DOCSLIB.ORG

Mutation Rarely Occurs in Musculoskeletal Tumors Other Than Fibrous Dysplasia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mutation Rarely Occurs in Musculoskeletal Tumors Other Than Fibrous Dysplasia ANTICANCER RESEARCH 26: 1611-1614 (2006) Activating Gs · Mutation Rarely Occurs in Musculoskeletal Tumors other than Fibrous Dysplasia WENGUANG GU1,2, AKIRA OGOSE1, ATSUSHI MATSUBA1, HIROYUKI KAWASHIMA1, TETSUO HOTTA1, NAOKO KUDO1, MAKIKO HOSHINO1, NAOKI KONDO1, HISASHI MERA1 and NAOTO ENDO1 1Division of Orthopedic Surgery, Niigata University Graduate School of Medical and Dental Sciences, Niigata, 951-8510, Japan; 2Department of Orthopedic Surgery, First Clinical College of Harbin Medical University, Harbin, 150001, China Abstract. Background: Activating Gs · mutations have been instances of FD, namely monostotic, polyostotic and identified in most instances of fibrous dysplasia (FD). This MAS(3, 4). This mutation leads to consistently elevated mutation leads to consistently elevated intracellular cyclic intracellular cyclic adenosine monophosphate (cAMP) adenosine monophosphate (cAMP) levels, with various levels, with various biological consequences (5). Increased biological consequences. The development of secondary production of cAMP in the bone cells most probably sarcoma in FD is a rare but well-established phenomenon. induces elevated C-fos expression (6). C-fos plays an This finding raised the possibility that a common gene important role in the control of bone cell proliferation and mutation exists in these tumors. Materials and Methods: The differentiation and in the development of bone tumors. expression of the Gs · mutation was examined in 16 cell lines Elevated levels of C-fos have been documented not only in and 173 musculoskeletal tumor tissues, including 13 cases of FD (7), but also in other musculoskeletal lesions (8-12). FD, via RT-PCR and sequence analysis. Results: No The development of secondary sarcoma in FD is a rare expression of a Gs · mutation was detected in any cell line or but well-established phenomenon. The sarcoma types that clinical tissue sample, excluding FD tissues. Direct sequence complicate fibrous dysplasia are most frequently malignant analysis demonstrated results identical to those of RT-PCR. fibrous histiocytoma or osteosarcoma of high histological Conclusion: Activating Gs · mutation rarely occurs in grade (13). Chondrosarcoma and other malignant lesions musculoskeletal tumors other than FD. The occurrence of that develop in association with FD have also been reported most sarcomas displays no correlation with Gs · mutations. (14-17). The relationship between FD and other musculoskeletal tumors remains unclear. C-fos was Fibrous dysplasia (FD) is a common benign bone disease expressed in FD as well as in some musculoskeletal tumors; characterized by focal proliferation of fibrous tissue in the consequently, this finding raised the possibility that a bone marrow, which leads to osteolytic lesion, deformity common gene mutation exists in these tumors. and fractures (1). This lesion occurs in 3 forms: monostotic, Although Gs · mutations in cases of FD have been polyostotic and McCune-Albright syndrome (MAS) (2). investigated, such mutations in other musculoskeletal Histologically, FD exhibits thin, curved trabeculae of bone tumors have not been evaluated thoroughly. The present and cellular proliferation of fibroblast-like cells. Activating study examined the expression of the Gs · mutation in 16 point mutations of the G protein (guanine nucleotide; cell lines and 173 musculoskeletal tumor tissues, including binding protein) · subunits (Gs ·) at the Arg 201 codon by 13 cases of FD. either cysteine (C-to-T, Arg-to-Cys, R201C) or histidine (G- to-A, Arg-to-His, R201H) have been identified in most Materials and