Mercer et al.

(2013)) could further elucidate these targets. In addition, these enhancer elements have been shown to be present in mouse epidermis, but while the exons themselves are highly conserved, this does not necessarily correlate with the enhancer elements being present across either tissues or species. While these enhancers are probably present where keratins are expressed since they likely regulate the genes within the keratin clusters, they could still possibly be performing some other regulatory

40 function elsewhere in the genome. Therefore, the identification of these regulatory elements in the keratin genes of other species and the presence or absence of these in other mouse tissues could potentially elucidate their roles in gene regulation and their possible contributions to the conservation of a cluster through the course of evolution.

With the presence of enhancer elements in conserved exons we have shown in mouse epidermis, the question arises of whether these regulatory elements change as both the mouse embryo and the epidermis develops. Thus, we chose two developmental time points to investigate whether these potential changes exist, namely E14.5, the stage in epidermal development in which only the proliferative basal layer is present, and E17.5, the stage at which the epidermis is fully formed.

We discovered multiple instances where called enhancers were present to a higher extent in E14.5 when compared to E17.5, and two of these instances coincided with definitive enhancers, or Krt83 exon 5 and Krt81 exon 6 specifically. The fact that these enhancers are present to a higher extent in E14.5 suggests that they are potentially playing a role in the initial differentiation processes occurring as the basal layer first differentiates, and are becoming less active as the fully functioning epidermis is established. These enhancer elements appear to be performing specific yet still unknown regulatory functions necessary for the proper development of the epidermis, and therefore a logical conclusion is that absence of exonic regulatory elements could in some way contribute to disease phenotypes.

A potential example of the loss of an enhancer contributing to disease arises in our observations of a loss of copy number at a gene that has been correlated with psoriasis in humans, Psors1c1. We have shown that in a significant number of psoriasis patients, CDSN, the gene encoded on the reverse strand of Psors1c1, has a loss of CNV that can span either exon2, exon 1, or a combination of both. The initial thought was that the loss of this gene, which is involved in keratinocyte cohesion and desquamation and reinforces cell-cell cohesion within the upper epidermis and the stratum corneum (Orru et al. (2005)), could be potentially contributing to the psoriasis phenotype. Oji et al. (2010) describe a peeling skin phenotype that is associated with the loss of CDSN, and they demonstrate that the lack of corneodesmosin causes an epidermal barrier defect to account for predisposition to atopic diseases. In addition, Leclerc et al. (2009) describe mice CDSN KO models showing a persistent barrier defect. A likely conclusion, therefore, would be that this loss in CDSN copy number is somehow helping to cause psoriasis. However, there are a few points that refute this hypothesis. Israeli et. al (2010) show that Peeling skin syndrome (PSS) is caused by a mutation in CDSN, but heterozygotes for this mutation are normal, and homozygotes develop a phenotype distinctly different from psoriasis. In addition, psoriatic skin lesions show an increase in CDSN expression (Allen et. Al (2001)), so a loss in copy number would likely not lead to psoriasis. However, if CDSN contains exonic enhancers, this loss in copy number could be changing the regulation of other genes, and therefore might contribute to

42 psoriasis in an indirect fashion rather than a direct one due to the loss of CDSN protein.

Therefore, we investigated the potential presence of exonic enhancers at this locus, and discovered one in exon 2 that is within the region shown to have a loss of

CNV in a significant number of psoriasis patients. This leads to the conclusion that this loss in regulatory activity is a real contributing factor to the psoriasis phenotype.

This instance could potentially be an example of an exonic CNV contributing to a disease not because of loss in protein concentration due to loss of copies of the gene, but instead because the lost region was performing some kind of necessary regulatory function. We have established a general presence of exonic enhancer elements, and these enhancers can potentially be playing an integral role in cellular functions in the epidermis, for their loss can lead to disease.

IV.

Materials and Methods

Embryonic Epidermis Isolation

Epidermis was taken from both E14.5 and E17.5 mice. Developmental time points were taken based upon called date of pregnancy of the mother. Embryos were extracted from the mother, and placed in 2.5 mM EDTA in PBS @ 37˚C for 30 minutes to permit separation of the epidermis from the rest of the embryo.

Epidermis was removed from the back and head of the embryo using tweezers and placed into a separate tube for further use.

