Bppart and Bpmax: RNA-RNA Interaction Partition Function and Structure Prediction for the Base Pair Counting Model
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Nuclear and Mitochondrial Genome Defects in Autisms
UC Irvine UC Irvine Previously Published Works Title Nuclear and mitochondrial genome defects in autisms. Permalink https://escholarship.org/uc/item/8vq3278q Journal Annals of the New York Academy of Sciences, 1151(1) ISSN 0077-8923 Authors Smith, Moyra Spence, M Anne Flodman, Pamela Publication Date 2009 DOI 10.1111/j.1749-6632.2008.03571.x License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California THE YEAR IN HUMAN AND MEDICAL GENETICS 2009 Nuclear and Mitochondrial Genome Defects in Autisms Moyra Smith, M. Anne Spence, and Pamela Flodman Department of Pediatrics, University of California, Irvine, California In this review we will evaluate evidence that altered gene dosage and structure im- pacts neurodevelopment and neural connectivity through deleterious effects on synap- tic structure and function, and evidence that the latter are key contributors to the risk for autism. We will review information on alterations of structure of mitochondrial DNA and abnormal mitochondrial function in autism and indications that interactions of the nuclear and mitochondrial genomes may play a role in autism pathogenesis. In a final section we will present data derived using Affymetrixtm SNP 6.0 microar- ray analysis of DNA of a number of subjects and parents recruited to our autism spectrum disorders project. We include data on two sets of monozygotic twins. Col- lectively these data provide additional evidence of nuclear and mitochondrial genome imbalance in autism and evidence of specific candidate genes in autism. We present data on dosage changes in genes that map on the X chromosomes and the Y chro- mosome. -
Molecular Basis for the Distinct Cellular Functions of the Lsm1-7 and Lsm2-8 Complexes
bioRxiv preprint doi: https://doi.org/10.1101/2020.04.22.055376; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Molecular basis for the distinct cellular functions of the Lsm1-7 and Lsm2-8 complexes Eric J. Montemayor1,2, Johanna M. Virta1, Samuel M. Hayes1, Yuichiro Nomura1, David A. Brow2, Samuel E. Butcher1 1Department of Biochemistry, University of Wisconsin-Madison, Madison, WI, USA. 2Department of Biomolecular Chemistry, University of Wisconsin School of Medicine and Public Health, Madison, WI, USA. Correspondence should be addressed to E.J.M. ([email protected]) and S.E.B. ([email protected]). Abstract Eukaryotes possess eight highly conserved Lsm (like Sm) proteins that assemble into circular, heteroheptameric complexes, bind RNA, and direct a diverse range of biological processes. Among the many essential functions of Lsm proteins, the cytoplasmic Lsm1-7 complex initiates mRNA decay, while the nuclear Lsm2-8 complex acts as a chaperone for U6 spliceosomal RNA. It has been unclear how these complexes perform their distinct functions while differing by only one out of seven subunits. Here, we elucidate the molecular basis for Lsm-RNA recognition and present four high-resolution structures of Lsm complexes bound to RNAs. The structures of Lsm2-8 bound to RNA identify the unique 2′,3′ cyclic phosphate end of U6 as a prime determinant of specificity. In contrast, the Lsm1-7 complex strongly discriminates against cyclic phosphates and tightly binds to oligouridylate tracts with terminal purines. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Epigenome-Wide Exploratory Study of Monozygotic Twins Suggests Differentially Methylated Regions to Associate with Hand Grip Strength
Biogerontology (2019) 20:627–647 https://doi.org/10.1007/s10522-019-09818-1 (0123456789().,-volV)( 0123456789().,-volV) RESEARCH ARTICLE Epigenome-wide exploratory study of monozygotic twins suggests differentially methylated regions to associate with hand grip strength Mette Soerensen . Weilong Li . Birgit Debrabant . Marianne Nygaard . Jonas Mengel-From . Morten Frost . Kaare Christensen . Lene Christiansen . Qihua Tan Received: 15 April 2019 / Accepted: 24 June 2019 / Published online: 28 June 2019 Ó The Author(s) 2019 Abstract Hand grip strength is a measure of mus- significant CpG sites or pathways were found, how- cular strength and is used to study age-related loss of ever two of the suggestive top CpG sites were mapped physical capacity. In order to explore the biological to the COL6A1 and CACNA1B genes, known