Methods Cell lines and tissue samples. The cell lines employed in this investigation are listed in Table I. NOS-2, NOS-1, NMS-2, NRS, Correspondence to: Dr. Akira Ogose, Division of Orthopedic Surgery, NMFH-1, NY, OST and NMS-7 were established in our laboratory. Niigata University Graduate School of Medical and Dental Sciences, The remaining cell lines were as follows: U2OS, SaOS2 and 1-757 Asahimachi-Dori, Niigata, 951-8510 Japan. Tel: +81-25-227- SKNMC (American Type Culture Collection, Bethesda, MD, 2272, Fax: +81-25-227-0782, e-mail: [email protected] USA); HuO9 (Japanese Cancer Research Resources Bank, Tokyo, Japan); MG63 and HT-1080 (Health Science Research Resources Key Words: Mesenchymal tumor, fibrous dysplasia, Gs · mutation, Bank, Osaka, Japan); 402-92 (Dr. P. Åringman, Department of gene expression. Clinical Genetics, University Hospital, Lund, Sweden); HS-SY-2 0250-7005/2006 $2.00+.40 1611 ANTICANCER RESEARCH 26: 1611-1614 (2006) Table I. Human cell lines employed in this study. Table II. List of tissue samples employed in this study. Cell lines Tissue derived from Source Diseases Case number NOS-1 Osteosarcoma Niigata University osteosarcoma (low-grade osteosarcoma) 34 (3) HuO9 Osteosarcoma JCRRB MFH 20 SaOS2 Osteosarcoma ATCC schwannoma 15 U2OS Osteosarcoma ATCC FD 13 NY Osteosarcoma JCRRB liposarcoma myxoid 11 NOS-2 Osteosarcoma Niigata University chondrosarcoma 8 OST Osteosarcoma RIKEN lipoma 8 MG63 Osteosarcoma HSRRB fibrosarcoma 7 HT-1080 Fibrosarcoma HSRRB GCT 6 NRS Alveolar rhabdomyosarcoma Niigata University Ewing sarcoma 5 NMFH-1 Malignant fibrous histiocytoma Niigata University MPNST 5 OUMS-27 Chondrosarcoma M. Namba synovial sarcoma 5 402-92 Liposarcoma P. Åman ASPS 4 SKNMC Primitive neuroectodermal tumor ATCC hemangioma 4 NMS-7 Malignant peripheral Niigata University chordoma 3 nerve sheath tumor desmoid 3 NMS-2 Malignant peripheral Niigata University exostosis 3 nerve sheath tumor lymphoma 3 FB Fibroblast Niigata University neurofibroma 3 chondroblastoma 2 ATCC, American Type Culture Collection; JCRRB, Japanese Cancer enchondroma 2 Research Resources Bank; HSRRB, Health Science Research rhabdomyosarcoma 2 Resources Bank; RIKEN; RIKEN Cell Bank. DFSP 1 epithelioid sarcoma 1 fibroma 1 hemangiosarcoma 1 (Dr. H. Sonobe, Department of Pathology, Kochi Medical School, leiomyosarcoma 1 Kochi, Japan); OUMS-27 (Dr. M. Namba, Department of Cell phosphatric mesenchymal tumor 1 Biology, Okayama University Medical School, Okayama, Japan); pleomorphic sarcoma 1 and HeLa (RIKEN Cell Bank, Tsukuba, Japan). NOS-2, NOS-1, SaOS2, HuO9, 402-92, HS-SY-2, NMS-2, NRS, NMFH-1, NY, Total 173 OST, NMS-7 and fibroblast cells were cultured in RPMI 1640 medium supplemented with 10% FBS. The U2OS and OUMS-27 MFH, malignant fibrous histiocytoma; FD, fibrous dysplasia; GCT, cells were cultured in Dulbecco's modified Eagle's medium giant cell tumor; MPNST, malignant peripheral nerve sheath tumor; containing 10% FBS. The MG63, SKNMC and HT-1080 cells were ASPS, alveolar soft part sarcoma; DFSP, dermatofibrosarcoma. cultured in the a-modification of Eagle's minimal essential medium supplemented with 10% FBS. The cultures were incubated at 37ÆC in an atmosphere of 5% CO2 in air at 100% humidity and were fed every 2 days. of denaturation for 30 sec at 94ÆC, annealing for 30 sec at 55ÆC, Samples of musculoskeletal tumor tissues were obtained from extension for 60 sec at 72ÆC and a final extension for 5 min at 72ÆC. 173 patients (98 men and 75 women) during surgical treatment A PCR control was conducted in parallel with primers that amplify (Table II). The mean patient age was 41.5±20.1 years (range, 1 to a 983-bp fragment of the G3PDH housekeeping gene (G3PDH-F: 76 years). Each tissue specimen was partitioned into 2 portions; one 5’- GAAGGTCGGAGTCAACGGATTTGGT3’; G3PDH-R: sample