Aus dem Institut für Pathophysiologie (Direktor Univ.- Prof. Dr. H. Brinkmeier) der Universitätsmedizin der Ernst-Moritz-Arndt-Universität Greifswald

"Expression und Lokalisation der Kationenkanäle TRPC3, TRPC6 und TRPV5 in verschiedenen Geweben der Maus"

Inaugural - Dissertation

zur

Erlangung des akademischen

Grades

Doktor der Medizin (Dr. med.)

der

Universitätsmedizin

der

Ernst-Moritz-Arndt-Universität

Greifswald

2013

vorgelegt von: Frederike Bisping geb. am: 04.09.1982 in: Winsen/Luhe Dekan: Prof. Dr. med. dent. Reiner Biffar 1. Gutachter: Prof. Dr. Heinrich Brinkmeier, Institut für Pathophysiologie, Universität Greifswald 2. Gutachter: Prof. Dr. med. Antje Bornemann, Institut für Pathologie und Neuropathologie, Universität Tübingen Ort, Raum: Ernst-Moritz-Arndt-Universität Greifswald, Hörsaal Pathologie Tag der Disputation: 06.12.2013 Inhaltsverzeichnis

1. Einleitung ...... 3 1.1 Die TRP Familie von Kationenkanälen ...... 3 1.2 Aufgaben und Bedeutung der TRP Kanäle ...... 7 1.3 Krankheiten ...... 8 1.4. Tiermodelle ...... 11 1.5 Zielstellung der Arbeit ...... 12

2. Material und Methoden ...... 13 2.1 Material ...... 13 2.1.1 Mausstamm ...... 13 2.1.2 Chemikalien und Enzyme ...... 13 2.1.3 Antikörper ...... 15 2.1.4 Enzyme und Primer ...... 15 2.1.5 Kits für die Immunhistochemie und in-situ Hybridisierung ...... 16 2.1.6 Plasmid ...... 17 2.1.7 Verwendete Lösungen ...... 17 2.1.8 Geräte ...... 19 2.2 Methoden ...... 20 2.2.1 Präparation der Mäusegewebe und Herstellung der Schnitte ...... 20 2.2.2 DIG-RNA-Sonden Synthese ...... 20 2.2.3 in-situ Hybridisierung ...... 21 2.2.4 Indirekte Immunhistochemie ...... 23 2.2.5 Indirekte Immunfluoreszenz ...... 24 2.2.6 Real-Time TaqMan® Polymerase Kettenreaktion ...... 25

3. Ergebnisse ...... 27 3.1 Quantitative RT-PCR für TRPC3, TRPC6 und TRPV5 ...... 27 3.2 In-situ Lokalisation von TRPC3, TRPC6 und TRPV5 ...... 30 3.2.1 Etablierung der in-situ Sonden ...... 31 3.2.2 Kontrollen und Korrespondenzgewebe ...... 31 3.2.3 In-situ Lokalisation im Gehirn ...... 35 3.2.4 In-situ Lokalisation in der Lunge ...... 37 1 3.2.5 In-situ Lokalisation im Herzmuskel und der Aorta ...... 38 3.2.6 In-situ Lokalisation in der Leber ...... 39 3.2.7 In-situ Lokalisation in der Milz ...... 39 3.2.8 In-situ Lokalisation im Dünndarm ...... 40 3.2.9 In-situ Lokalisation in der Niere ...... 41 3.2.10 In-situ Lokalisation im Pankreas ...... 42 3.2.11 In-situ Lokalisation in der Skelettmuskulatur ...... 44 3.2.12 In-situ Lokalisation in den männlichen Fortpflanzungsorganen ...... 44 3.2.13 In-situ Lokalisation in den weiblichen Fortpflanzungsorganen ...... 45 3.2.14 Zusammenfassung der Ergebnisse ...... 47

4. Diskussion ...... 49

5. Zusammenfassung ...... 55

6. Literaturverzeichnis ...... 57

7. Anhang...... 60 “Tissue-specific expression of TRP channel genes in the mouse and its variation in three different mouse strains.” von Kunert-Keil, Bisping, Krüger, Brinkmeier, BMC Genomics 2006, 7:159 "Transient receptor potential cation channels in normal and dystrophic mdx muscle.” Krüger, Kunert-Keil, Bisping, Brinkmeier, Neuromuscular Disorders 18 (2008) 501–513

2 1. Einleitung

1.1 Die TRP Familie von Kationenkanälen

Der erste TRP (Transient Receptor Potential) Kanal wurde in photosensiblen Retinazellen der Fruchtfliege Drosophila melanogaster nachgewiesen. Dieser Kalzium leitende Kanal wird durch Lichteinfall auf den G-Protein-gekoppelten Rhodopsinrezeptor aktiviert (Montell und Rubin 1989). Mittlerweile sind zahlreiche TRP Kanäle bekannt. Ihr Vorkommen ist weit gefächert; es reicht von Hefen und Würmern bis hin zu Wirbeltieren und Säugern. Es handelt sich dabei um Kationen transportierende Kanäle, die hauptsächlich permeabel für Natrium und Kalzium sind. Zu der Superfamilie der TRP Kanäle gehören sieben Unterfamilien, von denen fünf der Gruppe 1 (TRPC, TRPV, TRPM, TRPN und TRPA) und zwei der Gruppe 2 (TRPP und TRPML) zugeordnet werden. Sechs dieser Subfamilien wurden bisher in Säugetieren identifiziert (Montell 2005). TRPN konnte in Würmern, Drosophila und im Zebrafisch nachgewiesen werden (Venkatachalam und Montell 2007). Die phylogenetischen Zusammenhänge sind in Abbildung 1 dargestellt.

Abbildung 1.1: Stammbaum der TRP Superfamilie der Säugetiere (Nilius et al. 2007)

3 Die Unterteilung in die zwei Untergruppen basiert auf sequenziellen und strukturellen Unterschieden. Die Gruppe 1 weist eine starke Sequenzhomologie zu den Drosophila TRP Kanälen auf (Montell und Rubin 1989). Allen Kanalproteinen gemein sind sechs Tansmembrandomänen; die Amino- und Carboxyenden liegen bei allen Kanälen intrazellulär. Jeweils vier dieser Untereinheiten lagern sich zu einem funktionellen Kanal zusammen. Der Porus, der die Kationenpassage ermöglicht, liegt zwischen den jeweiligen fünften und sechsten Transmembrandomänen der vier Unterheiheiten (Venkatachalam und Montell 2007). Hinter der sechsten Transmembrandomäne am Carboxyende besitzen die Kanäle TRPC, TRPM und TRPN eine TRP Domäne, die aus einer Folge von 23-25 Aminosäuren besteht. Am N-terminalen Ende der TRPC, TPRV, TRPA und TRPN Subgruppen finden sich Wiederholungen einer Ankyrin Sequenz. (Venkatachalam und Montell 2007) Die Mitglieder der Gruppe 2 haben extrazellulär, zwischen der ersten und zweiten Transmembrandomäne, eine große Schleife (Venkatachalam und Montell 2007) (siehe Abbildung 1.2 a und b).

Abbildung 1.2: Aufbau der einzelnen TRP Proteine; (a) Gruppe 1; (b) Gruppe 2; A Ankyrinrepeat; cc coiled- coil Domäne Proteinkinase Domäne (rot); TRP Domäne (blau); P Pore(Venkatachalam and Montell 2007); Cytoplasm= Zytoplasma (Venkatachalam und Montell, 2007).

4 TRP Kanäle kommen in vielen verschiedenen Zell- und Gewebetypen vor. Außerdem sind die Aktivierungsmechanismen sehr variabel und nicht den Untergruppen zuzuordnen. Die Aktivität der TRP Kanäle wird zum einen über Rezeptoren und intrazelluläre Signalkaskaden

G-Protein vermittelt über Phosphatidylinositolbisphosphat (PIP2), Diacylglycerol (DAG) und

Inositoltrisphosphat (IP3) modifiziert. Zum anderen ist eine Aktivierung durch exogene (z.B. Capsaicin) oder endogene (z.B. Anandamid) Liganden möglich. Einige der Kanäle können auch direkt geöffnet werden, beispielsweise durch Temperaturänderungen (Ramsey, Delling et al. 2006). Gegenstand der Forschung ist außerdem eine Beteiligung beim store-operated Ca2+ entry (SOCE) (Nilius et al. 2004). Die Untergruppe TRPC, das C steht für „Classical“ oder „Canonical“, hat acht Mitglieder. Beim Menschen sind TRPC1, C3, C4, C5, C6 und C7 zu finden. Das Protein TRPC2 wird nur in der Maus exprimiert. Alle TRPC werden über die Phospholipase C aktiviert (Montell 2005). Die Verknüpfung läuft über verschiedene Wege, wie vermutlich über die Verringerung der Kalziumkonzentration intrazellulärer Speicher oder über Inositoltriphosphat (Venkatachalam et al. 2002). Auch Diacylglycerol (DAG) ist beispielsweise bei TRPC3 und TRPC6 in die Aktivierungskaskade involviert (Hofmann et al. 1999). Die Selektivität für Ionen reicht von dem nicht selektiven TRPC1 über TRPC3, mit einer Ionenselektivität von

PCa2+/PN+=1,6, zu den höherselektiven TRPC6 (PCa2+/PNa+=5) und TRPC5 (PCa2+/PNa+=9,5) (Venkatachalam und Montell 2007). Das Gehirn weist eine starke Expression besonders von TRPC3, TRPC4 und TRPC5 auf. TRPC6 findet sich vor allem in Lunge, Gehirn, Plazenta und Ovar. Im Herzmuskel kommen TRPC1 und TRPC7 vor (Venkatachalam und Montell 2007). Die TRPV Subfamilie (V steht für „Vanilloid“) besteht aus sechs Kanälen. Die Aktivierung ist auch hier wieder polymodal. Hitze aktiviert TRPV1, TRPV2, TRPV3 und TRPV4. Die Aktivierung wird außerdem modifiziert von Faktoren, wie dem pH-Wert oder der

Konzentration von PIP2 und Proteinkinase C (Montell 2005). Bei TRPV1 kann es außerdem zu einer Capsaicin-vermittelten Aktivierung kommen. Mangel an Kalzium im Zytosol sowie Hyperpolarisation der Zelle beeinflussen die Öffnung von TRPV5. TRPV5 weist, gemeinsam mit TRPV6, unter den TRP Kanälen die größte Selektivität für Kalzium auf (PCa2+/PNa+ >100). Dieser Kanal kommt besonders in Niere, Dünndarm und Pankreas vor. Andere TRPV Kanäle werden hauptsächlich in Ganglienzellen und im Rückenmark exprimiert (Venkatachalam und Montell 2007). Die TRPM Untergruppe (M steht für „Melastatin“) setzt sich aus acht Vertretern zusammen. Die Funktion von TRPM4 und TRPM5 ist einzigartig in der TRP Familie. Es sind spannungsabhängige und Kalzium aktivierte Kanäle, die nur monovalente Ionen

5 transportieren. Modifiziert wird die Aktivität durch PIP2 und bei TRPM5 auch durch Temperaturverschiebung. TRPM6 und TRPM7 sind selektiv für divalente Kationen, wie Magnesium und Kalzium. Reguliert werden sie durch den intrazellulären Magnesiumspiegel (Voets et al. 2004) und TRPM7 zusätzlich über den pH-Wert oder Adenosintriphosphat (ATP) (Venkatachalam und Montell 2007). TRPM8 wird durch kühle Temperaturen oder Substanzen die Kälteempfinden verursachen, wie Menthol oder Eukalyptol, aktiviert.

Modifiziert wird diese Aktivierung durch den pH-Wert und PIP2 (Elizondo et al. 2005). TRPM1-3 kommen vor allem im Gehirn vor. TRPM4 wird in der Prostata und im Dickdarm gefunden, wo hingegen TRPM5 im Darm und der Leber exprimiert wird. In der Niere lassen sich TRPM6 und M7 und in den Ganglienzellen TRPM8 nachweisen (Venkatachalam und Montell 2007). TRPA1 ist der einzige Kanal der TRPA Subfamilie, der beim Menschen vorkommt (Montell 2005). Das A steht für „Ankyrin“. Über verschiedenste Stimuli, wie Isothiocyanide (Wasabi oder Meerrettich), Knoblauch, Zimt oder auch Cannabis (Tetrahydrocannabinol) wird der Kanal aktiviert (Jordt et al. 2004; Macpherson et al. 2005; Bautista et al. 2006). Auch Bradykinin beispielsweise kann über die Signalkaskade der Phospholipase C TRPA1 öffnen

(Bandell et al. 2004). Die Selektivität für Kalzium ist gering (PCa2+/PNa+ = 0,8). Expressionsorte von TRPA1 sind Ganglienzellen, Haarzellen, Zellen des Ovars und des Hodens (Venkatachalam und Montell 2007).

6 1.2 Aufgaben und Bedeutung der TRP Kanäle

TRP Kanäle erfüllen verschiedenste Funktionen. Sie sind beteiligt an der Reaktion auf externe Stimuli (Phototransduktion, Thermo- und Nozizeption sowie Chemo- und Mechanozeption) und ebenso an der Reaktion auf die unmittelbare zelluläre Umgebung, wie Veränderungen des osmotischen Gleichgewichtes oder Sekretion von Hormonen (Venkatachalam und Montell 2007). Von besonderer Bedeutung ist die Mitwirkung einiger Vertreter bei der Regulation der Kalziumhomöostase. Kalziumionen spielen eine zentrale Rolle in vielen zellulären Prozessen, wie Muskelkontraktion, Transmitterfreisetzung, Zellproliferation, Gentranskription und Zelluntergang (Berridge et al. 2000). Ein Beispiel für die sensorischen Funktionen ist TRPM5, der in Geschmackszellen lokalisiert ist und auf die Geschmacksqualitäten Bitter und Süß reagiert (Zhang et al. 2003; Talavera et al. 2005). TRPC2 beispielsweise ist bei Pheromonsensorik im Vomeronasalen Organ vieler Säugetiere beteiligt. Bei männlichen Mäusen, die TRPC2 defizient sind, konnte eine Veränderung des Agressionsverhaltens beobachtet werden. Beim Menschen, bei dem das Vomeronasale Organ unterentwickelt ist, ist TRPC2 nur ein Pseudogen, wird also nicht exprimiert (Liman und Corey 1996; Stowers et al. 2002). TRPV1 ist ein Protein, das an der Thermozeption beteiligt ist. Bei TRPV1-defizienten Mäusen konnte eine Hitzeempfindung erst bei einer Temperatur von über 55°C ausgelöst werden (Caterina et al. 2000; Davis et al. 2000). Ähnliche Reaktionen löst Capsaicin aus, das auch TRPV1 aktiviert. Auch in Synapsen des zentralen Nervensystems spielen TRP Kanäle eine Rolle. So hat TRPC4, welcher in Dendriten des Thalamus vorkommt, eine Funktion bei der Ausschüttung des inhibitorischen Neurotransmitters GABA (-Aminobuttersäure). Das konnte in TRPC4 -/- knock-out Tieren nachgewiesen werden (Munsch et al. 2003). Ein weiteres Beispiel sind exzitatorische gutaminerge Signale, die von Purkinjezellen des Kleinhirns ausgehen und bei TRPC1 Defizienz vermindert sind (Kim et al. 2003). In Blutgefäßen wird über den Kalziumeinstrom der Gefäßtonus reguliert und damit der Blutdruck. Im Endothel der Gefäße finden sich unter anderem TRPC4 Kanäle. Bei Mäusen, denen das Gen für TRPC4 fehlt, zeigt sich eine reduzierte Fähigkeit zur Vasorelaxation. Bei diesen Tieren ist der IP3-gesteuerte Kalziumeinstrom gestört (Freichel et al. 2001).

7 1.3 Krankheiten

Wie im oberen Abschnitt in einigen Beispielen beschrieben, sind die Funktionen und damit auch die Funktionsstörungen der unterschiedlichen TRP Kanäle vielfältig. Bisher sind vier Krankheitsbilder bekannt, bei denen jeweils ein genetischer Defekt eines einzelnen TRP Kanals ursächlich ist („Channelopathies“). Es handelt sich dabei um Hypomagnesiämie (HSH), Fokale Segmentale Glomerulosklerose (FSGS), Polyzystische Nierendegeneration (ADPKD) und Mukolipidosis Typ IV (MLIV). Die Hypomagnesiämie mit sekundärer Hypokalziämie (HSH) kann durch eine seltene autosomal rezessiv vererbte Mutation vom TRPM6-Gen auf Chromosom 9 entstehen (Nilius et al. 2007). Der Kanal wird normalerweise im distalen Tubulus der Niere und im Bürstensaum des Dünndarmepithels exprimiert. TRPM6 ist magnesium- und kalziumspezifisch (siehe Kapitel 1.1). Fehlt dieser Kanal oder ist die Funktion gestört, wird zu wenig Magnesium aus dem Primärharn bzw. Darminhalt resorbiert (Voets et al. 2004). Klinisch imponieren neuromuskuläre Symptome wie Faszikulationen, Tremor und Krämpfe (Classen 2004). Die FSGS in der late-onset Form (engl.: später Beginn) ist eine Nierenerkrankung, bei der eine Funktionsstörung von TRPC6 nachgewiesen werden konnte. TRPC6 ist hauptsächlich für Kalziumionen durchlässig und wird in Podozytenfortsätzen exprimiert. Die Podozytenfortsätze bilden gemeinsam mit der Schlitzmembran, der Basalmembran und dem Kapillarendothel die glomeruläre Filtrationsmembran (siehe Abb. 1.3).

Podozyten- fortsätze

/Myosin

Aktin Netzwerk

Glomeruläre Basal- Nephrin Schlitzmembran- Membran proteine

Fenestriertes Endothel

Kapillarlumen

Abbildung 1.3: Aufbau der glomerulären Filtrationsmembran (Nilius et al. 2007).

8 Bisher sind sechs verschiedene Mutationen bekannt von denen drei mit einer erhöhten Kanalaktivität einhergehen (Reiser et al. 2005; Winn et al. 2005). Noch ist der Zusammenhang zwischen „Channelopathie“ und Pathogenese der Erkrankung unklar. Bei der FSGS kommt es zu einer, von den Podozytenfortsetzen ausgehenden, Hyalinisierung und Sklerosierung der Glomeruli, die zu Permeabilitätsstörungen führen. In der Adoleszenz beginnt der fortschreitende Funktionsverlust der Nieren mit Proteinurie und führt zu einer terminalen Niereninsuffizienz (Classen 2004). Bei der autosomal-dominant vererbten polyzystischen Nierendegeneration (ADPKD) kommt es im Erwachsenenalter zu zystischer Transformation des Markes und der Rinde beider Nieren, die häufig in eine chronische Niereninsuffizienz übergeht. Auch in Leber und Pankreas können Zysten auftreten (Classen 2004). Der ADPKD liegt eine Mutation auf Chromosom 16 (in 90% der Fälle) oder auf Chromosom 4 (10% d.F.) zugrunde (Classen 2004). Der Genort auf Chromosom 16 kodiert für TRPP1 und der auf Chromosom 4 für TRPP2. Die TRPPs (P steht für „Polycystin“) gehören zur Gruppe 2 der TRP Kanäle (siehe Kapitel 1.1). Die beiden Proteine kommen besonders in der Niere vor. Sie bilden dort, als funktionelle Einheit, einen nicht-selektiven Kationenkanal (Montell 2005). Es wurde gezeigt, dass in TRPP2-defizienten Nierenzellen die Zellproliferation gesteigert ist. Wahrscheinlich ist die fehlende Inhibition des zellproliferationssteigernden Proteins Id-2 durch TRPP2 ein, der Erkrankung zugrunde liegender Pathomechanismus (Benezra 2005). Eine Hypothese für die Pathogenese der ADPKD ist, dass durch dieses erhöhte Wachstum der Zellen, die pathognomonischen Zysten entstehen. (Li et al. 2005). Die Mukolipidosis Typ IV (MLIV) ist eine neurodegenerative lysosomale Speicherkrankheit, der ein autosomal-rezessiver Erbgang zugrunde liegt. Klinisch wird die Erkrankung charakterisiert durch psychomotorische Retardierung, ophtalmologische Fehlbildungen, Agenesie des Corpus callosum, Achlorhydrie des Magens und Eisenmangel. Die Erkrankung bricht im ersten Lebensjahr aus und schreitet langsam über Jahrzehnte voran (Bach 2005). Die Mutation liegt auf Chromosom 19 und betrifft ein Gen, das für TRPML1 kodiert (Raychowdhury et al. 2004). TRPML1 (ML steht für „Mukolipin“) ist ein Vertreter der Gruppe 2 TRP Kanäle (siehe Kapitel 1.1) und kommt im Gehirn und in glatter, sowie quergestreifter Muskulatur vor. (Venkatachalam und Montell 2007). TRPML1 leitet monovalente Kationen, wie Protonen (Kiselyov et al. 2005) und trägt zur pH-Regulierung in Lysosomen bei (Soyombo et al. 2006). Die pathophysiologischen Mechanismen, die der MLIV zugrunde liegen, sind noch nicht hinreichend bekannt. Es kommt zu Ablagerungen von Stoffen, wie Gangliosiden, Mukopolysaccariden und membranösem Material in Lysosomen

9 der betroffenen Zellen (Bach 2001). Eine Hypothese besagt, dass die defekten TRPML1 Kanäle durch Beeinflussung der Kalziumkonzentration in Zellorganellen die Störung des endosomalen/lysosomalen Transports auslösen (LaPlante et al. 2004).

10 1.4. Tiermodelle

Die meisten Erkenntnisse über die physiologische Funktion der TRP Kanäle stammen aus der Forschung an Tiermodellen, deren Gene modifiziert sind. Einzelne Gene können durch homologe Rekombination ausgetauscht werden und so ihre Funktion verlieren. Die Maus ist dabei ein besonders häufig verwendetes Modell, da die Nachkommenschaft zahlreich und der Vermehrungszyklus kurz ist. Für einige der TRP Kanäle existieren bereits solche genetisch veränderten Mausmodelle, auch transgene Mäuse und Knock-out Mäuse genannt. Beispielsweise ließ erst die Forschung an TRPC4-/- Mäusen, bei deren Epithelien der Kalziumeinstrom stark reduziert ist, Rückschlüsse auf die Beteiligung von TRPC4 bei der Vasokonstruktion zu (Freichel et al. 2001). TRPC6-defiziente Mäuse zeigten veränderte kontraktile Reaktion der Tracheal- und Gefäßmuskulatur auf Kathecholamine. Doch gleichzeitig wurde bei diesen Tieren eine offenbar kompensatorische Expressionssteigerung von TRPC3 gezeigt, der dem TRPC6 Kanal in Funktion und Aufbau sehr ähnlich ist. Ein Modell, bei dem die Gene für diese beiden Kanäle modifiziert sind, existiert noch nicht (Freichel et al. 2004). Versuche mit TRPV1 defizienten Mäusen zeigten in Neuronen der DRG (dorsal root ganglia) abgeschwächte elektrophysiologische Reaktionen auf Capsaicin, Hitze und säurehaltige Substanzen im Vergleich zu genetisch unveränderten Populationen. Des Weiteren scheinen TRPV1 Kanäle einen bisher noch wenig verstandenen Einfluss auf das Immunsystem zu haben. In knock-out Mäusen konnte ein abgeschwächter Fieberanstieg, im Sinne einer weniger ausgeprägten Entzündungsreaktion beobachtet werden (Iida et al. 2005). TRPV5 und TRPV6 sind TRP Kanäle mit der höchsten Kalziumselektivität. Da sie funktionelle Heteromere bilden können und von ihrer Struktur und Funktion sehr ähnlich sind, ist eine wechselseitige Kompensation bei Defizienz einer der beiden Kanäle denkbar (Hoenderop et al. 2003). In TRPV5-/- Mäusen, sowie auch in TRPV6-/- Mäusen konnte eine erniedrigte Kalziumaufnahme gezeigt werden. Trotz hoher Parathormon- und Vitamin D Spiegel kam es zu Knochendichteminderung und verminderter intestinaler Aufnahme von Kalzium (Hoenderop et al. 2003) (Bianco et al. 2007). Ein Modell, dass sowohl eine Mutation für TRPV5 als auch für TRPV6 bietet, steht noch aus (Desai und Clapham 2005).

11 1.5 Zielstellung der Arbeit

Um Rückschlüsse auf die Funktion eines Ionenkanals vornehmen zu können ist es notwendig, seine genaue Expression und zelluläre Lokalisation zu ermitteln. Bisher sind keine genauen mRNA- und Proteinlokalisationen der TRP Kanäle in der gesunden Maus bekannt. Da die Maus ein häufig verwendetes Modell ist, wäre dies ein wichtiger Vergleichs- und Ausgangspunkt der weiteren Erforschung von TRP Kanälen und den mit ihnen in Verbindung gebrachen Krankheiten. Ziel der vorliegenden Arbeit war es, die Expression und Lokalisation dreier TRP Kanäle der Gruppe 1 (TRPC3, TRPC6 und TRPV5) in verschiedenen Geweben der Maus zu charakterisieren. Aufgrund der Vielfalt der TRP-Kanäle mussten für das Vorhaben drei interessante Vertreter ausgewählt werden. Es wurden solche Kanäle ausgewählt, die für die Kalziumhomöostase relevant schienen und von denen bekannt war, dass sie im ZNS und Skelettmuskel exprimiert werden. Über die genaue zelluläre und subzelluläre Verteilung von TRPC3, TRPC6 und TRPV5 war wenig bekannt und ebenso wenig über ihre mögliche Beteiligungan neuromuskulären Krankheiten. Für die Bestimmung der Genexpression wurde die real-time RT-PCR genutzt. Zusätzlich wurde die mRNA Menge mittels densiometrischer Auswertung der nicht-radioaktiven in-situ- Hybridisierung (ISH) ermittelt. Die ISH wurde außerdem für die Lokalisation der mRNA im Gewebe genutzt. Für die Lokalisation des Proteins in den verschiedenen Maus-Organen standen Antikörper zur Verfügung. Der Nachweis der Proteinexpression erfolgte mit Hilfe der indirekten Immunhistochemie.

12 2. Material und Methoden

2.1 Material

Für die durchgeführten Untersuchungen wurden die im Folgenden aufgelisteten Materialien von den jeweils angegebenen Herstellern sowie herkömmliche Chemikalien (nicht im Einzelnen aufgeführt) eingesetzt. Alle Chemikalien sind mindestens in der Spezifikation „reinst“ oder in der höchstmöglichen kommerziell erhältlichen Reinheit verwendet worden.

