DOCSLIB.ORG

Id3 Is a Novel Regulator of P27kip1 Mrna in Early G1 Phase and Is

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Id3 Is a Novel Regulator of P27kip1 Mrna in Early G1 Phase and Is Oncogene (2007) 26, 5772–5783 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc ORIGINAL ARTICLE Id3 is a novel regulator of p27kip1 mRNA in earlyG1 phase and is required for cell-cycle progression A-A Chassot1,4, L Turchi1,4, T Virolle1, G Fitsialos1, M Batoz2, M Deckert2, V Dulic3, G Meneguzzi1, RBusca` 1 and G Ponzio1 1INSERM U634; Faculte´ de Me´decine, Universite´ Nice Sophia Antipolis, Nice cedex, France; 2INSERM U576, Hoˆpital de L’Archet, Universite´ Nice Sophia Antipolis, Nice, France and 3CRBM-CNRS FRE 2593, Montpellier, France P27kip is a keyinhibitoryprotein of the cell-cycle Introduction progression, which is rapidlydownregulated in earlyG1 phase bya post-translational mechanism involving the Most adult tissues are constituted by differentiated proteosomal degradation. In this study, using a wounding cells with reduced proliferative activity. Renewal and/or model that induces cell-cycle entry of human dermal fibro- regeneration of these tissues is supplied by quiescent blasts, we demonstrate that p27mRNA is downregulated cells sensitive to mitogenic signals. During the skin when cells progress into the G1 phase, and then it returns wound healing process, the proliferation of quiescent to its basal level when cells approach the S phase. By cells can be stimulated by signals such as serum afflux using a quantitative polymerase chain reaction screening and/or contact inhibition failure. we identified inhibitors of differentiation (Id3), a bHLH ‘Inhibitors of differentiation’ (Id) proteins are early transcriptional repressor, as a candidate mediator accoun- genes that operate as regulators of cell fate determi- ting for p27 mRNA decrease. Id3 silencing, using an small nation. They play a crucial role in the coordinated interfering RNA approach, reversed the injurymediated regulation of gene expression during cell growth, p27 downregulation demonstrating that Id3 is involved in differentiation and tumorigenesis (Norton, 2000; the transcriptional repression of p27. Reporter gene Benezra et al., 2001). The involvement of Ids was also experiments and a chromatin immunoprecipitation assay recently shown in cellular senescence (Alani et al., 2001; showed that Id3 likelyexerts its repressive action through Ohtani et al., 2001; Zheng et al., 2004) and in the fate of ELK1 inhibition. Byinhibiting earlyp27 downregulation, specialized cells such as lymphocytes, vascular endo- Id3 depletion blocked (i) the G1-phase progression as thelial cells and neurons (Lyden et al., 1999; Benezra assessed bythe inhibition of pRb phosphorylationand et al., 2001; Engel and Murre, 2001). p130 degradation and (ii) the G1/S transition as observed Today, four members of the Id protein family (Id1– bythe inhibition of cyclinA induction, demonstrating that Id4) have been identified. They directly associate with p27 mRNA decrease is required for cell proliferation. and regulate the activity of several families of transcrip- Apart from its effect on the earlyp27 diminution, Id3 tional regulators (Yates et al., 1999; Lasorella et al., appears also involved in the control of the steady-state 2000; Norton, 2000; Roberts et al., 2001). In mammals, level of p27 at the G1/S boundary. In conclusion, this Id proteins exert their biological effects mainly through studyidentifies a novel mechanism of p27 regulation the interaction with bHLH transcription factors by which besides p27 protein degradation also implicates a blocking their DNA-binding activity. Among the Id3 transcriptional mechanism mediated byId3. partners, the members of the E2A family of transcrip- Oncogene (2007) 26, 5772–5783; doi:10.1038/sj.onc.1210386; tion factors (E12, E47) are the most frequently described published online 2 April 2007 (Massari and Murre, 2000; Norton, 2000). However, they are not the exclusive partners of Id3 as it has also Keywords: