Metatranscriptome Libraries Were Prepared and Sequenced at the Joint Genome Institute

SUPPLEMENTAL INFORMATION

METHODS

Metatranscriptomic Sequencing (RNASeq)

Metatranscriptome libraries were prepared and sequenced at the Joint Genome Institute. Ribosomal RNA was depleted from 1 µg of total RNA using the Ribo-Zero rRNA Removal Kit (Epicentre) for Plants and

Bacteria. Stranded cDNA libraries were generated using the Illumina TruSeq Stranded RNA LT kit. The rRNA depleted RNA was fragmented and reversed transcribed using random hexamers and SSII

(Invitrogen) followed by second strand synthesis. The fragmented cDNA was treated with end-pair, A- tailing, adapter ligation, and 10 cycles of PCR. qPCR was used to determine the concentration of the libraries. Libraries were sequenced on the Illumina Hiseq.

The prepared libraries were quantified using KAPA Biosystem’s next-generation sequencing library qPCR kit and run on a Roche LightCycler 480 real-time PCR instrument. The quantified libraries were then multiplexed into pools of 1-3 libraries each, and the pool was then prepared for sequencing on the

Illumina HiSeq sequencing platform utilizing a TruSeq paired-end cluster kit, v3, and Illumina’s cBot instrument to generate a clustered flowcell for sequencing. Sequencing of the flowcell was performed on the Illumina HiSeq2000 sequencer using a TruSeq SBS sequencing kit, v3, following a 2x150 indexed run recipe.

Single Amplified Genome (SAG) Sequencing

Single amplified genomes (SAGs) were generated following standard procedures in the Department of

Energy Joint Genome Institute workflow (Rinke et al. 2014). Individual cells were sorted on a BD Influx

(BD Biosciences) and treated with Ready-Lyse lysozyme (Epicentre; 5 U/μl final concentration) for

15 min at room temperature prior to the addition of lysis solution. Whole-genome amplification was performed with the REPLI-g Single Cell Kit (Qiagen) in 2 μl reactions set up with an Echo acoustic liquid

1 handler (Labcyte). Amplification reactions were terminated after 6 h. Sequencing libraries were generated using the Nextera XT v2 kit (Illumina), and 2X150bp sequencing reads were sequenced on the

Illumina Nextseq platform.

Amplicon Sequencing (16S and ITS iTags)

Each RNA sample prepared for metatranscriptomics sequencing was also reverse transcribed to create a paired cDNA sample for 16S and ITS amplicon analysis. 400 ng of TURBO DNase-treated RNA was reverse transcribed using the SuperScript III First-Strand Synthesis System (Invitrogen) with random hexamers according to the manufacturer’s protocol. Plate-based 16S V4 region and ITS iTag preps are performed on the PerkinElmer Sciclone NGS robotic liquid handling system using 30 ng sample input, custom designed target primers with incorporated Illumina sequencing adapters. PCR amplicons were created using 25ul reactions using 10 ng cDNA, 1x 5PRIME HotMasterMix (Quantabio), 0.4 mg/ml

BSA, and 200 nmol each primers (515F GTGCCAGCMGCCGCGGTAA; 805R

GGACTACHVGGGTWTCTAAT) or Fungal ITS2 primers (ITS9 GAACGCAGCRAAIIGYGA; ITS4

TCCTCCGCTTATTGATATGC). Reverse primers were barcoded. Amplification procedure was as follows: initial denaturing at 94°C (3 min), 30 cycles of 94°C (45 sec), 50°C (60 sec), 72°C (90 sec), with a final extension at 72°C (10 min). After library sample prep, the samples from each target primer set were pooled together and the pool quantified using KAPA Biosystem’s next-generation sequencing library qPCR kit and run on a Roche LightCycler 480 real-time PCR instrument. The pool was then loaded and sequenced on the Illumina MiSeq sequencing platform utilizing a MiSeq Reagent Kit, v3 600 cycle, following a 2x300 indexed run recipe.

2 FIGURES

Rhizo/Bulk * Detritus/No Detritus * 3 reps = 48 soil metatranscriptomes

Figure S1: Experimental design. Plants were grown in microcosms with a separate experimental root chamber (sidecar). Root growth was tracked through the clear sidecar wall. After three days of root growth, individual root sections for all microcosms were marked to synchronize root age among all the microcosms. Marked root sections were destructively sampled at 3, 6, 12, and 22 days.

9 E+7 Rhizosphere Rhizosphere + Litter

SD) 8 E+7 - Bulk 7 E+7 Bulk + Litter 6 E+7 5 E+7 4 E+7 3 E+7 2 E+7

Avg. reads after filtering (+/ filtering after reads Avg. 1 E+7 0 E+0 3 6 12 22 Time (days)

Figure S2: Average number of potential mRNA reads per sample after removing sequencing contaminants and ribosomal RNA reads (+/- standard deviation). Reads are averaged by treatment over time (3, 6, 12, 22 days) after exposure to the root (Rhizosphere, blue), bulk soil (Bulk, red), and amending both these habitats with root detritus (Rhizosphere + Detritus, light blue; Bulk + Detritus, yellow).

0.90

0.85

Location 0.80 Bulk Rhizo

Avg Evenness Avg 0.75

0.70 H1 H2 H3 H4 Harvest

250000

200000 Location Bulk Rhizo Richness 150000

100000 H1 H2 H3 H4 Harvest

Location 10 Bulk Rhizo

Avg Shannon Diversity Avg 9

H1 H2 H3 H4 Harvest

Figure S3: Average mRNA diversity after mapping to reference database for all rhizosphere (blue) and bulk soil (red) samples over time. Diversity is presented as average evenness (A), average richness (B), and average Shannon diversity (C) +/- standard deviation. H1-H4 refers to timepoints 3, 6, 12, 22 days, respectively.

A. B.

Litter NoLitter Litter NoLitter 0.5 5.4 a a ab a a ab a a a 5.35 0.4 b 5.3 bc 0.3 bcd 5.25 d cd pH 5.2 0.2 c c 5.15 0.1 5.1 0 5.05 Gravimetric Soil Moisture 3 6 12 22 3 6 12 22 Time (days) Time (days)

Figure S4: Average gravimetric soil moisture (A) and pH (B) of the microcosm soil amended with root detritus (blue) and without root detritus (orange) at each time point (+/- standard deviation). Letters represent Tukey HSD post hoc significance groups.