to be mechanisms that influence hand grip strength varia- related to muscular dysfunction. By investigating tion, an epigenome-wide association study (EWAS) of genomic regions using the comb-p algorithm, several hand grip strength in 672 middle-aged and elderly differentially methylated regions in regulatory monozygotic twins (age 55–90 years) was performed, domains were identified as significantly associated to using both individual and twin pair level analyses, the hand grip strength, and pathway analyses of these latter controlling the influence of genetic variation. regions revealed significant pathways related to the Moreover, as measurements of hand grip strength immune system, autoimmune disorders, including performed over 8 years were available in the elderly diabetes type 1 and viral myocarditis, as well as twins (age 73–90 at intake), a longitudinal EWAS was negative regulation of cell differentiation. -
Dynamic Clonal Progression in Xenografts of Acute Lymphoblastic Leukemia with Intrachromosomal Amplification of Chromosome 21
Sinclair PB, Blair HH, Ryan SL, Buechler L, Cheng J, Clayton J, Hanna R, Hollern S, Hawking Z, Bashton M, Schwab CJ, Jones L, Russell LJ, Marr H, Carey P, Halsey C, Heidenreich O, Moorman AV, Harrison CJ. Dynamic clonal progression in xenografts of acute lymphoblastic leukemia with intrachromosomal amplification of chromosome 21. Haematologica 2018, https://doi.org/10.3324/haematol.2017.172304 Copyright: © 2018, Ferrata Storti Foundation. Authors will grant copyright of their article to the Ferrata Storti Foundation. No formal permission will be required to reproduce parts (tables or illustrations) of published papers, provided the source is quoted appropriately and reproduction has no commercial intent. Reproductions with commercial intent will require written permission and payment of royalties. Please contact the office for requests: [email protected] DOI link to article: https://doi.org/10.3324/haematol.2017.172304 Date deposited: 20/03/2018 This work is licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License Newcastle University ePrints - eprint.ncl.ac.uk Published Ahead of Print on February 15, 2018, as doi:10.3324/haematol.2017.172304. Copyright 2018 Ferrata Storti Foundation. Dynamic clonal progression in xenografts of acute lymphoblastic leukemia with intrachromosomal amplification of chromosome 21 by Paul B. Sinclair, Helen H. Blair, Sarra L. Ryan, Lars Buechler, Joanna Cheng, Jake Clayton, Rebecca Hanna, Shaun Hollern, Zoe Hawking, Matthew Bashton, Claire J. Schwab, Lisa Jones, Lisa J. Russell, Helen Marr, Peter Carey, Christina Halsey, Olaf Heidenreich, Anthony V. Moorman, and Christine J. Harrison Haematologica 2018 [Epub ahead of print] Citation: Paul B. Sinclair, Helen H. -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
Identification of Novel Chemotherapeutic Strategies For
www.nature.com/scientificreports OPEN Identification of novel chemotherapeutic strategies for metastatic uveal melanoma Received: 17 November 2016 Paolo Fagone1, Rosario Caltabiano2, Andrea Russo3, Gabriella Lupo1, Accepted: 09 February 2017 Carmelina Daniela Anfuso1, Maria Sofia Basile1, Antonio Longo3, Ferdinando Nicoletti1, Published: 17 March 2017 Rocco De Pasquale4, Massimo Libra1 & Michele Reibaldi3 Melanoma of the uveal tract accounts for approximately 5% of all melanomas and represents the most common primary intraocular malignancy. Despite improvements in diagnosis and more effective local therapies for primary cancer, the rate of metastatic death has not changed in the past forty years. In the present study, we made use of bioinformatics to analyze the data obtained from three public available microarray datasets on uveal melanoma in an attempt to identify novel putative chemotherapeutic options for the liver metastatic disease. We have first carried out a meta-analysis of publicly available whole-genome datasets, that included data from 132 patients, comparing metastatic vs. non metastatic uveal melanomas, in order to identify the most relevant genes characterizing the spreading of tumor to the liver. Subsequently, the L1000CDS2 web-based utility was used to predict small molecules and drugs targeting the metastatic uveal melanoma gene signature. The most promising drugs were found to be Cinnarizine, an anti-histaminic drug used for motion sickness, Digitoxigenin, a precursor of cardiac glycosides, and Clofazimine, a fat-soluble iminophenazine used in leprosy. In vitro and in vivo validation studies will be needed to confirm the efficacy of these molecules for the prevention and treatment of metastatic uveal melanoma. Uveal melanoma is the most common primary intraocular cancer, and after the skin, the uveal tract is the second most common location for melanoma1. -