Ids; cell-cycle; p27mRNA; wound healing been shown that Id3 also interacts with MyoD, Ets, Pax or TCFs Ets-domain transcription factors (Yates et al., 1999; Roberts et al., 2001; Trausch-Azar et al., 2004). Ids proteins lack a basic DNA-binding domain and readily associate with transcription factors of the bHLH family such as E proteins to inhibit their DNA-binding function. Recent data have demonstrated that Ids activity Correspondence: G Ponzio, INSERM U634, Faculte´ de Me´ decine, is inhibited by cell-cycle-dependent kinase activities Universite´ Nice Sophia Antipolis, 28 avenue de Valombrose, 06107 such as cyclin E- and A-CDK2 (Deed et al., 1997). In Nice cedex 02, France. addition, it has also been shown that E2A and Ids E-mail: [email protected] 4 proteins participate to the transcriptional regulation These two authors equally contributed to this work. cip1 Received 13 February 2006; revised 23 January 2007; accepted 1 February of the cyclin-dependent kinase inhibitors (CKIs) p21 2007; published online 2 April 2007 (Id1) (Prabhu et al., 1997; Takahashi et al., 2004) and Id3 regulates p27mRNA in early G1 A-A Chassot et al 5773 16ink4a (Id1) (Zheng et al., 2004) in different biological to date has been poorly studied compared to the p27 models including senescence. Recent studies have shown protein fate. that besides p21 and p16, Id1 and Id3 are also involved To perform this analysis, hyperconfluent contact inhi- in the regulation of p27 protein, notably in Xenopus bited (CI) normal HDF were injured to stimulate neural crest progenitors (Kee and Bronner-Fraser, 2005) cell-cycle entry and next p27 mRNA was measured by and in Epstein–Barr virus infected cells (Everly et al., real-time quantitative PCR, before wounding and 1, 3, 2004); however, the molecular basis of this inhibition 6, 15 and 24 h after injury. In parallel we also analysed has never been elucidated. the expression of p27 protein by Western blot. To The CKI p27kip1 is a key regulator of cell-cycle assess the synchronous cell-cycle entry, we measured commitment and progression. P27 is downregulated the expression of cyclin A as a marker of the G1-S when cells are stimulated with mitotic agents and it transition. is induced to play a key role in mediating G1 arrest We observed that p27 mRNA was rapidly down- in response to mitogen starvation, cell confluence or regulated in response to injury reaching its minimal transforming growth factor b (Sherr and Roberts, 1995). levels about 3 h after injury (Figure 1a). About 24 h It is well established that p27 expression is mainly post- later, p27 transcript reached again its basal levels translationally regulated by the ubiquitin-proteasome (Figure 1a) when cells entered in S phase as confir- pathway (Pagano et al., 1995; Montagnoli et al., 1999; med by the measure of cyclin A mRNA expression Malek et al., 2001; Kamura et al., 2004). However, some studies demonstrate that p27 might also be transcrip- tionally regulated (Servant et al., 2000; Sakakibara et al., 2005). Nevertheless, at present, the mechanisms 100 involved in such regulation remain unidentified. Dermal fibroblast proliferation is a major feature of cutaneous wound healing (Martin, 1997), which is altered in several pathologies such as keloids (Calderon 50 Cyclin A et al., 1996) and chronic wounds, which can evoluate (% of max) p27 toward cutaneous carcinoma (Loots et al., 1999; Chraibi Cyc A & p27 mRNA et al., 2004). To date the mechanisms underlying cell 0 proliferation in the cutaneous wound healing context 02030 remain poorly understood. Using a suitable model to Hours after injury study in vitro wound healing (Turchi et al., 2002), we have explored the molecular mechanisms responsible b p27 for the cell-cycle entry in wounded normal human dermal fibroblasts (HDF). We show that this process Conf 3 6 15 24 depends, at least in part, on the rapid downregulation of Hours after wounding p27 mRNA. Using a small interfering RNA (siRNA) approach, we identify Id3 as a mediator of this effect. c 1 The silencing of Id3 abolishes the early downregulation 0.8 of p27 and inhibits the cell progression in G1 as well as the G1/S transition. 