was frozen immediately in liquid nitrogen at the time of 5’-CATGTGGGCCATGAGGTCCACCAC3’) in order to verify surgery and stored at –80ÆC until RNA extraction was performed. that similar amounts of cDNA were provided in each preparation. The remaining sample was processed for pathological examination. The PCR products were analyzed by electrophoresis on a 1.5% agarose gel containing ethidium bromide and photographed under RT-PCR analysis. Following extraction from the culture cells and UV-light. clinical tissue samples, the total RNA was converted to cDNA as previously described (18). For RT-PCR, 1/20 of the cDNA was DNA sequencing analysis. Genomic DNA was extracted with a utilized for amplification of the Gs · mutations at the Arg 201 Wizard Genomic DNA Purification Kit (Promega Corporation, codon. The following primers were employed, as described Madison, WI, USA) according to the manufacturer’s instructions. previously (19): wild-type forward, 5’-GACCTGCTTCG CTGGCG- The extracted genomic DNA was stored at 4ÆC. In order to 3’; R201C forward, 5’-CAGGACCTGCTTCGCTCCT-3’; R201H examine the described Arg-to-Cys and Arg-to-His mutations, direct forward, 5’-GGACCTGCTTCGCTGGCA-3’. One single reverse sequencing analysis was conducted involving dideoxy chain primer was used in all reactions. The length of the expected termination methods, employing an ABI Prism 310 genetic products was 300 bp. The PCR protocol consisted of an initial analyzer and the Big Dye Terminator cycle sequencing ready denaturation step extending for 5 min at 94ÆC, followed by 30 cycles reaction kit (Perkin Elmer, Foster City, CA, USA). 1612 Gu et al: Gs · Mutation Rarely Occurs in Musculoskeletal Tumors Figure 1. Expression of Gs · mutations in tissue samples. Gs · mutations were detected in Cases 1 and 2 (fibrous dysplasia), but not in Case 3 (osteosarcoma), Case 4 (malignant fibrous histiocytoma) and Case 5 (schwannoma). Wild, wild-type; R201C, Arg-to-Cys; R201H, Arg-to-His. Results In addition to the clinical and pathological differences, the presence or absence of Gs · mutations would appear to Detection of Gs · mutations at the Arg
Load more

Recommended publications
  • A Rare Bone Tumor
    OPEN ACCESS L E T T E R T O T H E E D I T O R Periosteal Desmoplastic Fibroma of Radius: A Rare Bone Tumor Aniqua Saleem1,* Hira Saleem2 1 Radiology Department, District Head Quarters Hospital, Rawalpindi Medical University, Rawalpindi 2 Department of Surgery, Shifa International Hospital, Islamabad. Correspondence*: Dr. Aniqua Saleem, Radiology Department, District Head Quarters Hospital, Rawalpindi Medical University, Rawalpindi E-mail: [email protected] © 2019, Saleem et al, Submitted: 05-04-2019 Accepted: 09-06-2019 Conflict of Interest: None Source of Support: Nil This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. DEAR SIR Desmoplastic fibroma is an extremely rare tumor of enhancement on post contrast images and with adjacent bone with a reported incidence of 0.11 % of all primary bone involvement as was evident by focal cortical inter- bone tumors. The most common site of involvement is ruption, mild endosteal thickening and irregularity and mandible (reported incidence 22% of all Desmoplastic also mild ulnar shaft remodeling (Fig. 3a, 3b). To further fibroma cases) followed by metaphysis of long bones. characterize the lesion, Tc99 MDP (methylene diphos- Involvement of forearm especially involving periosteum phonate) bone scan was also performed which showed is seldom reported. Prompt diagnosis and adequate active bone involvement in left distal radial shaft. management is important for limb salvage and restora- tion of limb function. [1-3] An 11-year-old boy presented with painful mild swelling of left forearm for a month, with no significant past med- ical history or any history of trauma.