Whole-Genome and RNA Sequencing Reveal Variation and Transcriptomic Coordination in the Developing Human Prefrontal Cortex
UCSF UC San Francisco Previously Published Works Title Whole-Genome and RNA Sequencing Reveal Variation and Transcriptomic Coordination in the Developing Human Prefrontal Cortex. Permalink https://escholarship.org/uc/item/8j92s7z1 Journal Cell reports, 31(1) ISSN 2211-1247 Authors Werling, Donna M Pochareddy, Sirisha Choi, Jinmyung et al. Publication Date 2020-04-01 DOI 10.1016/j.celrep.2020.03.053 Peer reviewed eScholarship.org Powered by the California Digital Library University of California HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Cell Rep Manuscript Author . Author manuscript; Manuscript Author available in PMC 2020 June 15. Published in final edited form as: Cell Rep. 2020 April 07; 31(1): 107489. doi:10.1016/j.celrep.2020.03.053. Whole-Genome and RNA Sequencing Reveal Variation and Transcriptomic Coordination in the Developing Human Prefrontal Cortex Donna M. Werling1,2,32, Sirisha Pochareddy3,32, Jinmyung Choi3,32, Joon-Yong An1,4,5,32, Brooke Sheppard1, Minshi Peng6, Zhen Li3,7, Claudia Dastmalchi1, Gabriel Santpere3,8, André M.M. Sousa3, Andrew T.N Tebbenkamp3, Navjot Kaur3, Forrest O. Gulden3, Michael S. Breen9,10,11,12, Lindsay Liang1, Michael C. Gilson1, Xuefang Zhao13,14,15, Shan Dong1, Lambertus Klei16, A. Ercument Cicek17,18, Joseph D. Buxbaum9,10,11,19, Homa Adle- Biassette20, Jean-Leon Thomas21,22, Kimberly A. Aldinger23,24, Diana R. O’Day25, Ian A. Glass25, Noah A. Zaitlen26, Michael E. Talkowski13,14,15, Kathryn Roeder6,18, Matthew W. State1,27, Bernie Devlin16, Stephan J. Sanders1,27,33,*, -
Dissertation
Regulation of gene silencing: From microRNA biogenesis to post-translational modifications of TNRC6 complexes DISSERTATION zur Erlangung des DOKTORGRADES DER NATURWISSENSCHAFTEN (Dr. rer. nat.) der Fakultät Biologie und Vorklinische Medizin der Universität Regensburg vorgelegt von Johannes Danner aus Eggenfelden im Jahr 2017 Das Promotionsgesuch wurde eingereicht am: 12.09.2017 Die Arbeit wurde angeleitet von: Prof. Dr. Gunter Meister Johannes Danner Summary ‘From microRNA biogenesis to post-translational modifications of TNRC6 complexes’ summarizes the two main projects, beginning with the influence of specific RNA binding proteins on miRNA biogenesis processes. The fate of the mature miRNA is determined by the incorporation into Argonaute proteins followed by a complex formation with TNRC6 proteins as core molecules of gene silencing complexes. miRNAs are transcribed as stem-loop structured primary transcripts (pri-miRNA) by Pol II. The further nuclear processing is carried out by the microprocessor complex containing the RNase III enzyme Drosha, which cleaves the pri-miRNA to precursor-miRNA (pre-miRNA). After Exportin-5 mediated transport of the pre-miRNA to the cytoplasm, the RNase III enzyme Dicer cleaves off the terminal loop resulting in a 21-24 nt long double-stranded RNA. One of the strands is incorporated in the RNA-induced silencing complex (RISC), where it directly interacts with a member of the Argonaute protein family. The miRNA guides the mature RISC complex to partially complementary target sites on mRNAs leading to gene silencing. During this process TNRC6 proteins interact with Argonaute and recruit additional factors to mediate translational repression and target mRNA destabilization through deadenylation and decapping leading to mRNA decay. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name oligodendrocytic myelin paranodal and inner loop protein Gene Symbol OPALIN Organism Human Gene Summary Description Not Available Gene Aliases HTMP10, TMEM10, TMP10 RefSeq Accession No. NC_000010.10, NT_030059.13 UniGene ID Hs.12449 Ensembl Gene ID ENSG00000197430 Entrez Gene ID 93377 Assay Information Unique Assay ID qHsaCID0015438 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000371172, ENST00000393871, ENST00000393870, ENST00000419479, ENST00000536387 Amplicon Context Sequence GGGCCTCTTGTGCTCCCATCGTATTCTTCTCATGTGTGGGTGATCTCCTAGGATT CTCAGATATCTTGGGATTGTCATCAATTTCTGAAAT Amplicon Length (bp) 61 Chromosome Location 10:98105820-98108081 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9996 cDNA Cq Target not expressed in universal RNA cDNA Tm (Celsius) Target not expressed in universal RNA gDNA Cq Target not expressed in universal RNA Specificity (%) No cross reactivity detected Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report OPALIN, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. -