0.6 0.4 0.2 Results p27 mRNA level (A.U.) 0 Wounding regulates p27 at the mRNA level and this N WNW requires the synthesis of a mediator protein We have developed an original device that creates cali- brated long size injuries within confluent cell cultures. In Figure 1 Effect of HDF injury on p27 expression: confluent HDF were stimulated to grow by mechanical injury as described in classical conditions, this device wounds about 50% of Materials and methods and harvested at the indicated times. (a) the cell monolayer allowing the detection of a wide Total RNAs were isolated then p27 and cyclin A mRNA were spectrum of molecular events (Turchi et al., 2002). Using analysed by real-time PCRusing the procedure described in our wounding system, hyperconfluent dermal fibroblasts ‘Materials and methods’. The presented experiment corresponds to are synchronously stimulated to enter the cell-cycle a typical one chosen among six different experiments. (b) Cells were lysed and p27 protein levels were measured by Western blot. The (unpublished data). Using this system we have investi- presented experiment was chosen among four independent ones (c) gated the molecular mechanisms involved in the initial Effect of cycloheximide on the downregulation of p27mRNA in step of the cell-cycle entry in HDF in response to injury. wounded HDF. Confluent HDF were incubated 30 min in the We have focused our attention on p27kip1, an inhibitor absence (À) or in the presence of 5 mM cycloheximide (CHX) before injury. Wounded (W) and control (N)
Load more

Recommended publications
  • Peripheral T Cells Ets-1 Maintains IL-7 Receptor Expression In
    The Journal of Immunology Ets-1 Maintains IL-7 Receptor Expression in Peripheral T Cells Roland Grenningloh,*,† Tzong-Shyuan Tai,* Nicole Frahm,†,‡,1 Tomoyuki C. Hongo,‡ Adam T. Chicoine,‡ Christian Brander,†,‡,x,{ Daniel E. Kaufmann,†,‡,‖ and I-Cheng Ho*,† The expression of CD127, the IL-7–binding subunit of the IL-7 R, is tightly regulated during the development and activation of T cells and is reduced during chronic viral infection. However, the molecular mechanism regulating the dynamic expression of CD127 is still poorly understood. In this study, we report that the transcription factor Ets-1 is required for maintaining the expression of CD127 in murine peripheral T cells. Ets-1 binds to and activates the CD127 promoter, and its absence leads to reduced CD127 expression, attenuated IL-7 signaling, and impaired IL-7–dependent homeostatic proliferation of T cells. The expression of CD127 and Ets-1 is strongly correlated in human T cells. Both CD127 and Ets-1 expression are decreased in CD8+ T cells during HIV infection. In addition, HIV-associated loss of CD127 is only observed in Ets-1low effector memory and central memory but not in Ets-1high naive CD8+ T cells. Taken together, our data identify Ets-1 as a critical regulator of CD127 expression in T cells. The Journal of Immunology, 2011, 186: 969–976. nterleukin-7 signals are required for T cell development, GABPa or another Ets protein is responsible for maintaining maintaining the naive T cell pool, mounting proper primary CD127 expression in peripheral T cells is unknown. I responses, and inducing and maintaining CD4+ and CD8+ Ets-1 (E26 transformation-specific sequence) is the founding T cell memory (1–3).
    [Show full text]
  • Loss of the NKX3.1 Tumorsuppressor Promotes the TMPRSS2-ERG
    Thangapazham et al. BMC Cancer 2014, 14:16 http://www.biomedcentral.com/1471-2407/14/16 RESEARCH ARTICLE Open Access Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer Rajesh Thangapazham, Francisco Saenz, Shilpa Katta, Ahmed A Mohamed, Shyh-Han Tan, Gyorgy Petrovics, Shiv Srivastava and Albert Dobi* Abstract Background: In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Methods: Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Results: Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis.