    [Show full text]
  • Immunopathologic Studies in Relapsing Polychondritis
    Immunopathologic Studies in Relapsing Polychondritis Jerome H. Herman, Marie V. Dennis J Clin Invest. 1973;52(3):549-558. https://doi.org/10.1172/JCI107215. Research Article Serial studies have been performed on three patients with relapsing polychondritis in an attempt to define a potential immunopathologic role for degradation constituents of cartilage in the causation and/or perpetuation of the inflammation observed. Crude proteoglycan preparations derived by disruptive and differential centrifugation techniques from human costal cartilage, intact chondrocytes grown as monolayers, their homogenates and products of synthesis provided antigenic material for investigation. Circulating antibody to such antigens could not be detected by immunodiffusion, hemagglutination, immunofluorescence or complement mediated chondrocyte cytotoxicity as assessed by 51Cr release. Similarly, radiolabeled incorporation studies attempting to detect de novo synthesis of such antibody by circulating peripheral blood lymphocytes as assessed by radioimmunodiffusion, immune absorption to neuraminidase treated and untreated chondrocytes and immune coprecipitation were negative. Delayed hypersensitivity to cartilage constituents was studied by peripheral lymphocyte transformation employing [3H]thymidine incorporation and the release of macrophage aggregation factor. Positive results were obtained which correlated with periods of overt disease activity. Similar results were observed in patients with classical rheumatoid arthritis manifesting destructive articular changes. This study suggests that cartilage antigenic components may facilitate perpetuation of cartilage inflammation by cellular immune mechanisms. Find the latest version: https://jci.me/107215/pdf Immunopathologic Studies in Relapsing Polychondritis JERoME H. HERmAN and MARIE V. DENNIS From the Division of Immunology, Department of Internal Medicine, University of Cincinnati Medical Center, Cincinnati, Ohio 45229 A B S T R A C T Serial studies have been performed on as hematologic and serologic disturbances.
    [Show full text]
  • Desmoplastic Fibroma
    Send Orders of Reprints at [email protected] 40 The Open Orthopaedics Journal, 2013, 7, 40-46 Open Access Desmoplastic Fibroma: A Case Report with Three Years of Clinical and Radiographic Observation and Review of the Literature Alexander Nedopil*, Peter Raab and Maximilian Rudert Department of Orthopaedic Surgery at the University of Würzburg, König Ludwig Haus, Germany Abstract: Background: Desmoplastic fibroma (DF) is an extremely rare locally aggressive bone tumor with an incidence of 0.11% of all primary bone tumors. The typical clinical presentation is pain and swelling above the affected area. The most common sites of involvement are the mandible and the metaphysis of long bones. Histologically and biologically, desmoplastic fibroma mimics extra-abdominal desmoid tumor of soft tissue. Case Presentation and Literature Review: A case of a 27-year old man with DF in the ilium, including the clinical, radiological and histological findings over a 4-year period is presented here. CT scans performed in 3-year intervals prior to surgical intervention were compared with respect to tumor extension and cortical breakthrough. The patient was treated with curettage and grafting based on anatomical considerations. Follow-up CT scans over 18-months are also documented here. Additionally, a review and analysis of 271 cases including the presented case with particular emphasis on imaging patterns in MRI and CT as well as treatment modalities and outcomes are presented. Conclusion: In patients with desmoplastic fibroma, CT is the preferred imaging technique for both the diagnosis of intraosseus tumor extension and assessment of cortical involvement, whereas MRI is favored for the assessment of extraosseus tumor growth and preoperative planning.