2.1.1 Mausstamm

C57 Bl/10 ScSn Institut für Pathophysiologie, Abteilung Versuchstierkunde, Universitätsmedizin der EMAU Greifswald

2.1.2 Chemikalien und Enzyme

Aceton J.T. Baker

BCIP (5-Bromo-4-Chloro-3-Indolyl-Phosphate) Sigma Blocking Reagent Roche

ChemMate DAKO

DAB (3,3-Diaminobenzidin) Roth DEPC (Diethylpyrocarbonate) Sigma Dinatriumhydrogenphosphat-Heptahydrat Roth DMSO Roth

13 EDTA (Ethylendiaminotetraacetat) Serva Essigsäureanhydrid Fluka Ethanol Roth, Karlsruhe, Deutschland

Formamid (deionisiert) Roth

Glycergel (mounting medium) Dako Cytomation Guanidinethiocyanate Sigma-Aldrich, Münschen, Deutschland HCl Merck

Isopropanol Merck

Kaisers Glyceringelantine Merck Kaliumdihydrogenphosphat Roth

Levamisol Sigma

Magnesiumchloridhexahydrat Serva Maleinsäure Roth Methylgrün Zinkchlorid Doppelsalz Merck Meyers Hämalaun (Hämatoxylin) Dako Cytomation

N,N-Dimethylformamid Merck NaCl Roth NaOH Merck NBT (Nitro Blue Tetrazolium) Sigma

PFA (Parafomaldehyde) Sigma Roti Histokitt (Xylolbasis) Roth tn-Natriumcitrat-Dihydrat Roth Triethanolamin Sigma Trispuffer Sigma

14 Triton x-100 Merck t-RNA from E-coli MRE 600 Roche Tween 20 (Polyoxyethylene-Sorbitan Monolaurate) Sigma

Xylol J.T. Baker

2.1.3 Antikörper

Anti-Digoxigenin-Ab, Fab fragments Roche Anti-TRPC3 Alomone Labs Anti-TRPC6 Alomone Labs Anti-TRPV5 Alomone Labs Anti-Rabbit IgG Alexa 568 Molecular Probes

2.1.4 Enzyme und Primer

Pepsin Roche Primer TibMolBiol, Berlin Restiktionsendonukleasen NcoI SpeI New England Biolabs (NEB) RNase A (from bovine pankreas) Roche

15 Die Primer für die „Real-time“ RT-PCR stammen von den Firmen PE Applied Biosystems und TibMolBiol Berlin: Zugangsnummer/ Sequenz 5’ – 3’ Fragmentgröße TRPC3 NM 019510 For: CCAAGCTGGCCAACATAGAG 180 Bp Rev: GGCAAGTTTGACACGACTCA Sonde: ACTCGGAGGAGGTGGAAGCCATTC TRPC6 NM 013838 Als Sondenmix erhältlich: Mm00443441_m l 153 Bp

TRPV5 NM 001007572 For: CAAGAAGAAAGAGGCTCGAC 281 Bp Rev: AATGACTGTCACCAACTCCC Sonde: CCGTACACATGTTCGAGATAACACCATCA

2.1.5 Kits für die Immunhistochemie und in-situ Hybridisierung

Chemate Antibody Diluent Dako Cytomation

Dako Kit (mit DAB+ Chromogen x-50) Dako Cytomation

DIG RNA Labeling Kit (SP6/T7) Roche

Peroxidase Blocking Reagent (ready to use) Dako Cytomation

Rabbit/Anti-Human IgA Dako Cytomation

Chemate Target Retrieval Solution (x10) Dako Cytomation

Vectastain ABC Kit – Rabbit IgG Vector Laboratories

16 2.1.6 Plasmid

Für die Klonierung doppelsträngiger cDNA wurde der Vektor pGEM-T-Easy von Promega genutzt. Durch den Einbau der DNA in das Plasmid und mit Hilfe der auf dem Plasmid befindlichen T7 und SP6 Polymerase Promotoren konnten die DIG markierten RNA-Sonden für die in-situ Hybridisierung hergestellt werden.

2.1.7 Verwendete Lösungen

Alle Lösungen mit denen die in-situ-Hybridisierung durchgeführt wurde, außer 4% PFA, Lösung D und 1M MgCl, sind mit 0,1% DEPC versetzt, zwei Stunden gerührt und autoklaviert worden. Es wurde ausschließlich zweifach destilliertes Wasser (aqua bidest) verwendet. Der erforderliche pH-Wert wurde mit NaOH bzw. HCl eingestellt.

17 10x PBS (phosphate-buffered saline) 1,5 M NaCl pH 7,4 100 mM Na2HPO4 (7x H2O)

30 mM KH2PO4

20x SSPE 3,6 M NaCl pH 7,4 0,2 M NaH2PO4 0,2 M EDTA

Lösung D 4 M GTC (Guanidinthiocyanat) pH 7,0 25 mM Na-Citrat

20x SSC 3 M NaCl pH 7,4 0,3 M Na-Citrat

2x Maleatpuffer 200 mM Maleinsäure pH 7,5 300 mM NaCl

10x Blocking (bei -20°C lagern) 10 g Blocking-Reagent 100 ml 1x Maleatpuffer

10x AP-Puffer 1 M Tris pH 9,5 1 M NaCl

TE-Puffer 10 mM Tris 1 mM EDTA

Citratpuffer 0,1 M Zitronensäure pH 6,0 0,1 M Natriumcitrat

18 2.1.8 Geräte

In-situ Hybridisierung und Immunhistochemie:

Computerprogramm für Bilder Image Pro Plus Mikroskop für Floureszenz Nikon Eclipse TE300 pH-Meter WTW pH 325 Photometer Eppendorf Schüttler IKA-VIBRAX-VXR Wärmeschrank Heraeus Wärmewasserbad GFL 3CCD Farbkamera Hitachi HV-C20M (Hitachi Denski, Japan) Mikroskop Axiolab 200 Carl-Zeiss Göttingen

19 2.2 Methoden

Um die in Kapitel 3 dargestellten Ergebnisse zu ermitteln, wurde bei der Versuchsaufstellung nach folgenden Methoden gearbeitet.

2.2.1 Präparation der Mäusegewebe und Herstellung der Schnitte

Für die Präparation des Gewebes aus 15 Organen der Maus wurden Tiere (Maus C57Bl/10ScSn) der Versuchstierkunde der Universität Greifswald verwendet, die mit Diethylether getötet und präpariert wurden. Die entnommenen Organe wurden in 4% Paraformaldehyd (Gewebeeinbettung in Paraffin) gelagert. Die Anfertigung der 2-4 µm dicken Paraffingewebeschnitte wurde vom Institut für Pathologie der Universität Greifswald durchgeführt.

Es wurden folgende Organe untersucht: Gehirn Lunge Herz Leber Milz Dünndarm Niere Pankreas M. gastocnemius M. tibialis anterior Ovar Uterus Hoden Nebenhoden Aorta

2.2.2 DIG-RNA-Sonden Synthese

Das mit Digoxigenin markierte cRNA Fragment, das als Sonde bei der in-situ Hybridisierung eingesetzt wird, wird mit Hilfe der in-vitro Transkription hergestellt. Dazu muss zunächst die zu transkribierende DNA in ein geeignetes Plasmid kloniert werden (hier: pGEM®-T Easy). Dieser Vektor ist mit einem Promoter für eine RNA-Polymerase (SP6 oder T7) ausgestattet. Nach Linearisierung der Template-DNA werden mit Hilfe der RNA-Polymerasen „run-off“- Transkripte erzeugt. Als Substrat für die RNA Synthese wird mit Digoxigenin (ein Digitalisglycosid aus dem roten Fingerhut) verbundenes Uridintriphosphat (UTP) eingesetzt. Unter Standardbedingungen werden aus 1 µg DNA etwa 100 µg RNA transkribiert, wobei 20 etwa jedes 20. bis 25. Nukleotid der neusynthetisierten RNA ein DIG-UTP ist. Das entstandene DIG-markierte cRNA-Fragment liegt als Einzelstrang vor und steht für die Hybridisierung zur Verfügung. Die DIG-RNA-Sonde wird mit dem DIG RNA Labeling Kit (SP6/T7) hergestellt. Die Markierung wird nach dem im Kit enthaltenen Protokoll durchgeführt und die RNA-Sonde bei -80°C gelagert.

2.2.3 in-situ Hybridisierung

Mit der Methode der in-situ Hybridisierung ist es möglich, spezifische Ribonukleinsäuresequenzen in Geweben zu lokalisieren und sie auch innerhalb einer Zelle bestimmten Bereichen zuzuordenen. Ein Digoxigenin-markiertes RNA-Fragment kann als Sonde eingesetzt werden, die sich an Ort und Stelle (in-situ) mit einer komplementären mRNA verbindet und mit Hilfe eines Antikörpers (Anti-DIG-Alkalische Phosphatase) und spezifischen Substraten sichtbar gemacht werden kann. BCIP ist ein Substrat der alkalischen Phosphatase und wird nach seiner Dephosphorilierung oxidativ in einen blauen Indigofarbstoff überführt. NBT dient als Oxidationsmittel, wird ebenfalls in einen blauen Farbstoff umgewandelt und wirkt somit farbverstärkend. Die in-situ Hybridisierung lässt sich in mehrere Abschnitte unterteilen. 1) Vorbereitung des Gewebes auf den Objektträgern 2) Hybridisierung 3) Nachweiß der hybridisierten Sonde Bei der Vorbereitung werden die in Paraffin eingebetteten Gewebeschnitte als erstes in Xylol deparaffinisiert (30 min) und im Anschluss in einer absteigenden Alkoholreihe (Ethanol 100%, 96%, 70% für jeweils 5 min) und 1x PBS (2x 5 min) gespült. Anschließend werden die Schnitte fixiert (4% Paraformaldehyd; in 10x PBS verdünnt; 5 min, pH 7,4), gespült (1x PBS, 3x 5 min) mit Pepsin bei 37°C für 30 min angedaut (60 mg Pepsin und 1312µl 37% HCl auf

80 ml H2O) und wieder gewaschen (1x PBS, 2x 5 min). Nach einer zweiten Fixierung (4% PFA, 20 min) und Spülung (1x PBS, 3x 5 min) folgt die Acetylierung [15 min in 0,1 M TEA (pH 8,0), zu Beginn und nach 5 min jeweils 125 µl Essigsäureanhydrid zugeben]. Die Objektträger werden erneut gewaschen (1x PBS, 3x 5 min und 50% Formamid in 1,5x SSPE, 3x 5 min) und in eine feuchte Kammer gegeben.

21 Hier werden die Schnitte mit einem Fettstift umrahmt und auf jeden wird 50 µl Prähybridisierungspuffer (25 µl Formamid, 25 µl Lösung D, 2,5 µl 10% Blocking und 0,21 µl t-RNA) gegeben. Nach einer Stunde Inkubation bei 56°C wird die markierte und zuvor denaturierte (10 min bei 65°C) Sonde (2 µl auf 48 µl Prähybridisierungspuffer) auf die Schnitte gegeben und für 14-16 Stunden inkubiert (56°C). Am nächsten Tag werden die Schnitte mit Prähybridisierungspuffer (2x 5 min in feuchter Kammer), 2x SSC (3x 5 min wieder in Küvette), 0,1% SSC (3x 5 min) und 1x PBS (3x 5 min) bei Raumtemperatur gewaschen und für eine Stunde in einer Blockierungslösung (12% Tween: 420 µl, 10% Triton: 1 ml, 5 M NaCl: 2 ml, 10% Blocking-Lösung: 5 ml, 2x Maleat:

25 ml, DEPC-H2O: 16,6 ml) geschwenkt. Für den dritten Teil der in-situ Hybridisierung müssen die Gewebeschnitte mit einem mit alkalischer Phosphatase konjugierten DIG-Antikörper versehen [1h in feuchter Kammer, RT, je Schnitt: 0,42 µl 12% Tween, 0,1 µl 10% Triton, 0,5 µl 10% Blocking-Lösung, 25 µl 2x

Maleat, 0,1 µl Anti-DIG-AP (AK 1:1 in Glycerol verdünnt), 18,555 µl DEPC-H2O] und anschließend gewaschen (3x 5 min in 1x Maleat, 0,3% Tween, 0,2% Triton) werden. Die Visualisierung der gebundenen Ribosonden erfolgt nach Waschen mit 1x AP-Puffer mit

0,05M MgCl2 (2x 5 min) und Umäquilibrierung der Schnitte auf einen pH-Wert von 9,5 durch 1x AP-Puffer (1x 10 min) durch die Färbung mit BCIP und NBT bei 37°C und Dunkelheit unter Sichtkontrolle [auf 50 ml H2O: 10 mg BCIP (in 0,5 ml 100% Dimethylformamid gelöst) und 18,8 mg NBT (in 0,25 ml 70% Dimethylformamid gelöst), anschließend steril filtrieren]. Zu der Färbelösung wird Levamisol (11,5 mg) gegeben, um die endogene alkalische Phosphatase zu blocken. Die Färbung wird abgestoppt (1x TE für 5 min), die Schnitte werden gewaschen (5 min 10x PBS, 5 min 1x PBS, 2 min H2O), mit Methylgrün gegengefärbt und mit Glyceringelantine eingedeckt.

22 2.2.4 Indirekte Immunhistochemie

Mit der immunhistochemischen ABC-Methode lässt sich ein bestimmtes Protein mit Hilfe des jeweiligen Antikörpers in einem Gewebe nachweisen. Nach der Verbindung des polyklonalen Antikörpers mit dem Antigen wird ein sekundärer Antikörper, der mit Biotin markiert ist dazugegeben. Biotin ist ein wasserlösliches Vitamin, das durch Avidin gebunden werden kann. Nach Zugabe von Streptavidin (aus dem Bakterium Streptomyces avidinii isoliert) bilden sich Komplexe mit jeweils vier Biotinmolekülen. An den Komplex ist ein Enzym gekoppelt, die Meerrettichperoxidase (HRP= Horseradish Peroxidase), die unter Zugabe eines

Katalysators (H2O2) und des Chromogens DAB (3,3Diaminobenzidin) braune Farbkomplexe bildet. Die Immunhistochemie wurde nach dem Vectastain Standardprotokoll (Vectastain ABC Kit) durchgeführt. Die Immunhistochemie lässt sich in drei Abschnitte unterteilen. 1) Vorbereitung des Gewebes auf den Objektträgern 2) Bildung der Antigen-Antikörperkomplexe 3) Nachweiß der Komplexe durch ein Chromogen Die Paraffinschnitte werden in Xylol (2x 10 min) und einer absteigenden Alkoholreihe (Ethanol 100%, 96%, 70%, je 5 min) deparaffinisiert, danach gespült (Aqua bidest, 5 min) und mit Citratpuffer in der Mikrowelle (4x 5 min) demaskiert. Nachdem die Schnitte wieder auf Raumtemperatur abgekühlt sind, werden sie in 1x PBS (2x 5min) gespült und mit 3%

H2O2 (15 min) behandelt, um die endogenen Peroxidasen zu blockieren. Nach erneutem Waschen (1x PBS, 2x 5 min) und umlagern in eine feuchte Kammer, werden alle unspezifischen Reaktionen mit dem Vectastain Blocking-Reagenz (20 min, RT) geblockt. Mit dem Primärantikörper (1:100 oder 1:200) werden die Präparate für 2 Stunden bei Raumtemperatur inkubiert, danach gewaschen (1x PBS mit 0,05% Tween, 2x 5 min; 1x PBS, 5 min) und für 30 min mit dem biotinylierten Sekundärantikörper bedeckt. Die Schnitte werden gewaschen (1x PBS mit 0,05% Tween, 2x 5 min; 1x PBS, 5 min) und für 30 Minuten mit dem Vectastain ABC Reagenz versehen. Diese Lösung enthält Streptavidin und biotinylierte Meerrettich-Peroxidase. Die Präparate werden gespült (1x PBS, 2x 5 min) bevor sie mit 100 µl pro Schnitt für eine bis fünf Minuten entwickelt werden können (zu 10 ml PBS

1 Tablette DAB + 10 µl 30% H2O2, filtrieren). Die Reaktion wird mit Leitungswasser abgestoppt und die Schnitte danach in Aqua dest. gestellt. Mit Hämatoxylin wird eine Kern- Gegenfärbung gemacht nach der die Präparate mit Kaiser Gelantine eingedeckt werden.

23 2.2.5 Indirekte Immunfluoreszenz

Als zusätzlichen Proteinnachweis in den 15 Geweben (siehe oben) für die drei Ionenkanäle TRPC3, TRPC6 und TRPV5 wurde eine indirekte Immunfluoreszenz durchgeführt, bei der bei bestimmten Wellenlänge die Antigen-Antikörper-Sekundärantikörper Konglomerate mit einem Fluoreszenzmikroskop nachgewiesen werden können. Die Immunhistochemische Untersuchung lässt sich in 3 Schritte einteilen. 1. Entparaffinieren 2. Antikörperinkubation 3. Gegenfärbung Die Paraffingewebeschnitte werden in Xylol (2x 10 min) und Ethanol (100%, 96%, 70% je 5 min) entparaffiniert, anschließend in Aqua bidest gewaschen und in Citratpuffer (pH 6,0) in der Mikrowelle gekocht (4x 5 min). Der Flüssigkeitsverlust wird mit Aqua bidest ausgeglichen. Die Schnitte kühlen über eine Stunde bei Raumtemperatur ab. Danach werden die Objektträger in 1 x PBS gewaschen (2x 5 min), mit PAPPEN umrandet, in eine feuchte Kammer gegeben und für 20 min geblockt mit dem Blocking Reagenz aus dem Immunhisto Kit Vectastain ABC (3 Tropfen auf 10 ml 1x PBS). Im Anschluss werden die Objektträger erneut gewaschen (2x 5 min 1x PBS und 3x 5 min Tris/HCl pH 7,4) und über Nacht mit dem Primärantikörper (verdünnt in ChemMate) in der feuchten Kammer bei 4°C inkubiert. Am nächsten Tag, nach Abspülen der Objektträger (Tris/HCl + 0,02% Tween) und Waschen in der Küvette (Tris/HCl + 0,02% Tween 1x 5 min), werden die Schnitte mit dem Sekundärantikörper Anti-Rabbit IgG Alexa 568 (Verdünnung: 1:500 in 1x Tris/HCl) für 2-3 Stunden bei Raumtemperatur inkubiert. Die Objektträger werden gespült (Tris/HCl + 0,02% Tween) und in der Küvette für 5 min ebenfalls mit Tris/HCl + 0,02% Tween gewaschen. Für die Kerngegenfärbung werden die Präparate 2x 5 min mit 1x Tris/HCl auf den Schüttler gewaschen, um danach für 10 min bei Raumtemperatur in der feuchten Kammer mit Sytox Green (5 mM Sytox Green-Stammlösung 1:50000 in DMSO) inkubiert zu werden. Die Objektträger werden noch 2x 5 min in 1x Tris/HCl gewaschen und feucht eingedeckelt mit Fluorescent Mounting Medium. Anschließend können die Ergebnisse unter dem Fluoreszenzmikroskop bei den Anregungswellenlängen von 488 und 568 nm ausgewertet und mit einer CCD Kamera festgehalten werden.

24 2.2.6 Real-Time TaqMan® Polymerase Kettenreaktion

Das TaqMan PCR system 5700 Sequence Detektor wurde für die quantitative Expressionsanalyse mittels Real-Time RT-PCR verwendet. Durch die Real Time-PCR kann man den Verlauf einer PCR-Reaktion verfolgen und das gebildete Produkt relativ zu seinem Standard quantifizieren. Neben den üblichen Oligonukleotidprimern für die Amplifikation benötigt man ein beidseitig markiertes Oligonukleotid (TaqMan-Sonde) für die Detektion des gebildeten Produkts. Diese Sonde trägt an ihrem 5`-Ende einen fluoreszierenden „Reporter“- Farbstoff und an ihrem 3`-Ende einen „Quencher“-Farbstoff. Befinden sich die beiden Farbstoffe in enger räumlicher Nähe, wird die Emission des Reporter-Farbstoffes unterdrückt. Trifft nach der Hybridisierung der Primer und der Sonden mit dem Matritzenstrang die Taq Polymerase im Verlauf der DNA-Synthese auf eine Sonde, so wird diese vom Matrizenstrang verdrängt und durch die 5´-3´-Exonuclease-Aktivität der Taq Polymerase geschnitten. Der fluoreszierende „Reporter“-Farbstoff wird somit in zunehmendem Maße freigesetzt und entfernt sich räumlich von dem „Quencher“-Farbstoff. Die freien „Reporter“-Farbstoffe geben nun ihre Fluoreszenzstrahlung ab. Es werden nur Sonden, die während der PCR an einen DNA-Strang anlagern, hydrolysiert. Auf diese Weise korreliert das Ansteigen des Fluoreszenzsignals in der exponentiellen Phase der PCR direkt mit der Zunahme des PCR- Produktes. Dieses Signal wird mit Hilfe des TaqMan PCR system 5700 Sequence Detektor Zyklus für Zyklus erfasst. Der Reaktionsansatz des PCR-Genmixes für die TaqMan®-PCR enthielt die spezifischen sense- und antisense- Primer, die genspezifische Sonde, den 1x TaqMan Universal Mastermix und reines Wasser. Zu 39,6 µl PCR-Genmix wurden 4,4 µl cDNA als „template“ hinzugefügt. Die Proben wurden als Doppelbestimmung zu je 20 µl in eine 96-well- Mikrotiterplatte pipettiert, die mit einer Klebefolie verschlossen wurde. Die TaqMan Real- Time PCR erfolgte unter folgenden Bedingungen:

2 min 50°C 10 min 95°C 40 Zyklen {15 sec 95°C und 1 min 60°C}

Bei der TaqMan PCR werden bekannte Mengen der Ziel-cDNA als Standardkurve als Referenz amplifiziert. Die sogenannten CT-Werte werden dann in Abhängigkeit von der

25 Standard-cDNA-Menge anhand des Auswertungsprogramms aufgetragen und dienen als Bezug für die Messwerte der Proben. Die Auswertung wurde für n=3-5 Tiere pro Gen und Gewebe durchgeführt. Die Daten wurden mit Hilfe der TaqMan PCR system 5700 Software und einem Tabellenkalkulationsprogramm (Microsoft Excel) analysiert. Des Weiteren wurde der Student´s t-Test mittels „Sigma Plot“- Programm untersucht und signifkante Änderungen bestimmt.

26 3. Ergebnisse

Zur Charakterisierung der ausgewählen Kanäle wird im Folgenden zunächst die quantitative Lokalisation mittels RT-PCR und nachfolgend organgeordnet die subzelluläre Analyse mittels in-situ Hybridisierung und Immunhistochemie aufgeführt. Am Ende des Kapitels werden die Ergebnisse aller Untersuchungen in einer Tabelle zusammengefasst und semiquantifiziert.

3.1 Quantitative RT-PCR für TRPC3, TRPC6 und TRPV5

Die quantitative Ermittlung der mRNAs der drei genannten Ionenkanäle erfolgte mittels „Real-time“ RT-PCR. Untersucht wurden 100 Tage alte Tiere der Population Maus C57 Bl/10. Die benötigte cDNA wurde aus RNA aus unterschiedlichen Geweben der Maus (siehe unten) isoliertert und vom Institut für Pathophysiologie zur Verfügung gestellt.

Es wurden folgende Gewebe getestet: Großhirn Herz M. gastrocnemius Vorderhirn Niere M. tibialis anterior Kleinhirn Leber Hoden Hirnstamm Milz Nebenhoden Hippocampus Aorta Ovar Lunge Zwerchfell

Die Analyse erfolgte wie im Abschnitt 2.2.10 beschrieben, wobei die spezifische mRNA- Quantität nach Auswertung als Quotient (Ionenkanal mRNA / 18s rRNA) dargestellt wurde.

Die Ergebnisse der „Real-time“ RT-PCR sind in Abbildung 3.1 zusammengefasst (siehe unten). Dieser Abbildung ist zu entnehmen, dass TRPC3 der insgesamt am stärksten exprimierte Kanal war. TRPC6 wies ein vergleichbares Expressionsmuster auf, jedoch in geringerer Ausprägung. TRPV5 wurde in den untersuchten Geweben, außer der Niere, nur auf sehr geringem Niveau nachgewiesen. Im zentralen Nervensystem dominierten TRPC3 und TRPC6. Im Großhirn ließen sich ähnliche Quantitäten der beiden Kanäle bestimmen. Insbesondere im Kleinhirn, jedoch auch

27 im Hirnstamm und Hippocampus war das Vorkommen von TRPC3 deutlich stärker ausgeprägt. In der quergestreiften und glatten Muskulatur überwog TRPC3 deutlich im Vergleich zu TRPC6. TRPV5 war gar nicht, beziehungsweise in der Wadenmuskulatur sehr gering nachweisbar. In der Niere wurde eine sehr starke Expression von TRPV5 detektiert, während TRPC3 etwa ein Drittel so stark wie TRPV5 und TRPC6 nur in geringem Maße vorkam. In Leber und Milz konnten nur wenige mRNA-Kopien von TRPC6 und TRPV5 nachgewiesen werden. Lediglich TRPC3 wurde in der Milz in einer vergleichbaren Konzentration wie in der Niere exprimiert. In der Lunge dominierten TRPC3 und TRPC6. In den Geschlechtsorganen Ovar, Hoden und Nebenhoden kamen nur geringe Mengen der mRNA von TRPV5 und TRPC6 vor. TRPC3 wurde im Ovar in ähnlicher Ausprägung wie in Niere und Milz exprimiert.

28

A 0,03

0,025

0,02

0,015

0,01

copies TRPC3/18S rR TRPC3/18S copies 0,005

0

liver lung testis heart aorta kidney spleen ovary cerebrum forebrain epididymis cerebellum diaphragm hippocampus truncus encephali m.tibialis anteriorm. gastrocnemius

B 0,012

0,01

0,008

0,006

0,004

copies TRPC6/18S rR TRPC6/18S copies 0,002

0

liver lung testis heart aorta kidney spleen ovary cerebrum forebrain epididymis cerebellum diaphragm hippocampus truncus encephali m.tibialis anteriorm. gastrocnemius

C 0,025

0,02

0,015

0,01

copy numbers TRPV5/18S r TRPV5/18S numbers copy 0,005

0

liver lung testis heart aorta kidney spleen ovary forebrain epididymis cerebrum cerebellum diaphragm hippocampus truncus encephali m.tibialis anteriorm. gastrocnemius Abbildung 3.1: Real-time PCR von (A) TRPC3; (B) TRPC6 und (C) TRPV5 in verschiedenen Organen und

Geweben der Maus. Angegeben sind Mittelwert und Standardfehler für n=3-10 Tiere.

