Id3 Is a Novel Regulator of P27kip1 Mrna in Early G1 Phase and Is
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Peripheral T Cells Ets-1 Maintains IL-7 Receptor Expression In
The Journal of Immunology Ets-1 Maintains IL-7 Receptor Expression in Peripheral T Cells Roland Grenningloh,*,† Tzong-Shyuan Tai,* Nicole Frahm,†,‡,1 Tomoyuki C. Hongo,‡ Adam T. Chicoine,‡ Christian Brander,†,‡,x,{ Daniel E. Kaufmann,†,‡,‖ and I-Cheng Ho*,† The expression of CD127, the IL-7–binding subunit of the IL-7 R, is tightly regulated during the development and activation of T cells and is reduced during chronic viral infection. However, the molecular mechanism regulating the dynamic expression of CD127 is still poorly understood. In this study, we report that the transcription factor Ets-1 is required for maintaining the expression of CD127 in murine peripheral T cells. Ets-1 binds to and activates the CD127 promoter, and its absence leads to reduced CD127 expression, attenuated IL-7 signaling, and impaired IL-7–dependent homeostatic proliferation of T cells. The expression of CD127 and Ets-1 is strongly correlated in human T cells. Both CD127 and Ets-1 expression are decreased in CD8+ T cells during HIV infection. In addition, HIV-associated loss of CD127 is only observed in Ets-1low effector memory and central memory but not in Ets-1high naive CD8+ T cells. Taken together, our data identify Ets-1 as a critical regulator of CD127 expression in T cells. The Journal of Immunology, 2011, 186: 969–976. nterleukin-7 signals are required for T cell development, GABPa or another Ets protein is responsible for maintaining maintaining the naive T cell pool, mounting proper primary CD127 expression in peripheral T cells is unknown. I responses, and inducing and maintaining CD4+ and CD8+ Ets-1 (E26 transformation-specific sequence) is the founding T cell memory (1–3). -
Loss of the NKX3.1 Tumorsuppressor Promotes the TMPRSS2-ERG
Thangapazham et al. BMC Cancer 2014, 14:16 http://www.biomedcentral.com/1471-2407/14/16 RESEARCH ARTICLE Open Access Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer Rajesh Thangapazham, Francisco Saenz, Shilpa Katta, Ahmed A Mohamed, Shyh-Han Tan, Gyorgy Petrovics, Shiv Srivastava and Albert Dobi* Abstract Background: In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Methods: Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Results: Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. -
Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L. -
Additive Effects of Micrornas and Transcription Factors on CCL2 Production in Human White Adipose Tissue
1248 Diabetes Volume 63, April 2014 Agné Kulyté,1 Yasmina Belarbi,1 Silvia Lorente-Cebrián,1 Clara Bambace,1 Erik Arner,1,2 Carsten O. Daub,3 Per Hedén,4 Mikael Rydén,1 Niklas Mejhert,1 and Peter Arner1 Additive Effects of MicroRNAs and Transcription Factors on CCL2 Production in Human White Adipose Tissue Adipose tissue inflammation is present in insulin- converged on the nuclear factor-kB pathway. In resistant conditions. We recently proposed conclusion, TF and miRNA-mediated regulation of a network of microRNAs (miRNAs) and transcription CCL2 production is additive and partly relayed by factors (TFs) regulating the production of the cell-specific networks in human adipose tissue that proinflammatory chemokine (C-C motif) ligand-2 may be important for the development of insulin (CCL2) in adipose tissue. We presently extended and resistance/type 2 diabetes. further validated this network and investigated if the Diabetes 2014;63:1248–1258 | DOI: 10.2337/db13-0702 METABOLISM circuits controlling CCL2 can interact in human adipocytes and macrophages. The updated subnetwork predicted that miR-126/-193b/-92a White adipose tissue (WAT) function plays an important control CCL2 production by several TFs, including role in the development of insulin resistance/type 2 di- v-ets erythroblastosis virus E26 oncogene homolog 1 abetes. Fat cells present in WAT secrete a number of (avian) (ETS1), MYC-associated factor X (MAX), molecules, collectively termed adipokines, which affect and specificity protein 12 (SP1). This was confirmed insulin sensitivity by autocrine and/or paracrine mecha- in human adipocytes by the observation that gene nisms (1,2). In insulin-resistant obese subjects, WAT silencing of ETS1, MAX, or SP1 attenuated CCL2 displays a chronic low-grade inflammation, which is production. -