Tissue Lysis and Chromatin Preparation

Protocol was done using isolated epidermal tissue from both E17.4 and E14.5 mice. Place tissue in 15mL conical and Add 5mL X-linking buffer (with PFA) to each tube. Rotate @ Room Temperature, 25 minutes. Stop X-linking reaction by adding

250mL of 2.5M glycine and rotate at RT for 5 minutes. Centrifuge at 3500, 4˚C for 10 minutes, then decant and wash with cold PBS (Complete phosphatase inhibitor added, 1x). Centrifuge @ 3500, 4˚C for 10 minutes then decant. Then, either freeze using dry ice and store at -80˚C, or continue to lysis.

For tissue lysis, re-suspend tissue in 5ml of L1 buffer with 1x protease inhibitor (half a pill). Rock at 4˚C for 10min then spin at 3500 rpm for 10min at 4˚C and decant L1. Resuspend in 5ml of L2 buffer with 1x protease inhibitor (half a pill), rock at RT for 10min, then spin at 3500 rpm for 10min at 4˚C to pellet nuclei and

45 decant L2. Either save at -80C or continue on to final lysis and chromatin extraction and preparation.

Thaw samples on ice if needed, else if continuing proceed to add 1ml of

Buffer L3 to samples and assemble sonicator, making sure the metal probe does not touch the side of the Falcon tube and that the metal ring is placed between Falcon tube and the blue ring so tubes can rotate. Set sonicator to “HIGH” 30 seconds “ON” followed by 60 seconds “OFF”, for a 10 minute cycle. Repeat 5-6X, removing water and adding ice in between each cycle. After the sonication cycles, check sonication by linearizing DNA. Take 25ul of each sample, add 1ul of 5M NaCL, and place at 95˚C for 20minutes. Then load 10ul on a gel and observe band sizes. Band sizes of smear should be between 500-1000 bp for each sample. If the sizes are not in the range then repeat another sonication cycle and check again. Once properly sonicated, centrifuge at 3500 rpm for 15min at 4˚C, extract the supernatant, place in a 1.5ml

Eppendorf tube, check the OD using a Nanodrop 2000, and freeze at -80˚C.

Buffers:

X-Linking Buffer:

Final Concentration Stock For 50mL

50mM 1M Hepes-KOH, pH 7.5 2.5 mL

100mM 5M NaCl 1.0 mL

1mM .5M EDTA 50.0 uL

.5mM .5M EGTA 100.0 uL

11% 37% Formaldehyde 14.6 mL

ddH2O 31.5 mL

Lysis Buffer 1 (L1):

Final Concentration Stock For 100mL

50mM 1M Hepes-KOH, pH 7.5 5.0 mL

140mM 5M NaCl 2.8 mL

1mM .5M EDTA .2 mL

10% 50% glycerol 20.0 mL

.5% 10% NP-40 5.0 mL

.25% 10% Triton X-100 2.5 mL

ddH20 64.5 mL

Lysis Buffer 2 (L2):

Final Concentration Stock For 100mL

10mM Tris-HCL, pH 8.0 1.0mL

200mM 5M NaCl 4.0mL

1mM .5M EDTA .2mL

.5mM .5M EGTA .1mL

ddH2O 94.7mL

Lysis Buffer 3 (L3):

Final Concentration Stock For 100mL

10mM Tris-HCL, pH 8.0 1.0 mL

100mM 5M NaCl 2.0 mL

1mM .5M EDTA .2mL

.5mM .5M EGTA .1mL

.1% 10% Na-Deoxycholate (DOC) 1.0mL

.5% 20% N-lauroylsarcosine 2.5mL

ddH2O 93.2 mL

Chromatin Immunoprecipitation (ChIP)

ChIP was performed on E17.5 and E14.5 tissue samples previously lysed and sonicated.