29 3.2 In-situ Lokalisation von TRPC3, TRPC6 und TRPV5

Im folgenden Abschnitt werden Ergebnisse der Untersuchungen der spezifischen Expressionsorte der Ionenkanäle TRPC3, TRPC6 und TRPV5 an den Gewebeschnitten der Maus beschrieben und die aus den unterschiedlichen Methoden gewonnenen Erkenntnisse einander gegenüber gestellt. Die Lokalisation der mRNA Expressionsorte lässt sich mit Hilfe der nicht radioaktiven in-situ Hybridisierung bestimmen. Es wurden die unter 2.2.2 (Material und Methoden) beschriebenen Digoxigenin-markierten cRNA-Sonden verwendet. Dabei dienten die antisense-cRNA- Sonden dem spezifischen Nachweis der mRNA im Gewebe, da sie komplementär zu deren Sequenzen sind. Als interne Negativkontrolle wurden die sense-cRNA-Sonden genutzt. Für den Proteinnachweis mittels Immunhistochemie wurden polyklonale Antikörper verwendet (siehe Kapitel Material und Methoden, Abschnitt 2.2.4 und 2.2.5). Als Kontrolle für die Peroxidaseimmunhistochemie diente ein Gewebeschnitt, der statt mit dem in PBS Puffer verdünnten Antikörper, nur mit Phosphatpuffer (1x PBS) inkubiert wurde. Für die Fluorenszenzimmunhistochemie wurde als Kontrolle der mit seinem spezifischen Antigen geblockte Antikörper verwendet. Bei den Organen, aus denen die untersuchten paraffinfixierten Gewebeschnitte gefertigt wurden, handelt es sich um folgende: Gehirn Dünndarm Ovar Lunge Niere Uterus Herz Pankreas Hoden Leber M. gastocnemius Nebenhoden Milz M. tibialis anterior Aorta

Die Gewebe der in-situ Hybridisierung wurden mit Methylgrün, die der Peroxidase Immunhistochemie mit Mayers Hämalaun und die der Fluoreszenz Immunhistochemie mit Sytox Green gegengefärbt. Dadurch wurden Erkenntnisse über den Zelltyp und die Struktur der Zelle gewonnen.

30 3.2.1 Etablierung der in-situ Sonden

Bei der in-situ Hybridisierung wurden die aussagekräftigsten Ergebnisse mit dem in 2.2.3 beschriebenen Vorgehen erzielt. In vorausgegangenen Versuchen mit RNAse Verdau oder unverdünnten Sonden wurden keine eindeutigen Ergebnisse erzielt. Die optimale Sondenkonzentration beträgt 100 ng auf 50 µl Prähybridisierungsmix. Bei der Peroxidase-Immunhistochemie wurde ein vorgefertigtes Kit benutzt und die Untersuchung nach dem Vectastain Protokoll durchgeführt. Der Antikörper wurde mit einer Verdünnung von 1:100 auf die Schnitte aufgetragen. Die optimale Inkubationszeit beträgt 1 Stunde. Bei der Fluoreszenz Immunhistochemie wurde wie in 2.2.5 verfahren. Als beste Verdünnung des Primärantikörpers stellte sich 1:100 heraus. Die optimale Inkubationszeit mit dem Sekundärantikörper beträgt 2,5 Stunden.

3.2.2 Kontrollen und Korrespondenzgewebe

Die in diesem Abschnitt beschriebenen Negativkontrollen wurden bei jeder Untersuchung für jedes Gewebe angefertigt. Im Folgenden ist exemplarisch für jeden Kanal eine Negativkontrolle aufgeführt. Für TRPC3 und TRPC6 zeige ich die Negativkontrolle an Schnitten des Kleinhirns und für TRPV5 an der Niere. In der Abbildung 3.2 A zeigt sich bei Verwendung der TRPC3 Sonden ein spezifisches Signal, in Form einer dunkelblau/violetten Färbung, in den Purinjezellen des Stratum ganglionare und in den Körnerzellen des Stratum granulosum. Die Kontrolle mittels Sense- cRNA bindet dagegen nicht an die mRNA dieser Zellen; hier zeigt sich neben der grünen Zellkernfärbung mittels Methylgrün kein weiteres Signal. In der Abbildung 3.2. C ist der Proteinnachweis dargestellt; hier lässt sich das Signal in den gleichen Zellen noch deutlicher detektieren; man sieht ein positives Signal, in Form eines braunen Farbniederschlags in den Purkinjezellen, den Körnerzellen und auch ein schwaches Signal in wenigen Zellkernen des Stratum moleculare. Im Kleinhirnmark sind die Dendriten und die Zellen der Markscheiden nicht anzufärben. Hier ist TRPC3, sowohl auf RNA, als auf Proteinbasis nicht zu detektieren. Die Zellkerne sind mit einer Hämatoxylingegenfärbung blau dargestellt (Vgl. Abb. 3.2 C und D).

31

B A e f g

C D e f

g

Abbildung 3.2: TRPC3 im Kleinhirn: A+B in-situ Hybridisierung (200x Vergrößerung), A= Antisense RNA, B= Sense (Kontrolle), C+D indirekte Immunhistochemie (200x Vergrößerung), C= Antikörper, D= Kontrolle. Pfeil= Purkinjezellen, e= Kleinhirnmark, f= Stratum granulosum, g= Stratum moleculare

Wie bei den TRPC3-cRNA-Sonden liegt auch bei der Verwendung der TRPC6-Sonden (vgl. Abb. 3.3 A und B) im Kleinhirn ein positives Signal in den Purkinjezellen des Stratum ganglionare vor. Die Sense-cRNA bindet dagegen nicht an der TRPC6-mRNA. In Abbildung 3.3 C und D ist auch beim Poteinnachweis von TRPC6 eine deutliche Antikörperfärbung der Purkinjezellen in Form einer braunen Färbung zu detektieren. Die Körnerzellen zeigen im mRNA- und Proteinnachweis eine diskrete Anfärbung. Im Kleinhirnmark und den Zellen des Stratum moleculare ist keine spezifische Färbung zu erkennen. Eine Zellkerngegenfärbung wurde auch hier, wie auch im Folgenden, für alle Peroxidase-Immunhistochemien mit Hämatoxylin und für die in-situ Hybridisierung mit Methylgrün durchgeführt (vgl Abb. 3.2 und Abb. 3.3).

32

A B g f g

f

C D

f e f

g e g

Abbildung 3.3: TRPC6 im Kleinhirn: A+B in-situ Hybridisierung (400x Vergrößerung), A= Antisense RNA, B= Sense (Kontrolle), C+D indirekte Immunhistochemie (200x Vergrößerung)C= Antikörper, D= Kontrolle. Pfeil= Purkunjezellen, e= Kleinhirnmark, f= Stratum granulosum, g= Stratum moleculare

In Abbildung 3.4 ist die Verwendung der TRPV5 Sonden dargestellt; hier lässt sich ein deutliches Signal für die mRNA von TRPV5 in einigen Abschnitten des Tubulussystem der Niere finden. Die violette Färbung zeigt sich in Tubuluszellen, die dem distalen Abschnitt zuzuordnen sind (Vgl Abb. 3.4 A und C, Stern). Im proximalen Abschnitt und den Sammelrohren lässt sich keine spezifische Anfärbung erkennen. Der mRNA Nachweis für TRPV5 ist weiterhin positiv für die Zellen der Bowman-Kapsel der Glomeruli (siehe Abb. 3.4 A, e); die weiteren Anteile der Glomeruli sind nicht angefärbt. Beim Proteinnachweis mittels indirekter Immunfluoreszenz (in Abbildung 3.4 C und D dargestellt) zeigt sich bei Bestrahlung mit einer Wellenlänge von 568 nm ein spezifisches Signal für TRPV5, in Form einer roten Fluoreszenz in den Zellen des distalen Tubulus. In der Kontrolle, bei der der Antikörper zuvor durch eine Peptidblockung gebunden wurde, lässt sich bei der spezifischen Wellenlänge keine Signalanhebung beobachten. In anderen Zellen der Niere ist TRPV5 auf Proteinebene nicht nachzuweisen. Bei einer Wellenlänge von 488 nm zeigen sich, mittels einer Gegenfärbung mit Sytox Green, die Zellkerne in einer grün fluoreszierenden Färbung (Vgl. Abb. 3.4 C und D).

33

A B f

e e

C D

e e f

Abbildung 3.4: TRPV5 in der Niere: A+B in-situ Hybridisierung (200x Vergrößerung), A= Antisense RNA, B= Sense (Kontrolle), C+D indirekte Fluoreszenzimmunhistochemie (200x Vergrößerung), C= Antikörper, D= Kontrolle mittels Peptidblock. Pfeil= Bowman-Kapsel, e= Glomeruli, f= proximaler Tubulus, Stern= distaler Tubulus

34 3.2.3 In-situ Lokalisation im Gehirn

Beim Nachweis von TRPC3-mRNA und -Protein im Großhirn zeigt sich ein positives Signal in den Zellen des Großhirnkortex, insbesondere der Pyramidenzellen; weniger deutlich kann der Kanal in den Zellen des Hippocampus nachgewiesen werden. Die Zellen des Ventrikelependyms zeigen die stärkste Anfärbung. In den Gliazellen lässt sich kein Signal detektieren (Daten nicht gezeigt). Die Gewebeschnitte für das Kleinhirn sind im Vorkapitel gezeigt (vgl. Abb. 3.2). Die TRPC3 Sonden zeigen ein spezifisches Signal in den Purinkjezellen des Stratum ganglionare und in den Körnerzellen des Stratum granulosum. Im Kleinhirnmark, in dem sich die Dendriten und die Zellen der Markscheiden befinden, kann TRPC3 sowohl auf RNA als auch auf Proteinbasis nicht detektiert werden. TRPC6 verhält sich insgesamt ähnlich wie TRPC3, mit einer deutlichen Detektion auf Protein- und mRNA-Ebene in der Großhirnrinde, dem Hippocampus und dem Ventrikelependym. Insgesamt ist die Anfärbung etwas schwächer als bei TRPC3. Im Kleinhirn ist das Vorkommen ebenfalls im Vorkapitel gezeigt (Abbildung 3.3). Hier gelang ein Nachweis von TRPC6 in den Purkinjezellen des Stratum ganglionare. Die Körnerzellen zeigen im mRNA- und Proteinnachweis eine diskrete Anfärbung. Im Kleinhirnmark und den Zellen des Stratum moleculare ist keine spezifische Färbung zu erkennen. TRPC6 wird in den Pyramidenzellen des Hippocampus (siehe Abb. 3.5), nicht aber in den Zellen der Körnerschicht des Gyrus dentatus exprimiert. Ebenso kommt es zu einer deutlichen Anfärbung in der Immunhistochemie für die Pyramidenzellen der äußeren und inneren Pyramidenschicht der Großhirnrinde, während die Interneurone der Körnerzellschicht keine Expression von TRPC6 aufweisen (Siehe Abb. 3.5 A,B + C). Die mRNA von TRPV5 kann in den Pyramidenzellen der Großhirnrinde und im Ependym des Ventrikels nachgewiesen werden; im Gewebeanschnitt der Immunhistochemie sind diese Bereiche nicht beurteilbar. Ebenso kann das Vorliegen von TRPV5 im Hippocampus in den vorliegenden Anschnitten nicht sicher beurteilt werden. Die Ganglienzellen im Großhirnmark zeigen keine spezifische Anfärbung. Im Kleinhirnmark, dem Stratum moleculare und dem Stratum granulosum der Kleinhirnrinde ist ebenfalls kein Nachweis zu führen. Die Purkinjezellen zeigen jedoch eine deutliche Expression von TRPV5 auf Protein- und mRNA- Ebene (siehe Abbildung 3.5 D + E).

35

A B

h h

i

C

k

m

E D

f g f g

Abbildung 3.5: A+B Hippokampus: A Floureszenzimmunhistochemie TRPC6 (200x Vergrößerung), B Peroxydase Immunhistochemie TRPC6. C Großhirnrinde Peroxydaseimmunhistochemie TRPC6. h=Pyramidenzellen des Hippokamus, i= Körnerzellen des Gyrus dentatus, k= Pyramidenzellen der Großhirnrinde; m= Interneurone der Großhirnrinde D+E Kleinhirn: D in-situ Hybridisierung Antisense RNA TRPV5 (200x Vergrößerung), E indirekte Fluoreszenzimmunhistochemie TRPV5 (200x Vergrößerung). Pfeil= Purkunjezellen, f= Stratum granulosum, g= Stratum moleculare

36 3.2.4 In-situ Lokalisation in der Lunge

In Abbildung 3.6 ist das Protein TRPC3 und die zugehörige mRNA in der Lunge sowohl im Bronchialepithel und, etwas weniger deutlich, in den Alveolardeckzellen (Pneumozyten Typ I) nachweisbar. In den Zellen der glatten Muskulatur, die den Bronchioli dicht anliegt, kann die mRNA von TRPC3 detektiert werden; der indirekte Proteinnachweis gelang nicht. Das Endothel und die glatte Muskulatur der Arteriolen färben sich ebenfalls spezifisch in der in- situ Hybridisierung und der indirekten Immunhistochemie. Im weiteren Bindegewebe kann keine spezifische Anfärbung beobachtet werden (siehe Abbildung 3.6, A und B). TRPC6 zeigt sich besonders in den Zellen des Bronchialepithels und der Alveolardeckzellen sowohl auf RNA als auch auf Proteinebene. Eine leichte Anfärbung im indirekten Proteinnachweis gelang in der glatten Muskulatur der Bronchioli; mRNA ließ sich nicht nachweisen. In den Arteriolen kann RNA und das Kanalprotein sowohl in den Endothezellen, als auch in der Tunica muskularis vasorum nachgewiesen werden. Im Bindegewebe wird TRPC6 nicht exprimiert (siehe Abbildung 3.6, C und D). TRPV5 findet sich ebenfalls in den Epithelien der Bronchien und Bronchioli, sowie den Pneumozyten Typ I, nicht dagegen im Bindegewebe und den angeschnittenen Blutgefäßen (dargestellt in Abbildung 3.6 E und F).

A B

g

g

C D g

g

37 E F

g

g

Abbildung 3.6: Lunge: A in-situ Hybridisierung Antisense RNA TRPC3 (200x Vergrößerung), B indirekte Peroxydaseimmunhistochemie TRPC3 (200x Vergrößerung). C in-situ Hybridisierung Antisense RNA TRPC6 (200x Vergrößerung), D indirekte Peroxydaseimmunhistochemie TRPC6 (200x Vergrößerung), E in-situ Hybridisierung Antisense RNA TRPV5 (200x Vergrößerung), F indirekte Fluoreszenzimmunhistochemie TRPV5 (200x Vergrößerung). Pfeil= Bronchialepithel, g= Alveolaren, umgeben von Pneumozyten.

3.2.5 In-situ Lokalisation im Herzmuskel und der Aorta

Das Herz kann in drei Schichten, das Endokard, das Myokard und das Epikard eingeteilt werden. In den Schnitten konnte lediglich das Myokard dargestellt werden (Daten nicht dargestellt). Hier finden sich Kardiomyozyten, die für die Kontraktion und solche, die für das Reizleitungssystem zuständig sind. TRPC3 findet sich in dieser Schicht. Auch TRPC6 ist zu detektieren, doch kommt es bei der indirekten Immunhistochemie hier zu einem inhomogenen Verteilungsmuster, so dass eine Zuordnung im Rahmen der Funktion der beiden verschiedenen Zelltypen möglich erscheint. Etwa 60-70% der Zellen zeigen eine spezifische Anfärbung im Zytoplasma und um den Zellkern herum. TRPV5 ist ebenfalls auf Proteinebene, mit Hilfe der indirekten Immunfluoreszenz, im Zytoplasma der Kardiomyozyten zu finden. In der innersten Schicht der Aorta, der Tunica intima die das Endothel beinhaltet, kann eine Lokalisation von TRPC3, -C6 und -V5 auf Grund der geringen Schichtdicke nur vermutet werden. Beim Fluoreszenzsignal, das sich deutlicher gegen die Gegenfärbung abhebt, gelingt eine Detektion von TRPV5. In der Tunica media, die in der Aorta zu größten Teil aus Elastin besteht, zeigen sich Farbsignale für alle drei Proteine. In der Tunica adventitia ist keiner der drei untersuchten Kanäle zu detektieren (Daten nicht dargestellt).

38 3.2.6 In-situ Lokalisation in der Leber

In der Leber lässt sich in den Hepatozyten für TRPC3 ein deutliches Signal auf mRNA so wie auf Proteinebene finden. Das Gallengangsepithel, das in den Periportalfeldern zu finden ist, weist eine Exprimierung auf, die im Vergleich zu den Hepatozyten schwächer ist. Angeschnittene Gefäße weisen kein spezifisches Färbeverhalten auf. TRPC6 lässt sich in gleicher Lokalisation wie TRPC3 finden; es zeigt sich eine kräftige homogene Anfärbung im Zytoplasma der Hepatozyten und eine schwache Anfärbung im Gallengangsepithel, in den Hepatozyten und, etwas schwächer, im Epithel der Gallengänge. Auch mRNA und Protein des Kanals TRPV5 werden in den Hepatozyten exprimiert. Im Vergleich mit dem mRNA Nachweis von TRPC3 und TRPC6 ergeben sich keine Unterschiede in Ausprägung des Färbeverhaltens. Bei Vergleich des Signals der indirekten Immunfluoreszenz ergibt sich ein deutlicher Unterschied zwischen dem deutlichen Signal von TRPC3 und C6 und einem sehr schwachen Signal von TRPV5. Angeschnittene Gefäße zeigen auch hier keine spezifische Anfärbung (Daten werden nicht abgebildet).

3.2.7 In-situ Lokalisation in der Milz

In der Milz zeigt sich TRPC3 mRNA und Protein durch eine homogene Anfärbung des Zytoplasmas der Zellen der weißen Pulpa bzw. der des Primärfollikels, der das lymphatische Gewebe enthält. In der roten Pulpa zeigt sich keine Anfärbung für TRPC3 mRNA oder Protein. In der Rinde und Organkapsel zeigt sich ebenfalls keine Expression von TRPC3. Milztrabekel sind für eine Beurteilung nicht ausreichend dargestellt (Daten nicht abgebildet). Die Expression von TRPC6 lässt sich, im Gegensatz zu TRPC3 in Zellen der roten Pulpa zeigen. In den Zellen der weißen Pulpa zeigt sich keine spezifische Anfärbung für TRPC6. Auch liegt für TRPC6 keine Anfärbung der Organkapsel vor (Daten nicht gezeigt). Die mRNA, die für TRPV5 codiert, kann in starker Ausprägung in der lymphozytenreichen weißen Pulpa um die Milzfollikel herum lokalisiert werden. Die Ergebnisse des mRNA Nachweis stimmen mit den Proteinnachweisen überein (Daten nicht gezeigt).

39 3.2.8 In-situ Lokalisation im Dünndarm

In der Abbildung 3.2.8.1 sind die Gewebeschnitte des Dünndarmes dargestellt, hier sieht man Zotten und Krypten, die aus den Schichten der Mukosa und Submukosa, mit vereinzelt darin liegenden glatten Muskelzellen aufgebaut sind. Außerdem ist die darunter liegende glatte Muskulatur mit angeschnitten. TPRC3 lässt sich in den Enterozyten auf mRNA-Ebene nachweisen, was an Hand der ausgeprägten violett-blauen Färbung deutlich zu erkennen ist. Die Färbung nimmt im Bereich der Krypten zu. Die Proteinfärbung zeigt ein ähnliches Signal; hier ist außerdem eine Betonung der Färbung im basalen, zellkernnahen Teil der Zelle zu erkennen. Die Becherzellen färben sich dagegen nicht an. In der Lamina submucosa ist eine schwächere Färbung für TRPC3 auf mRNA-Ebene zu beobachten; das Kanalprotein zeigt sich dagegen nicht. Die Myozyten der glatten Muskulatur der Lamina muscularis mukosae enthalten weder mRNA, noch Eiweißstrukturen von TRPC3 (Vergl. Abbildung 3.7 A und B). Die mRNA und das Protein von TRPC6 lassen sich ebenfalls in den Enterozyten nachweisen. Im Gegensatz zu dem basalbetonten TRPC3 Kanal zeigt sich der TRPC6 Kanal auch weiter apikal gelegen. Die Becherzellen sind auch hier nicht angefärbt. In der Lamina submucosa erhalten wir ein unsicheres, sehr schwaches Signal. In den Myozyten der Lamina muscularis mucosae wird ebenso wie bei TRPC3 keine mRNA oder Protein für TRPC6 exprimiert (siehe Abb. 3.7 C und D). In Abbildung 3.7 E und F ist der Nachweis von TRPV5 dargestellt; hier konzentriert sich die spezifische Färbung für den mRNA-Nachweis noch deutlicher auf den apikalen Teil der Enterozyten. Auch der Kanal selbst ist im apikalen Teil der Zelle deutlich nachzuweisen. Eine Exprimierung in der Lamina submucosa liegt nicht vor. Im Gegensatz zu den beiden, im Voraus beschriebenen Kanälen ist für TRPV5 in den Zellen der glatten Muskulatur ein Signal zu detektieren, das jedoch schwächer ist, als die Färbung in den Enterozyten. Allen drei Kanälen gemein ist, dass sich ein deutlicheres Färbeverhalten in den Zellen der Krypten als in denen der Zotten zeigt. In den Krypten befinden sich vor allem enteroendokrine und exokrine Zellen, wie die Paneth-Körnerzellen und Stammzellen der Enterozyten, während in den Zotten ausgereifte Enterozyten vorherrschen.

j

40 A B j j

g k g

h

h C g D

j

j g h h

E F j h

g g j

h

Abbildung 3.7: Dünndarm: A in-situ Hybridisierung Antisense RNA TRPC3 (200x Vergrößerung), B indirekte Peroxydaseimmunhistochemie TRPC3 (200x Vergrößerung), C in-situ Hybridisierung Antisense RNA TRPC6 (200x Vergrößerung), D indirekte Peroxydaseimmunhistochemie TRPC6 (200x Vergrößerung), E in-situ Hybridisierung Antisense RNA TRPV5 (200x Vergrößerung), F indirekte Fluoreszenzimmunhistochemie TRPV5 (200x Vergrößerung), Pfeil= , g= Lamina submucosa, h= Enterozyten, j= lamina muskularis mucosae, k= Becherzelle

3.2.9 In-situ Lokalisation in der Niere

In den Schnitten der Niere konnten die Organteile Glomerulus, proximaler und distaler Tubulus mit Henle´scher Schleife dargestellt werden (siehe Abb. 3.4). Eine sichere histologische Zuordnung der Tubulusanteile gestaltete sich schwierig; anhand des 41 Färbeverhaltens ist jedoch deutlich, dass die untersuchten Kanäle jeweils nur in einigen Teilen des Tubulussystems exprimiert werden. TRPC3 zeigt kein Vorkommen in den Zellen der Glomeruli, einschließlich der Bowman- Kapsel. In den Zellen des Tubulussystems, am ehesten im distalen Tubulus, kann im Gegensatz zum proximalen Teil eine deutliche Anfärbung in der In-situ Hybridisierung und der Immunhistochemie detektiert werden. In der Untersuchung zum Vorkommen von TRPC6 fehlt die spezifische Färbung ebenso wie bei TRPC3 in den Zellen der Bowman-Kapsel und im Kapselraum. In einem Teil des Tubulussystems, hier wahrscheinlich auch der distale Abschnitt, kann die Expression durch eindeutige Anfärbung nachgewiesen werden. Die Gewebeschnitte der Niere für den Nachweis von TRPV5 sind im Kapitel 3.2.2 bereits dargestellt. Für TRPV5 ist im proximalen Abschnitt des Tubulus und den Sammelrohren keine spezifische Anfärbung zu erkennen. Der mRNA Nachweis für TRPV5 ist positiv für die Zellen der Bowman-Kapsel der Glomeruli (siehe Abb. 3.4 A, e); die weiteren Anteile der Glomeruli sind nicht angefärbt. Beim Proteinnachweis mittels Immunfluoreszenz (Abbildung 3.4 C und D) zeigt sich ein spezifisches Signal für TRPV5 in den Zellen des distalen Tubulus.

3.2.10 In-situ Lokalisation im Pankreas

In den Gewebeschnitten des Pankreas (Abb. 3.8) sind der exokrine Teil mit den serösen zentro-azinären Zellen und der endokrine Anteil in Form der Langerhans-Inseln zu erkennen. TRPC3 mRNA und Protein lassen sich in den Zellen des exokrinen Pankreasgewebes nachweisen. Die deutliche Färbung der serösen exokrinen Zellen ist basal betont. Hier befinden sich die Zellorganelle. Im apikalen Teil befindet sich die Sektretgranula; hier ist weniger spezifische Anfärbung für mRNA und Kanalprotein nachweisbar. In der Peroxidase Immunhistochemie, im Gegensatz zur RNA Detektion, ist auch in den Zellen der Langerhans- Inseln eine zarte braune Färbung zu finden. Zur Objektivierung wurde auch hier eine inrekte Immunfloureszenz durchgeführt. Es zeigt sich ein deutliches Signal in allen Drüsenzellen des Pankreas; die endokrinen Zellen sind hier noch deutlicher gefärbt als die exokrinen. Bei TRPC6 ist eine Färbung in der In-situ Hybridisierung und, äquivalent dazu, in der Immunhistochemie des basalen Zytoplasmas der exokrinen Pankreaszellen zu erkennen. Der endokrine Teil ist wiederum im Proteinnachweis deutlich gefärbt, während die mRNA Detektion nicht sicher gelingt.

42 Für TRPV5 zeigt sich ein widersprüchliches Ergebnis. Die exokrinen Zellen sind in der in- situ Hybridisierung angefärbt, während in der Immunfluoreszenz bei der spezifischen Wellenlänge kein Signal detektiert werden kann. Die Expression in den Langerhans Inseln ist jedoch deutlich zu erkennen. Für alle Kanäle gilt, dass in den angeschnittenen Gefäßen keine Expression vorliegt (siehe Abb 3.8).

A B

C D

E F

Abbildung 3.8: Pankreas: A in-situ Hybridisierung Antisense RNA TRPC3 (200x Vergrößerung), B indirekte Peroxydaseimmunhistochemie TRPC3 (200x Vergrößerung), C in-situ Hybridisierung Antisense RNA TRPC6 (200x Vergrößerung), D indirekte Peroxydaseimmunhistochemie TRPC6 (200x Vergrößerung), E in-situ Hybridisierung Antisense RNA TRPV5 (200x Vergrößerung), F indirekte Fluoreszenzimmunhistochemie TRPV5 (200x Vergrößerung). Pfeil= zentro-ainäre Zellen des enxokrinen Anteils, Stern= endokriner Anteil, Langerhans Insel.