Supplementary Materials
Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R: -
The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis
Subject Review The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis Michalis V. Karamouzis,1 Panagiotis A. Konstantinopoulos,1,2 and Athanasios G. Papavassiliou1 1Department of Biological Chemistry, Medical School, University of Athens, Athens, Greece and 2Division of Hematology-Oncology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts Abstract Much of the current anticancer research effort is focused on Respiratory epithelium cancers are the leading cause cell-surface receptors and their cognate upstream molecules of cancer-related death worldwide. The multistep natural because they provide the easiest route for drugs to affect history of carcinogenesis can be considered as a cellular behavior, whereas agents acting at the level of gradual accumulation of genetic and epigenetic transcription need to invade the nucleus. However, the aberrations, resulting in the deregulation of cellular therapeutic effect of surface receptor manipulation might be homeostasis. Growing evidence suggests that cross- considered less than specific because their actions are talk between membrane and nuclear receptor signaling modulated by complex interacting downstream signal trans- pathways along with the activator protein-1 (AP-1) duction pathways. A pivotal transcription factor during cascade and its cofactor network represent a pivotal respiratory epithelium carcinogenesis is activator protein-1 molecular circuitry participating directly or indirectly in (AP-1). AP-1–regulated genes include important modulators of respiratory epithelium carcinogenesis. The crucial role invasion and metastasis, proliferation, differentiation, and of AP-1 transcription factor renders it an appealing survival as well as genes associated with hypoxia and target of future nuclear-directed anticancer therapeutic angiogenesis (7). Nuclear-directed therapeutic strategies might and chemoprevention approaches. -
Lncegfl7os Regulates Human Angiogenesis by Interacting
RESEARCH ARTICLE LncEGFL7OS regulates human angiogenesis by interacting with MAX at the EGFL7/miR-126 locus Qinbo Zhou1†, Bo Yu1†*, Chastain Anderson1, Zhan-Peng Huang2, Jakub Hanus1, Wensheng Zhang3, Yu Han4, Partha S Bhattacharjee5, Sathish Srinivasan6, Kun Zhang3, Da-zhi Wang2, Shusheng Wang1,7* 1Department of Cell and Molecular Biology, Tulane University, New Orleans, United States; 2Department of Cardiology, Boston Children’s Hospital, Harvard Medical School, Boston, United States; 3Department of Computer Science, Xavier University, New Orleans, United States; 4Aab Cardiovascular Research Institute, University of Rochester School of Medicine and Dentistry, Rochester, United States; 5Department of Biology, Xavier University, New Orleans, United States; 6Cardiovascular Biology Research Program, Oklahoma Medical Research Foundation, Oklahoma, United States; 7Department of Ophthalmology, Tulane University, New Orleans, United States Abstract In an effort to identify human endothelial cell (EC)-enriched lncRNAs,~500 lncRNAs were shown to be highly restricted in primary human ECs. Among them, lncEGFL7OS, located in the opposite strand of the EGFL7/miR-126 gene, is regulated by ETS factors through a bidirectional promoter in ECs. It is enriched in highly vascularized human tissues, and upregulated in the hearts of dilated cardiomyopathy patients. LncEGFL7OS silencing impairs angiogenesis as shown by EC/fibroblast co-culture, in vitro/in vivo and ex vivo human choroid sprouting angiogenesis assays, while lncEGFL7OS overexpression has the opposite function. Mechanistically, *For correspondence: lncEGFL7OS is required for MAPK and AKT pathway activation by regulating EGFL7/miR-126 [email protected] (BY); expression. MAX protein was identified as a lncEGFL7OS-interacting protein that functions to [email protected] (SW) regulate histone acetylation in the EGFL7/miR-126 promoter/enhancer. -
