sign in sign up
<<
Home , Desmoplastic fibroma, Exostosis

ANTICANCER RESEARCH 26: 1611-1614 (2006)

Activating Gs · Mutation Rarely Occurs in Musculoskeletal Tumors other than Fibrous Dysplasia

WENGUANG GU1,2, AKIRA OGOSE1, ATSUSHI MATSUBA1, HIROYUKI KAWASHIMA1, TETSUO HOTTA1, NAOKO KUDO1, MAKIKO HOSHINO1, NAOKI KONDO1, HISASHI MERA1 and NAOTO ENDO1

1Division of Orthopedic Surgery, Niigata University Graduate School of Medical and Dental Sciences, Niigata, 951-8510, Japan; 2Department of Orthopedic Surgery, First Clinical College of Harbin Medical University, Harbin, 150001, China

Abstract. Background: Activating Gs · mutations have been instances of FD, namely monostotic, polyostotic and identified in most instances of fibrous dysplasia (FD). This MAS(3, 4). This mutation leads to consistently elevated mutation leads to consistently elevated intracellular cyclic intracellular cyclic adenosine monophosphate (cAMP) adenosine monophosphate (cAMP) levels, with various levels, with various biological consequences (5). Increased biological consequences. The development of secondary production of cAMP in the cells most probably in FD is a rare but well-established phenomenon. induces elevated C-fos expression (6). C-fos plays an This finding raised the possibility that a common gene important role in the control of bone cell proliferation and mutation exists in these tumors. Materials and Methods: The differentiation and in the development of bone tumors. expression of the Gs · mutation was examined in 16 cell lines Elevated levels of C-fos have been documented not only in and 173 musculoskeletal tumor tissues, including 13 cases of FD (7), but also in other musculoskeletal lesions (8-12). FD, via RT-PCR and sequence analysis. Results: No The development of secondary sarcoma in FD is a rare expression of a Gs · mutation was detected in any cell line or but well-established phenomenon. The sarcoma types that clinical tissue sample, excluding FD tissues. Direct sequence complicate fibrous dysplasia are most frequently malignant analysis demonstrated results identical to those of RT-PCR. fibrous or of high histological Conclusion: Activating Gs · mutation rarely occurs in grade (13). Chondrosarcoma and other malignant lesions musculoskeletal tumors other than FD. The occurrence of that develop in association with FD have also been reported most displays no correlation with Gs · mutations. (14-17). The relationship between FD and other musculoskeletal tumors remains unclear. C-fos was Fibrous dysplasia (FD) is a common benign expressed in FD as well as in some musculoskeletal tumors; characterized by focal proliferation of fibrous tissue in the consequently, this finding raised the possibility that a bone marrow, which leads to osteolytic lesion, deformity common gene mutation exists in these tumors. and fractures (1). This lesion occurs in 3 forms: monostotic, Although Gs · mutations in cases of FD have been polyostotic and McCune-Albright syndrome (MAS) (2). investigated, such mutations in other musculoskeletal Histologically, FD exhibits thin, curved trabeculae of bone tumors have not been evaluated thoroughly. The present and cellular proliferation of fibroblast-like cells. Activating study examined the expression of the Gs · mutation in 16 point mutations of the G protein (guanine nucleotide; cell lines and 173 musculoskeletal tumor tissues, including binding protein) · subunits (Gs ·) at the Arg 201 codon by 13 cases of FD. either cysteine (C-to-T, Arg-to-Cys, R201C) or histidine (G- to-A, Arg-to-His, R201H) have been identified in most Materials and Methods

Cell lines and tissue samples. The cell lines employed in this investigation are listed in Table I. NOS-2, NOS-1, NMS-2, NRS, Correspondence to: Dr. Akira Ogose, Division of Orthopedic Surgery, NMFH-1, NY, OST and NMS-7 were established in our laboratory. Niigata University Graduate School of Medical and Dental Sciences, The remaining cell lines were as follows: U2OS, SaOS2 and 1-757 Asahimachi-Dori, Niigata, 951-8510 Japan. Tel: +81-25-227- SKNMC (American Type Culture Collection, Bethesda, MD, 2272, Fax: +81-25-227-0782, e-mail: [email protected] USA); HuO9 (Japanese Cancer Research Resources Bank, Tokyo, Japan); MG63 and HT-1080 (Health Science Research Resources Key Words: Mesenchymal tumor, fibrous dysplasia, Gs · mutation, Bank, Osaka, Japan); 402-92 (Dr. P. Åringman, Department of gene expression. Clinical Genetics, University Hospital, Lund, Sweden); HS-SY-2

0250-7005/2006 $2.00+.40 1611 ANTICANCER RESEARCH 26: 1611-1614 (2006)

Table I. Human cell lines employed in this study. Table II. List of tissue samples employed in this study.