43 3.2.11 In-situ Lokalisation in der Skelettmuskulatur

In den Schnitten der Skelettmuskulatur wurden der Musculus gastrocnemius und der M. tibialis anterior untersucht (Daten nicht dargestellt). In den Untersuchungen für TRPC3 zeigte der mRNA Nachweis eine leichte Anfärbung des Sarkolemms. Im sarkoplasmatischen Retikulum, innerhalb der Muskelfaser und den Myofibrillen konnte keine Anfärbung beobachtet werden. Im Proteinnachweis wurde in der gesamten Muskelfaser keine spezifische Anfärbung detektiert. Für TRPC6 verhält es sich ähnlich; hier ist weder RNA noch Protein des Kanals nachweisbar (Daten nicht dargestellt). TRPV5 jedoch lässt sich deutlich in der Peripherie der Muskelfaser, vor allem im Sarkolemm und im sarkoplasmatischen Retikulum, detektieren. In den Muskelfibrillen und den Kapillaren liegt keine Expression von TRPV5 vor (Siehe Abb 3.9). A B

Abb 3.9: M. gastrocnemius: A in-situ Hybridisierung Antisense RNA TRPV5 (200x Vergrößerung), B Fluoreszenzimmunhistochemie TRPV5 (200x Vergrößerung), Pfeil: Sarkolemm und Sarkoplasmatisches Retikulum. Stern: Kapillare

3.2.12 In-situ Lokalisation in männlichen Fortpflanzungsorganen

Im Hoden und Nebenhoden konnten alle drei untersuchten Kanäle in unterschiedlicher Lokalisation nachgewiesen werden. Für TRPC3 konnte im Hoden ein Vorkommen von mRNA und Kanalprotein in den Leydig- Zwischenzellen und die Expression des Kanals in den Vorstufen der Spermien, den Spermatogonien und Spermatozyten gezeigt werden. Auch in den Sertolizellen ist eine leichte Anfärbung in der Immunhistochemie zu erkennen. Deutlich negativ ist allerdings das

44 Färbeverhalten der reifen Spermatiden. Im Nebenhoden ist TRPC3 im Epithel des Ductus epididymidis nachzuweisen. Die den Gang umgebende glatte Muskulatur enthält kein TRPC3 Kanalprotein (Daten nicht gezeigt). TRPC6 ist im Hoden in den Leydigzellen, den Sertolizellen und den Vorläuferzellen der Spermien zu finden. In der Reifungsstufe der Spermatogonien ergibt sich eine weniger starke Anfärbung als in den Spermatozyten. In den reifen Spermatiden ist keine spezifische Anfärbung zu erkennen. Im Nebenhoden zeigt sich in den Epithelzellen des Ductus epididymidis eine noch deutlichere Anfärbung für TRPC6, als bei TRPC3. Die glatte Muskulatur enthält kein TRPC6 (Daten nicht gezeigt). TRPV5 kommt im Hoden auf Trankriptions- und auf Expressionsebene in den Leydigzellen vor. Die Sertolizellen zeigen kein sicher positives Färbeverhalten. Deutlich ist jedoch eine Färbung beim Nachweis des Kanalproteins der Spermien eines höheren Reifezustandes; der mRNA Nachweis ist hier negativ. Im Nebenhoden kommen TRPV5, sowie TRPC3 und TRPC6 nur im Zytoplasma der Epithelzellen des Nebenhodenganges vor. In der glatten Muskulatur kann TRPV5 nicht detektiert werden (Daten nicht gezeigt).

3.2.13 In-situ Lokalisation in den weiblichen Fortpflanzungsorganen

Im Ovar lässt sich für TRPC3 eine Expression in den Granulosazellen der Follikel zeigen. Die Thekazellen, die um die Follikel gruppiert stehen und das Mark des Eierstocks zeigen kein spezifisches Färbeverhalten. In den Zellen des Corps luteum ist nur das Kanalprotein schwach nachweisbar; die mRNA kann nicht detektiert werden (siehe Abb. 3.10). In den Zellen des Endometriums des Uterus kommt es zu einem positiven Nachweis sowohl von mRNA und Protein. Das Myometrium zeigt kein Vorkommen dieses Kanals. TRPC6 wird im Ovar besonders deutlich in den Granulosazellen nachgewiesen; aber auch in der Medulla und dem Corpus luteum zeigt sich eine Expression. In den Thekazellen kommt es zu einem schwachen Signal in der in-situ Hybridisierung, jedoch zu keinem positiven Nachweis in der Immunhistochemie (Siehe Abb. 3.10). Im Endometrium des Uterus ist wie bei TRPC3 eine Anfärbung zu erkennen. Das Myometrium ist im Gegensatz zu TRPC3 schwach gefärbt. TRPV5 kann im Ovar am deutlichsten in den Granulosazellen der Follikel nachgewiesen werden. Ein schwächeres Färbeverhalten für die mRNA zeigen die Thekazellen; im Proteinnachweis gelingt kein sicherer Nachweis für TRPV. Im Uterus ist auch bei TRPV5 das

45 Endometrium deutlich angefärbt. Im Myometrium ist zeigt sich eine sehr schwache Anfärbung (Vgl. Abb. 3.10).

A B g

C D

g

g

E F

Abbildung 3.10: A in-situ Hybridisierung Antisense RNA TRPC3 (200x Vergrößerung), B indirekte Peroxydaseimmunhistochemie TRPC3 (200x Vergrößerung). C in-situ Hybridisierung Antisense RNA TRPC6 (200x Vergrößerung), D indirekte Peroxydaseimmunhistochemie TRPC6 (200x Vergrößerung). E in-situ Hybridisierung Antisense RNA TRPV5 (200x Vergrößerung), F indirekte Fluoreszenzimmunhistochemie TRPV5 (200x Vergrößerung). Pfeil= Granulosazellen, g= Corpus luteum, Thekazellen= um den Follikel mit den Granulosazellen gruppiert.

46 3.2.14 Zusammenfassung der Ergebnisse

In der folgenden Tabelle (Abbildung 3.11) werden, die in den vorherigen Abschnitten dargestellten Ergebnisse, als Synopsis aufgeführt und anhand des Färbeverhaltens semiquantifiziert. Gewebe TRPC3 TRPC3 TRPC6 TRPC6 TRPV5 TRPV5 In-situ Peroxidase In-situ Peroxidase In-situ Fluoreszenz Hybridisierung Immunhisto- Hybridisierung Immunhisto- Hybridisierung Immunhisto- chemie chemie chemie Quergestreifte Muskulatur - Sarkolemm + neg. +/- neg. + ++ - Sarkoplasmatisches neg. neg. neg. neg. ++ ++ Retikulum - Myofibrillen neg. neg. neg. neg. neg. neg. Herz - Myocard + +(+) (+) ++ +(+) ++ Endothel der Blutgefäße neg. neg. neg. neg. neg. neg. Aorta - Endothel + (+) n.d. + n.d. + - Tunica muskularis + + n.d. + n.d. + Dünndarm - glatte Muskulatur neg. neg. neg. neg. + ++ - Submukosa + - (+) (+) neg. neg. - Lamina mukosa der Zotten ++ ++ ++ ++ +++ ++ - Lamina mukosa der +++ +++ ++ +++ +++ ++ Krypten Niere - Glomeruli +/- neg. neg. neg. neg. neg. - distaler Tubulus +++ ++ ++ ++ +++ +++ - proximaler Tubulus neg. neg. neg. neg. neg. neg. Lunge - Bronchialepithel +++ ++(+) ++ +++ +++ +++ - Alveolarzellen (Typ I + II) + + + ++ ++ + Leber - Hepatozyten +++ +++ ++ +++ ++ (+) - Gallengangsepithel +++ ++ ++ ++ ++ (+) Milz - rote Pulpa ++ ++ neg. (+) (+) neg. - weiße Pulpa neg. neg. ++ ++ ++ ++ - Organkapsel neg. neg. neg. neg. n.d. n.d. Pankreas - exokriner Anteil +++ ++ +++ ++ +++ neg. - endokriner Anteil neg. + neg. ++ + +++ - Ductus pancreaticus ++ (?) - neg. neg. neg. neg. neg.

47

Gewebe TRPC3 TRPC3 TRPC6 TRPC6 TRPV5 TRPV5 In-situ Peroxidase In-situ Peroxidase In-situ Fluoreszenz Hybridisierung Immunhisto- Hybridisierung Immunhisto- Hybridisierung Immunhisto- chemie chemie chemie Hoden - Leydigzellen + (+) ++ ++ ++ ++ - Sertolizellen neg. (+) neg. (+) (+) neg. - Spermatocyten neg. (+) ++ ++ neg. + - Spermatogonien neg. (+) + + neg. + Nebenhoden - Epithel des Ductus +++ ++ +++ +++ ++ ++ efferentes testis - Epithel des Ductus + +/- ++ +/- + + epidymidis - reife Spermatiden neg. neg. neg. neg. neg. ++ - glatte Muskulatur neg. neg. neg. neg. neg. neg. Uterus - Endometrium ++ ++ +++ +++ ++ ++ - Myometrium neg. neg. + + + +/- Ovar - Granulosa Zellen ++ +++ ++ ++ ++ ++ - Theka Zellen neg. neg. + neg. + neg. - Corpus luteum neg. + + + n.d. n.d. - Medulla neg. neg. + + neg. + Großhirn - Cortex ++ ++ + ++ ++ n.d. - Hippocampus + ++ + +++ n.d. n.d. - Ventrikel ependym +++ ++ ++ n.d. ++ n.d. Kleinhirn - Purkinje Zellen ++ ++(+) +++ ++(+) ++ + - Stratum molekulare neg. (+) neg. neg. neg. neg. - Stratum granulosum + ++ + +(+) neg. neg. - Mark neg. neg. neg. neg. neg. neg.

Abbildung 3.11: neg. = keine Expression, (+) = sehr geringe Expression, + = geringe Expression, ++ = mäßige Expression, ++(+) mäßig-starke Expression, +++ = starke Expression.

48 4. Diskussion

Die Familie der TRP Ionenkanäle ist eine nach ihrer Struktur definierte Gruppe, deren Vertreter die unterschiedlichsten Funktionen erfüllen. Obwohl schon einige Studien die Gewebeverteilung in Säugetieren zeigen konnten, ist ein Großteil der Bedeutung der einzelnen Kanäle für die unterschiedlichen Gewebe und Zelltypen noch unverstanden. In dieser Arbeit wurde die Lokalisation der TRP Kanäle C3, C6 und V5 einer systematischen Untersuchung unterzogen. In Zusammenschau der Ergebnisse unterschiedlicher Methoden, sowohl quantitativer Nachweis von RNA mittels real-time RT-PCR, als auch qualitativ mittels in-situ Hybridisierung, indirekter Immunhistochemie und zT indirekter Immunfluoreszenz stellen sich vergleichbare Ergebnisse der untersuchten Gewebe dar. Zusammenfassend konnte gezeigt werden, dass TRPC3 in der real-time PCR in der größten Ausprägung im zentralen Nervensystem vorkommt. Auch in anderen Organen, wie in der Leber, Lunge, Niere, Pankreas, Ovar und Hoden gelang der Nachweis. Mittels in-situ Hybridisierung und Proteinnachweis zeigte sich im zentralen Nervensystem ein Vorkommen in den Pyramidenzellen der Großhirnrinde, im Hippocampus und in den Purkinjezellen des Kleinhirns. Riccio at al. beschreiben Ergebnisse, nach denen das Vorkommen von TRPC3 im Gehirn bis zu 10mal höher liegt, als in anderen Geweben (Riccio et al. 2002). Wir konnten diese Ergebnisse bestätigen; so zeigte die RT-PCR für TRPC3 ein 3fach höheres Vorkommen im Gehirn (insbesondere im Kleinhirn), als in der Lunge und ein ca. 10fach höheres Vorkommen im Vergleich zum Muskelgewebe oder Leber. Des Weiteren beschreibt die gleiche Forschungsgruppe das Vorkommen von TRPC6 im Gehirn als vergleichbar mit anderen Geweben (Riccio et al. 2002). In unserer Untersuchung bestand ein geringer quantitiativer Unterschied. TRPC6 zeigt die größte Expression im Gehirn und nachfolgend in der Lunge. In kleineren Mengen konnte die RNA von TRPC6 auch in der Niere, Ovar, Milz und in der Muskulatur nachgewiesen werden. Immunhistochemisch zeigte sich TRPC6 in den Zellen des Großhirnkortex, des Hypocampus und im Kleinhirn. In den Gliazellen der weißen Substanz, den Interneuronen der Großhirnrinde und den Körnerzellen des Gyrus dentatus kann in unserer Untersuchung ein Vorkommen nicht bestätigt werden. Es gelang der Nachweis im Bronchialepithel und den Alveolarzellen der Lunge, der Lamina mucosa des Dünndarms, den Zellen des distalen Tubulus der Niere, im exokrinen Anteil des Pankreas und der Leber. Nach der Quantifizierung ist das Vorkommen in den letztgenannten Geweben (Dünndarm, Niere, Pankreas. Leber) im Vergleich zum Gehirn und der Lunge sehr

49 gering, somit bestätigen unsere Ergebnisse weitgehend die vorausgegangenen Untersuchungen von Riccio et al.. Garcia et al. untersuchten 1997 mittels RT-PCR die gewebespezifische Expression einer Auswahl von TRP Kanälen in unterschiedlichen Zelllinien von Ratten. Für TRPC3 wurde in dieser Untersuchung die höchste mRNA-Expression im Kleinhirn und eine geringere Expression in Lunge, Herz, Niere, Hoden und Ovar gezeigt. Für TRPC6 konnte die höchste Konzentration im Lungengewebe, Großhirn und Ovar erfasst werden. Lediglich in der Leber war praktisch keine mRNA von TRPC3 und TRPC6 nachzuweisen (Garcia und Schilling 1997). Die Ergebnisse der oben genannten Gewebe der Ratte sind mit unseren Ergebnissen bei der Maus vergleichbar; wir konnten fedoch bei den untersuchten Mäusen ein Vorkommen in der Leber nachweisen. Die Lokalisation konzentriert sich hauptsächlich auf das Gallengangsepithel, schwächer jedoch auch auf die Hepatozyten. Das Vorkommen von TRPC3 und -C6 in den Muskelzellen der quergestreiften Muskulatur ist bekannt (Vandebrouck et al., 2002). Wir zeigten, dass die Lokalisation der Kanalproteine am Sarkolemm konzentriert ist und vermuten, dass TRPC3 im Vergleich zu TRPC6 eine wichtigere Rolle der Muskelfunktion einnehmen könnte, da es in deutlich höheren Konzentrationen vorliegt (Kunert-Keil et al. 2006). Da die beiden Kanäle funktionelle Heteromere bilden können, ist jedoch eine streng getrennte funktionelle Zuordnung schwer denkbar. In einer Arbeit unserer Arbeitsgruppe wurde die Expression von TRPC3 und TRPC6 in Muskelzellen bei, an Muskeldystrophie erkrankten Mäusen untersucht. Da es bei der Muskeldystrophie, also beim Fehlen von Dystrophin in den Muskelzellen durch einen Gendefekt, zu einem verstärkten Kalziumeinstrom in die Zelle kommt, ist unter anderem die Beteiligung von TRPC3 und C6 als nicht-selektive Ionenkanäle an der Pathogenese zu diskutieren. In den Muskeldystrophin-defizienten Mäusen (mdx Maus) war die Expression von TRPC3 im Vergleich zur gesunden Kontrolle unverändert, während die Expression der mRNA von TRPC6 signifikant reduziert war (Krüger et al. 2008). Der Zusammenhang der intrazellulären Kalziumkonzentration bei der Muskeldystrophie und der Expression der TRPC3 und -C6 Kanäle ist Gegenstand weiterer Forschung. TRPV5 zeige im Vergleich mit den beiden anderen Kanälen im Allgemeinen ein deutlich geringeres Vorkommen. In der real-time PCR zeigte sich das größte Vorkommen der TRPV5 mRNA in der Niere. Geringere Mengen ließen sich auch in der Lunge, der Milz und im Gehirn nachweisen. Die mRNA von TRPV5 lässt sich qualitativ außerdem in den Myozyten der quergestreiften Muskulatur, im distalen Tubulus der Nieren, in der Lunge, der Leber und den Geschlechtsorganen finden. Das Vorkommen in der Niere, in der TRPV5 eine wichtige

50 Rolle bei der Kalziumrückresorption aus dem Primärharn hat und somit zu einem Anstieg des Serumkalziumspiegels führt, konnten unsere Ergebnisse insbesondere das Vorkommen im distalen Tubulus bestätigen (Mizuno et al. 1999). Hoenderop et al. konnten 2003 zeigen, dass TRPV5-defiziente Mäuse unter vermindertem Serumkalziumspiegel und in Folge dessen an einer reduzierten Knochendichte leiden (Hoenderop et al. 2003). Für TRPV5 zeigen sich, im Gegensatz zu den beiden Vertretern der TRPC Familie, häufig widersprüchliche Ergebnisse von in-situ Hybridisierung und indirekter Immunhistochemie. In diesem Fall muss von einer geringen Spezifität des, für die indirekte Immunfluoreszenz genutzten Antikörpers ausgegangen werden. Besonders widersprüchlich ist das Ergebnis bei der Untersuchung des Pankreas. Die mRNA zeigt sich im exokrinen Anteil, während in der Immunfluoreszenz der Eindruck entsteht, TRPV5 sei hauptsächlich in den Langerhans-Zellen zu finden. Weiter technisch/methodisch als Fehlergebnis zu diskutieren ist der Nachweis in den Spermien, da diese eine sehr hohe Peroxidaseaktivität aufweisen. Ebenso verhält es sich in der Lamina mukosa des Dünndarms, in der sich alle Kanäle scheinbar sehr gut darstellen lassen.

In unseren Ergebnissen zeichnet sich, sowohl bei TRPC3, als auch bei TRPC6, eine besonders hohe Expression im Gewebe des zentralen Nervensystems ab. Die Funktion dieser Kanäle im zentralen Nervensystem, so wie der Zusammenhang mit neurodegenerativen Erkrankungen wie M. Alzheimer, M. Parkinson oder Entwicklungsstörungen von neuronalen Dendriten, ist zurzeit Gegenstand der Forschung. Eine Arbeit von Yan at al. vermutet eine wichtige Rolle von TRPC für Gedächtnisfunktionen. Bei cholinerger Aktivierung von Pyramidenzellen im cerebralen Kortex kommt es nach der eigentlichen Exzitation zu einer kurzen Depolarisation, die durch einen Kalzium-aktivierten, nicht selektiven Kationenkanal vermittelt ist. Bei Versuchen mit Überexpression von TRPC5 und -C6 konnte ein Anstieg dieser Depolarisationsamplitude gezeigt werden (Yan et al. 2009). Wir konnten den Nachweis für TRPC6 in den Pyramidenzellen des cerebralen Kortex erbringen; im Zytoplasma der Pyramidenzellen des Hypokampus ist eine besonders deutliche Anfärbung zu verzeichnen, während die Zellen des Gyrus dentatus keine Anfärbung zeigten. Es scheint also, dass TRPC6 in den Pyramidenzellen des Gyrus dentatus, der in Bezug auf die Afferenzen dem Hypocampus vorgeschaltet ist, noch keine Rolle spielt. Auch in Zusammenhang mit der neuronalen Proliferation in der Embryonalphase könnten TRPC3 und TRPC6 eine Rolle spielen, da ein Vorkommen in embryonalen Gehirnzellen der Maus gezeigt werden konnte (Boisseau et al. 2009). Boisseau et al. konnten weiterhin zeigen,

51 dass alle Isoformen der TRPC Familie, insbesondere jedoch TRPC1, -C3 und -C5 im Telencephalon während der Embryogenese exprimiert werden (Boisseau et al. 2009). Korrespondierend dazu kommt es bei genetischen Erkrankungen, die mit mentaler Retardierung einhergehen, wie der Trisomie 21 oder dem fragilen X-Syndrom zu Abnormalitäten in der Dendritenmorphologie (Dierssen und Ramakers 2006). Tai et al. konnten zeigen, dass es beim knock-down von TRPC6 in hippocampalen Neuronen zu einer Verminderung der Dentritenlänge kommt (Tai et al. 2008). So scheint TRPC6, welches in Pyramidenzellen der Großhirnrinde und im Hypocampus in hoher Ausprägung nachgewiesen werden konnte, für die Entwicklung und Funktion von Nervenzellen des Gehirns entscheidend zu sein und möglicherweise in Zusammenhang mit vielen genetischen und degenerativ bedingten Krankheiten zu stehen. Auch ein Zusammenhang mit einer cerebralen Expressionssteigerung von TRP Kanälen durch cerebrale Hypoxie beim ischämischen Schlaganfall ist zurzeit Gegenstand der wissenschaftlichen Diskussion (Simard at al. 2007). Die Apoptose und das, sich bei cerebraler Ischämie entwickelnde Ödem, sind unter anderem durch nicht-selektiven Ioneneinstrom in die Zelle durch TRP-Kanäle vermittelt. Lin et al. konnten 2004 eine hypoxiebedingte Hochregulation von TRPC6 Kanälen in der Lunge zeigen (Lin et al. 2004). Bei dem sehr hohen Vorkommen von TRPC6 im Gehirn ist ein Zusammenhang mit Ödem und Apoptose im Hypoxiefall vorstellbar.

Interessant und weiterer Untersuchung bedürftig ist der Zusammenhang von Vasokonstriktion und TRPC-Kanälen. Im Endothel und der glatten Muskulatur von Aorta und den, in den Präparaten der Lunge angeschnittenen Arteriolen konnten wir eine Expression sowohl von TRPC3, als auch von TRPC6 nachweisen, während TRPV5 in den Arterien nicht vorhanden ist. Unsere Ergebnisse lassen sich vereinbaren mit denen von Beech et al., die ebenfalls einen Nachweis von TRPC3 und TRPC6 in der Aorta führen konnten (Beech et al. 2004). Ein direkter Zusammenhang zwischen den untersuchten Kalziumkanälen und dem extrazellulären Rezeptor-operated Kalziumeinstrom über Noradrenalin und IP3, ist wahrscheinlich. Bekannt ist, dass TRPC3 und TRPC6 über Diacylglycerol (DAG) aktiviert werden (Tu et al. 2009). Auch ein Zusammenhang der TRPC Kanäle mit den SOC (Store-operated Channels) wird immer wieder diskutiert (Albert et al. 2007). Reading et al. konnten zeigen, dass eine Hemmung der mRNA von TRPC3 eine Verminderung der Vasokonstriktion zur Folge hat (Reading et al. 2005). Ein Mechanismus der Vasokonstriktion ohne Beteiligung der autonomen Nerven ist der Bayliss-Effekt, dem

52 eine myogene Vasokonstriktion bei Dehnung des Gefäßes durch erhöhten Blutdruck, beispielsweise bei Lageänderungen zugrunde liegt. Auch hier ist die mögliche Beteiligung von TRPC6 beschrieben (Welsh et al. 2002), so dass eine Signalkaskade, die durch mechanische Dehnung in Gang gesetzt wird, vermutlich über den TRPC6 Rezeptor reguliert wird. TRPC6, dessen Nachweis in den glatten Muskelzellen der Lungenarteriolen erfolgte, wurde in vorausgegangenen Untersuchungen von Yu et al. in Zusammenhang mit der idiopathischen pulmonalen Hypertension gebracht. Ein Zusammenhang von Expressionslevel von TRPC6 und Zellproliferation der pulmonalen arteriellen Muskelzellen konnte gezeigt werden und, interessanterweise, eine herabgesetzte Zellproliferation bei Hemmung der TRPC6 Expression (siRNA vermittelt) (Yu et al. 2004). Eine Zunahme der Expression von TRPC6 und der Anstieg des OAG-induzierten (DAG Analogon) Kalziumeinstroms konnte in der Lunge von Ratten gezeigt werden, welcher chronischer Hypoxie ausgesetzt waren. In Tieren, bei denen TRPC6 herunterreguliert wurde, zeigte sich eine deutliche Verminderung des, durch Hypoxie bedingten Kalziumeinstroms in die Muskelzellen und damit eine verminderte Vasokonstriktion (Lin et al. 2004).

In unserer Untersuchung konnte TRPC3 und TRPC6 in den Kardiomyocyten dargestellt werden, wobei TRPC3 stärker vertreten war. In beiden Fällen lag im indirekten Proteinnachweis ein heterogenes Verteilungsbild vor. Wir konnten das Vorkommen von TRPC3 und TRPC6 in den Kardiomyozyten, nicht aber in den Endothelien der kleineren Blutgefäße zeigen. TRPC3 und TRPC6 können Homo- und Heteromere bilden und als funktionelle Einheiten wirken. Eine kompensatorische Hochregulation bei Ausfall eines der beiden Kanäle, mit dadurch weiterhin erhaltener Funktion, ist wahrscheinlich und zur Zeit Gegenstand der Forschung (Dietrich et al. 2005). TRPC3 und -C6, die nicht-selektive, aber hauptsächlich Kalzium transportierende Kationenkanäle bilden, haben eine wichtige Aufgabe in der kardialen Kalziumhomöostase. Die kardiale Hypertrophie ist reguliert durch Rezeptoren und intrazelluläre Signaltransduktion, die kalziumabhängig sind. Bei TRPC6 konnte in transgenen Mäusen gezeigt werden, dass die kardiale Hypertrophie bei Stimulus von chronischer Druckbelastung weniger ausgeprägt war, als bei Tieren, bei denen TRPC6 nicht herunterreguliert war. Eine pharmakologische Hemmung von TRPC6 bzw. TRPC3 am Herzen (funktionelle Heteromere) könnte somit für die Therapie der Herzinsuffizienz in der Zukunft eine Rolle spielen (Nishida et al. 2010).

53 Eine pharmakologische Anwendung ist bisher nicht gezielt möglich. Es besteht aber der Verdacht, dass Hyperforin, welches für die antidepressive Wirkung von Johanniskraut (Hypericum perforatum) verantwortlich ist, ein selektiver TRPC6 Antagonist ist, der keinen Effekt auf die anderen TRPC Isoformen hat (Tu et al. 2009). Hyperforin hemmt, auf einem, bisher nicht geklärten Weg, die neuronale Aufnahme von Serotonin und Norepinephrin. Es gibt nun Hinweise, dass der bisher unverstandene Mechanismus über Elektrolytverschiebungen und Membranpotentialveränderungen über den TRPC6-Rezeptor gesteuert werden könnte (Leuner et al. 2007).

Zusammenfassend lässt sich feststellen, dass mittels der PCR die drei untersuchten Kanäle in fast allen untersuchten Geweben nachzuweisen waren; jedoch lässt nur die genauere subzelluläre Lokalisation durch die hybridisierungs- und histochemischen Verfahren Rückschlüsse auf die Funktion zu. Insbesondere konnten in dieser Arbeit neue Ergebnisse über bisher nicht ausreichend untersuchte Organe wie Gehirn, Skelettmuskel, Herz und Reproduktionsorgane erhoben werden. Die Ergebnisse dieser Arbeit bilden eine Grundlage für die weitere Erforschung der Familie der TRP Kanäle am Mausmodel.