Step 1: Bead preparation

Create or thaw stock of 5mg/ml BSA in tissue culture grade PBS, add 10ul of strepavadin beads (Sheep anti-rabbit IgG) to PCR tubes, and add 200ul BSA to each tube. Include one tube for IGG (-control, Rabbit) and one for each Ab tested

(h3k4me1, h3k27ac; both Ab are Rabbit) for each desired experimental condition. In this instance one tube of each Ab was made for each developmental time point

(E14.5 and E17.5). Invert tubes gently, centrifuge quickly to remove liquid from the lid, and place on magnetic tube holder to allow beads to bind to magnet. Remove the

BSA via pipette, and repeat 3x. After final wash, add 200 uL BSA and antibodies to tubes (IgG 1:50 dilution, 4uL in 200uL; H3K4me1 1:50 dilution, 4uL in 200 uL;

H3K27ac 1:25 dilution, 8uL in 200uL). Incubate on rotary at 4°C for 4 hours or overnight.

Step 2: Binding of Chromatin

Thaw Chromatin stocks and prepare Master Mix while chromatin is thawing

(DOC must be made fresh each time). Add 20ug of sample DNA in 100ul to an empty

1.5 mL tube, and add 100ul Master Mix (ideal volume is 1:1). Make one tube for each

Ab. Remove the antibody supernatant from strepavadin beads via pipette (be very gentile) and add the 200ul of Master Mix/Chromatin (total of 20ug Chromatin) to

49 each tube. Invert to mix and place on inversion table at 4°C overnight. Separately, keep 10% of the chromatin loaded (2ug; taken from sonicated stock) as input

Chromatin to be used as input in a 1.7ml tube.

Master Mix:

Stock Solution Final Concentration Volume (µl)

10% Triton-X 1% 200

10% DOC 0.1% 20

10x Complete 1X 200

1x TE 1X 580

Total volume 1mL

Step 3: Chrimaton Removal and Un-Crosslinking

Place tubes on the magnetic tube holder and remove the supernatant. Add

100ul of RIPA buffer, resuspend the beads through inversion, spin briefly to remove liquid from the cap, and place the tubes back on the magnet to remove the supernatant. Repeat 4 more times (5 washes total) (Make Fresh RIPA buffer, again

DOC must be made fresh and added to RIPA buffer). Wash 1x with TE, remove the supernatant, and add 100ul of Elution buffer. Re-suspend and place in the 65°C hybridization rotor (keep beads moving) for 20 min. Then place the tubes on the magnet, coalesce the beads, and remove the chromatin containing supernatant.

Place the supernatant into a 1.7ml Eppendorf tube and put tubes in the 65°C

50 waterbath overnight or minimum of 8 hours. Add elution buffer to the Input chromatin saved in Step 2 to bring volume to 100ul and place in the waterbath with the ChIP chromatin samples.

Ripa Buffer:

Stock Final Concentration Volume (mL) dH20 -- 6.175

1M Hepes, pH 8.0 50mM 0.5

10% NP-40 1% 1

10% DOC 0.7% 0.7

8M LiCL 0.5M 0.625

10x Complete 1x 1

Total Volume 10

Elution Buffer: (Does not need to be fresh)

Stock Final Concentration Volume (mL)

1M Tris, pH 8.0 10mM 0.5

0.5M EDTA 1mM 0.1

10% SDS 1% 5 dH20 -- 44.4

Total Volume 50

Step 4: DNA Purification

Add 200ul of TE to each tube, add RNAse A (final concentration = 0.2mg/ml), and incubate at 37°C for 1 hour (if following standard protocol 6ul of 10mg/ml

RNAse A in 300ul of sample). Add Proteinase K (final concentration = 0.4mg/ml) and incubate at 55°C while rotating for 1 hour (if following standard protocol 6ul of

20mg/ml Proteinase K in 300ul of sample). Add 330ul of

Phenol:Chloroform:Isoamyl alcohol to each tube, then spin down Phase lock tubes for 1min @ 14k rpm to bring beads to the bottom of the tube. Add the sample to the phase lock tube and shake vigorously, then spin for 4 min @ 14k rpm. If aqueous phase is cloudy, spin again. Transfer the aqueous layer to a new 1.7ml Eppendrof tube and add 16ul of 5M NaCl (final concentration = 200mM), plus 1.5ul of 20mg/ml glycogen (30ug), then vortex. Add 920ul of cold 100% EtOH and vortex briefly, then incubate @ -80°C for 20-30 min. Spin at 14k RPM for 15min @ 4°C to pellet DNA, then wash the pellet with 1ml of cold 70% EtOH. Vortex, spin for 15min @ 4°C, 14k