A. B.

Figure S5: Influence of time 16S bacterial communities (A) and mRNA transcripts (B). Symbols represent the different treatments: Rhizosphere (hollow triangles), Rhizosphere + Detritus (filled triangles), Bulk (hollow circles), Bulk + Detritus (filled circles). Points are shaded by time point from light blue (3 days) to purple (22 days). Arrow overlays on indicate significant factors (Rhizosphere, Bulk) and numerical correlates (moisture, time) driving the community composition, as calculated by envfit.

7 ● ● 100 ● Rhizosphere + Litter 50 Rhizosphere ● Bulk + Litter 40 75

● ● 30 ● 50 ● 20 ●

10 25 Auxiliary Activity (upregulated genes)

0 (upregulated genes) Esterase Carbohydrate 5 10 15 20 5 10 15 20 Time (days) Time (days)

● 10.0 ● 300 ●

7.5

200 ●

● 5.0 ●

● ● 100 2.5

Glycoside Hydrolase (upregulated genes) 0.0 Polysaccharide Lyase (upregulated genes) Lyase Polysaccharide 5 10 15 20 5 10 15 20 Time (days) Time (days) Figure S6: The cumulative number of significantly upregulated CAZy genes in the treatments relative to bulk soil for four CAZy enzyme classes (auxiliary activity, carbohydrate esterases, glycoside hydrolases, polysaccharide lyases) over the time-course experiment. The treatments are rhizosphere samples that contain detritus (red circles), bulk soil samples that contain detritus (black square), and rhizosphere without detritus addition (blue triangle).

8 Supplemental Figure S7: Population metatranscriptomes for carbohydrade degradation CAZymes for the 26 populations (A-Z below) that had 4 or more CAZymes significantly expressed. Gene annotation is presented in rows (CAZyme number and consensus annotation). Treatments are Rhizosphere (R), Rhizosphere + Detritus (RL), and Bulk Soil + Detritus (BL). H1-H4 represents the timepoints (3, 6, 12, 22 days, respectively). “S.P.” indicates that the reference gene sequence had a potential signal peptide as calculated by SignalP (Petersen et al. 2011). 226 of 407 enzymes had recognizable signal peptides.

A. Burkholderiales 54_8 (Rhizosphere guild)

S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] GH16 Endo−1,3−1,4−beta−glycanase GH16 Endo−1,3−1,4−beta−glycanase PL9 Poly(beta−D−mannuronate) lyase [EC:4.2.2.3] CE4 Xylanase/chitin deacetylase S.P. GH102 Membrane−bound Lytic murein transglycosylase A S.P. GH103 Membrane−bound Lytic murein transglycosylase B S.P. GH23 Membrane−bound Lytic murein transglycosylase C GH23 Membrane−bound Lytic murein transglycosylase C S.P. GH23 Membrane−bound Lytic murein transglycosylase D GH3 Beta−N−acetylhexosaminidase [EC:3.2.1.52] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

B. Janthinobacterium 65_15 (Rhizosphere guild) GH5 Endoglucanase [EC:3.2.1.4] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH43 Arabinoxylan arabinofuranohydrolase [EC:3.2.1.55] GH28 Polygalacturonase [EC:3.2.1.15] S.P. GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] S.P. GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] S.P. GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] S.P. GH23 Membrane−bound Lytic murein transglycosylase D CE4 Chitin deacetylase [EC:3.5.1.41] GH13 Alpha−glucosidase [EC:3.2.1.20] GH15 Glucoamylase S.P. GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH31 Alpha−D−xyloside xylohydrolase [EC:3.2.1.177] S.P. GH31 Alpha−D−xyloside xylohydrolase [EC:3.2.1.177] GH2 Beta−galactosidase [EC:3.2.1.23] S.P. GH42 Beta−galactosidase [EC:3.2.1.23] S.P. GH74 Sialidase−1 [EC:3.2.1.18] GH74 Sialidase−1 [EC:3.2.1.18] S.P. GH74 Sialidase−1 [EC:3.2.1.18] GH74 Sialidase−1 [EC:3.2.1.18] GH74 Sialidase−1 [EC:3.2.1.18] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

9 C. Massilia 66_12 (Rhizosphere guild)

S.P. GH8 Endoglucanase [EC:3.2.1.4] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH43 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH43 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH43 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] PL9 Pectate lyase S.P. GH105 Unsaturated rhamnogalacturonyl hydrolase [EC:3.2.1.172] S.P. GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] S.P. GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] S.P. GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] S.P. GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] GH78 Alpha−L−rhamnosidase [EC:3.2.1.40] S.P. GH43 Arabinan endo−1,5−alpha−L−arabinosidase [EC:3.2.1.99] S.P. GH43 Arabinan endo−1,5−alpha−L−arabinosidase [EC:3.2.1.99] S.P. GH43 Arabinan endo−1,5−alpha−L−arabinosidase [EC:3.2.1.99] S.P. GH5 Mannan endo−1,4−beta−mannosidase [EC:3.2.1.78] S.P. GH102 Membrane−bound Lytic murein transglycosylase A S.P. GH103 Membrane−bound Lytic murein transglycosylase B S.P. GH23 Membrane−bound Lytic murein transglycosylase D S.P. GH13 Alpha−amylase [EC:3.2.1.1] GH13 Alpha−amylase [EC:3.2.1.1] S.P. GH13 Alpha−amylase [EC:3.2.1.1] S.P. GH31 Alpha−glucosidase [EC:3.2.1.20] S.P. GH97 Alpha−glucosidase [EC:3.2.1.20] GH13 Pullulanase [EC:3.2.1.41] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] GH3 Beta−glucosidase [EC:3.2.1.21] GH3 Beta−glucosidase [EC:3.2.1.21] GH1 Beta−glucosidase [EC:3.2.1.21] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH31 Alpha−D−xyloside xylohydrolase [EC:3.2.1.177] GH31 Alpha−D−xyloside xylohydrolase [EC:3.2.1.177] S.P. GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH39 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH39 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] GH43 Xylosidase/arabinosidase S.P. GH29 Alpha−L−fucosidase GH29 Alpha−L−fucosidase [EC:3.2.1.51] S.P. GH95 Alpha−L−fucosidase [EC:3.2.1.51] S.P. GH42 Beta−galactosidase [EC:3.2.1.23] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] GH2 Beta−galactosidase [EC:3.2.1.23] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] GH2 Beta−galactosidase [EC:3.2.1.23] GH2 Beta−galactosidase [EC:3.2.1.23] GH35 Beta−galactosidase [EC:3.2.1.23] GH42 Beta−galactosidase [EC:3.2.1.23] GH2 Beta−galactosidase [EC:3.2.1.23] GH2 Beta−glucuronidase [EC:3.2.1.31] GH1 6−phospho−beta−glucosidase [EC:3.2.1.86] GH74 Sialidase−1 [EC:3.2.1.18] S.P. GH74 Sialidase−1 [EC:3.2.1.18] S.P. GH74 Sialidase−1 [EC:3.2.1.18] S.P. GH74 Sialidase−1 [EC:3.2.1.18] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