    [Show full text]
  • The New EU Agenda on Cancer and the Role of the European Reference Network EURACAN Jean Yves Blay
    14 1 2021 The new EU Agenda on Cancer and the role of the European Reference Network EURACAN J-Y Blay Rare Adult Solid Cancers Co-funded by the EU Connective tissue Female genital organs and placenta Male genital organs, and of the urinary tract Neuroendocrine system Digestive tract Endocrine organs Head and neck Thorax Skin and eye melanoma Brain, spinal cords Geographical spreading of the Consortium all over Europe. 2017 66 full members accross 17 Member states Cyprus 2020 9 APS accross 7 Member States 2021 42 new members EURACAN - Lyon_Centre Léon Bérard November 2020 ASSOCIATE PARTNERS EURACAN - Lyon_Centre Léon Bérard November 2020 AFFILIATED PARTNERS Associated National Centres approved National Coordination hub approved Austria • Centre for bone and soft tissue tumors – Graz Luxembourg -Hospital Centre Croatia Malta - Mater dei Hospital - • University Hospital centre - Zagreb • Sestre University Hospital centre - Zagreb Cyprus • Bank of Cyprus oncology centre in collaboration with the Karaiskakio Foundation Estonia • North Estonia Medical Centre • University Hospital - Taru Latvia • East clinical University Hospital - Riga Member state Town Candidate Name DOMAIN(S) APPROVED BY THE BoN code G1.1 G2.2 G5.2 G9.1 G10 Brussels Cliniques universitaires Saint-Luc ASBL BE G1 G2.2 G3.1 G6.1 G9.2 Ghent Ghent University Hospital Prague Thomayer Hospital G3.1 CZ G2.1 Prague The institute for the Care of Mother and Child Berlin Helios Klinikum Berlin-Buch G1.1 G1.2 DE G1.1 G1.2 G2.1 G2.2 G3.1 G4 G5.1 G5.2 Munich Comprehensive Cancer Center
    [Show full text]
  • Low‑Grade Myofibroblastic Sarcoma Arising in the Tip of the Tongue with Intravascular Invasion: a Case Report
    ONCOLOGY LETTERS 16: 3889-3894, 2018 Low‑grade myofibroblastic sarcoma arising in the tip of the tongue with intravascular invasion: A case report YURIE MIKAMI1,2, SHINSUKE FUJII1, KEN‑ICHI KOHASHI3, YUICHI YAMADA3, MASAFUMI MORIYAMA2, SHINTARO KAWANO2, SEIJI NAKAMURA2, YOSHINAO ODA3 and TAMOTSU KIYOSHIMA1 1Laboratory of Oral Pathology and 2Section of Maxillofacial Oncology, Division of Maxillofacial Diagnostic and Surgical Sciences, Faculty of Dental Science, Kyushu University; 3Department of Anatomic Pathology, Graduate School of Medical Sciences, Kyushu University, Higashi‑ku, Fukuoka 812‑8582, Japan Received March 24, 2018; Accepted June 28, 2018 DOI: 10.3892/ol.2018.9115 Abstract. Low‑grade myofibroblastic sarcoma (LGMS) is a firstly identified in granulation tissue in 1971 (5). Fibroblasts rare intermediate tumor, which rarely metastasizes and has differentiate into myofibroblasts during wound healing myofibroblastic differentiation in various sites. It is particularly and tissue repair (6). According to the 2013 World Health associated with the tongue in the head and neck region. The Organization (WHO) classification (7), LGMS is categorized lack of any pathological features means it is difficult to make as a fibroblastic/myofibroblastic tumor; intermediate tumors a conclusive diagnosis of LGMS. The immunohistochemical (rarely metastasizing). Clinically, LGMS has a propensity for features and genomic rearrangements, including SS18‑SSXs local recurrence and is associated with a low risk of metastatic and MYH9‑USP6s and the genetic mutations of cancer‑associ- spread. Immunohistochemically, LGMS tumor cells are posi- ated genes, including APC, CTNNB1, EGFR, KRAS, PIK3CA tive for at least one myogenic marker, such as alpha‑smooth and p53 were examined in a case of LGMS arising in the tip muscle actin (α‑SMA), desmin or muscle actin (HHF‑35).