RPM, then re-suspend in 34ul of 10mM Tris (EB from Qiagen kits). OD the input

DNA using a Nanodrop 2000 and store everything @ -80°C.

qPCR Analysis:

Quantitative PCR done by ROCHE 480 light cycler was used to measure the quantity of DNA co-precipitated with a specific antibody using ChIP and determine which sites of interest contained significantly enriched amounts of pulled-down

DNA when compared to negative controls. Master Mix for each site was created by mixing 5ul Sybr Green, 2.5 uL of water, .5 uL of the desired primer, and 2uL of sample. 10μl reactions were done in triplicates. A ChIP sample was compared to the input DNA of that sample at each site, and a percent input was generated for each triplicate. These percent inputs were then used for analysis of histone marker presence between various sites. Input Ct values were adjusted to compensate for the difference in amount of chromatin added to the tube (set aside 2ug as input, used

20ug for ChIP).

For CDSN CNV detection, all samples were diluted to 10 ng/uL and 2.5uL of sample was used for each primer. Master Mix contained 5ul Sybr Green, 2 uL of water, .5 uL of the desired primer, and 2.5uL of sample. Standard curves were generated for each primer by running against serial dilutions of human fibroblast genomic DNA. Amount present at each site for each individual was calculated by converting Ct values using these standard curves, and these numbers were compared to YWHZ to determine percent genomic DNA. Non-psoriatic patients were used as control to observe loss of CNV.

DNA Extraction From Buccal Swabs:

Genomic DNA was extracted from buccal swabs obtained by psoriasis and normal patients using the Qiagen QIAamp DNA Blood Mini Kit (cat. No. 51104).

Protocol from the kit was followed, and samples were eluted in 150uL AE and OD

was obtained using a Nanodrop 2000, with adequate A260/A280 within the 1.6-2.1 range.

Primer Sequences:

Primers were designed using sequence data from UCSC genome browser and

Ensembl genome browser. Primers were created by the use of the online program primer 3.

ChIP-qPCR: (Mouse)

New Nomenclature Primer Name Name Fw Primer Sequence Rev Primer Sequence CTCGGGAGTAACTGGTG CCACAGAGGTGGCTCTG Krt1E x1 GAA GA ACCTTCCCCTGACCCAG ACCTTCCCCTGACCCAG Krt2E x2 A A CACCAAATCCAAAGCCA TCTCCTTCCAGCGGTAG Krt4E x3 CTT TTG ACCACCACCACCACCAC CCAGTGTTCTTGCTCCT mu_ChIPq_x5 x5 T CCA AGGTCCTGCATGTTCCT GAACCTGGATCCGTTGT mu_ChIPq_x6 x6 CAG TTG AGACGTGTGTCTGCATC CGGTGAGCAATTAACCC mu_ChIPq_x7 x7 TGG AAA TCCAGCAGCTTCCTGTA GGAGCTGGCTCTCAAAG Krt5E x8 GGT ATG CACCTGCACTCCTCTCC ACCTGCAAGCTGCTATT Krt6aE x9 TTC GCT TGCTTCTTAACGTGGTC AGGTCACAGCTGGCAGA Krt6bE x10 GAT CAT CCACTAAGCCAAGCACA TGTGGAAGAGGAGGAA mu_ChIPq_x11 x11 TCA CCTG GAAGCACGGGGATGAC CCTGGTTCTTCAAGGTG Krt7Ex6E x12 CT TCAA TGCCAAGTTAGAGTCCA GGTAGGTGGCGATCTCA Krt7Ex7E x13 GCA ATG CATGGTTTCAGCCTCAG GGAGATCCGTGAGTTGC Krt8E x14 CTC AGT