10 D. Verrucomicrobiota 63_30 (Rhizosphere guild) GH74 Endoglucanase [EC:3.2.1.4] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH43 Arabinoxylan arabinofuranohydrolase [EC:3.2.1.55] S.P. GH97 Alpha−glucosidase [EC:3.2.1.20] GH31 Alpha−D−xyloside xylohydrolase [EC:3.2.1.177] GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH39 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH43 Xylosidase/arabinosidase S.P. GH29 Alpha−L−fucosidase S.P. GH29 Alpha−L−fucosidase S.P. GH29 Alpha−L−fucosidase S.P. GH2 Beta−galactosidase [EC:3.2.1.23] GH2 Beta−galactosidase [EC:3.2.1.23] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

E. Burkholderiales 62_29 (Rhizosphere guild)

S.P. GH74 Cellulase [EC:3.2.1.4] GH62 Beta−1,4−xylanase [EC:3.2.1.8] GH30 Glucuronoarabinoxylan endo−1,4−beta−xylanase [EC:3.2.1.136] PL4 Rhamnogalacturonan endolyase [EC:4.2.2.23] CE1 Tannase and feruloyl esterase GH102 Membrane−bound Lytic murein transglycosylase A S.P. GH103 Membrane−bound Lytic murein transglycosylase B S.P. GH103 Membrane−bound Lytic murein transglycosylase B S.P. GH23 Membrane−bound Lytic murein transglycosylase D GH78 Amylo−alpha−1,6−glucosidase GH15 Glucoamylase GH1 Beta−glucosidase [EC:3.2.1.21] GH2 Beta−mannosidase [EC:3.2.1.25] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

F. Asticcacaulis 63_11 (Detritusphere guild)

S.P. GH5 Cellulase [EC:3.2.1.4] S.P. GH5 Endoglucanase [EC:3.2.1.4] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH1 Beta−glucosidase [EC:3.2.1.21] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH39 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH95 Alpha−L−fucosidase [EC:3.2.1.51] GH2 Beta−galactosidase [EC:3.2.1.23] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] S.P. GH2 Beta−glucuronidase [EC:3.2.1.31] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

11 G. Myxococcales 67_7 (Detritusphere guild) GH45 Cellulase [EC:3.2.1.4] GH9 Endoglucanase [EC:3.2.1.4] GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH30 Glucuronoarabinoxylan endo−1,4−beta−xylanase [EC:3.2.1.136] GH16 Endo−beta−1,3−1,4 glucanase (EC:3.2.1.73) GH13 Alpha−amylase GH3 Beta−glucosidase [EC:3.2.1.21] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

H. Fibrobacterota 63_12 (Detritusphere guild) GH51 Cellulase [EC:3.2.1.4] GH8 Endoglucanase [EC:3.2.1.4] S.P. GH5 Endoglucanase [EC:3.2.1.4] S.P. GH5 Endoglucanase [EC:3.2.1.4] S.P. GH9 Endoglucanase [EC:3.2.1.4] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH30 Glucuronoarabinoxylan endo−1,4−beta−xylanase [EC:3.2.1.136] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH23 Membrane−bound Lytic murein transglycosylase D GH23 Membrane−bound Lytic murein transglycosylase D GH13 Glycogen debranching enzyme S.P. GH13 Alpha−amylase GH13 Alpha−amylase GH57 Alpha−amylase/alpha−mannosidase GH31 Alpha−glucosidase [EC:3.2.1.20] GH13 Maltooligosyltrehalose trehalohydrolase [EC:3.2.1.141] GH1 Beta−glucosidase [EC:3.2.1.21] S.P. GH43 Beta−xylosidase GH43 Beta−xylosidase GH2 Beta−galactosidase [EC:3.2.1.23] GH1 6−phospho−beta−glucosidase [EC:3.2.1.86] GH94 Cellobiose phosphorylase [EC:2.4.1.20] GH94 Cellobiose phosphorylase [EC:2.4.1.20] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

I. Segetibacter b85 (Detritusphere guild) GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH43 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH13 Alpha−amylase [EC:3.2.1.1] S.P. GH13 Alpha−amylase [EC:3.2.1.1] GH13 Maltooligosyltrehalose trehalohydrolase [EC:3.2.1.141] GH13 Pullulanase [EC:3.2.1.41] GH3 Beta−glucosidase [EC:3.2.1.21] GH31 Alpha−D−xyloside xylohydrolase [EC:3.2.1.177] S.P. GH39 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

12 J. Devosia JGI 030 (Detritusphere guild) GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH38 Alpha−mannosidase [EC:3.2.1.24] S.P. GH3 Beta−N−acetylhexosaminidase [EC:3.2.1.52] GH13 Glycogen debranching enzyme GH13 Alpha−glucosidase GH13 Maltodextrin glucosidase GH1 Beta−glucosidase [EC:3.2.1.21] GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] GH4 Alpha−galactosidase [EC:3.2.1.22] GH4 Alpha−galactosidase [EC:3.2.1.22] GH29 Alpha−L−fucosidase GH2 Beta−galactosidase [EC:3.2.1.23] GH42 Beta−galactosidase [EC:3.2.1.23] GH2 Beta−mannosidase [EC:3.2.1.25] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

K. Niastella b58 (Detritusphere guild) S.P. GH5 Cellulase S.P. GH11 Endo−1,4−beta−xylanase [EC:3.2.1.8] GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH43 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. PL9 Pectate lyase S.P. PL9 Pectate lyase S.P. GH28 Polygalacturonase [EC:3.2.1.15] AA2 catalase S.P. GH23 Membrane−bound Lytic murein transglycosylase D S.P. GH18 Chitinase [EC:3.2.1.14] S.P. GH18 Chitinase [EC:3.2.1.14] GH78 Amylo−alpha−1,6−glucosidase GH13 Alpha−amylase GH13 Alpha−amylase [EC:3.2.1.1] GH13 Oligo−1,6−glucosidase [EC:3.2.1.10] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH43 Beta−xylosidase S.P. GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] GH95 Alpha−L−fucosidase [EC:3.2.1.51] GH2 Beta−galactosidase [EC:3.2.1.23] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] GH2 Beta−galactosidase [EC:3.2.1.23] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] GH1 6−phospho−beta−glucosidase [EC:3.2.1.86] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