54 5. Zusammenfassung

In der vorliegenden Arbeit wurde die Gewebeexpression und Lokalisation dreier TRP Kanäle der Gruppe 1 (TRPC3, TRPC6 und TRPV5) in verschiedenen Geweben der Maus beschrieben. Die Kanäle TRPC3, TRPC6 und TRPV5 transportieren vor allem Kalzium in das Innere der Zelle. Für die Bestimmung der Genexpression wurde die real-time RT-PCR genutzt. Zusätzlich wurde die mRNA-Menge mittels densiometrischer Auswertung der nicht- radioaktiven in-situ-Hybridisierung ermittelt. Die in-situ Hybridisierung wurde außerdem für die Lokalisation der mRNA im Gewebe genutzt. Für die Lokalisation des Proteins in den verschiedenen Maus-Organen standen Antikörper für die indirekte Immunhistochemie zur Verfügung. In den Ergebnissen zeigte sich, dass TRPC3 in allen untersuchten Geweben nachweisbar war, jedoch mit deutlicher Konzentration im zentralen Nervensystem und der Lunge. Auch in Herz und Skelettmuskel konnte TRPC3 deutlich mittels PCR und Antikörpernachweis gefunden werden. Funktionell ist der Zusammenhang von Kalziumhomöostase und Signaltransduktion sowie Muskelkontraktion entscheidend. Die höchsten Expressionslevel von TRPC6 zeigten sich ebenfalls in Gehirn und Lunge; ein positiver Nachweis gelang aber ebenfalls in den Zellen des Dünndarmes, der Leber, des distalen Tubulus der Niere und in Zellen des exokrinen Pankreas. In Zellen der Skelettmuskulatur scheint TRPC6 keine entscheidende Rolle zu spielen. Es gelang zusätzlich der Nachweis im Herzmuskel. TPRV5 wird besonders in der Niere, dort in Zellen des distalen Tubulus exprimiert, was der wichtigen Funktion in der Kalziumrückresorption entspricht. In geringerem Maße, aber deutlich auf Protein und RNA Ebene bestätigt, ist der Kanal auch in Lunge, Milz und Gehirn nachweisbar. Die drei untersuchten Kanäle sind in fast allen untersuchten Geweben nachzuweisen; jedoch lässt die genauere Lokalisation in bestimmte Zellen der untersuchten Organe bessere Rückschlüsse auf die Funktion zu. Insbesondere konnten in dieser Arbeit neue Ergebnisse über bisher nicht ausreichend untersuchte Organe wie Gehirn, Skelettmuskel, Herz und Reproduktionsorgane erhoben werden. Die Ergebnisse dieser Arbeit bilden eine Grundlage für die weitere Erforschung der Familie der TRP Kanäle am Mausmodel. Ein Teil der Daten dieser Arbeit wurde in zwei Publikationen veröffentlicht, im Jahre 2006 “Tissue-specific expression of TRP channel genes in the mouse and its variation in three

55 different mouse strains.” von Kunert-Keil, Bisping et al. und im Jahre 2008 "Transient receptor potential cation channels in normal and dystrophic mdx muscle.” von Krüger et al. (siehe Anhang).

56 6. Literaturverzeichnis

Albert, A. P., S. N. Saleh, et al. (2007). "Multiple activation mechanisms of store-operated TRPC channels in smooth muscle cells." J Physiol 583(Pt 1): 25-36. Bach, G. (2001). "Mucolipidosis type IV." Mol Genet Metab 73(3): 197-203. Bach, G. (2005). "Mucolipin 1: endocytosis and cation channel--a review." Pflugers Arch 451(1): 313-7. Bandell, M., G. M. Story, et al. (2004). "Noxious cold ion channel TRPA1 is activated by pungent compounds and bradykinin." Neuron 41(6): 849-57. Bautista, D. M., S. E. Jordt, et al. (2006). "TRPA1 mediates the inflammatory actions of environmental irritants and proalgesic agents." Cell 124(6): 1269-82. Beech, D. J., K. Muraki, et al. (2004). "Non-selective cationic channels of smooth muscle and the mammalian homologues of Drosophila TRP." J Physiol 559(Pt 3): 685-706. Benezra, R. (2005). "Polycystins: inhibiting the inhibitors." Nat Cell Biol 7(12): 1164-5. Berridge, M. J., P. Lipp, et al. (2000). "The versatility and universality of calcium signalling." Nat Rev Mol Cell Biol 1(1): 11-21. Bianco, S. D., J. B. Peng, et al. (2007). "Marked disturbance of calcium homeostasis in mice with targeted disruption of the Trpv6 calcium channel gene." J Bone Miner Res 22(2): 274-85. Boisseau, S., C. Kunert-Keil, et al. (2009). "Heterogeneous distribution of TRPC proteins in the embryonic cortex." Histochem Cell Biol 131(3): 355-63. Caterina, M. J., A. Leffler, et al. (2000). "Impaired nociception and pain sensation in mice lacking the capsaicin receptor." Science 288(5464): 306-13. Classen, M. (2004). Innere Medizin, Urban & Fischer Verlag München/Jena. Davis, J. B., J. Gray, et al. (2000). "Vanilloid receptor-1 is essential for inflammatory thermal hyperalgesia." Nature 405(6783): 183-7. Desai, B. N. and D. E. Clapham (2005). "TRP channels and mice deficient in TRP channels." Pflugers Arch 451(1): 11-8. Dierssen, M. and G. J. Ramakers (2006). "Dendritic pathology in mental retardation: from molecular genetics to neurobiology." Genes Brain Behav 5 Suppl 2: 48-60. Dietrich, A., M. Mederos y Schnitzler, et al. (2005). "Functional characterization and physiological relevance of the TRPC3/6/7 subfamily of cation channels." Naunyn Schmiedebergs Arch Pharmacol 371(4): 257-65. Elizondo, M. R., B. L. Arduini, et al. (2005). "Defective skeletogenesis with kidney stone formation in dwarf zebrafish mutant for trpm7." Curr Biol 15(7): 667-71. Freichel, M., S. H. Suh, et al. (2001). "Lack of an endothelial store-operated Ca2+ current impairs agonist-dependent vasorelaxation in TRP4-/- mice." Nat Cell Biol 3(2): 121-7. Freichel, M., R. Vennekens, et al. (2004). "Functional role of TRPC proteins in vivo: lessons from TRPC-deficient mouse models." Biochem Biophys Res Commun 322(4): 1352- 8. Garcia, R. L. and W. P. Schilling (1997). "Differential expression of mammalian TRP homologues across tissues and cell lines." Biochem Biophys Res Commun 239(1): 279-83. Hoenderop, J. G., J. P. van Leeuwen, et al. (2003). "Renal Ca2+ wasting, hyperabsorption, and reduced bone thickness in mice lacking TRPV5." J Clin Invest 112(12): 1906-14. Hoenderop, J. G., T. Voets, et al. (2003). "Homo- and heterotetrameric architecture of the epithelial Ca2+ channels TRPV5 and TRPV6." Embo J 22(4): 776-85. Hofmann, T., A. G. Obukhov, et al. (1999). "Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol." Nature 397(6716): 259-63. 57 Iida, T., I. Shimizu, et al. (2005). "Attenuated fever response in mice lacking TRPV1." Neurosci Lett 378(1): 28-33. Jordt, S. E., D. M. Bautista, et al. (2004). "Mustard oils and cannabinoids excite sensory nerve fibres through the TRP channel ANKTM1." Nature 427(6971): 260-5. Kim, S. J., Y. S. Kim, et al. (2003). "Activation of the TRPC1 cation channel by metabotropic glutamate receptor mGluR1." Nature 426(6964): 285-91. Kiselyov, K., J. Chen, et al. (2005). "TRP-ML1 is a lysosomal monovalent cation channel that undergoes proteolytic cleavage." J Biol Chem 280(52): 43218-23. LaPlante, J. M., C. P. Ye, et al. (2004). "Functional links between mucolipin-1 and Ca2+- dependent membrane trafficking in mucolipidosis IV." Biochem Biophys Res Commun 322(4): 1384-91. Leuner, K., V. Kazanski, et al. (2007). "Hyperforin--a key constituent of St. John's wort specifically activates TRPC6 channels." Faseb J 21(14): 4101-11. Li, X., Y. Luo, et al. (2005). "Polycystin-1 and polycystin-2 regulate the cell cycle through the helix-loop-helix inhibitor Id2." Nat Cell Biol 7(12): 1202-12. Liman, E. R. and D. P. Corey (1996). "Electrophysiological characterization of chemosensory neurons from the mouse vomeronasal organ." J Neurosci 16(15): 4625-37. Lin, M. J., G. P. Leung, et al. (2004). "Chronic hypoxia-induced upregulation of store- operated and receptor-operated Ca2+ channels in pulmonary arterial smooth muscle cells: a novel mechanism of hypoxic pulmonary hypertension." Circ Res 95(5): 496- 505. Macpherson, L. J., B. H. Geierstanger, et al. (2005). "The pungency of garlic: activation of TRPA1 and TRPV1 in response to allicin." Curr Biol 15(10): 929-34. Mizuno, N., S. Kitayama, et al. (1999). "Molecular cloning and characterization of rat trp homologues from brain." Brain Res Mol Brain Res 64(1): 41-51. Montell, C. (2005). "The TRP superfamily of cation channels." Sci STKE 2005(272): re3. Montell, C. and G. M. Rubin (1989). "Molecular characterization of the Drosophila trp locus: a putative integral membrane protein required for phototransduction." Neuron 2(4): 1313-23. Munsch, T., M. Freichel, et al. (2003). "Contribution of transient receptor potential channels to the control of GABA release from dendrites." Proc Natl Acad Sci U S A 100(26): 16065-70. Nilius, B. (2004). "Store-operated Ca2+ entry channels: still elusive!" Sci STKE 2004(243): pe36. Nilius, B., G. Owsianik, et al. (2007). "Transient receptor potential cation channels in disease." Physiol Rev 87(1): 165-217. Nishida, M., K. Watanabe, et al. (2010)"[Mechanism of cardiac hypertrophy via diacylglycerol-sensitive TRPC channels]." Yakugaku Zasshi 130(3): 295-302. Ramsey, I. S., M. Delling, et al. (2006). "An introduction to TRP channels." Annu Rev Physiol 68: 619-47. Raychowdhury, M. K., S. Gonzalez-Perrett, et al. (2004). "Molecular pathophysiology of mucolipidosis type IV: pH dysregulation of the mucolipin-1 cation channel." Hum Mol Genet 13(6): 617-27. Reading, S. A., S. Earley, et al. (2005). "TRPC3 mediates pyrimidine receptor-induced depolarization of cerebral arteries." Am J Physiol Heart Circ Physiol 288(5): H2055- 61. Reiser, J., K. R. Polu, et al. (2005). "TRPC6 is a glomerular slit diaphragm-associated channel required for normal renal function." Nat Genet 37(7): 739-44. Soyombo, A. A., S. Tjon-Kon-Sang, et al. (2006). "TRP-ML1 regulates lysosomal pH and acidic lysosomal lipid hydrolytic activity." J Biol Chem 281(11): 7294-301.

58 Stowers, L., T. E. Holy, et al. (2002). "Loss of sex discrimination and male-male aggression in mice deficient for TRP2." Science 295(5559): 1493-500. Tai, Y., S. Feng, et al. (2008). "TRPC6 channels promote dendritic growth via the CaMKIV- CREB pathway." J Cell Sci 121(Pt 14): 2301-7. Talavera, K., K. Yasumatsu, et al. (2005). "Heat activation of TRPM5 underlies thermal sensitivity of sweet taste." Nature 438(7070): 1022-5. Venkatachalam, K. and C. Montell (2007). "TRP channels." Annu Rev Biochem 76: 387-417. Venkatachalam, K., D. B. van Rossum, et al. (2002). "The cellular and molecular basis of store-operated calcium entry." Nat Cell Biol 4(11): E263-72. Voets, T., B. Nilius, et al. (2004). "TRPM6 forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption." J Biol Chem 279(1): 19-25. Welsh, D. G., A. D. Morielli, et al. (2002). "Transient receptor potential channels regulate myogenic tone of resistance arteries." Circ Res 90(3): 248-50. Winn, M. P., P. J. Conlon, et al. (2005). "A mutation in the TRPC6 cation channel causes familial focal segmental glomerulosclerosis." Science 308(5729): 1801-4. Yan, H. D., C. Villalobos, et al. (2009). "TRPC Channels Mediate a Muscarinic Receptor- Induced Afterdepolarization in Cerebral Cortex." J Neurosci 29(32): 10038-46. Yu, Y., I. Fantozzi, et al. (2004). "Enhanced expression of transient receptor potential channels in idiopathic pulmonary arterial hypertension." Proc Natl Acad Sci U S A 101(38): 13861-6. Zhang, Y., M. A. Hoon, et al. (2003). "Coding of sweet, bitter, and umami tastes: different receptor cells sharing similar signaling pathways." Cell 112(3): 293-301.

59 7. Anhang

60 BMC Genomics BioMed Central

Research article Open Access Tissue-specific expression of TRP channel genes in the mouse and its variation in three different mouse strains Christiane Kunert-Keil*, Frederike Bisping, Jana Krüger and Heinrich Brinkmeier

Address: Ernst Moritz Arndt University of Greifswald, Institute of Pathophysiology, Greifswalder Str. 11C, D-17495 Karlsburg, Germany Email: Christiane Kunert-Keil* - [email protected]; Frederike Bisping - [email protected]; Jana Krüger - [email protected]; Heinrich Brinkmeier - [email protected] * Corresponding author

Published: 20 June 2006 Received: 20 December 2005 Accepted: 20 June 2006 BMC Genomics 2006, 7:159 doi:10.1186/1471-2164-7-159 This article is available from: http://www.biomedcentral.com/1471-2164/7/159 © 2006 Kunert-Keil et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract Background: The purpose of this work was to study the gene expression of transient receptor potential (TRP) channels in the mouse. The application of a standardized and quantitative technique, TaqMan RT-PCR, should give information about the pattern and relative importance of TRP channels for murine tissues and cell types. To verify data sets with an independent method, we studied the occurrence of some of the transcripts by in situ hybridization. Results: We have characterized the mRNA expression of 22 TRP channels in the mouse with a focus on nerve and muscle tissues. This is the first study to describe the expression profiles of all channel isoforms of the four related Group 1 subfamilies (TRPC, TRPV, TRPM and TRPA) with a standardized and quantitative technique. Comparisons of transcript abundance showed a consistent dominance of TRPM7 and TRPC3 in most tissues. We further observed characteristic patterns and differences in gene expression of individual channels ranging over three orders of magnitude. The overall level of TRP channel mRNAs was highest in brain areas followed by kidney, lung, reproductive organs and muscle. In brain TRPM3 and TRPM7 dominated and 19 other isoforms were detected. In lung and kidney TRPV4, TRPV5 and TRPM7 were found in highest levels. TRPM7, TRPC3, TRPC6 and TRPM3 mRNAs were characteristically present in all tested muscle tissues. Most data obtained with the C57Bl/10 mouse strain were confirmed with Balb/c and NOD mice. However, TRPC3, C6, TRPM7, M3, TRPV2 and V4 expression showed marked differences in the three tested mouse strains. In situ hybridization revealed co-expression of transcripts on the cellular level and widely confirmed the data obtained with RT-PCR. Conclusion: Transcripts coding for members of the TRPC, TRPV, TRPM and TRPA subfamilies of TRP cation channels are present in a broad spectrum of murine tissues. Several channel isoforms often coexist in a specific tissue or cell type. TRP channel expression does not show typical tissue specific dominance of individual members as is known from other ion channel families. Mouse strain specific variations of TRP channel expression indicate that genetic background or physiological requirements considerably influence expression levels.

Page 1 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

Background specific tissues as vessels or vascular smooth muscle [7] or The mammalian homologues of the Drosophila transient human tissue samples of the central nervous system [12]. receptor potential (TRP) channel are plasma membrane Most studies cover only one subfamily of TRP channels, cation channels sharing significant sequence homology e.g. TRPC [11-13] or TRPV [14], although in many cell and a common structure. In mice 28 genes have been types channels of several families are expressed and cer- described coding for TRP proteins [1]. The superfamily of tain members of different families may have overlapping TRP channels has been divided into six subfamilies in physiological functions. At present it is not clear whether mammals, TRPC, TRPV, TRPM, TRPA, TRPP and TRPML TRP channels show a characteristic tissue-specific expres- according to structural similarities and modes of activa- sion that is constant in different mammalian species or tion [1,2]. The members of subfamilies TRPC, TRPV, mouse strains. TRPM and TRPA comprise the Group 1 TRPs, since TRPP and TRPML members are distantly related and classified The current study was designed to prepare a basis for as the Group 2 TRPs [1]. TRP genes are almost ubiqui- investigating the relevance of TRP channels in mamma- tously expressed and occur in splice variants [3,4]. The lian tissues in health and disease. We determined the channel proteins interact with a variety of other proteins expression of 22 TRP channel genes in the mouse, one of to form macromolecular complexes [5]. The selectivity for the major model organisms of man. Besides the method specific cations is diverse among TRP channels. Some of of RT-PCR, we used the quantitative method of real-time them are selective for Ca2+, some for Na+ or Mg2+, while RT-PCR to investigate the relative expression levels of TRP others seem to be non-selective cation channels. The channel genes in a broad spectrum of tissues in three known functions of TRP channels are extremely diverse as mouse strains. This should give information about the rel- well. Some of them mediate sensory transduction of cold, ative significance of distinct TRP isoforms in a specific tis- heat, mechanical, osmotic or noxious stimuli [6]. Others sue and address the question whether redundancy is a are involved in the regulation of neuronal function, vascu- characteristic feature of TRP channels. Before doing func- lar tone [7], epithelial calcium absorption and the regula- tional studies it is important to know whether there is a tion of cellular calcium and magnesium homeostasis dominating channel expressed in a certain tissue or cell [2,8]. The variety of isoforms and splice variants and the type. To verify the data obtained with real-time RT-PCR fact that one cell type often expresses several types of TRP using an independent method, we applied the technique proteins makes it difficult to elucidate the precise function of in situ hybridization. Although we focus on nerve and of TRP channels in individual cells types and tissues. In muscle tissue, an almost complete set of data for a wide some cases, one channel isoform is dominant in a speci- spectrum of mouse tissues is presented. fied cell type, i.e. it can be detected in relatively high levels by RT-PCR, in situ hybridization and immunochemical Results methods. In these rare cases TRP channel expression can Detection and quantification of TRP channel transcripts in be correlated with physiological function such as inward mouse tissues currents of cations and the modulation of cellular excita- Using standard RT-PCR as well as real-time RT-PCR we bility or calcium homeostasis. detected signals for all above mentioned TRP channel transcripts in many murine tissues. We observed charac- As the majority of TRP channels allows an influx of cal- teristic expression patterns and differences in gene expres- cium into the cell and since calcium is the most common sion of individual TRP channels ranging over three orders cellular second messenger, TRP channel function may of magnitude. have important consequences for cell growth and divi- sion, differentiation and also for cell damage and cell Standard RT-PCR of TRP channel transcripts from periph- death [9,10]. eral tissues and brain regions from Balb/c mice as well as from the mouse skeletal muscle cell line C2C12 yielded To study the roles of TRP channels in cells and tissues, it is PCR products of expected size. All products were important to know where they are expressed and at what sequenced in an exemplary manner and revealed the level they are expressed. In order to obtain valid data expected DNA sequence. Figure 1 shows the results for about the tissue specific expression it can be important some frequently observed TRP channels, TRPC3, TRPC6, and helpful to test gene expression with several independ- TRPV2, TRPV4, TRPM4, TRPM7 and GAPDH, respectively. ent techniques. Unfortunately, the current expression All tested tissues were positive for TRPV4 mRNA coding studies in mammals are heterogeneous with regard to spe- for a cation channel sensitive to extracellular osmolarity. cies, applied methods, number of included tissues and The strongest response was observed with kidney (Fig. 1, cell types and number of included TRP channels. Some line 4, column 7). The occurrence of TRPM4 mRNA authors show the expression of several TRPC isoforms in showed the largest variation among the tested tissues and, a variety of rat tissues and cell lines [11], some focus on in contrast to all other transcripts a low expression in

Page 2 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

TRPC3 expression of this housekeeping gene were observed between the different tissues (data not shown), suggesting that 18S rRNA can be used for normalization. TRPC6

The strongest expression of TRPC channels was found in TRPV2 brain areas. In cerebrum TRPC3 and TRPC6 dominated followed by TRPC1, 4 and 5. TRPC2 and 7 only occurred

TRPV4 in low concentrations reaching 2% of that of TRPC1 (Fig. 2A and 3). TRPC1 mRNA showed a rather constant level in all tested brain areas while other isoforms varied con- TRPM4 siderably. TRPC6 mRNA was very prominent in cerebrum and basal ganglia but much less expressed in cerebellum. TRPM7 In the hippocampus TRPC3 was the most abundant iso- form among the TRPCs. TRPC channel transcripts were also prevalent in peripheral tissues. In the muscle tissues, GAPDH skeletal muscle, aorta and heart, the TRPC3 transcript

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 dominated over all other members of the TRPC subfamily (Fig. 2A). The next most frequent isoforms were TRPC1 ExpressionstandardFigure 1 RT-PCR of TRP channel mRNAs in murine tissues using and TRPC6 reaching about 10% of the level of TRPC3 in Expression of TRP channel mRNAs in murine tissues heart and diaphragm (Fig. 3). using standard RT-PCR. Reverse transcribed RNA (8 ng) from tissues of adult (100 d) C57Bl/10SC mice was added to the reaction mixtures and PCR products amplified in 40 Members of the TRPV subfamily of cation channels are cycles. The products were separated on agarose gels and known for their functions in sensation of heat, cold and stained with ethidium bromide. Water served as negative other stimuli (TRPV1-4) and for Ca2+ transport through control. 1) testis; 2) liver; 3) lung; 4) spleen; 5) skeletal mus- the epithelia (TRPV5-6). In this study TRPV1 mRNA was cle; 6) epididymis; 7) kidney; 8) ovary; 9) seminal vesicle; 10) hardly detectable in any of the tested tissues and only uterus; 11) C2C12 cells; 12) H2O; 13) aorta; 14) intestine; found at significant levels in basal ganglia and testis. 15) heart; 16) hippocampus; 17) brain stem 18) forebrain; 19) TRPV2 was the dominating isoform in all tested brain cerebrum 20) cerebellum; 21) truncus encephali. areas. Among the TRPVs only TRPV4 reached similar lev- els. However, compared to the TRPC transcripts, TRPV2 and 4 mRNAs were expressed at much lower levels reach- brain regions (Fig. 1, columns 16–21). The tested brain ing only 3–10% of those of TRPC3 and TRPC4 (Fig. 2B regions were consistently positive for TRPC3 and 6 as well and 3). As expected, strong signals were found for TRPV5 as for TRPV2 and 4 mRNAs. Brain regions showed the in kidney and TRPV6 in lung. In addition TRPV4 tran- overall strongest expression of TRP channel transcripts scripts were found at high levels in these two organs. Alto- and at the same time the highest diversity of TRP channel gether in lung and kidney transcripts coding for TRPV gene expression. Muscle tissues, aorta (col 13), heart (col channels dominated over those of TRPCs. In muscle tis- 15) uterus (col 10) and skeletal muscle (col 5) were posi- sues transcripts of TRPV3, 4 and 6 were regularly detected. tive for few TRP mRNAs, in particular TRPC3 and TRPV4, While TRPV3 showed quite a strong expression in tibial but the signals were relatively weak. and gastrocnemius muscle, TRPV4 and TRPV6 were the most abundant isoforms in diaphragm and aorta. In heart In order to quantify tissue specific TRP channel expression muscle the expression the TRPVs was very low (Fig. 2B and more precisely we applied TaqMan RT-PCR on tissue sam- 3). ples from adult C57Bl/10 mice. For the murine transcripts of TRPC3 and 4, TRPV1 and 5 as well as for TRPM2-4 and Channels of the TRPM subfamily serve different functions TRPM6 specific TaqMan primers and probe sets were as they are involved in cold sensation (TRPM8), Mg2+ developed. They were used to prepare DNA standards and transport (TRPM6 and 7) and can have an enzymatic func- to perform real-time RT-PCR. For all other transcripts cod- tion in addition to their channel activity (TRPM2, 6, 7). In ing for TRP channels commercially available primers and the mouse, the TRPM7 gene was consistently expressed in probe sets were used. The primer pairs were chosen in all tested organs and tissues and it was at the same time it order to obtain products that cross intron-exon borders to was the dominating isoform except for brain areas. In exclude results from a contamination with genomic DNA. brain TRPM3 mRNA was found at highest levels and Parallel to the analyses of TRP channel transcripts, the TRPM2 transcripts were also found at considerable levels copy number of eukaroytic 18S rRNA was determined for reaching about 10% of those of TRPM3 and 7 (Fig. 2C and each individual sample. Only minor differences in the 3). In muscle tissues TRPM7 dominated, followed by

Page 3 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

A m.tibialis anterior m. gastrocnemius heart diaphragm cerebrum kidney

0.02

0.015

0.01

0.005

copy numbers TRP/18S rRNA 0 TRPC1 TRPC2 TRPC3 TRPC4 TRPC5 TRPC6 TRPC7 B 0.02

0.015

0.01

0.005 copy numbers TRP/18S rRNA 0 TRPV1 TRPV2 TRPV3 TRPV4 TRPV5 TRPV6 TRPA1 C 0.30

0.20

0.10 copy numbers TRP/18S rRNA TRP/18S numbers copy 0.00 TRPM1 TRPM2 TRPM3 TRPM4 TRPM5 TRPM6 TRPM7 TRPM8

QuantificationFigure 2 of TRP ion channel mRNA levels in murine tissues using Real-time RT-PCR Quantification of TRP ion channel mRNA levels in murine tissues using Real-time RT-PCR. Expression of TRPC1- 7 (A), TRPV1-6 and TRPA1 (B) as well as TRPM1-8 (C) mRNA was analyzed in murine tissues using Real-time RT-PCR. Sam- ples were from adult (100 d) C57Bl/10SC mice. The mRNA levels of TRP ion channels are given in relation to 18S rRNA. Means ± S.E.M. are given in all cases for n = 3–10 samples.