TGGTCATAGTGTTTTGC GTGAGTGAGGAGGGAA mu_ChIPq_x15 x15 CACA CCTG CCTCGCTCTCCAGAAGT GTGACAGTGCCCTCAAG Krt71E x16 TTG GAT GGTAGGTGGCGATCTCA GTGACTGTGCCCTCAAG Krt73E x17 ATG GAT GATCTCCACGTCCAGTG CTGAGCAGAGAGGGGA Krt74E x18 ACA CAGT GTGGGCTGATCAAGTGG TGTGGGTCCTGTGGTTA Krt74Ex9E x19 TCT TCA TACCAGGACTCAGCCTC TGCAGGAGCTGTCTCAG mu_ChIPq_x20 x20 TGC ATG AAGCAGCCAGAGAAGG TGTCCCTCCAAAGTTCA Krt75E x21 ACAA CAA CTGGTGGTCTGAGAGAA CCAGCAGAGAATGGGCT Krt76E x23 CTGAA TTA ACCCAAGACCAGAGCAC GACCTGGGGAAAATGTT mu_ChIPq_x24 x24 ATC GAA TCTCCTCTAGGCACGGT TAACAGAGGGCAGCATT Krt78E x25 CAC GTG GGTACCAGGACTCAGCC AGCCAAGTGCAGACCAA Krt79Ex5E x26 TCA TGT AGGTGGCGATCTCCATA ATCGCAGAAGCAGAGCA Krt79Ex7E x28 TCC GA TGGTCTTCCGTAGGATG GCAACTCTACCTCCGTT Krt79Ex9E x29 GAG TGC CTGGCTCCGTGAATATG CCTTACAGCCCAAGTGA Krt80E x31 CTT AGG CAAAGGCAGGGGGAGT GGGTCTCTCCAACCTCA mu_ChIPq_x32 x32 AAG ACA GCAGTCAGCCTCTGGAT TTCCCAACCCCTAGTGT Krt81E x33 CAT GAG CGGCTCAGCTCCTCAAC CTTCCAGGAACCGGCTT mu_ChIPq_x34 x34 TAA T CGCTTGCTCTAGTCCCT GCTCTTCGAGGGCTACA mu_ChIPq_x35 x35 TTG TCT CCCCCTCCTCTGATGTT TCGTGAAGATGGACAAC mu_ChIPq_x36 x36 TCT AGC TCGCAGGGGATGTAGA CTGTCAGCAGCTCCAAA Krt82E x37 GTTC GGT GGTACCAGGACTCAGCC GTCTCCTCCATTCCCAC Krt83E x38 TCA ATC ACAGTTGCCTCAGGAAG CTTCCTCCTTTAGGATG Krt83Ex4E x39 TCG TGGA AGGGCCTCCGAATCCAT GTTGGATGCTCTCGTCC mu_ChIPq_x40 x40 AG TGT TGTACCCCTCCCACAGT TCGTGAAGATGGACAAC mu_ChIPq_x41 x41 CTC AGC GCGGGAGGTGGTGGTA GGGTCCAGAGGAGGCT Krt84E x42 GAT CAG CTCTGCGTCTCTGGTAC TGCAGCATTGTGACCTC Krt86E x43 TGC CTA

GCTTTGTGTGTGTGCAT GGGTGGTGGTGGTAAAA mu_ChIPq_x44 x44 GTG TCA TTCCCTACAGGCTTGGT ACCCCCACAACTGTGAT mu_ChIPq_x45 x45 CTG CTG TGAGGGTGAGGAACACT GCCTGAGGCTGTCTACT mu_ChIPq_x47 x47 CAG GCT CTCAAGGACCCACTCAG GTGACCGGATCCAGAAT mu_ChIPq_x48 x48 GAC GTC CCCTCCGTAGCTCTGCT TCTGGTGGTGGCTCCAG mu_ChIPq_x49 x49 G T GACGATATGGTGCCTCA TCCTGAGCCAGATCCAT mu_ChIPq_x50 x50 TCA ACC mu_ChIPq_CDSN CTCTAGCAACCCCATCA AATTCTCGTACCCGAGC Ex2 (2) CDSN Ex2(2) TCC AAG mu_ChIPq_CDSN GGTTACCCCTGCCTTTC AAGGCTTCACTTGGGTC Ex2 (3) CDSN Ex2(3) TGT AGA GCAACAGGGAGGAATGT AGTGTCGGGAACAAGAC mu_ChIPq_CDSN 5' CDSN 5' GAA AGG mu_ChIPq_CDSN GTGCCCATGAGCTTCTG CTCCCAAGGCCCCAGAC Ex1 CDSN Ex1 TC T

CDSN CNV Detection: (Human)