    [Show full text]
  • Pathology and Genetics of Tumours of Soft Tissue and Bone
    bb5_1.qxd 13.9.2006 14:05 Page 3 World Health Organization Classification of Tumours WHO OMS International Agency for Research on Cancer (IARC) Pathology and Genetics of Tumours of Soft Tissue and Bone Edited by Christopher D.M. Fletcher K. Krishnan Unni Fredrik Mertens IARCPress Lyon, 2002 bb5_1.qxd 13.9.2006 14:05 Page 4 World Health Organization Classification of Tumours Series Editors Paul Kleihues, M.D. Leslie H. Sobin, M.D. Pathology and Genetics of Tumours of Soft Tissue and Bone Editors Christopher D.M. Fletcher, M.D. K. Krishnan Unni, M.D. Fredrik Mertens, M.D. Coordinating Editor Wojciech Biernat, M.D. Layout Lauren A. Hunter Illustrations Lauren A. Hunter Georges Mollon Printed by LIPS 69009 Lyon, France Publisher IARCPress International Agency for Research on Cancer (IARC) 69008 Lyon, France bb5_1.qxd 13.9.2006 14:05 Page 5 This volume was produced in collaboration with the International Academy of Pathology (IAP) The WHO Classification of Tumours of Soft Tissue and Bone presented in this book reflects the views of a Working Group that convened for an Editorial and Consensus Conference in Lyon, France, April 24-28, 2002. Members of the Working Group are indicated in the List of Contributors on page 369. bb5_1.qxd 22.9.2006 9:03 Page 6 Published by IARC Press, International Agency for Research on Cancer, 150 cours Albert Thomas, F-69008 Lyon, France © International Agency for Research on Cancer, 2002, reprinted 2006 Publications of the World Health Organization enjoy copyright protection in accordance with the provisions of Protocol 2 of the Universal Copyright Convention.
    [Show full text]
  • Nationwide Incidence of Sarcomas and Connective Tissue Tumors of Intermediate Malignancy Over Four Years Using an Expert Pathology Review Network
    medRxiv preprint doi: https://doi.org/10.1101/2020.06.19.20135467; this version posted June 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Nationwide incidence of sarcomas and connective tissue tumors of intermediate malignancy over four years using an expert pathology review network. Prof. Gonzague de Pinieux MD, PhD *1 , Marie Karanian-Philippe MD *2, Francois Le Loarer MD, PhD*3, Sophie Le Guellec MD4 , Sylvie Chabaud PhD2, Philippe Terrier MD 5, Corinne Bouvier MD,PhD6, Maxime Battistella MD,PhD 7, Agnès Neuville MD, PhD3 , Yves-Marie Robin MD 8, Jean- Francois Emile MD, PhD 9 , Anne Moreau MD 10, Frederique Larousserie MD, PhD 11, Agnes Leroux MD12 , Nathalie Stock MD 13, Marick Lae MD 14, Francoise Collin MD15, Nicolas Weinbreck MD16, Sebastien Aubert MD8, Florence Mishellany MD17, Céline Charon-Barra MD15, Sabrina Croce MD, PhD3, Laurent Doucet MD 18, Isabelle Quintin-Rouet MD18 , Marie-Christine Chateau MD19 , Celine Bazille MD20, Isabelle Valo MD21, Bruno Chetaille MD16, Nicolas Ortonne MD22, Anne Gomez-Brouchet MD, PhD4 , Philippe Rochaix MD4, Anne De Muret MD1, Jean-Pierre Ghnassia MD, PhD23 , Lenaig Mescam-Mancini MD 25, Nicolas Macagno MD6, Isabelle Birtwisle-Peyrottes MD26, Christophe Delfour MD19, Emilie Angot MD13, Isabelle Pommepuy MD2, Dominique Ranchere-Vince MD2, Claire Chemin- Airiau MSc2 , Myriam Jean-Denis MSc2, Yohan Fayet PhD2 , Jean-Baptiste Courrèges MSc3 , Nouria Mesli MSc3 , Juliane Berchoud MSc10 , Maud Toulmonde MD, PhD3, Prof.