13 L. Rhizobium 59_9 (Detritusphere guild) AA2 katG; catalase−peroxidase GH38 Alpha−mannosidase [EC:3.2.1.24] S.P. GH25 Lysozyme S.P. GH103 Membrane−bound Lytic murein transglycosylase B S.P. GH103 Membrane−bound Lytic murein transglycosylase B S.P. GH103 Membrane−bound Lytic murein transglycosylase B S.P. GH23 Membrane−bound Lytic murein transglycosylase C CE4 Chitin deacetylase [EC:3.5.1.41] GH13 Glycogen debranching enzyme GH13 Alpha−amylase GH13 Alpha−amylase GH13 Alpha−glucosidase [EC:3.2.1.20] GH3 Beta−glucosidase [EC:3.2.1.21] GH4 Alpha−galactosidase [EC:3.2.1.22] GH2 Beta−galactosidase [EC:3.2.1.23] GH2 Beta−mannosidase [EC:3.2.1.25] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

M. Streptomyces tu. 70_12 (Detritusphere guild) S.P. GH74 Cellulase S.P. GH6 Cellulase S.P. GH5 Cellulase S.P. GH48 Cellulose 1,4−beta−cellobiosidase [EC:3.2.1.91] S.P. GH9 Endoglucanase [EC:3.2.1.4] S.P. GH10 Cellulase/xylanase GH62 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH11 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH62 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH62 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH12 Xyloglucan−specific endo−beta−1,4−glucanase [EC:3.2.1.151] GH13 Glycogen debranching enzyme GH13 Glycogen debranching enzyme GH1 Beta−glucosidase [EC:3.2.1.21] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] GH1 Beta−glucosidase [EC:3.2.1.21] S.P. GH39 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH29 Alpha−L−fucosidase S.P. GH32 Levanase [EC:3.2.1.65] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

14 N. Streptomycetales 68_8 (Detritusphere guild) GH9 Endoglucanase [EC:3.2.1.4] S.P. GH5 Endoglucanase [EC:3.2.1.4] S.P. GH5 Endoglucanase [EC:3.2.1.4] GH43 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH11 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH43 Arabinoxylan arabinofuranohydrolase [EC:3.2.1.55] GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] S.P. GH3 Beta−N−acetylhexosaminidase [EC:3.2.1.52] GH1 Beta−glucosidase [EC:3.2.1.21] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

O. Steptomyces 70_9 (Aging root guild) GH5 Cellulase GH48 Cellulase [EC:3.2.1.91] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH51 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH1 Beta−glucosidase [EC:3.2.1.21] GH36 Alpha−galactosidase [EC:3.2.1.22] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

P. Steptomyces 71_13 (Aging root guild) S.P. GH5 Cellulase S.P. GH5 Cellulase S.P. GH6 Cellulose 1,4−beta−cellobiosidase [EC:3.2.1.91] S.P. GH48 Cellulose 1,4−beta−cellobiosidase [EC:3.2.1.91] GH48 Cellulose 1,4−beta−cellobiosidase [EC:3.2.1.91] S.P. GH12 Endoglucanase [EC:3.2.1.4] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH11 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH11 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. CE4 Acetyl xylan esterase GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH53 Arabinogalactan endo−1,4−beta−galactosidase [EC:3.2.1.89] GH16 1,3−beta−glucanase S.P. GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH29 Alpha−L−fucosidase GH2 Beta−galactosidase [EC:3.2.1.23] GH35 Beta−galactosidase [EC:3.2.1.23] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

15 Q. Streptomyces 71_16 (Aging root guild) GH6 Cellulase GH48 Cellulase [EC:3.2.1.91] S.P. GH6 Endoglucanase [EC:3.2.1.4] GH5 Endoglucanase [EC:3.2.1.4] S.P. GH10 Cellulase/xylanase S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] GH62 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. CE5 Cutinase [EC:3.1.1.74] AA2 cpeB; catalase/peroxidase GH1 Beta−glucosidase [EC:3.2.1.21] S.P. GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

R. Streptomyces 70_12 (Aging root guild)

S.P. GH12 Cellulase S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH62 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH43 Arabinoxylan arabinofuranohydrolase [EC:3.2.1.55] AA2 catalase/peroxidase S.P. GH43 Arabinan endo−1,5−alpha−L−arabinosidase [EC:3.2.1.99] S.P. GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

S. Actinobacteriota 70_8 (Aging root guild)

S.P. GH6 Cellulose 1,4−beta−cellobiosidase [EC:3.2.1.91] S.P. GH5 Endoglucanase [EC:3.2.1.4] CE8 Pectinesterase [EC:3.1.1.11] GH38 Alpha−mannosidase [EC:3.2.1.24] S.P. GH25 Lysozyme GH3 Beta−glucosidase [EC:3.2.1.21] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

16 T. Catenulisporales 70_18 (Aging root guild) S.P. GH6 Cellulose 1,4−beta−cellobiosidase [EC:3.2.1.91] S.P. GH5 Endoglucanase [EC:3.2.1.4] S.P. GH5 Endoglucanase [EC:3.2.1.4] S.P. GH11 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH11 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] AA2 catalase/peroxidase HPI GH3 Unspecified beta−glucosidase S.P. GH54 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] GH2 Beta−galactosidase [EC:3.2.1.23] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

U. Streptomyces URHA0041 (Aging root guild) S.P. GH5 Cellulase S.P. GH48 Cellulose 1,4−beta−cellobiosidase [EC:3.2.1.91] S.P. GH5 Endoglucanase [EC:3.2.1.4] S.P. GH5 Endoglucanase [EC:3.2.1.4] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH11 Endo−1,4−beta−xylanase [EC:3.2.1.8] GH54 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH43 Arabinoxylan arabinofuranohydrolase [EC:3.2.1.55] S.P. GH12 Xyloglucan−specific endo−beta−1,4−glucanase [EC:3.2.1.151] S.P. GH55 1,3−beta−glucanase S.P. GH18 Chitinase [EC:3.2.1.14] GH13 Glycogen debranching enzyme S.P. GH3 Beta−glucosidase [EC:3.2.1.21] GH3 Unspecified beta−glucosidase S.P. GH29 Alpha−L−fucosidase S.P. GH2 Beta−galactosidase [EC:3.2.1.23] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] S.P. GH2 Beta−galactosidase [EC:3.2.1.23] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