Primer Primer Name Location Fw Primer Rev Primer chr6 31090751 AACATCATTTCCTCCTGTG AGAAGCCACAGATTCCACTGTT CDSN 5' 31090855 GGCCT CC chr6 31088128 ATCAGTCAGGAGGCCGTG CDSN Ex1 31088223 CAGT AGCCAGCAGCAGTGCCATCAT chr6 31088128 ATCAGTCAGGAGGCCGTG CDSN Ex1b 31088223 CAGTC AGCCAGCAGCAGTGCCATCAT chr6 31084184 TGGCTAAGAGCATTGGCA ACCAGAGCTTCTGGCACTGGAA CDSN Ex2(2) 31084362 CCTTCT AT chr6 31083866 TCTTCTGGTCACCCTTGCA AGAGGCTTCACTTGGGCTAGG CDSN Ex2(3) 31084032 TGTCT ATA

References

1. Allen, M, Ishida-Yamamoto, A, McGrath, J, Davison, S, Iizuka, H, Simon, M, Guerrin, M, Hayday, A, Vaughan, R, Serre, G, Trembath, R, Barker, J (2001). Corneodesmosin expression in psoriasis vulgaris differs from normal skin and other inflammatory skin disorders. Lab Invest. Vol 81(7), 969-976.

2. Blow, Matthew, McCulley, David, Li, Zirong, Zhang, Tao, Akiyama, Jennifer, Holt, Amy, Plajzer-Frick, Ingrid, Shoukry, Malak, Wright, Crystal, Chen, Feng, Afzal, Veena, Bristow, James, Ren, Bing, Black, Brian, Rubin, Edward, Visel, Axel, Pennacchio, Len (2010). ChIP-Seq identification of weakly conserved heart enhancers. Nature Genetics 42(9), 806-810.

3. Bragulla, HH, Homberger, DG (2009). Structure and functions of keratin proteins in simple, stratified, keratinized and cornified epithelia. J Anat Vol.214, 516-559.

4. Coulombe, Pierre A., Wong, Pauline (2004). Cytoplasmic intermediate filaments revealed as dynamic and multipurpose scaffolds. Nature Cell Biology Vol. 6, 699-706.

5. Creyghton, Menno P, Cheng, Albert W, Welstead, G Grant, Kooistra, Tristan, Carey, Bryce W., Steine, Eveline J, Hanna, Jacob, Lodato, Micheal A, Frampton, Garrett M, Sharp, Phillip A, Boyer, Laurie A, Young, Richard A, Jaenisch, Rudolf (2010). Histone H3K27ac separates active from poised enhancers and predicts developmental state. PNAS Vol.107(50), 21931-21936.

6. Ghadially, Ruby (2012). 25 Years of Epidermal Stem Cell Research. Journal of Investigative Dermatology 132, 797-810.

7. Gu, LH, Coulombe, PA. (2007). Keratin function in skin epithelia: a broadening palette with surprising shades. Curr Opin Cell Biol Vol.19(1), 13- 23.

8. Heintzman, Nathaniel D, Stuart, Rhona K, Hon, Gary, Fu, Yutao, Ching, Christina W, Hawkins, R David, Barrera, Leah O, Van Calcar, Sara, Qu, Chunxu, Ching, Keith A, Wang, Wei, Weng, Zhiping, Green, Roland D, Crawford, Gregory E, Ren, Bing (2007). Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nature Genetics 39(3), 311-318.

9. Koser, Maranke I., Roop, Dennis (2007). Mechanisms Regulating Epithelial Stratification. Annu. Rev. Cell Dev. Biol. Vol 23, 93-113.

10. Leclerc EA, Huchenq A, Mattiuzzo NR, Metzger D, Chambon P, Ghyselinck NB, Serre G, Jonca N, Guerrin M. (2009). Corneodesmosin gene ablation induces lethal skinbarrier disruption and hair-follicle degeneration related to desmosome dysfunction. Journal of Cell Science. 122:2699-2709.

11. Lodish, Harvey, Berk, Arnold, Kasier, Chris A., Krieger, Monty, Scott, Matthew P., Bretscher, Anthony, Ploegh, Hidde, Matsudaira, Paul (2008). Molecular Cell Biology, Sixth Edition, 274-275.