Cell lines Tissue derived from Source Diseases Case number

NOS-1 Osteosarcoma Niigata University osteosarcoma (low-grade osteosarcoma) 34 (3) HuO9 Osteosarcoma JCRRB MFH 20 SaOS2 Osteosarcoma ATCC schwannoma 15 U2OS Osteosarcoma ATCC FD 13 NY Osteosarcoma JCRRB myxoid 11 NOS-2 Osteosarcoma Niigata University chondrosarcoma 8 OST Osteosarcoma RIKEN 8 MG63 Osteosarcoma HSRRB 7 HT-1080 Fibrosarcoma HSRRB GCT 6 NRS Alveolar Niigata University Ewing sarcoma 5 NMFH-1 Malignant fibrous histiocytoma Niigata University MPNST 5 OUMS-27 Chondrosarcoma M. Namba 5 402-92 Liposarcoma P. Åman ASPS 4 SKNMC Primitive neuroectodermal tumor ATCC hemangioma 4 NMS-7 Malignant peripheral Niigata University chordoma 3 nerve sheath tumor desmoid 3 NMS-2 Malignant peripheral Niigata University exostosis 3 nerve sheath tumor lymphoma 3 FB Fibroblast Niigata University neurofibroma 3 chondroblastoma 2 ATCC, American Type Culture Collection; JCRRB, Japanese Cancer enchondroma 2 Research Resources Bank; HSRRB, Health Science Research rhabdomyosarcoma 2 Resources Bank; RIKEN; RIKEN Cell Bank. DFSP 1 epithelioid sarcoma 1 1 hemangiosarcoma 1 (Dr. H. Sonobe, Department of Pathology, Kochi Medical School, 1 Kochi, Japan); OUMS-27 (Dr. M. Namba, Department of Cell phosphatric mesenchymal tumor 1 Biology, Okayama University Medical School, Okayama, Japan); pleomorphic sarcoma 1 and HeLa (RIKEN Cell Bank, Tsukuba, Japan). NOS-2, NOS-1, SaOS2, HuO9, 402-92, HS-SY-2, NMS-2, NRS, NMFH-1, NY, Total 173 OST, NMS-7 and fibroblast cells were cultured in RPMI 1640 medium supplemented with 10% FBS. The U2OS and OUMS-27 MFH, malignant fibrous histiocytoma; FD, fibrous dysplasia; GCT, cells were cultured in Dulbecco's modified Eagle's medium giant cell tumor; MPNST, malignant peripheral nerve sheath tumor; containing 10% FBS. The MG63, SKNMC and HT-1080 cells were ASPS, alveolar soft part sarcoma; DFSP, dermatofibrosarcoma. cultured in the a-modification of Eagle's minimal essential medium supplemented with 10% FBS. The cultures were incubated at 37ÆC in an atmosphere of 5% CO2 in air at 100% humidity and were fed every 2 days. of denaturation for 30 sec at 94ÆC, annealing for 30 sec at 55ÆC, Samples of musculoskeletal tumor tissues were obtained from extension for 60 sec at 72ÆC and a final extension for 5 min at 72ÆC. 173 patients (98 men and 75 women) during surgical treatment A PCR control was conducted in parallel with primers that amplify (Table II). The mean patient age was 41.5±20.1 years (range, 1 to a 983-bp fragment of the G3PDH housekeeping gene (G3PDH-F: 76 years). Each tissue specimen was partitioned into 2 portions; one 5’- GAAGGTCGGAGTCAACGGATTTGGT3’; G3PDH-R: sample was frozen immediately in liquid nitrogen at the time of 5’-CATGTGGGCCATGAGGTCCACCAC3’) in order to verify surgery and stored at –80ÆC until RNA extraction was performed. that similar amounts of cDNA were provided in each preparation. The remaining sample was processed for pathological examination. The PCR products were analyzed by electrophoresis on a 1.5% agarose gel containing ethidium bromide and photographed under RT-PCR analysis. Following extraction from the culture cells and UV-light. clinical tissue samples, the total RNA was converted to cDNA as previously described (18). For RT-PCR, 1/20 of the cDNA was DNA sequencing analysis. Genomic DNA was extracted with a utilized for amplification of the Gs · mutations at the Arg 201 Wizard Genomic DNA Purification Kit (Promega Corporation, codon. The following primers were employed, as described Madison, WI, USA) according to the manufacturer’s instructions. previously (19): wild-type forward, 5’-GACCTGCTTCG CTGGCG- The extracted genomic DNA was stored at 4ÆC. In order to 3’; R201C forward, 5’-CAGGACCTGCTTCGCTCCT-3’; R201H examine the described Arg-to-Cys and Arg-to-His mutations, direct forward, 5’-GGACCTGCTTCGCTGGCA-3’. One single reverse sequencing analysis was conducted involving dideoxy chain primer was used in all reactions. The length of the expected termination methods, employing an ABI Prism 310 genetic products was 300 bp. The PCR protocol consisted of an initial analyzer and the Big Dye Terminator cycle sequencing ready denaturation step extending for 5 min at 94ÆC, followed by 30 cycles reaction kit (Perkin Elmer, Foster City, CA, USA).