V. Gammaproteobacteria b1 (Low response) S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. PL1 Pectate lyase [EC:4.2.2.2] S.P. GH105 Unsaturated rhamnogalacturonyl hydrolase [EC:3.2.1.172] S.P. GH97 Alpha−glucosidase [EC:3.2.1.20] S.P. GH97 Alpha−glucosidase [EC:3.2.1.20] S.P. GH3 Beta−glucosidase [EC:3.2.1.21] S.P. GH31 Alpha−D−xyloside xylohydrolase [EC:3.2.1.177] GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] GH43 Xylan 1,4−beta−xylosidase [EC:3.2.1.37] S.P. GH29 Alpha−L−fucosidase H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

17 W. Niabella b75 (Low response) GH73 Mannosyl−glycoprotein endo−beta−N−acetylglucosaminidase GH133 Glycogen debranching enzyme S.P. GH31 Alpha−D−xyloside xylohydrolase [EC:3.2.1.177] S.P. GH95 Alpha−L−fucosidase [EC:3.2.1.51] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

X. Micromonosporaceae (Low response) S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH11 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH10 Endo−1,4−beta−xylanase [EC:3.2.1.8] S.P. GH43 Alpha−N−arabinofuranosidase [EC:3.2.1.55] S.P. GH74 Xyloglucan−specific exo−beta−1,4−glucanase [EC:3.2.1.155] S.P. GH16 Unspecified beta−glucanase [EC:3.2.1.73] GH42 Beta−galactosidase [EC:3.2.1.23] GH2 Beta−galactosidase [EC:3.2.1.23] GH42 Beta−galactosidase [EC:3.2.1.23] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

Y. Bradyrhizobium URHA0013 (Low response) AA2 katG; catalase−peroxidase GH78 Amylo−alpha−1,6−glucosidase GH13 Glycogen debranching enzyme GH13 Alpha−amylase GH13 Maltooligosyltrehalose trehalohydrolase [EC:3.2.1.141] GH2 Beta−galactosidase [EC:3.2.1.23] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

Z. Kribbella b6 (Low response) GH13 Glycogen debranching enzyme GH13 Alpha−amylase GH31 Alpha−D−xyloside xylohydrolase [EC:3.2.1.177] GH29 Alpha−L−fucosidase GH65 Alpha,alpha−trehalose phosphorylase [EC:2.4.1.64] GH13 trehalose−6−phosphate hydrolase [EC:3.2.1.93] H1_R H2_R H3_R H4_R H1_RL H2_RL H3_RL H4_RL H1_BL H2_BL H3_BL H4_BL signalp

Figure S8. Population increases based on housekeeping gene expression (gyrase A, B), or “Growers.” Heatmaps colors indicate the log2 fold increase (red) or decrease (blue) of average gyrase gene expression per genome relative to bulk soil over time (3, 6, 12, 22 days). Stars (*) indicate significant upregulation of gene expression relative to bulk soil by DESeq2. No gyrase data was available for Myxococcalis 67_7.

Figure S9. Population abundance-normalized CAZyme expression depicting “Upregulators.” Heatmaps colors indicate the log2 fold increase (red) or decrease (blue) of average CAZyme gene expression per genome relative to housekeeping gene expression (gyrase A, B) over time (3, 6, 12, 22 days). Stars (*) indicate > 1.6x log2 fold change (i.e., 3-fold change). No gyrase data was available for Myxococcalis 67_7.

Figure S10. Identification of “Synergist” populations that have highest gene expression in the Rhizosphere + Detritus (RL) treatment relative to both the Rhizosphere (R) and Bulk + Detritus (BL) treatments. Heatmaps colors indicate the log2 fold increase (red) or decrease (blue) over time (3, 6, 12, 22 days). Stars (*) indicate > 1.6x log2 fold change (i.e., 3-fold change). Red stars indicate synergist populations that had a star (*) for both the RL vs R comparison and the RL vs BL comparison.

21 Table S4: F tables

A. 16S cDNA F r2 p Habitat 16 0.15 <0.0001 *** Detritus 24 0.23 <0.0001 *** Time 6.5 0.19 <0.0001 *** Detritus:Time 2.2 0.063 0.021 *

B. ITS cDNA F r2 p Detritus 19 0.25 <0.0001 *** Time 2.5 0.098 <0.0001 ***

C. mRNA (3-22d) F r2 p Time 3.2 0.16 0.0068 ** Habitat:Time 3.0 0.052 0.011 * Habitat:Detritus:Time 2.1 0.11 0.016 *

mRNA (3-12d) F r2 p Habitat 5.8 0.13 <0.0001 *** Detritus 5.1 0.11 <0.0001 *** Time 2.9 0.066 <0.0001 *** Habitat:Time 1.7 0.037 0.029 * Detritus:Time 1.7 0.039 0.027 *

22 Table S5: Number of significantly upregulated bacterial OTUs relative to bulk soil by 16S itag sequence data. Data is aggregated at the family taxonomic level. Comparisons are between each treatment— Rhizosphere, Rhizosphere + Detritus, and Bulk Soil + Detritus—relative to Bulk soil without detritus amendment. Significance criteria are p<0.05 calculated by DESeq2 and accounts for multiple comparisons. Upregulated (Relative to Bulk) Rhizosphere Rhizosphere + Detritus Bulk Soil + Detritus Phylum Family 3 6 12 22 3 6 12 22 3 6 12 22 Acidobacteria Unknown Ellin6075 Koribacteraceae 1 RB40 1 Solibacteraceae 1 Actinobacteria Unknown Actinosynnemataceae 1 AK1AB1_02E 1 Gaiellaceae Microbacteriaceae 1 1 1 1 1 1 1 3 1 Micrococcaceae 1 1 1 1 1 Micromonosporaceae 1 Nocardiaceae 1 Patulibacteraceae Solirubrobacteraceae Sporichthyaceae 1 1 Streptomycetaceae 2 (blank) Armatimonadetes Unknown 1 1 2 1 4 2 2 1 1 Fimbriimonadaceae 1 6 8 1 8 6 8 2 5 Armatimonadaceae 1 1 2 2 1 1 Bacteroidetes Unknown 3 2 2 5 17 4 4 2 6 Amoebophilaceae 1 2 2 Chitinophagaceae 2 5 15 14 11 13 12 15 8 9 Cryomorphaceae 1 2 2 2 2 2 2 2 2 2 2 Cytophagaceae 1 2 5 14 8 7 16 15 15 6 10 Flavobacteriaceae 1 1 Sphingobacteriaceae 3 3 3 4 5 5 (blank) 1 1 2 5 1 3 Chlamydiae Criblamydiaceae 1 1 Parachlamydiaceae 1 2 1 1 2 (blank) 1 1 1 1 2 2 2 1 Chlorobi Unknown 1 2