12. Loots, Gabriela, Ovcharenko, Ivan (2006). ECRbase: database of evolutionary conserved regions, promoters, and transcription factor binding sites in vertebrate genomes. Bioinformatics Applications Note Vol.23(1), 122- 124.

13. Luo B, Aster JC, Hasserjian RP, Kuo F, Sklar J. (1997). Isolation and functional analysis of a cDNA for human Jagged2, a gene encoding a ligand for the Notch1 receptor. Mol Cell Biol Vol.17, 6057–6067.

14. McGrath, J.A.; Eady, R.A.; Pope, F.M. (2004).Rook's Textbook of Dermatology (7th ed.). Blackwell Publishing. pp. 3.1–3.6. ISBN 978-0-632- 06429-8.

15. Mercer, Tim R., Edwards, Stacey L, Clark, Michael B, Neph, Shane J, Wang, Hao, Stergachis, Andrew B, John, Sam, Sandstrom, Richard, Li, Guoliang, Sandhu, Kuljeet S, Ruan, Yijun, Nielsen, Lars K, Mattick, John S, Stamatoyannopoulos, John A (2013). DNAse I-hypersensitive exons colocalize with promoters and distal regulatory elements. Nature Genetics Vol.45, 852-863.

16. Israeli, Shirli, Zamir, Hadas, Sarig, Ofer, Bergman, Reuven, Sprecher, Eli (2011). Inflammatory Peeling Skin Syndrome Caused by a Mutation in CDSN Encoding Corneodesmosin. Journal of Investigative Dermatology Vol 131, 779-781.

17. Oji, Vinzenze, Eckl, Katja-Martina, Aufenvenne, Karin, Matebus, Marc, Tarinski, Tatjana, Ackerman, Katharina, Seller, Natalia, Metze, Dieter, Nurnberg, Hudrun, Folster-Holst, Regina, Schafer-Korting, Monika, Hausser, Ingrid, Traupe, Heiko, Hennies, Hans Christian (2010). Loss of Corneodesmosin Leads to Severe Skin Barrier Defect, Pruritus, and Atopy: Unraveling the Peeling Skin Disease. American Journal of Human Genetics Vol. 87, 274-281.

18. Ong, Chin-Tong, Corces, Victor G (2012). Enhancers: Emergin roles in cell fate specification. EMBO Reports 13(5), 423-430.

19. Orru, S., Giuressi, E., Carcassi, C., Mirella, C., Licinio, C. (2005). Mapping of the Major Psoriasis-Susceptibility Locus (PSORS1) in a 70-Kb Interval around the Corneodesmosin Gene (CDSN). Am. J. Hum. Genet. 76:164-171.

20. Presland, Richard B., Dale, Beverly A. (2000). Epithelial structural proteins of the skin and oral cavity: function in health and disease. Crit Rev Oral Biol Med Vol 11(4), 383-408.

21. Rada-Iglesias, Alvaro, Bajpai, Ruchi, Swigut, Tomek, Brugmann, Samantha A, Flynn, Ryan A, Wysocka, Joanna (2011). A unique chromatin signature uncovers early developmental enhancers in humans. Nature Vol.470, 279-283.

22. Rangarajan A, Talora C, Okuyama R, Nicolas M, Mammucari C, Oh H, Aster JC, Krishna S, Metzger D, Chambon P, Miele L, Aguet M, Radtke F, Dotto GP (2001). Notch signaling is a direct determinant of keratinocyte growth arrest and entry into differentiation. EMBO J Vol.20, 3427–36.

23. Shetty, Shibani, Gokul S. (2012). Keratinization and its Disorders. Oman Medical Journal Vol. 27(5), 348-357.

24. Vaidya, MM, Kanojia, D. (2007). Keratins: markers of cell differentiation or regulators of cell differentiation? J Biosci Vol.32(4), 629-634.

25. Visel, Axel, Blow, Matthew J, Li, Zirong, Zhang, Tao, Akiyama, Jennifer A, Holt, Amy, Plajzer-Frick, Ingrid, Shoukry, Malak, Wright, Crystal, Chen, Feng, Afzal, Veena, Ren, Bing, Rubin, Edward M, Pennacchio, Len A (2009). ChIP-seq accurately predicts tissue-specific activity of enhancers. Nature Vol.457, 854-858.