Original Article Identification of Differentially Expressed Genes Between Male and Female Patients with Acute Myocardial Infarction Based on Microarray Data
Int J Clin Exp Med 2019;12(3):2456-2467 www.ijcem.com /ISSN:1940-5901/IJCEM0080626 Original Article Identification of differentially expressed genes between male and female patients with acute myocardial infarction based on microarray data Huaqiang Zhou1,2*, Kaibin Yang2*, Shaowei Gao1, Yuanzhe Zhang2, Xiaoyue Wei2, Zeting Qiu1, Si Li2, Qinchang Chen2, Yiyan Song2, Wulin Tan1#, Zhongxing Wang1# 1Department of Anesthesiology, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China; 2Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China. *Equal contributors and co-first au- thors. #Equal contributors. Received May 31, 2018; Accepted August 4, 2018; Epub March 15, 2019; Published March 30, 2019 Abstract: Background: Coronary artery disease has been the most common cause of death and the prognosis still needs further improving. Differences in the incidence and prognosis of male and female patients with coronary artery disease have been observed. We constructed this study hoping to understand those differences at the level of gene expression and to help establish gender-specific therapies. Methods: We downloaded the series matrix file of GSE34198 from the Gene Expression Omnibus database and identified differentially expressed genes between male and female patients. Gene ontology, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analy- sis, and GSEA analysis of differentially expressed genes were performed. The protein-protein interaction network was constructed of the differentially expressed genes and the hub genes were identified. Results: A total of 215 up-regulated genes and 353 down-regulated genes were identified. The differentially expressed pathways were mainly related to the function of ribosomes, virus, and related immune response as well as the cell growth and proliferation. -
Bioinformatics Tools for the Analysis of Gene-Phenotype Relationships Coupled with a Next Generation Chip-Sequencing Data Processing Pipeline
Bioinformatics Tools for the Analysis of Gene-Phenotype Relationships Coupled with a Next Generation ChIP-Sequencing Data Processing Pipeline Erinija Pranckeviciene Thesis submitted to the Faculty of Graduate and Postdoctoral Studies in partial fulfillment of the requirements for the Doctorate in Philosophy degree in Cellular and Molecular Medicine Department of Cellular and Molecular Medicine Faculty of Medicine University of Ottawa c Erinija Pranckeviciene, Ottawa, Canada, 2015 Abstract The rapidly advancing high-throughput and next generation sequencing technologies facilitate deeper insights into the molecular mechanisms underlying the expression of phenotypes in living organisms. Experimental data and scientific publications following this technological advance- ment have rapidly accumulated in public databases. Meaningful analysis of currently avail- able data in genomic databases requires sophisticated computational tools and algorithms, and presents considerable challenges to molecular biologists without specialized training in bioinfor- matics. To study their phenotype of interest molecular biologists must prioritize large lists of poorly characterized genes generated in high-throughput experiments. To date, prioritization tools have primarily been designed to work with phenotypes of human diseases as defined by the genes known to be associated with those diseases. There is therefore a need for more prioritiza- tion tools for phenotypes which are not related with diseases generally or diseases with which no genes have yet been associated in particular. Chromatin immunoprecipitation followed by next generation sequencing (ChIP-Seq) is a method of choice to study the gene regulation processes responsible for the expression of cellular phenotypes. Among publicly available computational pipelines for the processing of ChIP-Seq data, there is a lack of tools for the downstream analysis of composite motifs and preferred binding distances of the DNA binding proteins.