23 Chloroflexi Unknown A4b 4 1 2 3 2 2 3 3 oc28 1 3 1 Thermogemmatisporaceae (blank) 1 Cyanobacteria Unknown 1 1 1 FBP Unknown 1 3 1 3 4 4 3 3 Fibrobacteres Unknown 1 1 3 2 4 4 3 3 4 1 Firmicutes Bacillaceae Clostridiaceae 1 Paenibacillaceae 1 1 1 1 1 Planococcaceae (blank) Planctomycetes Unknown 1 3 6 1 2 Gemmataceae Pirellulaceae 1 1 Proteobacteria Unknown 3 2 7 6 11 16 9 8 5 15 Acetobacteraceae Alteromonadaceae 1 1 1 3 1 1 1 3 2 1 1 Bacteriovoracaceae 1 3 1 1 3 1 1 Bdellovibrionaceae 1 1 2 1 2 1 3 3 2 3 1 1 Caulobacteraceae 1 4 6 8 7 7 7 7 8 7 6 Comamonadaceae 2 3 5 5 7 6 6 7 2 2 1 1 Coxiellaceae 2 1 1 2 1 1 1 Geobacteraceae 1 2 6 Haliangiaceae 1 1 3 3 1 1 1 2 Hyphomicrobiaceae 1 1 2 1 1 1 Legionellaceae 2 2 3 1 Methylocystaceae 1 Myxococcaceae OM27 2 1 1 2 1 2 1 Oxalobacteraceae 7 6 2 3 9 9 2 4 4 3 1 1 Phyllobacteriaceae 2 1 1 1 4 3 2 1 Polyangiaceae 1 2 3 1 1 1 3 Pseudomonadaceae 1 1 1 Rhizobiaceae 3 4 3 3 4 4 4 3 3 Rhodocyclaceae 1 Rhodospirillaceae 3 3 2 1 5 3 2 2 3 Rickettsiaceae 1 1 2 Sinobacteraceae 1 1 3 2 3 5 5 3 2 5

24 Sphingomonadaceae 5 6 6 4 5 8 6 3 6 Syntrophobacteraceae Xanthobacteraceae 1 1 1 1 1 1 Xanthomonadaceae 1 3 1 2 2 8 3 1 2 (blank) 1 3 3 6 5 10 26 6 8 6 14 TM6 Unknown 3 1 3 Verrucomicrobia Unknown 1 2 1 5 3 5 6 2 2 2 6 Chthoniobacteraceae 1 2 7 8 10 9 8 6 8 1 3 01D2Z36 1 1 1 1 1 1 1 Ellin515 2 1 1 1 1 Ellin517 3 3 1 Opitutaceae 2 3 4 3 3 5 5 2 1 3 Verrucomicrobiaceae 1 1 2 (blank) 1 1 3 3 2 1 1 Unknown (blank) 5 4 2 1 4 8 2 5

Total 15 20 44 81 161 132 129 241 161 159 89 138

25 Table S6: Number of significantly downregulated bacterial OTUs relative to bulk soil by 16S itag sequence data. Data is aggregated at the family taxonomic level. Comparisons are between each treatment—Rhizosphere, Rhizosphere + Detritus, and Bulk Soil + Detritus—relative to Bulk soil without detritus amendment. Significance criteria are p<0.05 calculated by DESeq2 and accounts for multiple comparisons.

Downregulated (Relative to Bulk) Rhizosphere + Bulk Soil + Rhizosphere Detritus Detritus Phylum Family 3 6 12 22 3 6 12 22 3 6 12 22 Acidobacteria Unknown 3 1 Ellin6075 2 1 Koribacteraceae 1 1 RB40 Solibacteraceae Actinobacteria Unknown 1 1 2 1 Actinosynnemataceae AK1AB1_02E 1 1 Gaiellaceae 1 1 1 3 2 1 5 Microbacteriaceae 1 Micrococcaceae Micromonosporaceae 1 Nocardiaceae Patulibacteraceae 1 1 Solirubrobacteraceae 2 3 2 Sporichthyaceae 1 1 Streptomycetaceae (blank) 1 1 1 1 Armatimonadetes Unknown Fimbriimonadaceae 1 Armatimonadaceae Bacteroidetes Unknown Amoebophilaceae Chitinophagaceae Cryomorphaceae Cytophagaceae 1 1 2 1 Flavobacteriaceae Sphingobacteriaceae (blank) Chlamydiae Criblamydiaceae Parachlamydiaceae 1 (blank)

26 Chlorobi Unknown Chloroflexi Unknown 4 6 A4b oc28 Thermogemmatisporaceae 1 (blank) Cyanobacteria Unknown 1 1 1 1 1 FBP Unknown Fibrobacteres Unknown Firmicutes Bacillaceae 1 1 1 Clostridiaceae Paenibacillaceae 2 2 1 Planococcaceae 1 1 (blank) 1 2 1 Planctomycetes Unknown 2 1 Gemmataceae 1 Pirellulaceae Proteobacteria Unknown 1 3 2 1 3 5 2 1 1 Acetobacteraceae 1 Alteromonadaceae Bacteriovoracaceae Bdellovibrionaceae Caulobacteraceae 1 Comamonadaceae Coxiellaceae Geobacteraceae Haliangiaceae Hyphomicrobiaceae 1 1 Legionellaceae Methylocystaceae Myxococcaceae 1 OM27 Oxalobacteraceae Phyllobacteriaceae Polyangiaceae Pseudomonadaceae Rhizobiaceae Rhodocyclaceae Rhodospirillaceae 1 Rickettsiaceae 1

27 Sinobacteraceae 1 Sphingomonadaceae Syntrophobacteraceae 1 Xanthobacteraceae Xanthomonadaceae (blank) 1 4 1 1 1 1 TM6 Unknown Verrucomicrobia Unknown 1 1 Chthoniobacteraceae 2 1 1 01D2Z36 Ellin515 Ellin517 Opitutaceae Verrucomicrobiaceae (blank) Unknown (blank) 3 1 1

Total 0 0 0 4 12 6 28 33 11 13 9 20

28 Table S7: Decomposition CAZymes and their putative substrates used to assess the carbohydrate degradation potential for the population metatranscriptomes. The number of unique genes significantly up- or down-regulated relative to bulk soil was totaled per annotation category (all treatments aggregated). Significance was determined by DESeq2. Gene annotation is a consensus annotation from KEGG, ggkbase, and dbCAN (assigned CAZy numbers noted). References provided where relevant for clarification.