Transcriptional Control of Tissue-Resident Memory T Cell Generation
Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells. -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
A Web-Platform for Analysis of Host Factors Involved in Viral Infections Discovered by Genome Wide Rnai Screen
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2017 vhfRNAi: A web-platform for analysis of host factors involved in viral infections discovered by genome wide RNAi screen Anamika Thakur#, Abid Qureshi# and Manoj Kumar* Bioinformatics Centre, Institute of Microbial Technology, Council of Scientific and Industrial Research, Sector 39A, Chandigarh-160036, India #Equal contribution * To whom correspondence should be addressed. Tel, 91-172-6665453; Fax, 91-172- 2690585; 91-172-2690632; Email, [email protected] Supplementary Tables Table S1: Statistics of unique and duplicate host factors in each virus Table S2: Table denoting genes common among different viruses Table S3: Statistics of GWAS analysis Table S1. Statistics of unique and duplicate host factors in each virus S. No. Virus Unique-Entries Duplicate-Entries 1. Adeno-associated virus (AAV) 926 533 2. Avian influenza virus (AIV) 0 11 3. Borna disease virus (BDV) 14 20 4. Dengue virus 2 (DEN-2) 27 13 5. Hepatitis C virus (HCV) 236 213 6. Human immunodeficiency virus 1 (HIV) 1388 857 7. Human parainfluenza virus 3 (HPIV-3) 0 27 8. Human herpesvirus 1 (HSV-1) 34 38 9. Influenza A virus (IAV) 700 513 10. Lymphocytic choriomeningitis virus (LCMV) 0 54 11. Marburgvirus (MARV) 0 11 12. Poliovirus (PV) 3340 1035 13. Rotavirus (RV) 347 175 14. Sendai virus (SeV) 32 27 15. Sindbis virus (SIV) 70 41 16. Vaccinia virus (VACV) 482 296 17. Vesicular stomatitis virus (VSV) 9 78 18. West Nile virus (WNV) 313 137 Table S1. Statistics of unique host factors for each virus having overlapping and unique factors in different viruses Non-overlap – Overall- S. -
Agonists and Knockdown of Estrogen Receptor Β Differentially Affect
Schüler-Toprak et al. BMC Cancer (2016) 16:951 DOI 10.1186/s12885-016-2973-y RESEARCH ARTICLE Open Access Agonists and knockdown of estrogen receptor β differentially affect invasion of triple-negative breast cancer cells in vitro Susanne Schüler-Toprak1*, Julia Häring1, Elisabeth C. Inwald1, Christoph Moehle2, Olaf Ortmann1 and Oliver Treeck1 Abstract Background: Estrogen receptor β (ERβ) is expressed in the majority of invasive breast cancer cases, irrespective of their subtype, including triple-negative breast cancer (TNBC). Thus, ERβ might be a potential target for therapy of this challenging cancer type. In this in vitro study, we examined the role of ERβ in invasion of two triple-negative breast cancer cell lines. Methods: MDA-MB-231 and HS578T breast cancer cells were treated with the specific ERβ agonists ERB-041, WAY200070, Liquiritigenin and 3β-Adiol. Knockdown of ERβ expression was performed by means of siRNA transfection. Effects on cellular invasion were assessed in vitro by means of a modified Boyden chamber assay. Transcriptome analyses were performed using Affymetrix Human Gene 1.0 ST microarrays. Pathway and gene network analyses were performed by means of Genomatix and Ingenuity Pathway Analysis software. Results: Invasiveness of MBA-MB-231 and HS578T breast cancer cells decreased after treatment with ERβ agonists ERB-041 and WAY200070. Agonists Liquiritigenin and 3β-Adiol only reduced invasion of MDA-MB-231 cells. Knockdown of ERβ expression increased invasiveness of MDA-MB-231 cells about 3-fold. Transcriptome and pathway analyses revealed that ERβ knockdown led to activation of TGFβ signalling and induced expression of a network of genes with functions in extracellular matrix, tumor cell invasion and vitamin D3 metabolism. -
Accompanies CD8 T Cell Effector Function Global DNA Methylation
Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M.