Page 4 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

The TRPA1 transcript coding for a channel possibly involved in cold and chemosensation was found in low levels in various brain regions as well as in reproductive organs and spleen (Fig. 2B and 3). liver spleen basal ganglia epididymis forebrain heart hippocampus lung gastrocn. M. M. tibialis ovary testis cerebrum diaphragm kidney cerebellum aorta TRPC1 Taken together, brain areas showed a high diversity and strong expression of TRP channels. Most prominent were TRPC2 TRPM7 and M3 and TRPC3 and C4, but many other iso- TRPC3 forms are potentially relevant as their transcripts occurred TRPC4 at significant levels. Kidney revealed a more restricted and

TRPC5 characteristic pattern of TRP channels dominated by TRPM7, TRPV4 and V5, followed by TRPC3 and C1. Mus- TRPC6 cle tissues showed much lower expression, at least one TRPC7 order of magnitude lower than brain and kidney. There TRPV1 seem to be differences in TRP channel expression between smooth muscle (aorta), skeletal muscles and heart but it TRPV2 is difficult to recognize a typical tissue-specific pattern that TRPV3 is characteristic and differentiates the three muscle tissues. TRPV4 Cellular localization of TRPC3, TRPC5 and TRPC6 mRNAs TRPV5 The in situ hybridization technique was used to localize TRPV6 mRNAs of TRPC3, 5 and 6 in certain cell types of the CNS TRPM1 and peripheral organs. Furthermore, the technique was TRPM2 used to visualize mRNA levels in these tissues. The exper- iments were performed with tissue slices of C57Bl/10 TRPM3 mice. For TRPC3, C5 and TRPC6 positive reactions were TRPM4 = 0 observed in the cytoplasm of neuronal cells in the C2 area TRPM5 > 0.001 of the hippocampus without any strong variation of > 0.01 expression levels (Fig. 4A). Sense probes applied as con- TRPM6 trols did not show positive results (Fig. 4, second column TRPM7 > 0.1 from left). In kidney, epithelial cells of the distal tubule TRPM8 > 1 showed intense staining of TRPC3 mRNA, while glomer- uli and proximal tubules were negative. Distal tubules TRPA1 > 10 were also positive for TRPC5 and 6 but the staining inten- sity was much weaker (Fig. 4B). In lung tissue an intense SummaryFigure 3 of tissue specific TRP channel gene expression staining was observed in bronchial epithelium for TRPC3 Summary of tissue specific TRP channel gene expres- and C6 while TRPC5 detection was only slightly positive sion. Expression of TRPC1-7, TRPM1-8, TRPV1-6 and in these cells. For all three transcripts, pneumocytes TRPA1 mRNAs in murine tissues was determined by real- showed a lesser reaction than bronchial epithelium, and time RT-PCR. Levels of mRNAs are given in relation to that even poorer staining was observed for blood vessels (Fig. of 18S rRNA; all data were multiplied by 1000. Means were 4C). Epididymis revealed strong expression of TRPC3 in calculated from n = 3–10 samples and classified into 5 cate- the epithelium of the Ductuli epididymis and Ductuli gories. If the threshold level of fluorescence according to the efferentes testes while the other cell types were negative. TaqMan RT-PCR technique was not reached after 40 cycles The same result was obtained for TRPC5 and 6 in these of amplification, a resulting expression level of zero (0) was cells (Fig. 4D). Cross sections of skeletal muscle showed assigned to the corresponding channel transcript and tissue. most intense sarcolemmal staining for TRPC3 and less for For better illustration categories of gene expression levels are represented by different colors ranging from zero (white) TRPC6. The mRNA of TRPC5 was not detectable in these to values higher than 10 (dark blue). tissue slices (Fig. 4E). The results of in situ hybridization as well as staining intensities for many tissues and cell types are summarized in Table 4.

Differences in TRP channel expression between mouse TRPM3 and 4. The highest expression and diversity strains among TRPMs was observed in the aorta, while heart mus- In order to address the question of whether the findings cle showed the overall lowest expression (Fig. 2C and 3). on TRP channel gene expression can be generalized for the

Page 5 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

TRPC3 TRPC5 TRPC6 C57BL NOD Balbc

A 0.100 cerebrum

A 0.080

0.060

0.040 B 0.020

copy numbers TRP/18S rRNA TRP/18S numbers copy 0.000 TRPC3 TRPC6 TRPM3 TRPM7 TRPV2 TRPV4 B C 0.300

A kidney 0.250

0.200

D 0.150 0.100

0.050 copy numbers TRP/18S rRN 0.000 E TRPC3 TRPC6 TRPM3 TRPM7 TRPV2 TRPV4 C 0.02 skeletal muscle antisense sense antisense antisense 0.016 organsInFigure situ localizationusing 4 in situ of hybridization three TRPC mRNAs in different mice 0.012 In situ localization of three TRPC mRNAs in different mice organs using in situ hybridization. In situ hybridiza- 0.008 tion of TRPC3, TRPC5 and TRPC6 mRNA was performed 0.004

with tissue sections of adult (100d) C57Bl/10SC mice. The rRNA TRP/18S numbers copy two left hand columns of sections were incubated with the 0 antisense probe for TRPC3 and the sense probe (control), TRPC3 TRPC6 TRPM3 TRPM7 TRPV2 TRPV4 D respectively. For TRPC5 and TRPC6 only results with anti- 0.02 sense probes are shown. Tissue sections: A: hippocampus, B: heart Kidney, C: Lung, D: epididymis, E: skeletal muscle. In all cases 0.016 a methyl green counter-staining was performed. Magnifica- 0.012 tion: × 200. 0.008

0.004 copy numbers TRP/18S rRNA TRP/18S numbers copy mouse, in addition to C57Bl/10 mice tissue we analyzed 0 samples from animals of two other mouse strains, NOD TRPC3 TRPC6 TRPM3 TRPM7 TRPV2 TRPV4 and Balb/c. For most of the TRP channel transcripts and tissues similar levels were obtained for NOD and Balb/c ComparisonstrainsFigure 5 of TRP channel mRNA levels in different mouse mice compared to the C57Bl/10 strain (data not shown). Comparison of TRP channel mRNA levels in differ- ent mouse strains. Expression of TRPC3, C6, M3, M7, V2 However, some differences between the mouse strains and V4 channels was determined by Real-time RT-PCR in became obvious. To ensure that possible polymorphisms selected tissues of three different mouse strains. Tissue sam- in the primer or probe binding sites would not influence ples were collected from adult (100 d) C57Bl/10SC (grey col- the amplification of the PCR products, we determined the umns), NOD (black columns) and Balb/c mice (dotted amplification efficiencies for all transcripts and mouse columns). The mRNA levels of TRP channels are given in strains shown in Fig. 5. For individual genes, PCR efficien- relation to 18S rRNA for cerebrum (A), kidney (B) skeletal cies varied only by several percent between the strains, muscle (C) and heart (D). Means ± S.E.M. are given in all indicating that they cannot account for the strain specific cases for n = 3–10 samples. differences in gene expression. On this basis, TRPC3 expression was higher in some tissues, e.g. in cerebrum, skeletal muscle and heart of C57Bl/10 mice while TRPC6 heart and skeletal muscle. The very high expression of expression was lower in the same tissues (Fig. 5). Data of TRPM3 and M7 in cerebrum of C57Bl/10 mice was not NOD and Balb/c mice showed a high degree of congru- observed in NOD and Balb/c. Furthermore, TRPM7 ence. In contrast to C57Bl/10, NOD and Balb/c mice expression was very low in tissues of NOD mice compared showed a significant expression of TRPV2 and V4 in the to the C57Bl/10 and Balb/c strain (Fig. 5).

Page 6 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

Table 1: Primers used for standard RT-PCR

Gene Accession number, product Sequence 5'-3' size & references

TRPC1 NM_011643 for: CAAGAT TTTGGGAAATTTCTGG 371 bp [11] rev: TTTATCCTCATGATTTGCTAT

TRPC2 NM_011644 for: GATCCGGTTCATGTTCATCCT 326 bp [29] rev: GAGCGAGCAAACTTCCACTC

TRPC3 NM_019510 for: TGACTTCCGTTGTGCTCAAATATG 317 bp [11] rev: CCTTCTGAAGCCTTCTCCTTCTGC

TRPC4 NM_016984 for: TCTGCAGATATCTCTGGGAAGGATGC 414 bp [11] rev: AAGCTTTGTTCGAGCAAATTTCCATTC

TRPC5 NM_009428 for: ATCTACTGCCTAGTACTACTGGCT 339 bp [11] rev: CAGCATGATCGGCAATGAGCTG

TRPC6 NM_013838 for: AAAGATATCTTCAAATTCATGGTC 326 bp [11] rev: CACGTCCGCATCATCCTCAATTTC

TRPC7 NM_012035 for: CGTGCTGTATGGGGTTTATAATG 692 bp rev: GCTTTGGAATGCTGTTAGAC

TRPV1 NM_001001445 for: GCATCTTCTACTTCAACTTCTTCGTC 320 bp rev: CCACATACTCCTTGCGATGGC

TRPV2 NM_011706 for: CGGCACTTCCTCTCT 427 bp rev: GTCGGTCACGGTCAA

TRPV3 NM_145099 for: CAAGGACTGCCACCACCATC 298 bp rev: CATCACAGTTGCCAGAGAGG

TRPV4 NM_022017 for: GAGTCCTCAGTAGTGCCTGG 249 bp rev: CAACAAGAAGGAGAGCAGTC

TRPV5 NM_001007572 for: CGTTGGTTCTTACGGGTTGAA 172 bp [30] rev: GTTTGGAGAACCACAGAGCCTCTA

TRPV6 NM_022413 for: AACCAGCCTTCCACC 318 bp rev: CCTCCATTAGCACCA

TRPM1 NM_018752 for: TATCCTATGACACCAAGCCA 446 bp rev: GGTCTTCCTTATTCTCCACG

TRPM2 NM_138301 for: CAGATCCCAACCTACATTGACG 215 bp rev: GAAGGTGTAGTTGAACATGGCGA

TRPM3 NM_177341 for: CCTGTTCTTCTGGCA 497 bp rev: GCTTCTCTGGCTCCT

TRPM4 NM_175130 for: CCCTGAGGATGGTGTTGAGT 176 bp rev: AGGAGCACTGGGATGTCAAT

TRPM5 NM_020277 for: CAGATACTGAGGATGGCTGG 360 bp rev: GGATCTTGGTGGATGTGCTA

Page 7 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

Table 1: Primers used for standard RT-PCR (Continued) TRPM6 NM_153417 for: CCAGGTGCCGGTAATAACA 219 bp rev: CTCTTGTGGCTGCCTTAGGT

TRPM7 NM_021450 for: CGGAGCTGGTCGCACAATTA 295 bp rev: CCTGGAAGACATCTGTGAGG

TRPM8 NM_134252 for: TCCACGAGACTTCTTCACTT 344 bp rev: GTGTATCTGAGGTCAGTCTT

GAPDH NM_008084 for: ACCACAGTCCATGCCATCAC 451 bp rev: TCCACCACCCTGTTGCTGTA

Primers described in the literature are indicated (references). All other primers were newly designed.

Discussion plausible. In most brain areas the copy number of TRPM3 The TRP superfamily of ion channels is a structurally mRNA exceeded even that of TRPM7. In contrast to defined group of cation channels showing an enormous humans where TRPM3 shows a high expression in kidney functional diversity [1]. Although several studies have [17], mouse kidney did not reveal extensive expression of shown the distribution and tissue specific expression of TRPM3. This is in agreement with the results of Grimm these channels in mammals, the relative importance of and coworkers [18], who studied the tissue distribution of individual channels for certain tissues or cell types is TRPM3 using northern blot analysis and immunochemi- widely unknown in most cases. The present study system- cal methods. Obviously, the osmotically regulated chan- atically quantifies the expression of all members of the nel TRPM3 has different physiological relevance in TRPC, TRPV, TRPM and TRPA subfamilies in a broad spec- different species. trum of tissues. Members of the TRPC subfamily were also widely distrib- Our results suggest a high relevance of TRPM channels in uted in murine tissues, but their overall expression was many murine tissues, since members of this subfamily about one order of magnitude lower than that of the showed the highest expression levels. These findings may TRPMs. The dominant and most widely distributed iso- qualify some studies that focused on members of the form is TRPC3, which occurred in high concentrations in TRPC subfamily and tried to correlate gene expression all tested brain areas. In addition, TRPC3 expression was with physiological function. Among the TRPMs, the obviously present in many other tissues such as liver, chanzyme TRPM7 dominated over all other tested TRP lung, kidney, ovary and testis. This is largely in agreement members and seems to be ubiquitously expressed. As with results from rat tissues [11], only the absence of TRPM7 has a unique function for cellular Mg2+ homeosta- TRPC3 from rat liver showed a marked difference to our sis [15,16] its wide distribution in all tested tissues looks results. Further, we did not observe the strong expression of TRPC1 shown by Garcia and Schilling [11]. In many Table 2: Information about real-time RT-PCR primers and probes for indicated ion channel transcripts parts of human brain TRPC3 showed an at least tenfold higher expression than in peripheral tissues [12], a finding Gene Accession number Assay-on-Demand that is supported by this study in the mouse. Riccio and coworkers [12] also showed a high prevalence of TRPC1, TRPC1 NM_011643 Mm00441975_m1 C4, C5, and C7 in the CNS, i.e. a much stronger expres- TRPC2 NM_011644 Mm00441984_m1 sion in all brain regions than in peripheral tissues. Only TRPC5 NM_009428 Mm00437183_m1 TRPC6 NM_013838 Mm00443441_m1 TRPC6 expression was in the same range in CNS as in TRPC7 NM_012035 Mm00442606_m1 peripheral tissues. Our study comes to similar results for TRPV2 NM_011706 Mm00449223_m1 the mouse. Furthermore, as levels of TRP channel mRNAs TRPV3 NM_145099 Mm00454996_m1 are normalized to that of 18S rRNA (Fig. 3), it is possible TRPV4 NM_022017 Mm00499025_m1 to estimate the relative importance of an individual TRP TRPV6 NM_022413 Mm00499069_m1 member for a certain tissue or brain region. For the cellu- TRPM1 NM_018752 Mm00450619_m1 lar localization of TRP mRNAs in the CNS we used the in TRPM5 NM_020277 Mm00498453_m1 TRPM7 NM_021450 Mm00457998_m1 situ hybridization technique. In agreement with two pre- TRPM8 NM_134252 Mm00454566_m1 vious publications [19,20] we detected TRPC3 mRNA and TRPA1 NM_177781 Mm00625268_m1 TRPC6 mRNA preferentially in Purkinje cells, neurons of basal ganglia and ventricle ependym, while TRPC5 mRNA The sets of probes and primers for detection of TRP channel mRNAs was only found in a very small amount in any of these cell by TaqMan RT-PCR were obtained from PE Applied Biosystems. types. The morphometric results of the mRNA levels for

Page 8 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

Table 3: Sets of real-time RT-PCR primers and probes for detection of TRP ion channel transcripts

Gene Accession number Sequence 5'-3'

TRPC3 NM_019510 for: CCAAGCTGGCCAACATAGAG rev: GGCAAGTTTGACACGACTCA probe: actcggaggaggtggaagccattc

TRPC4 NM_016984 for: TGGAGTGGATGATATTACCG rev: CCACATGTCCCATGATTC probe: TGTGATGAACTCCTTGTATCTGGCAACAA

TRPV1 NM_001001445 for: GCATCTTCTACTTCAACTTCTTCGTC rev: CCACATACTCCTTGCGATGGC probe: CAAACTCTTGAGGGATGGTCGCCTCT

TRPV5 NM_001007572 for: CAAGAAGAAAGAGGCTCGAC rev: AATGACTGTCACCAACTCCC probe: CCGTACACATGTTCGAGATAACACCATCA

TRPM2 NM_138301 for: CAGATCCCAACCTACATTGACG rev: GAAGGTGTAGTTGAACATGGCGA probe: ACCAGTGCAGCCCCAATGGCA

TRPM3 NM_177341 for: CAAAGATGACATGCCCTATATGA rev: CTTTCTTTCTGGATGATTCCC probe: ATGAAGAGGACATGGAGCTAACAGCAA

TRPM4 NM_175130 for: CCCTGAGGATGGTGTTGAGT rev: AGGAGCACTGGGATGTCAAT probe: CTTCTTGGTGGATGATGGCACC

TRPM6 NM_153417 for: CCAGGTGCCGGTAATAACA rev: CTCTTGTGGCTGCCTTAGGT probe: CAGTTGAATGCAGAGCCAGGAGAAAC

The sets of PCR primers and TaqMan fluorogenic probes were obtained from TIBMOLBIOL.

TRPC3, C5 and TRPC6 displayed a good correlation Tissues or organs that mainly consist of muscle cells such between Real-time RT-PCR and in situ hybridization as the aorta, skeletal muscle and heart showed an overall experiments. low expression of TRP channels. However, calcium con- ducting TRP channels may also be of great importance for Members of the TRPV subfamily showed an overall lower muscle function, since contraction is controlled by cal- expression compared to members of TRPC and TRPM cium ions. The modulation of muscular calcium signaling subfamilies. This is not surprising, since several of these by increased calcium entry through the sarcolemma can channels serve as molecular sensors for pain and heat sen- have consequences for muscle function and may cause sation and occur preferentially in sensory nerve terminals dysfunction and disease [9]. For members of the TRPC [1,6]. However, some characteristic exceptions have to be subfamily the expression in smooth muscle and tissue mentioned. High expressions of TRPV4 and TRPV5 were preparations such as the aorta have been well investigated. observed in kidney (Fig. 3). This finding is in agreement Signals of TRPC1, C3, C4, C5 and C6 have been reported with earlier studies showing the importance of TRPV5 for in mouse and rat aorta, while TRPC2 and C7 transcripts calcium re-absorption in the kidney [21]. were not observed [7]. Our study confirms many of these results. In addition, we observed the presence of TRPC2 in TRPA1 expression was even lower than that of TRPVs and the aorta, but very low signals for TRPC4 and C5. Further- more or less restricted to nervous tissue, ovary, testis and more, other members of the TRP family may be of rele- spleen. Low expression of TRPA1 in brain is compatible vance for aortic smooth muscle. We found TRPV4 with its presumed function as a neuronal sensor molecule. expression almost as high as that of the most abundant Its occurrence in reproductive organs is described for the TRPC member, TRPC3. TRPC3 and TRPV4 expression was first time in this study. even exceeded by TRPM5 and TRPM7 (Fig. 3).

Page 9 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

Table 4: In situ localization of TRPC3, TRPC5 and TRPC6 transcripts in different mouse organs

tissue TRPC3 TRPC5 TRPC6

Skeletal muscle • sarcolemma +neg.± • sarcoplasmic reticulum neg. neg. neg. • myofibrils neg. neg. neg.

Heart • cardiac muscle cells + neg. ± • blood vessel endothelium neg. neg. neg.

Aorta • Tunica muscularis + + n. d. • endothelium +neg.n. d.

small intestine • smooth muscle layer neg. ± neg. • submucosa +±± • enterocytes of the villi ++ + ++ • enterocytes of the crypts +++ +++ ++

Kidney • glomeruli ± neg. neg. • distal tubule +++ ± ++ • proximal tubule neg. neg. neg.

Lung • bronchial epithel +++ + ++ • pneumocytes +±+ • blood vessel endothelium + neg. +

Liver • hepatocytes +++ ++ ++ • epithel of the Ductus interlobularis bilifer +++ ++ ++

Spleen • red pulp ++ neg. neg. • white pulp neg. ++ ++

Pancreas • exocrine acini +++ +++ +++ • islet of Langerhan's neg. neg. neg. • duct system ++ neg. neg. • blood vessel endothelium neg. neg. neg.

testis • leydig cells ++++ • sertoli cells neg. neg. neg. • spermatogonia/spermatocytes neg. neg. + • spermatozoa neg. neg. ++

Epididymis • epithelium of the Ductuli efferentes testis +++ ++ ++ • epithelium of the Ductus epididymidis + ++ ++ • spermatozoa neg. neg. neg.

Uterus • endometrium – glandular epithelial cells ++ +++ +++ • myometrium neg. ++ +

Page 10 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

Table 4: In situ localization of TRPC3, TRPC5 and TRPC6 transcripts in different mouse organs (Continued)

fallopian tube • smooth muscle layer neg. ± neg. • tubal epithelium + + +

Ovary • cortex - granulosa cells ++ + ++ - theca cells neg. ± + - corpus luteum neg. ± + • medulla neg. neg. +

CNS • spinal ganglia +++ + n. d. • cortex ++ ± + • hippocampus +neg.+ • ventricle ependym +++ ± ++ • basal ganglia ++ neg. ++ • cerebellum - Purkinje cells ++ ± +++ - Stratum granulosum + neg. +

The in situ hybridization technique was applied to tissue sections as shown in Fig. 3. The obtained signals were classified into six categories: negative (neg.), very weak (±), weak (+), moderate (++), strong (+++) or not determined (n. d.).

In human heart muscle several TRPC transcripts have specific overexpression of TRPV2 caused a cardiomyopa- been detected. TRPC1, C4, C5, and C6 mRNAs show thy due to cellular Ca2+ overload in a transgenic mouse moderate levels compared to CNS [12]. This study comes model. The severity of the cardiomyopathy was roughly to the result that among TRPC family members only related to sarcolemmal TRPV2 levels [24]. These data TRPC1, C3 and C6 occur in mouse heart at significant lev- show that TRPV2 can be an important element of cardiac els. We found only traces of TRPC4 and C5 mRNAs. Dif- Ca2+ homeostasis. Besides TRPCs and TRPV2, other mem- ferences between mouse and human heart or the fact that bers of the TRP family were found to be expressed in heart TRPC4 and C5 are not constitutively expressed may be muscle, e.g. TRPV4, V6, M4 and M7. This is in accordance responsible for these findings. Recently, the upregulation with previous studies showing the expression of TRPV4 of TRPC4 and C5 was shown in cardiomyocytes in [25], TRPV6 [26]and TRPM4 [4] in murine heart. response to inhibition of SERCA expression. In this model TRPC4 and C5 seem to be induced after insufficient func- In addition to earlier studies that focussed on the TRPC tion of SR calcium accumulation [22]. Using in situ subfamily [27,28], we investigated expression levels of hybridization experiments we were able to localize the TRPV and TRPM channels in skeletal muscle. Two reports mRNAs for TRPC3 and TRPC6 in cardiac muscle cells but described the presence of TRPC1, C2, C3, C4 and C6 not in the endothelium of cardiac blood vessels. It is mRNAs by standard RT-PCR and showed that the corre- known that the subgroup of TRPC3/C6/C7 can assemble sponding channel proteins are localized in the sarco- into homo- and heterotetramers [23]. As TRPC3 and C6 lemma [27,28]. These data are in agreement with our are expressed at significant levels in mouse heart, these results, however we suggest a dominant role of TRPC3 in two channels have the potential to form several Ca2+ con- mouse muscle, since the TRPC3 transcript occurs in much ducting non selective cation channels in myocytes and higher concentrations than those of the other TRPC mem- contribute to cardiac Ca2+ homeostasis. bers. In addition, mRNAs of TRPV3, V4 and V6 as well as TRPM3, M4 and M7 were found in considerable concen- Surprisingly, cardiac expression levels of TRP mRNAs trations in several mouse skeletal muscles including dia- showed considerable variability among different mouse phragm. strains. In C57Bl mice TRPC3 was dominantly expressed in heart muscle whereas TRPC6 was the major isoform in Apart from RT-PCR studies, databases containing NOD and Balb/c hearts. Heterogeneity was also observed expressed sequence tags (ESTs) can be used to estimate for TRPV2 expression. This mRNA was only found in gene expression. The relation of the ESTs of a certain gene NOD and Balb/c hearts and almost absent in the C57Bl to the total number of ESTs derived from a tissue provides strain. Recently, the presence of TRPV2 in the sarcolemma a measure for gene expression [31]. However, TRP tran- of cardiac muscle has been reported. Further, the cardiac- scripts code for membrane proteins of low abundance and

Page 11 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

constitute only a small fraction of the cellular transcrip- Cell lines tome. Therefore it is not surprising that ESTs derived from The mouse skeletal muscle cell line C2C12 was obtained TRP RNAs occur at very low frequencies. EST databases are from the Department of General Physiology of the Uni- not very informative for tissues such as skeletal muscle versity of Ulm. Cells were routinely grown in Dulbecco's and heart, since the number of hits for individual TRP modified Eagle's medium containing 10% fetal calf transcripts is often 0 or 1. Large numbers of ESTs exist for serum, 1% L-glutamine and 1% penicillin-streptomycin certain brain regions. In combination with the fact of a (all from Sigma) in a humidified 5% CO2 atmosphere at rather high TRP channel expression in nervous tissue EST 37°C. Cells were grown in a low density of 5 × 105 cells/ frequencies may reflect gene expression and can be com- 35-mm culture dishs and submitted to polymerase chain pared to RT-PCR data. For cerebrum and cerebellum our reaction (RT-PCR). RT-PCR data (Fig. 3) widely agree qualitatively with the occurrence of EST frequencies included in UniGene. Both RNA extraction and reverse transcription sets of data show high expression most TRPC members, Total RNA was isolated using guanidinium-isothiocy- TRPM3, 4 and 7, followed by TRPV2, 4 and 6. However, anate (RNeasy Mini Kit, Qiagen, Hilden, Germany) and current EST data show quantitative differences to the RT- RNA concentration was determined by UV absorbance PCR data and reveal some unexpected negative results. For measurements. An amount of 200 ng total RNA was example, in UniGene there is no hit for TRPC1 in cere- reverse transcribed using random hexamer primers and brum and cerebellum is negative for TRPV4 and 6. Thus, the TaqMan Reverse Transcription Reagents (PE Applied to date RT-PCR seems to be the superior method for stud- Biosystems, Weiterstadt, Germany). ying gene expression of low abundance transcripts such as TRP channel mRNAs. Standard RT-PCR PCR was performed with Taq Polymerase (Qiagen) for 40 Conclusion cycles using a Thermal Cycler Px2 (Thermo Electron, We have characterized the tissue specific mRNA expres- Dreieich, Germany). Primers used for amplification of sion of 22 TRP ion channels of four major subfamilies. We murine TRP and GAPDH gene fragments are shown in conclude that transcripts coding for members of the Table 1. For standard RT-PCR an amount of 8 ng reverse TRPC, TRPV, TRPM and TRPA subfamilies are present in a transcribed RNA was used in a 50 µl reaction volume. The broad spectrum of murine tissues. In addition to well thermocycler was programmed to apply an initial cycle studied tissues we detected many TRP isoforms in poorly consisting of 94°C denaturation for 5 min, followed by investigated tissues such as skeletal muscle, heart and 40 cycles of 54°C annealing for 15 s, 72°C elongation for reproductive organs. Expression levels of members of the 30 s and 94°C denaturation for 15 s. A final elongation TRPM subfamily were generally higher than those of step at 72°C for 5 min was included. A "no-template con- TRPC and TRPV subfamilies indicating important physio- trol" with water was performed alongside all experiments. logical roles of TRPMs. For some TRPC members the data Parallel PCR analysis was run for the housekeeping gene obtained by quantitative RT-PCR were largely confirmed GAPDH to normalize data for differences in mRNA quan- by in situ hybridization. In view of the mouse as the major tity and integrity. All primers were obtained from TIB- model organism of man, differences between TRP channel MOLBIOL (Berlin, Germany). expression in human and murine tissues are of major interest. This study offers a guideline for the investigation Preparation of DNA fragment standards of the physiological relevance of individual members of For real-time quantification by TaqMan, DNA fragments almost the whole TRP channel superfamily. containing the target sequences of TRP channels and those of 18S rRNA were cloned in the pGEM-T-Easy cloning vec- Methods tor (Promega, Germany) according to the manufacturer's Animals instructions and sequenced. Sequence identities were Mice of the inbred strains C57Bl/10SC (originally established by searching the databases using the NCBI obtained from Charles River, Sulzfeld, Germany), Balb/c BLAST program. and NOD (originally obtained from Taconic Europe Inc., Ry, Denmark) were used for the study. All animals were TaqMan RT-PCR bred in the Department of Laboratory Animal Science of To quantify the expression of mouse TRP channel genes, the Medical Faculty, University of Greifswald. Adult mice we applied the TaqMan PCR system using the 5700 (100 d) of either sex were killed using ether inhalation in Sequence Detector (Applied Biosystems). Gene-specific a manner approved by the institutional animal ethics TaqMan PCR primers and probes for murine TRP chan- committee. Tissue samples were removed quickly and fro- nels were purchased from PE Applied Biosystems (Table zen in liquid nitrogen. 2) or TIBMOLBIOL (Table 3), whereby each probe was synthesized with a fluorescent 5'-reporter dye (FAM: 6-

Page 12 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

carboxy-fluorescein) and a 3'-quencher dye (TAMRA: 6- visualized by incubation with alkaline phosphatase-con- carboxy-tetramethyl-rhodamine). Parallel TaqMan PCR jugated anti-DIG antibody (Roche Biochemicals, Ger- assays for each gene target were performed with cDNA many) and subsequent substrate reaction containing 5- samples and genomic standards. Reaction mixtures con- bromo-4-chloro-3-indolyl phosphate/nitroblue-tetrazo- tained 1× TaqMan Universal PCR Master Mix (Applied lium chloride. The level of mRNA expression was deter- Biosystems), 1× murine specific Primer and Probe Mixture mined in a blinded fashion in a single run with identical (see Tables 1, 2, 3) or 1× Eukaryotic 18S rRNA Endog- staff, equipment, and chemicals. Analysis of the stained enous control (Applied Biosystems). To quantify TRP sections was carried out by two independent investigators channel expression an amount of 8 ng reverse transcribed and staining intensity was scored ± (very weak reaction), RNA was used in a 20 µl reaction volume. To amplify 18S + (weak reaction), ++ (moderate reaction), and +++ rRNA (internal control) only 20 pg were used. PCR prod- (strong reaction). ucts were amplified (50°C, 2 min; 95°C 10 min followed by 40 cycles of 95°C, 15 s and 60°C, 1 min) and analysed Authors' contributions on a real-time PCR cycler (SDS 5700, Applied Biosys- CKK contributed to the design and coordination of the tems). Absolute copy numbers of TRP channel transcripts study assembled figures and worked on the manuscript. and 18S cDNA were determined using calibration curves CKK further performed TaqMan RT-PCR experiments. FB generated with cloned PCR fragment standards. Copy carried out in-situ hybridization experiments. JK carried numbers of individual TRP channel transcripts are given out tissue preparation, RNA isolation and standard RT- in relation to those of 18S cDNA. A "no-template control" PCR. HB contributed to the design and planning of the with water was performed parallel in all experiments. study, to the discussion and interpretation of results and Each series of experiments was performed twice. to the writing of the manuscript.