Assigned # Sig. Putative Substrate Gene Annotation (Reference) CAZy Genes Cell Wall Lysozyme GH25 3 Membrane-bound Lytic murein transglycosylase A GH102 3 Membrane-bound Lytic murein transglycosylase B GH103 7 GH23 1 Membrane-bound Lytic murein transglycosylase C GH23 7 Membrane-bound Lytic murein transglycosylase D GH23 12 Cellulose Cellulase GH12 1 GH5 7 GH6 2 GH74 1 Cellulase [EC:3.2.1.4] GH45 1 GH5 2 GH51 1 GH6 1 GH74 1 Cellulase [EC:3.2.1.91] GH48 2 Cellulose 1,4-beta-cellobiosidase [EC:3.2.1.91] GH48 4 GH6 3 Endoglucanase [EC:3.2.1.4] (Berlemont and Martiny 2013) GH12 1 GH5 13 GH6 1 GH74 1 GH8 2 GH9 4 Chitin Beta-N-acetylhexosaminidase [EC:3.2.1.52] (Konno et al. 2012) GH3 4 Chitin deacetylase [EC:3.5.1.41] CE4 2 Chitinase [EC:3.2.1.14] GH18 4 Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase GH73 1 Cutin Cutinase [EC:3.1.1.74] CE5 1 Disaccharides 6-phospho-beta-glucosidase [EC:3.2.1.86] (Yu et al. 2013) GH1 4 GH4 1 Cellobiose phosphorylase [EC:2.4.1.20] GH94 4 Fructan Levanase [EC:3.2.1.65] GH32 1

29 Glycogen Amylo-alpha-1,6-glucosidase GH78 4 Glycogen debranching enzyme GH13 25 GH133 2 Lignin catalase AA2 2 catalase/hydroperoxidase HPI(I) AA2 2 catalase/peroxidase AA2 1 catalase/peroxidase HPI AA2 3 catalase/peroxidase HPI (EC:1.11.1.6) AA2 3 cpeB; catalase/peroxidase AA2 1 katG; catalase (EC:1.11.1.6 1.11.1.7) AA2 1 katG; catalase (EC:1.11.1.6) AA2 1 katG; catalase peroxidase (EC:1.11.1.21) AA2 1 katG; catalase-peroxidase AA2 2 katG; Catalase-peroxidase (EC:1.11.1.21) AA2 1 katG; catalase-peroxidase (EC:1.11.1.6) AA2 1 katG; peroxidase/catalase katG (EC:1.11.1.7 1.11.1.8) AA2 1 katGa; peroxidase/catalase oxidoreductase (EC:1.11.1.6) AA2 1 Cellulose- Beta-glucosidase [EC:3.2.1.21] (Berlemont and Martiny 2013, Oligosaccharide Bergmann et al. 2014) GH1 15 GH3 31 Unspecified beta-glucosidase GH3 2 Xylan- Oligosaccharide Alpha-D-xyloside xylohydrolase [EC:3.2.1.177] GH31 10 Beta-xylosidase (Bajpai 1997) GH39 2 GH43 4 Oligosaccharide reducing-end xylanase [EC:3.2.1.156] GH8 1 Xylan 1,4-beta-xylosidase [EC:3.2.1.37] GH39 6 GH43 15 GH54 1 Xylosidase/arabinosidase GH43 2 Oligosaccharides Alpha-galactosidase [EC:3.2.1.22] GH36 1 GH4 7 Alpha-L-fucosidase (Cao et al. 2014) GH29 10 Alpha-L-fucosidase [EC:3.2.1.51] GH29 1 GH95 5 Beta-galactosidase [EC:3.2.1.23] GH2 32 GH35 2 GH42 11 Beta-glucuronidase [EC:3.2.1.31] GH2 5 Beta-mannosidase [EC:3.2.1.25] GH2 3 Glucan 1,3-beta-glucosidase GH16 1

30 Other Polysaccharide 1,3-beta-glucanase GH16 1 GH55 1 Alpha-L-rhamnosidase [EC:3.2.1.40] GH78 1 Alpha-mannosidase [EC:3.2.1.24] (Moreira and Filho 2008) GH38 4 Arabinan endo-1,5-alpha-L-arabinosidase [EC:3.2.1.99] GH43 6 Endo-1,3-1,4-beta-glycanase GH16 3 Endo-beta-1,3-1,4 glucanase (EC:3.2.1.73) (Kuge et al. 2015) GH16 1 Mannan endo-1,4-beta-mannosidase [EC:3.2.1.78] (de Vries and Visser 2001) GH5 2 Poly(beta-D-mannuronate) lyase [EC:4.2.2.3] (Zhu and Yin 2015) PL9 1 Unspecified beta-glucanase [EC:3.2.1.73] GH16 1 Xylanase/chitin deacetylase CE4 1 Pectin Pectate lyase (Abbott and Boraston 2008) PL9 3 Pectate lyase [EC:4.2.2.2] PL1 2 Pectinesterase [EC:3.1.1.11] (Abbott and Boraston 2008) CE8 1 Polygalacturonase [EC:3.2.1.15] (Abbott and Boraston 2008) GH28 2 Rhamnogalacturonan endolyase [EC:4.2.2.23] PL4 1 Unsaturated rhamnogalacturonyl hydrolase [EC:3.2.1.172] (Silva et al. 2016) GH105 2 Arabinogalactan endo-1,4-beta-galactosidase [EC:3.2.1.89] Pectin Accessory (Abbott and Boraston 2008) GH53 1 Sialic Acid Sialidase-1 [EC:3.2.1.18] (Severi et al. 2007) GH74 10 Starch Alpha-amylase GH13 20 Alpha-amylase [EC:3.2.1.1] GH13 7 Alpha-amylase/alpha-mannosidase GH57 1 Alpha-glucosidase GH13 1 Alpha-glucosidase [EC:3.2.1.20] GH13 3 GH31 3 GH97 5 Glucoamylase GH15 2 Isoamylase GH13 2 Maltodextrin glucosidase GH13 1 Maltooligosyltrehalose trehalohydrolase [EC:3.2.1.141] GH13 8 Oligo-1,6-glucosidase [EC:3.2.1.10] GH13 3 Pullulanase [EC:3.2.1.41] GH13 3 Tannan or Ferulic Acid Tannase and feruloyl esterase CE1 1 Trehalose Alpha,alpha-trehalose phosphorylase [EC:2.4.1.64] GH65 2 trehalose-6-phosphate hydrolase [EC:3.2.1.93] GH13 1 Xylan Beta-1,4-xylanase [EC:3.2.1.8] (Barcelos et al. 2015) GH5 1 GH62 1