1612 Gu et al: Gs · Mutation Rarely Occurs in Musculoskeletal Tumors

Figure 1. Expression of Gs · mutations in tissue samples. Gs · mutations were detected in Cases 1 and 2 (fibrous dysplasia), but not in Case 3 (osteosarcoma), Case 4 (malignant fibrous histiocytoma) and Case 5 (schwannoma). Wild, wild-type; R201C, Arg-to-Cys; R201H, Arg-to-His.

Results In addition to the clinical and pathological differences, the presence or absence of Gs · mutations would appear to Detection of Gs · mutations at the Arg 201 codon was suggest that FD is distinct from other musculoskeletal performed in these cell lines with RT-PCR. However, no tumors; that is, different molecular pathobiologies may exist expression of a Gs · mutation was detected in any cell line among these tumors. However, some malignant lesions (data not shown). Direct sequence analysis demonstrated associated with FD may be obviously similar to FD in terms results identical to those obtained by RT-PCR. Furthermore, of histology, leading to diagnostic problems (27-29). One of in order to identify the expression of a Gs · mutation in the most important differential diagnoses of FD is low- clinical tissue samples, the expression was examined in 173 grade osteosarcoma, which was first described as a distinct musculoskeletal tumor tissues, including 13 cases of FD clinicopathological entity in 1977 (30). Histologically, low- (Figure 1). In a manner consistent with the results obtained grade osteosarcoma consists of spindle cells displaying little from the cell lines, the expression of Gs · mutation was cytological atypia. Mitotic figures are uncommon; moreover, detected only in tissues. Of the 13 FD lesions, 12 cases the cells are arranged in an interfacing pattern. The matrix expressed a Gs · mutation (Arg-to-Cys, R201C: 7 cases; Arg- frequently forms in the pattern of regular bony trabeculae, to-His, R201H: 5 cases); in contrast, only one case exhibited which simulates parosteal osteosarcoma. no mutation. Approximately 50% of low-grade are richly fibroblastic and histologically resemble or mimic FD (31). The Discussion differential diagnosis can be difficult or even impossible in a tiny biopsy specimen (27). On occasion, only the clinical In the present study, RT-PCR was utilized to identify Gs · course can reveal the true nature of the lesion. Our findings mutations at the Arg 201 codon in FD. Twelve out of 13 demonstrated no Gs · mutation in any of the 3 cases involving cases were positive. Subsequent DNA sequencing analysis this tumor in contrast to FD. Pollandt et al. (25) also reported revealed the occurrence of Gs · mutations at the Arg 201 a low prevalence of Gs · mutation in low-grade osteosarcoma. codon. Various techniques have been applied for detection These results suggest that detection of Gs · mutations by RT- of Gs · mutations (20-23). Our findings suggested that PCR appears to be a suitable method to distinguish FD from RT-PCR analysis is a suitable method for the detection of low-grade osteosarcoma and other musculoskeletal tumors. these mutations in the absence of radioactive materials or In conclusion, activating Gs · mutations at the Arg 201 antibodies. codon rarely occur in musculoskeletal tumors other than Sequentially, we investigated the expression of the Gs · FD. The occurrence of most sarcomas displays no mutation in 16 cell lines and 160 musculoskeletal tumor correlation with Gs · mutations. RT-PCR analysis can be tissues and found that Gs · mutations were not expressed applied for the detection of this mutation in the absence of in any tested sample. Okamoto et al. (24) also examined radioactive materials or antibodies. The detection of Gs · myxoid tumors and showed that no tumors mutations via RT-PCR is a suitable approach to distinguish expressed a Gs · mutation, with the exception of FD from other musculoskeletal tumors. intramuscular . Previous reports had indicated that Gs · mutations are rarely observed in bone or soft Acknowledgements tissue tumors (25, 26). These findings suggest that the occurrence of most sarcomas lacks correlation with Gs · This study was supported in part by the Niigata Orthopedic mutations. International Exchange Fund, Japan.