Preparation of riboprobes for in situ hybridization Acknowledgements For TRPC3, TRPC5 and TRPC6 cDNA fragments of about We are grateful to Prof. I. Klöting (Department of Laboratory Animal Sci- 200 to 300 bp length (TRPC3 [GenBank: NM_019510] ence of the Medical Faculty, University of Greifswald) for supplying mice, position nt +1856 to +2173; TRPC5 [GenBank: Dr. E. Dazert (Institute of Pathology, University of Greifswald) for provid- NM_009428] position nt +2472 to +2686, TRPC6 [Gen- ing the paraffin sections. We thank D. Schulz and H. Kenk for excellent technical assistance. This work was supported by BMBF (MD-NET, project Bank: NM_013838] position nt +2181 to +2507) were R14, 01GM0302) and the German Federal Ministry for Education and cloned into the pGEM-T-Easy cloning vector (Promega, Research (NBL3 program, reference 01 ZZ 0403). Germany). The fragments were labeled with DIG (digoxi- genin) by in vitro transcription using the DIG RNA labeling References Kit (SP6/T7, Roche Biochemicals, Germany). The anti- 1. Montell C: The TRP superfamily of cation channels. Sci STKE sense cRNA was used for the detection of the mRNA 2005, 2005:re3. 2. Montell C, Birnbaumer L, Flockerzi V, Bindels RJ, Bruford EA, Cater- whereas the sense cRNA probe served as control. ina MJ, Clapham DE, Harteneck C, Heller S, Julius D, Kojima I, Mori Y, Penner R, Prawitt D, Scharenberg AM, Schultz G, Shimizu N, Zhu MX: A unified nomenclature for the superfamily of TRP cat- In situ hybridization analysis on paraffin sections ion channels. Mol Cell 2002, 9:229-231. Non-radioactive in situ hybridization was performed with 3. Lu G, Henderson D, Liu L, Reinhart PH, Simon SA: TRPV1b, a func- paraffin sections (4 m) which had been fixed in 4 % tional human vanilloid receptor splice variant. Mol Pharmacol µ 2005, 67:1119-1127. paraformaldehyde. Sections were rehydrated and permea- 4. Murakami M, Xu F, Miyoshi I, Sato E, Ono K, Iijima T: Identification bilized by pepsin digestion (750 µg/ml pepsin in 0.2 M and characterization of the murine TRPM4 channel. Biochem HCl, 37°C, 30 min). Post-fixation (paraformaldehyde 4 Biophys Res Commun 2003, 307:522-528. 5. Harteneck C: Proteins modulating TRP channel function. Cell %, 20 min, 4°C) was followed by acetylation using 0.4 % Calcium 2003, 33:303-310. acetic anhydride in triethanolamine (0.1 M, pH8.0, 15 6. Clapham DE: TRP channels as cellular sensors. Nature 2003, 426:517-524. min). After washing with 50 % formamide in 1.5 % SSPE 7. Beech DJ, Muraki K, Flemming R: Non-selective cationic channels (20 × SSPE: 3.6 M NaCl, 0.2 M NaH2PO4, 0.2 M EDTA, pH of smooth muscle and the mammalian homologues of Dro- 7.4) the sections were prehybridized for 1 h at 56°C in a sophila TRP. J Physiol 2004, 559:685-706. 8. Clapham DE, Runnels LW, Strubing C: The TRP ion channel fam- solution containing 50 % formamide and 50 % solution ily. Nat Rev Neurosci 2001, 2:387-396. D (4 M guanidine thiocyanate, 25 mM sodium citrate, pH 9. Berchtold MW, Brinkmeier H, Müntener M: Calcium ion in skele- tal muscle: its crucial role for muscle function, plasticity, and 7.0), 0.5% blocking reagent (Roche Biochemicals, Ger- disease. Physiol Rev 2000, 80:1215-1265. many) and 210 µg/ml t-RNA. After hybridization for 12– 10. Berridge MJ, Bootman MD, Roderick HL: Calcium signalling: 16 h with prehybridization solution containing 125 ng dynamics, homeostasis and remodelling. Nat Rev Mol Cell Biol 2003, 4:517-529. digoxigenin (DIG)-labeled cRNA probe and washing with 11. Garcia RL, Schilling WP: Differential expression of mammalian 2 × SSC (20 × SSC: 3 M NaCl, 0.3 M sodium citrate; pH TRP homologues across tissues and cell lines. Biochem Biophys 7.4), sections were incubated with blocking reagent Res Commun 1997, 239:279-283. 12. Riccio A, Medhurst AD, Mattei C, Kelsell RE, Calver AR, Randall AD, (Roche Biochemicals, Germany). Bound riboprobe was Benham CD, Pangalos MN: mRNA distribution analysis of

Page 13 of 14 (page number not for citation purposes) BMC Genomics 2006, 7:159 http://www.biomedcentral.com/1471-2164/7/159

human TRPC family in CNS and peripheral tissues. Brain Res Mol Brain Res 2002, 109:95-104. 13. Yip H, Chan WY, Leung PC, Kwan HY, Liu C, Huang Y, Michel V, Yew DT, Yao X: Expression of TRPC homologs in endothelial cells and smooth muscle layers of human arteries. Histochem Cell Biol 2004, 122:553-561. 14. Kitahara T, Li HS, Balaban CD: Changes in transient receptor potential cation channel superfamily V (TRPV) mRNA expression in the mouse inner ear ganglia after kanamycin challenge. Hear Res 2005, 201:132-144. 15. Wolf FI: TRPM7: channeling the future of cellular magnesium homeostasis? Sci STKE 2004, 2004:pe23. 16. Fleig A, Penner R: The TRPM ion channel subfamily: molecular, biophysical and functional features. Trends Pharmacol Sci 2004, 25:633-639. 17. Lee N, Chen J, Sun L, Wu S, Gray KR, Rich A, Huang M, Lin JH, Feder JN, Janovitz EB, Levesque PC, Blanar MA: Expression and charac- terization of human transient receptor potential melastatin 3 (hTRPM3). J Biol Chem 2003, 278:20890-20897. 18. Grimm C, Kraft R, Sauerbruch S, Schultz G, Harteneck C: Molecular and functional characterization of the melastatin-related cation channel TRPM3. J Biol Chem 2003, 278:21493-21501. 19. Mori Y, Takada N, Okada T, Wakamori M, Imoto K, Wanifuchi H, Oka H, Oba A, Ikenaka K, Kurosaki T: Differential distribution of TRP Ca2+ channel isoforms in mouse brain. Neuroreport 1998, 9:507-515. 20. Mizuno N, Kitayama S, Saishin Y, Shimada S, Morita K, Mitsuhata C, Kurihara H, Dohi T: Brain Res Mol Brain Res 1999, 64:41-51. 21. van Abel M, Hoenderop JG, Bindels RJ: Molecular cloning and characterization of rat trp homologues from brain. Naunyn Schmiedebergs Arch Pharmacol 2005, 371:295-306. 22. Seth M, Sumbilla C, Mullen SP, Lewis D, Klein MG, Hussain A, Soboloff J, Gill DL, Inesi G: Sarco(endo)plasmic reticulum Ca2+ ATPase (SERCA) gene silencing and remodeling of the Ca2+ signal- ing mechanism in cardiac myocytes. Proc Natl Acad Sci USA 2004, 101:16683-16688. 23. Dietrich A, Mederos YSM, Kalwa H, Storch U, Gudermann T: Func- tional characterization and physiological relevance of the TRPC3/6/7 subfamily of cation channels. Naunyn Schmiedebergs Arch Pharmacol 2005, 371:257-265. 24. Iwata Y, Katanosaka Y, Arai Y, Komamura K, Miyatake K, Shigekawa M: A novel mechanism of myocyte degeneration involving the Ca2+-permeable growth factor-regulated channel. J Cell Biol 2003, 161:957-967. 25. Strotmann R, Harteneck C, Nunnenmacher K, Schultz G, Plant TD: OTRPC4, a nonselective cation channel that confers sensi- tivity to extracellular osmolarity. Nat Cell Biol 2000, 2:695-702. 26. Nijenhuis T, Hoenderop JG, van der Kemp AW, Bindels RJ: Locali- zation and regulation of the epithelial Ca2+ channel TRPV6 in the kidney. J Am Soc Nephrol 2003, 14:2731-2740. 27. Weigl L, Zidar A, Gscheidlinger R, Karel A, Hohenegger M: Store operated Ca2+ influx by selective depletion of ryanodine sensitive Ca2+ pools in primary human skeletal muscle cells. Naunyn Schmiedebergs Arch Pharmacol 2003, 367:353-363. 28. Vandebrouck C, Martin D, Colson-Van Schoor M, Debaix H, Gailly P: Involvement of TRPC in the abnormal calcium influx observed in dystrophic (mdx) mouse skeletal muscle fibers. J Cell Biol 2002, 158:1089-1096. 29. Gailly P, Colson-Van Schoor M: Involvement of trp-2 protein in store-operated influx of calcium in fibroblasts. Cell Calcium 2001, 30:157-165. Publish with BioMed Central and every 30. Van Cromphaut SJ, Dewerchin M, Hoenderop JG, Stockmans I, Van Herck E, Kato S, Bindels RJ, Collen D, Carmeliet P, Bouillon R, Car- scientist can read your work free of charge meliet G: Duodenal calcium absorption in vitamin D receptor- "BioMed Central will be the most significant development for knockout mice: functional and molecular aspects. Proc Natl disseminating the results of biomedical research in our lifetime." Acad Sci USA 2001, 98:13324-13329. 31. Unigene database [http://www.ncbi.nlm.nih.gov/]. Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright

Submit your manuscript here: BioMedcentral http://www.biomedcentral.com/info/publishing_adv.asp

Page 14 of 14 (page number not for citation purposes) This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/copyright Author's personal copy

Neuromuscular Disorders 18 (2008) 501–513 www.elsevier.com/locate/nmd

Transient receptor potential cation channels in normal and dystrophic mdx muscle

Jana Kru¨ger, Christiane Kunert-Keil, Frederike Bisping, Heinrich Brinkmeier *

Institute of Pathophysiology, Ernst Moritz Arndt University of Greifswald, Greifswalder Street 11C, D-17495 Karlsburg, Germany

Received 15 January 2008; received in revised form 28 March 2008; accepted 8 April 2008

Abstract

To investigate the defective calcium regulation of dystrophin-deficient muscle fibres we studied gene expression and localization of non-voltage gated cation channels in normal and mdx mouse skeletal muscle. We found TRPC3, TRPC6, TRPV4, TRPM4 and TRPM7 to be the most abundant isoforms. Immunofluorescent staining of muscle cross-sections with antibodies against TRP proteins showed sarcolemmal localization of TRPC6 and TRPM7, both, for mdx and control. TRPV4 was found only in a fraction of fibres at the sar- colemma and around myonuclei, while TRPC3 staining revealed intracellular patches, preferentially in mdx muscle. Transcripts of low abundance coding for TRPC5, TRPA1 and TRPM1 channels were increased in mdx skeletal muscle at certain stages. The increased Ca2+-influx into dystrophin-deficient mdx fibres cannot be explained by increased gene expression of major TRP channels. However, a constant TRP channel expression in combination with the well described weaker Ca2+-handling system of mdx fibres may indicate an imbalance between Ca2+-influx and cellular Ca2+-control. Ó 2008 Elsevier B.V. All rights reserved.

Keywords: Duchenne muscular dystrophy; mdx mouse; Calcium influx; TRP channels; TRPC3; TRPC6; TRPV4; TRPM7; Sarcolemma

1. Introduction nism that connects dystrophin deficiency to fibre necrosis [5]. Duchenne muscular dystrophy (DMD) and its animal It is widely accepted that an abnormal calcium influx model murine muscular dystrophy (mdx) are characterized and abnormal intracellular calcium handling are key fac- by the lack of dystrophin, a submembraneous cytoskeletal tors in the destructive process leading to muscle fibre protein [1,2]. Dystrophin deficiency leads to necrosis of degeneration in dystrophin-deficient muscle [6–10]. The muscle fibres, muscle damage, fibrosis and progressive total muscle calcium content is increased in DMD [11,12] muscle weakness [3]. Though mdx mice show a much and mdx muscle [13] while the free global cytoplasmic cal- milder phenotype than DMD patients, their fibres also cium level of mdx muscle fibres is unchanged or at least undergo the typical cycles of necrosis and regeneration close to that of normal fibres [14–16]. It is assumed that [4]. In contrast to muscles of DMD patients, mdx muscle effective compensatory mechanisms extrude excessive cal- is characterized by continuous regeneration and tissue cium from the cytoplasm and that fibres can adjust a nearly remodelling, effects that seem to compensate effectively normal free cytoplasmic calcium level at least at rest. How- for the lack of dystrophin. Nevertheless, the mdx mouse ever, a more sophisticated approach revealed that mdx is regarded as a suitable model to study the pathomecha- myotubes can develop much higher calcium transients in the sub-sarcolemmal area than in the bulk cytosol. Carba- chol-induced Ca2+ transients below the plasma membrane were in average 4.5-fold higher in mdx myotubes compared * Corresponding author. Tel.: +49 3834 86 19319; fax: +49 3834 86 19111. with controls [17]. In adult, resting mdx fibres the sub-sar- E-mail address: [email protected] (H. Brinkmeier). colemmal calcium concentration was estimated to be three-

0960-8966/$ - see front matter Ó 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.nmd.2008.04.003 Author's personal copy

502 J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513 fold higher than that of control fibres using Ca2+-activated expression of TRPV2 can lead to pathological changes due K+ channels as indicators [18]. Increased Ca2+ influx and to Ca2+ overload in cardiac muscle [31]. Thus, TRPV chan- increased Ca2+ levels may stimulate proteolytic activity nel dysfunction may contribute to the pathogenesis of which is indeed higher in mdx compared to control muscle degenerative diseases, such as muscular dystrophy. [19]. As a consequence, affected muscle fibres may become The present study was designed to identify candidates of necrotic or apoptotic and release mitogenic chemoattrac- cation channels responsible for the abnormal Ca2+ influx in tants which initiate inflammatory processes [20]. Finally, dystrophin-deficient muscle. To obtain an overview about the continuous cycles of degeneration and partial regener- the expression of cation channel genes in skeletal muscle, ation lead to irreversible muscle wasting and replacement we studied the expression of all DEG/ENaC channels of muscle tissue by connective and adipose tissue. and all group1 TRP channels on the RNA level in control While Ca2+ influx is increased in mdx muscle fibres, the and mdx mice. For the first time we established a complete concentration of certain calcium binding proteins is reduced. set of gene expression data for all relevant non-voltage Calsequestrin-like proteins [21] and sarcalumenin [7], pro- gated cation channels. In addition, the presence of four teins that are involved in sarcoplasmic Ca2+ storage, are major Ca2+ conducting TRP channels was studied on the markedly decreased and show an abnormal staining pattern protein level and their cellular localization was investigated in mdx muscle. This observation may indicate that dystro- by immunochemistry. phin-deficient fibres have a weaker system to keep their free intracellular Ca2+ within the physiological range. 2. Materials and methods Though many abnormalities in calcium handling have been described in dystrophin-deficient fibres, the mecha- 2.1. Animals nisms of Ca2+ entry are still a matter of debate. Voltage- gated L-type Ca2+ channels do not seem to account for 2+ Mice of the inbred strains C57Bl/10Sc/J (control) and the increased Ca influx, since they have a low open prob- mdx C57Bl/100ScSn-Dmd /J (mdx) were originally obtained ability at resting potential. It was shown that L-type Ca2+ from Charles River (Sulzfeld, Germany). Animals of either current densities increased with age in mdx fibres, but were sex were used for the study at ages 30, 100 and 365 d. Both always significantly smaller than those of age-matched con- strains were bred in the Department of Laboratory Animal trol fibres [22]. Stretch-activated channels [23], calcium leak Science of the Medical Faculty at the University of Greifs- channels [6] mechanosensitive channels [24], insulin-like wald. All animals were killed using ether inhalation accord- growth factor (IGF-1) activated channels [25] and store- ing to the regulations of the University of Greifswald. operated channels [26] are regarded as candidates for influx Tissue samples were removed quickly and frozen in liquid pathways of Ca2+ into muscle fibres. Recently, physiologi- nitrogen for real-time RT-PCR and situated in formalin- cal and pharmacological data indicated that stretch-acti- buffer for in situ hybridisation and immunohistochemistry. vated channels and store-operated channels belong to the Muscle tissue from TRPC3 knockout mice was kindly pro- same channel population in skeletal muscle or share com- vided by Dr. L. Birnbaumer, National Institute of Environ- mon constituents [27]. mental Health Service, NC, USA. We have also described an influx pathway for divalent cations into skeletal muscle fibres. It is active at rest and the rate of influx in mdx fibres was found to be twofold 2.2. TaqMan RT-PCR higher as in normal fibres [28]. Based on physiological data on divalent cation influx and sarcolemmal channel activity TaqMan RT-PCR assays of mouse TRP channel genes we hypothesized that candidates for influx channels could were performed as described previously [32]. To quantify be members of the degenerin/epithelial Na+-channel gene expression of mouse DEG/ENaC channels, voltage + (DEG/ENaC) family of cation channels or members of gated Na channels SCN4A and SCN5A and the skeletal the transient receptor potential (TRP) ion channel super- muscle ryanodine receptor (RyR1) we purchased gene-spe- family. Vandebrouck and coworkers showed that TRPC1, cific TaqMan PCR primers and probes from PE Applied 4 and 6 are localized at the sarcolemma of mdx muscle Biosystems (Weiterstadt, Germany, Table 1) or TIBMOL- fibres [29] and suggested that these proteins are the molec- BIOL (Berlin, Germany, Table 2) with each probe having 2+ ular counterparts of the above mentioned Ca -leak chan- Table 1 nels. However, in the latter study only one subfamily, Primers and probes for real-time RT-PCR of ion channel transcripts TRPC, of the large TRP channel superfamily [30] has been Gene Accession Nos. Assay-on-demand investigated. The superfamily of TRP channels has been ACCN1 NM_007384 Mm00475691_m1 divided into six subfamilies in mammals, TRPC, TRPV, SCN4A NM_133199 Mm00500103_m1 TRPM, TRPA, TRPP and TRPML according to struc- SCN5A NM_021544 Mm00451971_m1 tural similarities and modes of activation [30]. The mem- RYR1 NM_009109 Mm01175172_g1 bers of subfamilies TRPC, TRPV, TRPM and TRPA a1-Actin NM_009109 Mm01175172_g1 comprise the Group 1 TRPs, while the TRPP and TRPML The sets of probes and primers for detection by TaqMan RT-PCR were members are classified as the Group 2 TRPs [30]. The over- obtained from PE Applied Biosystems. Author's personal copy

J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513 503

0 been synthesised with a fluorescent 5 -reporter dye (FAM: 5 mM NaN3, pH 8.2) supplemented with a protease 6-carboxy-fluorescein) and a 30-quencher dye (TAMRA: inhibitor cocktail (Sigma, Taufkirchen, Germany) using 6-carboxy-tetramethyl-rhodamine). an Ultrathurax. Then the suspension was centrifuged at 11,000g for 1 h at 4 °C. The pellets containing the crude 2.3. Antibodies membrane fractions were resuspended in Gly-Gly-buffer supplemented with protease inhibitors. The protein con- A polyclonal anti-TRPM7 antibody was generated in a centration of the membrane fractions and the superna- rabbit using the deduced N-terminal sequence STKE- tant (containing soluble proteins) was determined by SEATNSVRLMLC of mouse TRPM7 for immunisation. the bicinchoninic acid method [33]. Protein samples The obtained serum was subsequently affinity purified at Uni- (50 lg) of the pellet fractions were subjected to SDS gels cus (Karlsburg, Germany). Additionally, the following poly- and transferred to nitrocellulose membranes (Schleicher clonal antibodies were used: anti-TRPC3, anti-TRPC6, and & Schuell, Dassel, Germany) using a tank blotting sys- anti-TRPV4 (Alomone Laboratories, Jerusalem, Israel). tem (Gibco-BRL, Germany). Blots were incubated with polyclonal antibodies against TRPC3, TRPC6, TRPV4 2.4. In situ hybridization analysis and immunohistochemistry and TRPM7 (dilution 1:100 in PBS containing 5% pow- dered milk and 0.025% NaN3)at4°C over night. As a Non-radioactive in situ hybridization was performed with control for the specificity of the antibodies, antigen digoxigenin-labeled cRNA probes as described previously pre-incubated antibodies (1 lg peptide per 1 lg of anti- [32]. Confocal laser-scanning microscopy was performed body) were used in the same way described above. Sec- on paraffin sections (4 lm) after immunofluorescence label- ondary alkaline phosphatase-conjugated goat anti-rabbit ling with polyclonal antibodies (anti-TRPC3, TRPC6, immunoglobulins (DAKO, Hamburg, Germany) were TRPV4: dilution 1:200) or the affinity-purified TRPM7 anti- used at a 1:1000 dilution. Visualization of bound second- body (dilution 1:100). As a control for the specificity of the ary antibody was achieved in incubation buffer (100 mM antibodies, antigen pre-incubated antibodies (1 lg peptide Tris/Cl, 5 mM MgCl2, 100 mM NaCl, pH 9.5) containing per 1 lg of antibody) were used in the same way. Slices were 5-bromo-4-chloro-3-indolyl phosphate/nitroblue-tetrazo- labelled with Alexa Fluor 568 goat anti-rabbit immunoglob- lium chloride. ulin G (dilution 1:500, MoBiTec, Go¨ttingen, Germany) and counterstained with Sytox Green (dilution 1: 50,000, 3. Results MoBiTec). 3.1. Major cation channels in mdx and control mouse muscle 2.5. Immunoblot analysis Quantitative TaqMan RT-PCR performed on muscle Murine tissue samples were mechanically homogenized tissue samples revealed the presence of many cation chan- during thawing in Gly-Gly-buffer (50 mM glycylglycine, nel transcripts in mdx and control muscle. Since we did

Table 2 Sets of real-time RT-PCR primers and probes for detection of DEG/ENaC channel transcripts Gene Accession Nos. Sequence 50–30 ACCN2 NM_009597 for: AGGCTTCCAGACGTTTGTG rev: GCTCCGGAGTACAGTATGGG probe: TTCGACTCCTACAGCATCACGGCC ACCN3 NM_183000 for: AAGTGCGGATGTCGAATGAT rev: GTTCCACGGCCTCATAGTTG probe: AGTACAAGGACTGTGCCAGCCCAGC ACCN4 NM_183022 for: ACATTGAATGTGCCGACC rev: CCATGGCTTCAGAAGTTAGG probe: TCGTTACGGCAAAGAGATCTCCATGG ACCN5 NM_021370 for: CCATCCTTGATCACATCGAG rev: CACGAGATTCTCCCGGATA probe: ACAACTCCAGCTGCCCTGTGTCA SCNN1A NM_011324 for: TGCCTTCTCCTTGGATAGCC rev: GACTTCACAGACGGCCATC probe: AGGAAGCCGTGCAGTGTGACCAAC SCNN1B NM_011325 for: ACCACATGATCCGTAACTGC rev: TGCTCAGGGTGATATTCGAG probe: AAGGAGTCCTGCAATGACACCCAG SCNN1G NM_011326 for: ACCCTTTCATCGAAGACGTG rev: GGACAAAGGCCTGGTACAG probe: CTATTCCCTCCAGATCTGCCTTTACTCA The sets of PCR primers and TaqMan fluorogenic probes were obtained from TIBMOLBIOL (for, forward primer; rev, reverse primer). Author's personal copy