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • Additive Effects of Micrornas and Transcription Factors on CCL2 Production in Human White Adipose Tissue
    1248 Diabetes Volume 63, April 2014 Agné Kulyté,1 Yasmina Belarbi,1 Silvia Lorente-Cebrián,1 Clara Bambace,1 Erik Arner,1,2 Carsten O. Daub,3 Per Hedén,4 Mikael Rydén,1 Niklas Mejhert,1 and Peter Arner1 Additive Effects of MicroRNAs and Transcription Factors on CCL2 Production in Human White Adipose Tissue Adipose tissue inflammation is present in insulin- converged on the nuclear factor-kB pathway. In resistant conditions. We recently proposed conclusion, TF and miRNA-mediated regulation of a network of microRNAs (miRNAs) and transcription CCL2 production is additive and partly relayed by factors (TFs) regulating the production of the cell-specific networks in human adipose tissue that proinflammatory chemokine (C-C motif) ligand-2 may be important for the development of insulin (CCL2) in adipose tissue. We presently extended and resistance/type 2 diabetes. further validated this network and investigated if the Diabetes 2014;63:1248–1258 | DOI: 10.2337/db13-0702 METABOLISM circuits controlling CCL2 can interact in human adipocytes and macrophages. The updated subnetwork predicted that miR-126/-193b/-92a White adipose tissue (WAT) function plays an important control CCL2 production by several TFs, including role in the development of insulin resistance/type 2 di- v-ets erythroblastosis virus E26 oncogene homolog 1 abetes. Fat cells present in WAT secrete a number of (avian) (ETS1), MYC-associated factor X (MAX), molecules, collectively termed adipokines, which affect and specificity protein 12 (SP1). This was confirmed insulin sensitivity by autocrine and/or paracrine mecha- in human adipocytes by the observation that gene nisms (1,2). In insulin-resistant obese subjects, WAT silencing of ETS1, MAX, or SP1 attenuated CCL2 displays a chronic low-grade inflammation, which is production.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R:
    [Show full text]
  • The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis
    Subject Review The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis Michalis V. Karamouzis,1 Panagiotis A. Konstantinopoulos,1,2 and Athanasios G. Papavassiliou1 1Department of Biological Chemistry, Medical School, University of Athens, Athens, Greece and 2Division of Hematology-Oncology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts Abstract Much of the current anticancer research effort is focused on Respiratory epithelium cancers are the leading cause cell-surface receptors and their cognate upstream molecules of cancer-related death worldwide. The multistep natural because they provide the easiest route for drugs to affect history of carcinogenesis can be considered as a cellular behavior, whereas agents acting at the level of gradual accumulation of genetic and epigenetic transcription need to invade the nucleus. However, the aberrations, resulting in the deregulation of cellular therapeutic effect of surface receptor manipulation might be homeostasis. Growing evidence suggests that cross- considered less than specific because their actions are talk between membrane and nuclear receptor signaling modulated by complex interacting downstream signal trans- pathways along with the activator protein-1 (AP-1) duction pathways. A pivotal transcription factor during cascade and its cofactor network represent a pivotal respiratory epithelium carcinogenesis is activator protein-1 molecular circuitry participating directly or indirectly in (AP-1). AP-1–regulated genes include important modulators of respiratory epithelium carcinogenesis. The crucial role invasion and metastasis, proliferation, differentiation, and of AP-1 transcription factor renders it an appealing survival as well as genes associated with hypoxia and target of future nuclear-directed anticancer therapeutic angiogenesis (7). Nuclear-directed therapeutic strategies might and chemoprevention approaches.
    [Show full text]
  • Lncegfl7os Regulates Human Angiogenesis by Interacting
    RESEARCH ARTICLE LncEGFL7OS regulates human angiogenesis by interacting with MAX at the EGFL7/miR-126 locus Qinbo Zhou1†, Bo Yu1†*, Chastain Anderson1, Zhan-Peng Huang2, Jakub Hanus1, Wensheng Zhang3, Yu Han4, Partha S Bhattacharjee5, Sathish Srinivasan6, Kun Zhang3, Da-zhi Wang2, Shusheng Wang1,7* 1Department of Cell and Molecular Biology, Tulane University, New Orleans, United States; 2Department of Cardiology, Boston Children’s Hospital, Harvard Medical School, Boston, United States; 3Department of Computer Science, Xavier University, New Orleans, United States; 4Aab Cardiovascular Research Institute, University of Rochester School of Medicine and Dentistry, Rochester, United States; 5Department of Biology, Xavier University, New Orleans, United States; 6Cardiovascular Biology Research Program, Oklahoma Medical Research Foundation, Oklahoma, United States; 7Department of Ophthalmology, Tulane University, New Orleans, United States Abstract In an effort to identify human endothelial cell (EC)-enriched lncRNAs,~500 lncRNAs were shown to be highly restricted in primary human ECs. Among them, lncEGFL7OS, located in the opposite strand of the EGFL7/miR-126 gene, is regulated by ETS factors through a bidirectional promoter in ECs. It is enriched in highly vascularized human tissues, and upregulated in the hearts of dilated cardiomyopathy patients. LncEGFL7OS silencing impairs angiogenesis as shown by EC/fibroblast co-culture, in vitro/in vivo and ex vivo human choroid sprouting angiogenesis assays, while lncEGFL7OS overexpression has the opposite function. Mechanistically, *For correspondence: lncEGFL7OS is required for MAPK and AKT pathway activation by regulating EGFL7/miR-126 [email protected] (BY); expression. MAX protein was identified as a lncEGFL7OS-interacting protein that functions to [email protected] (SW) regulate histone acetylation in the EGFL7/miR-126 promoter/enhancer.