1613 ANTICANCER RESEARCH 26: 1611-1614 (2006)

References N: High-level expression of the coxsackievirus and adenovirus receptor messenger RNA in osteosarcoma, Ewing's sarcoma, 1 Lichtenstein L and Jaffe H: Fibrous dysplasia of bone. Arch and benign neurogenic tumors among musculoskeletal tumors. Pathol 33: 777-816, 1942. Clin Cancer Res 10: 3831-3838, 2004. 2 Albright F, Butler A, Hampton A and Smith P: Syndrome 19 Riminucci M, Liu B, Corsi A, Shenker A, Spiegel AM, Robey characterized by fibrosa disseminata, areas of PG and Bianco P: The histopathology of fibrous dysplasia of pigmentation and endocrine dysfunction, with precocious bone in patients with activating mutations of the Gs alpha gene: puberty in females. N Engl J Med 216: 727-746, 1937. site-specific patterns and recurrent histological hallmarks. J 3 Alman BA, Greel DA and Wolfe HJ: Activating mutations of Pathol 187: 249-258, 1999. Gs protein in monostotic fibrous lesions of bone. J Orthop Res 20 Hannon TS, Noonan K, Steinmetz R, Eugster EA, Levine MA 14: 311-315, 1996. and Pescovitz OH: Is McCune-Albright syndrome overlooked 4 Shenker A, Weinstein LS, Sweet DE and Spiegel AM: An in subjects with fibrous dysplasia of bone? J Pediatr 142: 532- activating Gs alpha mutation is present in fibrous dysplasia of 538, 2003. bone in the McCune-Albright syndrome. J Clin Endocrinol 21 Matsuba A, Ogose A, Tokunaga K, Kawashima H, Hotta T, Metab 79: 750-755, 1994. Urakawa S, Umezu H, Higuchi T and Endo N: Activating Gs 5 Marie PJ, de Pollak C, Chanson P and Lomri A: Increased alpha mutation at the Arg201 codon in liposclerosing proliferation of osteoblastic cells expressing the activating Gs myxofibrous tumor. Hum Pathol 34: 1204-1209, 2003. alpha mutation in monostotic and polyostotic fibrous dysplasia. 22 Pinducciu C, Borgonovo G, Arezzo A, Torre GC, Giordano G Am J Pathol 150: 1059-1069, 1997. and Cordera R: Toxic thyroid adenoma: absence of DNA 6 Gaiddon C, Boutillier AL, Monnier D, Mercken L and Loeffler mutations of the TSH receptor and Gs alpha. Eur J Endocrinol JP: Genomic effects of the putative oncogene G alpha s. 138: 37-40, 1998. Chronic transcriptional activation of the c-fos proto-oncogene 23 Riminucci M, Fisher LW, Shenker A, Spiegel AM, Bianco P in endocrine cells. J Biol Chem 269: 22663-22671, 1994. and Gehron RP: Fibrous dysplasia of bone in the McCune- 7 Candeliere GA, Glorieux FH, Prud'homme J and St-Arnaud Albright syndrome: abnormalities in bone formation. Am J R: Increased expression of the c-fos proto-oncogene in bone Pathol 151: 1587-1600, 1997. from patients with fibrous dysplasia. N Engl J Med 332: 1546- 24 Okamoto S, Hisaoka M, Ushijima M, Nakahara S, Toyoshima S 1551, 1995. and Hashimoto H: Activating Gs(alpha) mutation in 8 Franchi A, Calzolari A and Zampi G: Immunohistochemical intramuscular myxomas with and without fibrous dysplasia of detection of c-fos and c-jun expression in osseous and bone. Virchows Arch 437: 133-137, 2000. cartilaginous