    [Show full text]
  • Periapical Radiopacities
    2016 self-study course two course The Ohio State University College of Dentistry is a recognized provider for ADA CERP credit. ADA CERP is a service of the American Dental Association to assist dental professionals in identifying quality providers of continuing dental education. ADA CERP does not approve or endorse individual courses or instructors, nor does it imply acceptance of credit hours by boards of dentistry. Concerns or complaints about a CE provider may be directed to the provider or to the Commission for Continuing Education Provider Recognition at www.ada.org/cerp. The Ohio State University College of Dentistry is approved by the Ohio State Dental Board as a permanent sponsor of continuing dental education. This continuing education activity has been planned and implemented in accordance with the standards of the ADA Continuing Education Recognition Program (ADA CERP) through joint efforts between The Ohio State University College of Dentistry Office of Continuing Dental Education and the Sterilization Monitoring Service (SMS). ABOUT this COURSE… FREQUENTLY asked QUESTIONS… . READ the MATERIALS. Read and Q: Who can earn FREE CE credits? review the course materials. COMPLETE the TEST. Answer the A: EVERYONE - All dental professionals eight question test. A total of 6/8 in your office may earn free CE questions must be answered correctly credits. Each person must read the contact for credit. course materials and submit an online answer form independently. SUBMIT the ANSWER FORM ONLINE. You MUST submit your answers ONLINE at: Q: What if I did not receive a confirmation ID? us http://dentistry.osu.edu/sms-continuing-education A: Once you have fully completed your .
    [Show full text]
  • CT and MRI of Superficial Solid Tumors
    251 Review Article CT and MRI of superficial solid tumors Jingfeng Zhang1, Yanyuan Li2, Yilei Zhao1, Jianjun Qiao3 1Department of Radiology, 2Department of Pathology, 3Department of Dermatology, the First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou 310003, China Correspondence to: Jianjun Qiao. Department of Dermatology, the First Affiliated Hospital, College of Medicine, Zhejiang University, No. 79, Qingchun Road, Hangzhou 310003, China. Email: [email protected]. Abstract: Superficial solid masses are common conditions in clinical practice, however, some of which can be easily diagnosed and others would be difficult. Although imaging of superficial masses is not always characteristic, it would be helpful to give a definitive diagnosis or narrow a differential diagnosis. Crossing- section imaging can depicture the masses directly, find some pathognomonic signs and demonstrate their relationship with adjacent structures, which can provide decision support for clinician’s reference. Computed tomography (CT) can be used to detect calcifications and bone erosion which could not be seen on radiographs. Magnetic resonance imaging (MRI) is the preferred way for evaluating soft tissue lesions and provides information on hemorrhage, necrosis, edema, cystic and myxoid degeneration, and fibrosis. Other advantages of MRI are its superior soft tissue resolution and any profile imaging, which can aid the assessment of extension and adjacent infiltration. Positron emission tomography (PET)/CT and PET/MRI have been increasingly used in bone and soft tissue sarcomas and provides advantages in the initial tumor staging, tumor grading, therapy assessment, and recurrence detection. Therefore, imaging examination can play an important role in treatment decision making for superficial solid tumors. Here we review the important conditions presenting as superficial mass and show the imaging of typical cases diagnosed in our hospital.
    [Show full text]
  • 2016 Essentials of Dermatopathology Slide Library Handout Book
    2016 Essentials of Dermatopathology Slide Library Handout Book April 8-10, 2016 JW Marriott Houston Downtown Houston, TX USA CASE #01 -- SLIDE #01 Diagnosis: Nodular fasciitis Case Summary: 12 year old male with a rapidly growing temple mass. Present for 4 weeks. Nodular fasciitis is a self-limited pseudosarcomatous proliferation that may cause clinical alarm due to its rapid growth. It is most common in young adults but occurs across a wide age range. This lesion is typically 3-5 cm and composed of bland fibroblasts and myofibroblasts without significant cytologic atypia arranged in a loose storiform pattern with areas of extravasated red blood cells. Mitoses may be numerous, but atypical mitotic figures are absent. Nodular fasciitis is a benign process, and recurrence is very rare (1%). Recent work has shown that the MYH9-USP6 gene fusion is present in approximately 90% of cases, and molecular techniques to show USP6 gene rearrangement may be a helpful ancillary tool in difficult cases or on small biopsy samples. Weiss SW, Goldblum JR. Enzinger and Weiss’s Soft Tissue Tumors, 5th edition. Mosby Elsevier. 2008. Erickson-Johnson MR, Chou MM, Evers BR, Roth CW, Seys AR, Jin L, Ye Y, Lau AW, Wang X, Oliveira AM. Nodular fasciitis: a novel model of transient neoplasia induced by MYH9-USP6 gene fusion. Lab Invest. 2011 Oct;91(10):1427-33. Amary MF, Ye H, Berisha F, Tirabosco R, Presneau N, Flanagan AM. Detection of USP6 gene rearrangement in nodular fasciitis: an important diagnostic tool. Virchows Arch. 2013 Jul;463(1):97-8. CONTRIBUTED BY KAREN FRITCHIE, MD 1 CASE #02 -- SLIDE #02 Diagnosis: Cellular fibrous histiocytoma Case Summary: 12 year old female with wrist mass.