31 Cellulase/xylanase GH10 2 Endo-1,4-beta-xylanase [EC:3.2.1.8] (Barcelos et al. 2015) GH10 22 GH11 9 GH43 1 GH62 1 Glucuronoarabinoxylan endo-1,4-beta-xylanase [EC:3.2.1.136] GH30 4 Xylan Accessory Acetyl xylan esterase (Zhang et al. 2011) CE4 1 Alpha-N-arabinofuranosidase [EC:3.2.1.55] (Rahman et al. 2003) GH43 6 GH51 17 GH54 19 GH62 5 Arabinoxylan arabinofuranohydrolase [EC:3.2.1.55] GH43 8 Xyloglucan Xyloglucan-specific endo-beta-1,4-glucanase [EC:3.2.1.151] GH12 2 Xyloglucan-specific exo-beta-1,4-glucanase [EC:3.2.1.155] (de Vries and Visser 2001) GH74 15

32 REFERENCES

Abbott, D. W., and A. B. Boraston. 2008. Structural biology of pectin degradation by Enterobacteriaceae. Microbiology and molecular biology reviews : MMBR 72:301-316- table of contents. Bajpai, P. 1997. Microbial Xylanolytic Enzyme System: Properties and Applications. Pages 141- 194. Elsevier. Barcelos, C. A., V. A. Rocha, C. Groposo, A. M. De Castro, and N. Pereira. 2015. Enzymes and Accessory Proteins involved in the Hydrolysis of Lignocellulosic Biomass for Bioethanol Production. Pages 23-56. Bergmann, J. C., O. Y. A. Costa, J. M. Gladden, S. Singer, R. Heins, P. D'haeseleer, B. A. Simmons, and B. F. Quirino. 2014. Discovery of two novel β-glucosidases from an Amazon soil metagenomic library. FEMS Microbiology Letters 351:147-155. Berlemont, R., and A. C. Martiny. 2013. Phylogenetic distribution of potential cellulases in bacteria. Applied and Environmental Microbiology 79:1545-1554. Cao, H., J. D. Walton, P. Brumm, and G. N. Phillips Jr. 2014. Structure and Substrate Specificity of a Eukaryotic Fucosidase from Fusarium graminearum. Journal of Biological Chemistry 289:25624-25638. de Vries, R. P., and J. Visser. 2001. Aspergillus Enzymes Involved in Degradation of Plant Cell Wall Polysaccharides. Microbiology and Molecular Biology Reviews 65:497-522. Konno, N., H. Takahashi, M. Nakajima, T. Takeda, and Y. Sakamoto. 2012. Characterization of β- N-acetylhexosaminidase (LeHex20A), a member of glycoside hydrolase family 20, from Lentinula edodes shiitake mushroom). AMB Express 2:29. Kuge, T., H. Nagoya, T. Tryfona, T. Kurokawa, Y. Yoshimi, N. Dohmae, K. Tsubaki, P. Dupree, Y. Tsumuraya, and T. Kotake. 2015. Action of an endo-β-1,3(4)-glucanase on cellobiosyl unit structure in barley β-1,3:1,4-glucan. Bioscience, Biotechnology, and Biochemistry 79:1810-1817. Moreira, L. R. S., and E. X. F. Filho. 2008. An overview of mannan structure and mannan- degrading enzyme systems. Applied Microbiology and Biotechnology 79:165-178. Petersen, T. N., S. Brunak, G. von Heijne, and H. Nielsen. 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nature Methods 8:785-786. Rahman, A. K. M. S., N. Sugitani, M. Hatsu, and K. Takamizawa. 2003. A role of xylanase, alpha- L-arabinofuranosidase, and xylosidase in xylan degradation. - PubMed - NCBI. Canadian Journal of Microbiology 49:58-64. Rinke, C., J. Lee, N. Nath, D. Goudeau, B. Thompson, N. Poulton, E. Dmitrieff, R. Malmstrom, R. Stepanauskas, and T. Woyke. 2014. Obtaining genomes from uncultivated environmental microorganisms using FACS–based single-cell genomics. Nature Protocols 9:1038-1048. Severi, E., D. W. Hood, and G. H. Thomas. 2007. Sialic acid utilization by bacterial pathogens. Microbiology 153:2817-2822. Silva, I. R., C. Jers, A. S. Meyer, and J. D. Mikkelsen. 2016. Rhamnogalacturonan I modifying enzymes: an update. New biotechnology 33:41-54. Yu, W.-L., Y.-L. Jiang, A. Pikis, W. Cheng, X.-H. Bai, Y.-M. Ren, J. Thompson, C.-Z. Zhou, and Y. Chen. 2013. Structural Insights into the Substrate Specificity of a 6-Phospho-β-

33 glucosidase BglA-2 from Streptococcus pneumoniaeTIGR4. Journal of Biological Chemistry 288:14949-14958. Zhang, J., M. Siika-aho, M. Tenkanen, and L. Viikari. 2011. The role of acetyl xylan esterase in the solubilization of xylan and enzymatic hydrolysis of wheat straw and giant reed. Biotechnology for Biofuels 4:60. Zhu, B., and H. Yin. 2015. Alginate lyase: Review of major sources and classification, properties, structure-function analysis and applications. Bioengineered 6:125-131.