    [Show full text]
  • Transcriptional Control of Tissue-Resident Memory T Cell Generation
    Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • A Web-Platform for Analysis of Host Factors Involved in Viral Infections Discovered by Genome Wide Rnai Screen
    Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2017 vhfRNAi: A web-platform for analysis of host factors involved in viral infections discovered by genome wide RNAi screen Anamika Thakur#, Abid Qureshi# and Manoj Kumar* Bioinformatics Centre, Institute of Microbial Technology, Council of Scientific and Industrial Research, Sector 39A, Chandigarh-160036, India #Equal contribution * To whom correspondence should be addressed. Tel, 91-172-6665453; Fax, 91-172- 2690585; 91-172-2690632; Email, [email protected] Supplementary Tables Table S1: Statistics of unique and duplicate host factors in each virus Table S2: Table denoting genes common among different viruses Table S3: Statistics of GWAS analysis Table S1. Statistics of unique and duplicate host factors in each virus S. No. Virus Unique-Entries Duplicate-Entries 1. Adeno-associated virus (AAV) 926 533 2. Avian influenza virus (AIV) 0 11 3. Borna disease virus (BDV) 14 20 4. Dengue virus 2 (DEN-2) 27 13 5. Hepatitis C virus (HCV) 236 213 6. Human immunodeficiency virus 1 (HIV) 1388 857 7. Human parainfluenza virus 3 (HPIV-3) 0 27 8. Human herpesvirus 1 (HSV-1) 34 38 9. Influenza A virus (IAV) 700 513 10. Lymphocytic choriomeningitis virus (LCMV) 0 54 11. Marburgvirus (MARV) 0 11 12. Poliovirus (PV) 3340 1035 13. Rotavirus (RV) 347 175 14. Sendai virus (SeV) 32 27 15. Sindbis virus (SIV) 70 41 16. Vaccinia virus (VACV) 482 296 17. Vesicular stomatitis virus (VSV) 9 78 18. West Nile virus (WNV) 313 137 Table S1. Statistics of unique host factors for each virus having overlapping and unique factors in different viruses Non-overlap – Overall- S.
    [Show full text]
  • Agonists and Knockdown of Estrogen Receptor Β Differentially Affect
    Schüler-Toprak et al. BMC Cancer (2016) 16:951 DOI 10.1186/s12885-016-2973-y RESEARCH ARTICLE Open Access Agonists and knockdown of estrogen receptor β differentially affect invasion of triple-negative breast cancer cells in vitro Susanne Schüler-Toprak1*, Julia Häring1, Elisabeth C. Inwald1, Christoph Moehle2, Olaf Ortmann1 and Oliver Treeck1 Abstract Background: Estrogen receptor β (ERβ) is expressed in the majority of invasive breast cancer cases, irrespective of their subtype, including triple-negative breast cancer (TNBC). Thus, ERβ might be a potential target for therapy of this challenging cancer type. In this in vitro study, we examined the role of ERβ in invasion of two triple-negative breast cancer cell lines. Methods: MDA-MB-231 and HS578T breast cancer cells were treated with the specific ERβ agonists ERB-041, WAY200070, Liquiritigenin and 3β-Adiol. Knockdown of ERβ expression was performed by means of siRNA transfection. Effects on cellular invasion were assessed in vitro by means of a modified Boyden chamber assay. Transcriptome analyses were performed using Affymetrix Human Gene 1.0 ST microarrays. Pathway and gene network analyses were performed by means of Genomatix and Ingenuity Pathway Analysis software. Results: Invasiveness of MBA-MB-231 and HS578T breast cancer cells decreased after treatment with ERβ agonists ERB-041 and WAY200070. Agonists Liquiritigenin and 3β-Adiol only reduced invasion of MDA-MB-231 cells. Knockdown of ERβ expression increased invasiveness of MDA-MB-231 cells about 3-fold. Transcriptome and pathway analyses revealed that ERβ knockdown led to activation of TGFβ signalling and induced expression of a network of genes with functions in extracellular matrix, tumor cell invasion and vitamin D3 metabolism.
    [Show full text]
  • Accompanies CD8 T Cell Effector Function Global DNA Methylation
    Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M.
    [Show full text]