    [Show full text]
  • Shared Data & Cancer Registries
    15 4 2021 Shared data & Cancer registries Jean-Yves BLAY Prof. of Medical oncology Director of Centre Léon Bérard Director of the ERN-EURACAN French Academy of Medicine President of Unicancer Disclosures Company Scientific advice Scientific works Symposia & oral communications Abbvie X X Amgen X X X ARIAD X X AstraZeneca X X Bayer X X X BMS X X X Deciphera x x DDB X X EISAI X X X Genomic Health X X Gilead X X GSK X X INNATE PHARMA X (member of the Supervisory committee) INCYTE X IQVIA x x x Jansenn X X LILLY X X Merck Serono X X MSD X X Nanobiotix X x Novartis X X X Novex X X Onxeo X Pfizer X X Pharmamar X X PRA X Roche X X Sanofi Aventis X X Swedish Orphan X X Takeda X Toray X Shared data & Cancer registries • The revolution of oncology : precision medicine vs biology based oncology (.. emerging rare cancers) • Shared data & registries: • Diagnosis • Epidemiology • Optimal primary treatment is cheaper • Connecting patients and doctors • Academic clinical and translational research Nosology and treatment Histology Nosology & treatment 2021+ Trials on molecular/immune Histology subgroups Molecular Trials on somatic genotype? Stroma characterization SHIVA, SAFIR, MOST (immune cells…) BASKET ! Example : NTRK fusions across cancers 0.5-1% of all cancers 9000/year in EU? Diagnosis? Treatment? EURACAN : THE ERN FOR RARE ADULT SOLID CANCERS Sub-thematic areas Connective tissue Female genital organs and placenta Male genital organs, and of the urinary tract Neuroendocrine system Digestive tract Endocrine organs 20% of cancers Head and neck 30%
    [Show full text]
  • Musculoskeletal Radiology
    MUSCULOSKELETAL RADIOLOGY Developed by The Education Committee of the American Society of Musculoskeletal Radiology 1997-1998 Charles S. Resnik, M.D. (Co-chair) Arthur A. De Smet, M.D. (Co-chair) Felix S. Chew, M.D., Ed.M. Mary Kathol, M.D. Mark Kransdorf, M.D., Lynne S. Steinbach, M.D. INTRODUCTION The following curriculum guide comprises a list of subjects which are important to a thorough understanding of disorders that affect the musculoskeletal system. It does not include every musculoskeletal condition, yet it is comprehensive enough to fulfill three basic requirements: 1.to provide practicing radiologists with the fundamentals needed to be valuable consultants to orthopedic surgeons, rheumatologists, and other referring physicians, 2.to provide radiology residency program directors with a guide to subjects that should be covered in a four year teaching curriculum, and 3.to serve as a “study guide” for diagnostic radiology residents. To that end, much of the material has been divided into “basic” and “advanced” categories. Basic material includes fundamental information that radiology residents should be able to learn, while advanced material includes information that musculoskeletal radiologists might expect to master. It is acknowledged that this division is somewhat arbitrary. It is the authors’ hope that each user of this guide will gain an appreciation for the information that is needed for the successful practice of musculoskeletal radiology. I. Aspects of Basic Science Related to Bone A. Histogenesis of developing bone 1. Intramembranous ossification 2. Endochondral ossification 3. Remodeling B. Bone anatomy 1. Cellular constituents a. Osteoblasts b. Osteoclasts 2. Non cellular constituents a.
    [Show full text]