tumours of the skeleton. Virchows Arch 432: 515- 25 Pollandt K, Engels C, Kaiser E, Werner M and Delling G: Gs 519, 1998. alpha gene mutations in monostotic fibrous dysplasia of bone 9 Gamberi G, Benassi MS, Bohling T, Ragazzini P, Molendini L, and fibrous dysplasia-like low-grade central osteosarcoma. Sollazzo MR, Pompetti F, Merli M, Magagnoli G, Balladelli A Virchows Arch 439: 170-175, 2001. and Picci P: C-myc and c-fos in human osteosarcoma: 26 Sakamoto A, Oda Y, Iwamoto Y and Tsuneyoshi M: A prognostic value of mRNA and protein expression. comparative study of fibrous dysplasia and osteofibrous 55: 556-563, 1998. dysplasia with regard to Gs alpha mutation at the Arg201 10 Wang ZQ, Grigoriadis AE and Wagner EF: Stable murine codon: polymerase chain reaction-restriction fragment length chondrogenic cell lines derived from c-fos-induced cartilage polymorphism analysis of paraffin-embedded tissues. J Mol tumors. J Bone Miner Res 8: 839-847, 1993. Diagn 2: 67-72, 2000. 11 Weisstein JS, Majeska RJ, Klein MJ and Einhorn TA: 27 Bertoni F, Bacchini P, Fabbri N, Mercuri M, Picci P, Ruggieri Detection of c-fos expression in benign and malignant P and Campanacci M: Osteosarcoma. Low-grade intraosseous- musculoskeletal lesions. J Orthop Res 19: 339-345, 2001. type osteosarcoma, histologically resembling parosteal 12 Zhu JD, Pan HO, Suzuki F and Takigawa M: Proto-oncogene osteosarcoma, fibrous dysplasia, and desmoplastic fibroma. expression in a human chondrosarcoma cell line: HCS-2/8. Jpn Cancer 71: 338-345, 1993. J Cancer Res 85: 364-371, 1994. 28 Bertoni F, Fernando Arias L, Alberghini M and Bacchini P: 13 Dorfman HD and Czerniak B: Bone Tumors, 1st edition. Fibrous dysplasia with degenerative atypia: a benign lesion Mosby, St.Louis, pp. 469, 1997. potentially mistaken for sarcoma. Arch Pathol Lab Med 128: 14 Blackwell JB: Mesenchymal chondrosarcoma arising in fibrous 794-796, 2004. dysplasia of the femur. J Clin Pathol 46: 961-962, 1993. 29 Kurt AM, Unni KK, McLeod RA and Pritchard DJ: Low-grade 15 Eguchi K, Ishi S, Sugiura H and Noga K: Angiosarcoma of the intraosseous osteosarcoma. Cancer 65: 1418-1428, 1990. chest wall in a patient with fibrous dysplasia. Eur J 30 Unni KK, Dahlin DC, McLeod RA and Pritchard DJ: Cardiothorac Surg 22: 654-655, 2002. Intraosseous well-differentiated osteosarcoma. Cancer 40: 1337- 16 Halawa M and Aziz AA: Chondrosarcoma in fibrous dysplasia 1347, 1977. of the pelvis. A case report and review of the literature. J Bone 31 Dwinnell LA, Dahlin DC and Ghormley RK: Parosteal Joint Surg Br 66: 760-764, 1984. (juxtacortical) osteogenic sarcoma. J Bone Joint Surg Am 36- 17 Ruggieri P, Sim FH, Bond JR and Unni KK: Malignancies in A: 732-744, 1954. fibrous dysplasia. Cancer 73: 1411-1424, 1994. 18 Gu W, Ogose A, Kawashima H, Ito M, Ito T, Matsuba A, Kitahara H, Hotta T, Tokunaga K, Hatano H, Morita T, Received January 23, 2006 Urakawa S, Yoshizawa T, Kawashima H, Kuwano R and Endo Accepted February 27, 2006

1614