504 J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513 not observe differences in gene expression between male ular weight of TRPV4 and was therefore selected for and female animals the data of both sexes were combined. quantitative evaluation (Fig. 3C). TRPM4 was only Five isoforms of TRP channel mRNAs dominated over all tested by real-time RT-PCR and revealed lower levels other tested ones showing the following frequency of in mdx muscle at early stages (30 d, 100 d), but not at occurrence: TRPM7 > TRPC3 P TRPV4 = TRPM4 > 1 year (Fig. 1). TRPC6. These data were confirmed with m. tibialis ante- The expression of TRPM7 mRNA was almost the same rior, diaphragm (Fig. 1, Table 3), m. gastrocnemius and in muscles from 30 d and 100 d-old mdx mice and very sim- heart (data not shown) and were observed for both geno- ilar to that of controls. At the very late stage of 1 year we types. Therefore, further investigations were focussed on found a higher mRNA level in mdx diaphragm (Fig. 1). these five members of the TRP channel family. The presence of the TRPM7 protein was shown by an In 100 d-old mdx and control mice the TRPM7 mRNA immunoreactive band of about 210 kDa at all stages and showed the highest level among the transcripts of high for both genotypes (Fig. 2). The up-regulation of the abundance. The next frequent TRP channel transcript TRPM7 mRNA expression in 1-year-old mdx mice was was that of TRPC3, which reached about 10% of the not simultaneously observed for the TRPM7 protein TRPM7 mRNA level. TRPV4 and TRPM4 transcripts (Fig. 3D). occurred in the same range as that of TRPC3 while TRPC6 To compare the expression levels of the mentioned non- showed the lowest level of the five selected isoforms reach- voltage cation channels with well described muscle specific ing about 30% compared to TRPC3 mRNA. In mdx mus- ion channels we quantified mRNA levels of SCN4A, cle from 100 d-old animals, TRP channel expression was SCN5A and RYR1 genes, coding for voltage gated sodium similar to that of controls, only TRPC6 and TRPM4 channels and the ryanodine receptor 1. The transcript of mRNA levels were significantly reduced by 50–85% SCN5A was consistently found in skeletal muscles at low (Fig. 1, Table 3). Heart muscle showed a similar expression levels without showing differences in the expression pattern of TRP channels as skeletal muscle (data not between mdx and control mice (Table 3). However, the shown). SCN4A and RYR1 transcript levels were significantly To test for age-dependent changes of TRP channel gene reduced in mdx mice and reached only between 25% and expression and alterations during the course of murine 60% of the mRNAs level of control muscles. As a control muscular dystrophy we studied mRNA and protein levels the level of skeletal muscle a1-actin mRNA was tested at different stages. TRPC3 mRNA expression was nearly and found to be unchanged in mdx tibialis and gastrocne- constant at 30 and 100 d in all tested muscles of mdx and mius muscles. Only in mdx diaphragm there was a control mice. At the very late stage of 1 year we found a tendency of a reduced expression of a1-actin mRNA downregulation of TRPC3 mRNA in tibialis muscle and (Table 3). diaphragm of mdx mice (Fig. 1). Also for gastrocnemius muscle and heart we detected a tendency of lower TRPC3 3.2. Cellular localization of major TRP channel mRNAs and mRNA levels (data not shown). proteins Western blot analysis allowed us to quantify the TRPC3 protein (Fig. 2). A main band of approximately 90 kDa To study, whether the dominant muscular TRP channels was detected. This band agrees with the expected molecular occur preferentially in muscle fibres and not in non-muscle weight of TRPC3. The band was absent when muscle pro- cells we applied in situ hybridization of mRNAs. Further, teins from a TRPC3 knockout mouse were blotted in the we tried to detect TRP channel proteins by immunofluores- same way (Fig. 2B). The quantitative evaluation of TRPC3 cence staining. In situ hybridization experiments revealed Western blots did not show differences between mdx and the presence of TRPC3, TRPC6, TRPV4 and TRPM7 control mice at any stage, except of a tendency of reduced mRNAs within muscle fibres close to the sarcolemma, both levels in 1-year-old mdx mice (Fig. 3A). Thus, TRPC3 pro- for mdx and control (Fig. 4). In addition mdx fibres tein and mRNA expression are widely in agreement (Figs. showed positive reactions around central nuclei. Control 1 and 3A). experiments with the corresponding sense cRNA probes Gene expression and Western blot analyses of were negative (Fig. 4, second row). In mdx muscle a strong TRPC6 yielded the following results: In tibialis muscle staining for some TRP channel RNAs was also seen in of mdx mice, but not in diaphragm, we observed a mononucleated cells and regenerating fibres (data not marked reduction of the mRNA levels at all stages shown). (Fig. 1). Also the TRPC6 protein, detected by an immu- Immunofluorescence staining of muscle cross-sections noreactive band at about 100 kDa occurred at reduced showed the presence of TRP proteins in the sarcolemma levels in 100 d and 1-year-old mdx muscle (Figs. 2 of muscle fibres (Fig. 5). Sarcolemmal staining was most and 3B). TRPV4 gene expression was consistently found obvious for TRPV4, both in mdx and control muscle. In in mouse skeletal muscle, but we did neither observe addition, the TRPV4 antibody stained peripheral nuclei mentionable age-dependent changes nor differences (control) and central nuclei (mdx) of muscle fibres. TRPC3 between mdx and control (Figs. 1–3C). The band at was partly found at the sarcolemma of mdx and control about 100 kDa (Fig. 2) agrees with the expected molec- fibres and showed besides a diffuse cytoplasmic localization Author's personal copy

J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513 505

m. tibialis anterior diaphragm TRPC3 0.005 0.005

0.004 0.004 0.003 *** 0.003 0.002 0.002

0.001 0.001 TRPC3 / 18S rRNA 0 0 30d 100d 365d 30d 100d 365d

TRPC6 0.002 0.002

0.0015 0.0015

0.001 ** 0.001 0.0005 * 0.0005 TRPC6 / 18S rRNA ** 0 0 30d 100d 365d 30d 100d 365d

TRPV4 0.002 0.002

0.0015 0.0015 ** 0.001 0.001

0.0005 0.0005 TRPV4 / 18S rRNA

0 0 30d 100d 365d 30d 100d 365d

TRPM4 0.002 0.002

0.0015 0.0015 ** ** 0.001 * 0.001 ** * 0.0005 0.0005 TRPM4 / 18S rRNA 0 0 30d 100d 365d 30d 100d 365d

TRPM7 0.04 0.04

0.03 0.03

0.02 0.02

0.01 0.01 ** TRPM7 / 18S rRNA 0 0 30d 100d 365d 30d 100d 365d control mdx

Fig. 1. Quantification of predominant TRP ion channel mRNA levels in tibialis muscle and diaphragm. Levels of TRPC3, TRPC6, TRPV4, TRPM4 and TRPM7 mRNAs were determined by real-time RT-PCR using RNA preparations from tibialis muscle and diaphragm. Samples were from 30, 100 and 365 d mdx mice (open symbols and dashed lines) and control mice (black symbols and continuous lines). The mRNA levels of TRP ion channels are given in relation to that of 18S rRNA. Means ± SEM are given in all cases for n = 3–8 samples. Stars indicate significant differences: *p < 0.05; **p < 0.01; ***p < 0.005, unpaired t-test. in most fibres. In mdx fibres, but not in control fibres, at the sarcolemma. They further showed a weak cytoplas- prominent intracellular patches were observed for TRPC3 mic staining in some fibres and co-localization with periph- (Fig. 5). TRPC6 and TRPM7 were preferentially detected eral (control) and central (mdx) nuclei. The nuclear Author's personal copy

506 J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513

Table 3 Summary of muscle specific gene expression in mdx and control mice Gene m. tibialis C57Bl m. tibialis mdx Diaphragm C57Bl Diaphragm mdx Significant difference TRPA1 0.0016 0.0982 0.0057 0.064 p < 0.05 TRPC1 0.1018 0.0209 0.1101 0.0867 ns TRPC2 0.0991 0.0236 0.0482 0.0567 ns TRPC3 1.143 0.6751 1.44 1.7406 ns TRPC4 0.0847 0 0 0 ns TRPC5 0.1035 0.0907 0.0088 0.0497 p < 0.05 TRPC6 0.3773 0.0461 0.5764 0.3388 p < 0.05 TRPC7 0.0147 0 0.0252 0 ns TRPM1 0.0006 0.0581 0.0023 0.0226 p < 0.05 TRPM2 0.2318 0.0031 0.0284 0.0164 ns TRPM3 0.0855 0.2596 0.4173 0.6364 ns TRPM4 0.860 0.3873 1.0117 0.5049 p < 0.01 TRPM5 0.0229 0.0051 0.292 0.0144 ns TRPM6 0.0422 0 0.2347 0.0354 ns TRPM7 15.2443 8.505 19.436 16.8714 ns TRPM8 0.0046 0.0022 0.0016 0 ns TRPV1 0 0 0 0 ns TRPV2 0.0923 0.0506 0.1117 0.2403 ns TRPV3 0.012 0 0.0219 0 ns TRPV4 0.3962 0.3776 1.1365 0.546 p < 0.01 TRPV5 0.0151 0 0 0 ns TRPV6 0.0288 0.0042 0.0117 0.0047 ns SCNN1a 0.0756 0.0340 0.2714 0.0696 ns SCNN1b 0.4003 0.1799 0.0022 0.1784 p < 0.01 SCNN1g 0.1713 0.3236 0.0081 0.1879 p < 0.005 ACCN1 0.0445 0.0036 0.2289 0.0307 ns ACCN2 0.0666 0 0 0.0022 ns ACCN3 0.0444 0 0 0 ns ACCN4 0 0 0 0 ns ACCN5 0 0 0 0 ns SCN4A 101.5 26.8 66.0375 10.336 p < 0.005 SCN5A 0.1329 0.0874 0.1323 0.1496 ns RYR1 1 684 1 656 212.5 127 p < 0.05 a1-actin 42 086 53 063 19 093 6 364 ns Expression levels of mRNAs coding for group 1 TRP channels, DEG/ENaC channels, voltage-gated Na+ channels, RyR1 and a1-actin as determined by real-time RT-PCR. Tissue samples were from tibialis anterior muscles and diaphragms of 100 d-old mdx and control mice. Mean levels of mRNAs (from 3 to 10 samples) are given in relation to that of 18S rRNA. All values were multiplied by 1000. If the threshold level of fluorescence according to the TaqMan RT-PCR technique was not reached after 40 cycles of amplification, a resulting expression level of zero (0) was assigned to the corresponding gene transcript. Significant differences (unpaired t-test) between mdx and control mice are given and the respective data printed bold (m., musculus; ns, not significant). localization was prominent and frequently observed for 3). Among the transcripts of low abundance we observed TRPM7, but hardly detectable for TRPC6. As controls the following differences between control and mdx muscle: antibodies were pre-incubated with respective C-terminal SCNN1b and SCNN1a mRNAs were found to be peptides. Under these conditions no specific staining was increased in mdx diaphragm. TRPA1 and TRPM1 mRNA detectable (Fig. 5, second row). levels were in average more than 10-fold higher in 100 d- old mdx mice compared to control (Fig. 6, Table 3); 3.3. Cation channel transcripts of low abundance in mdx and TRPC5 mRNA levels were increased in mdx diaphragm. control mouse muscle The latter three TRP isoforms showed marked age-depen- dent changes in mdx muscle. The mRNA levels of TRPA1 To obtain a complete overview about muscular cation and TRPM1 substantially increased between two to four- channel expression we tested, in addition to the 5 major fold in mdx muscle whereas they remained almost constant transcripts, the occurrence of all other 17 members of the over time in the controls. In contrast, the TRPC5 mRNA group 1 TRP channels and of all DEG/ENaC cation levels were significantly lower in aged mdx muscle and channels. The expression levels of all of these transcripts yielded only 10% of the level at 30 d (Fig. 6). were below 0.0005 copies channel mRNA/18S rRNA, i.e., less than 50% of the TRPC6 mRNA level, both for 4. Discussion mdx and control muscle. Some cation channel transcripts (TRPC4, TRPV1, TRPV3, TRPV5 and ACCN2-5) were The lack of dystrophin in muscle fibres is closely related hardly or not at all detectable in both genotypes (Table to an increased Ca2+ influx in such fibres. In dystrophin- Author's personal copy

J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513 507

antibody A control mdx +peptide 30d 100d 365d 30d 100d 365d 100 kDa TRPC3 75 kDa

116 kDa TRPC6

TRPV4 116 kDa

83 kDa

48 kDa

33 kDa

TRPM7 203 kDa

α-actinin 100 kDa

- B -/

control mdx TRPC3

TRPC3

α-actinin

Fig. 2. Detection of TRP channel proteins in tibialis muscle. (A) Representative Western blots of TRPC3, TRPC6, TRPV4 and TRPM7 in skeletal muscle of 30 d, 100 and 365 d-old mdx and control mice. The membranes were probed with TRPC3, TRPC6, TRPV4, TRPM7 or a-actinin antibodies. As controls replica of the blots were probed with the TRP channel antibodies after pre-absorption with the respective C-terminal antigenic peptides (most right column). (B) Western blot to detect TRPC3; proteins of tibialis muscles from 100 d-old mdx, control and TRPC3-deficient mice were applied. deficient fibres in particular the sub-sarcolemmal Ca2+ level agreement with Vandebrouck and coworkers [29] we found is increased, an observation that restricts the primary site several members of the TRPC subfamily of cation chan- of abnormal Ca2+ handling to the surface membrane of nels. However, in contrast to the latter study we quantified the muscle fibres [17,18]. In the past many studies have TRPC channel expression by real-time RT-PCR and been performed to identify Ca2+-conducting ion channels extended the investigations to the complete set of 22 Group that could allow an increased sarcolemmal Ca2+ influx. 1 TRP channels [30,32] and 8 members of the DEG/ENaC These studies used both, physiological and molecular family of cation channels. methods, but until to date no clear candidate for the Among the tested transcripts of the DEG/ENaC family proposed influx channel has been identified [34,35]. How- four were found to be expressed in skeletal muscle and ever, there is wide agreement that a major contribution SCNN1b and SCNN1g were increased in mdx diaphragm, of voltage-gated Ca2+ channels to the sarcolemmal Ca2+ but not in limb muscles. Since the detected DEG/ENaC influx is unlikely [22,36]. On the other hand mechanosensi- transcripts SCNN1a, b and g code for Na+-selective ion tive channels and store-operated channels were brought channels, it is unlikely that members of this family contrib- into focus by several authors [23,26,27,35,37,38]. In addi- ute significantly to sarcolemmal Ca2+ influx. In skeletal tion, the molecular identification of the calcium release muscles and heart TRPC3, TRPC6, TRPV4, TRPM4 activated calcium (CRAC) channel as Orai1 [39] offers an and TRPM7 mRNAs were the dominant isoforms of the alternative for a Ca2+- influx channel. According to recent TRP superfamily. These observations extend earlier results findings Orai1 may be associated with TRP channels and on TRP channel expression in murine muscle tissues [32]. other proteins forming a macromolecular complex In mdx muscle the mRNA expression of the predominant involved in store-operated Ca2+ entry [40]. TRP channels TRPC3, TRPV4 and TRPM7 was The present study confirms that many transcripts coding unchanged while that of TRPC6 and TRPM4 was signifi- for non-voltage gated cation channels are expressed in cantly reduced compared with control muscle. However, normal and dystrophic skeletal muscle (Table 3). In also the mRNA levels of the muscle specific genes SCN4A Author's personal copy

508 J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513

A B 1.2 1.2

1 1 -actinin 0.8 -actinin 0.8 α α 0.6 0.6 * * 0.4 0.4

0.2 0.2 mod TRPC3 / mod TRPC6 / 0 0 30d 100d 365d 30d 100d 365d C D 1.8 1.6 1.6 1.4 1.4 1.2 -actinin

-actinin 1.2 α

α 1 1 0.8 0.8 0.6 0.6 0.4 0.4 0.2

mod TRPV4 / 0.2 mod TRPM7 / 0 0 30d 100d 365d 30d 100d 365d control mdx

Fig. 3. Quantification of TRP channel proteins in tibialis muscle. Quantitative analyses of Western blots as shown in Fig. 2. Protein extracts of tibialis muscles from 30, 100 and 365 d-old mdx and control mice were separated on SDS gels, blotted and stained. Protein bands attributed to TRPC3, TRPC6, TRPV4 and TRPM7 were evaluated using the GelScan 5.2 software (Serva, Germany). The mean optical densities (mod) ± SEM are given in all cases for three independent Western blots and n = 3–5 muscle samples. (A) TRPC3, (B) TRPC6, (C) TRPV4, (D) TRPM7. Stars indicate significant differences: *p < 0.05, unpaired t-test. and RYR1 were reduced. Decreased gene expression in ground or resting Ca2+ influx in muscle fibres. The immu- mdx muscle has been frequently described in the literature. nochemical data for TRPC3 and TRPC6 using Alomone Turk and coworkers showed that genes coding for compo- antibodies seem to be valid, since corresponding bands in nents of the dystrophin-associated glycoprotein complex the Western blots were absent when tissue from knockout are downregulated in mdx muscle [41]. Furthermore, mdx mice was tested (Fig. 2B, for TRPC6 see [44]). diaphragm and hindlimb muscles show lower expression Another potential Ca2+-influx channel of the sarco- of genes involved in cellular Ca2+ control, e.g., the SR cal- lemma is TRPV4, a non-voltage gated channel with a 2+ cium ATPase, parvalbumin [42], calsequestrin-like proteins rather high Ca selectivity (PCa/PNa = 6). This study [21] and sarcalumenin [7]. The reduction of molecules shows that TRPV4 is one of the most abundant TRP chan- involved in cellular Ca2+ handling in combination with a nels in mouse skeletal muscle and that the channel protein constant expression of Ca2+-influx channels may indicate is localized in the sarcolemmal membrane of mdx and con- an imbalance between Ca2+-influx pathways and cellular trol fibres. Since the functional role of TRPV4 has not yet Ca2+ control. been investigated in skeletal muscle one can only speculate TRPC3 was found to be one of the predominant TRP about its role in muscle fibres. In other cell types TRPV4 channels in skeletal muscle and the mRNA and protein lev- can be activated by osmotic cell swelling, mechanical stim- els were unchanged in mdx compared to control. The ques- uli and synthetic and endogenous chemical substances tion whether TRPC3 forms an important sarcolemmal [45,46]. Based on these findings TRPV4 it may well func- Ca2+-influx channel in skeletal muscle is difficult to esti- tion as a muscular Ca2+-influx channel that is abnormally mate, because according to immunohistochemical analyses regulated in dystrophin-deficient muscle. The most fre- it is preferentially localized in the intracellular compart- quent non-voltage gated cation channel in skeletal muscle ment (Fig. 5) [29]. In non-muscle cells TRPC3 function is is probably TRPM7, since its mRNA level is about 10 fold regulated by channel translocation to the plasma mem- higher than those of TRPV4 and TRPC3. Though TRPM7 brane [30,43], a mechanism that has not been studied in preferentially conducts Mg2+ it provides a significant Ca2+- skeletal muscle. However, it is possible that TRPC3 func- entry pathway [47]. However, TRPM7 is functionally con- tions as a Ca2+-influx channel in skeletal muscle that is trolled by intracellular Mg2+ and since the Mg2+ concen- translocated to the plasma membrane dependent on phys- tration is unchanged in mdx muscle [13] there is no iological requirements. In contrast to TRPC3, TRPC6 evidence to assume a major contribution of TRPM7 to showed a typical sarcolemmal staining in mdx and control the increased Ca2+ influx in mdx muscle. The immuno- muscle. Therefore, TRPC6 could well contribute to back- chemical data for TRPV4 and TRPM7 seem to be valid, Author's personal copy

J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513 509

Fig. 4. In situ localization of various TRP channel mRNAs in tibialis muscle. In situ hybridization of TRPC3, C6, V4 and TRPM7 mRNA was performed with tissue sections of 100 d-old mdx and control mice. Sections were incubated with the antisense and the respective sense cRNA probe of TRPC3. For TRPC6, TRPV4 and TRPM7 only results with antisense probes are shown. Positive reactions appear as dark staining close to the sarcolemma of control muscle fibres. In mdx fibres staining was also observed around central nuclei. Magnification: 200Â. since the antibodies stained a band at the expected molec- localizations of the antigens, an observation that is in ular weight in the Western blot. Immunohistochemical agreement with the presumed localization of TRP staining of muscle cross-sections points to sarcolemmal channels. Author's personal copy

510 J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513

Fig. 5. Immunohistochemical staining of TRP channel proteins in tibialis muscle. Immunofluorescence staining of TRPC3, C6, V4 and TRPM7 was performed with cross-sections of 100 d-old mdx and control mice. Confocal laser scanning microscopy-based images show double label fluorescence of nucleic acid (green) and TRP channel proteins (red). In the merged images co-localization appears in yellow. As a control peptide-antigen pre-incubated antibodies were used in the same way than untreated antibodies (only shown for TRPC3). Magnification: 200Â.

The decreased TRPM4 and TRPC6 expression levels in the dystrophic phenotype in mdx mouse muscle [48]. This mdx muscle could be a secondary effect in response to the finding shows the existence of a signalling pathway that increased Ca2+ influx. Recently it was shown, that tar- connects chronically increased Ca2+ levels to altered gene geted inhibition of Ca2+/calmodulin signalling exacerbates expression in dystrophin-deficient muscle, leading to a Author's personal copy

J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513 511

m. tibialis anterior diaphragm

TRPA1 0.0003 0.0003 *

0.0002 ** 0.0002 * 0.0001 0.0001 * TRPA1 / 18S rRNA

0 0 30d 100d 365d 30d 100d 365d

TRPM1 0.0002 0.0002 ** *

0.0001 0.0001 * TRPM1 / 18S rRNA

0 0 30d 100d 365d 30d 100d 365d

TRPC5 0.0003 0.0003

0.0002 0.0002 ** 0.0001 0.0001 *** ** * TRPC5 / 18S rRNA

0 0 30d 100d 365d 30d 100d 365d

control mdx

Fig. 6. Quantification of TRPA1, TRPC5 and TRPM1 mRNA levels in tibialis muscle and diaphragm of mdx and control mice. Levels of TRPA1, TRPC5 and TRPM1 mRNAs were determined by real-time RT-PCR using RNA preparations from tibialis muscle and diaphragm. Samples were from 30, 100 and 365 d-old mdx (dashed lines) and control mice (black lines). The mRNA levels of TRP ion channels are given in relation to that of 18S rRNA. Means ± SEM are given in all cases for n = 3–8 samples. Asterisks indicate significant differences: *p < 0.05; **p < 0.01; ***p < 0.005, unpaired t-test. cytoprotective effect. Though the authors show an upreg- ine skeletal muscle, we found an increased expression of ulation of utrophin in response to Ca2+/calmodulin signal- TRPC5 in early stages in mdx muscle and have already ling [48], a mechanism that could explain fibre protection shown that the TRPC5 mRNA is localized in skeletal mus- in the absence of dystrophin, it is not excluded that a cle fibres [32]. TRPC5 forms a Ca2+-permeable non-selec- decreased expression of Ca2+-influx channels like that of tive cation channel that integrates signalling pathways TRPC6 contributes to the observed effect. In addition to from G-protein-coupled receptors and receptors tyrosine the modulation of gene expression, Ca2+/calmodulin sig- kinases independently of store depletion [50,51]. TRPA1 nalling may directly influence TRP channel function in and TRPM1 transcripts were strongly increased in mdx mdx muscle. Many TRP channels contain putative bind- muscles at later stages (100 d and 1 year) and are also ing sites for calmodulin. While the monovalent cation known to conduct Ca2+ under certain conditions [52]. Fur- channel TRPM4 can be transiently activated by Ca2+/cal- ther, we cannot exclude that other TRP channel isoforms modulin [45], TRPC6 and other TRP channels may be of low abundance such as TRPC 1 (Table 3) play a role functionally inhibited by Ca2+/calmodulin, in terms of a in the pathomechanism of fibre necrosis of dystrophin-defi- negative feedback of calmodulin activation on Ca2+ influx cient muscle [29,34,35]. TRPC1 appears to be a candidate [49]. for the stretch-induced Ca2+ influx in skeletal fibres that In addition to the mentioned members of the TRP chan- is increased in mdx muscle [23]. Since TRPC1 associates nel family, TRPC5, TRPA1 and TRPM1 may constitute with a1-syntrophin [38], a component of the dystrophin- Ca2+-influx pathways into dystrophic fibres. Though the associated glycoprotein complex, a dysfunction of TRPC1 overall expression of the three isoforms is quite low in mur- in dystrophin-deficient muscle is conceivable. Recently it Author's personal copy

512 J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513 was shown that TRPC1 and TRPC3 can co-assemble in Acknowledgements HSY cells to form heteromultimers [53]. This property of TRP channels will complicate the final elucidation and dif- We are grateful to Prof. I. Klo¨ting (Department of Lab- ferentiation of the molecular nature of resting, store-oper- oratory Animal Science of the Medical Faculty, University ated and stretch-induced Ca2+ entry in muscle fibres. of Greifswald) for supplying mice, Dr. E. Dazert and R. Another stretch-sensitive TRP channel is TRPV2, a Bischoff (Institute of Pathology, University of Greifswald) channel that has been shown to allow increased Ca2+ influx for providing the paraffin sections. The authors further and cell degeneration in cardiomyocytes from d-sarcogly- thank Dr. L. Birnbaumer for providing muscle tissue from can-deficient Syrian hamsters [31]. The authors also TRPC3 knockout mice. We thank D. Schulz and H. Kenk showed an increased presence of TRPV2 in the sarcolemma for excellent technical assistance. This work was supported of mdx fibres and mdx myotubes. They suggested that an by the BMBF (MD-NET, project R14, 01GM0302). elevated TRPV2-induced Ca2+ influx may be a common feature of muscles with a disrupted dystrophin-glycopro- References tein complex [31]. However, according to the observations of Iwata and coworkers, TRPV2 expression is rather low in [1] Hoffman EP, Brown Jr RH, Kunkel LM. Dystrophin: the protein skeletal muscle compared to heart muscle. Further, we product of the Duchenne muscular dystrophy locus. Cell showed that several other TRP channel isoforms dominate 1987;51:919–28. over TRPV2 (Table 3). Therefore, it is questionable [2] Campbell KP. Three muscular dystrophies: loss of cytoskeleton- whether the discussed mechanism of TRPV2 induced extracellular matrix linkage. Cell 1995;80:675–9. 2+ [3] Emery AEH, Emery MHL. Refining the clinical picture. In: Emery Ca -influx plays an important role in mdx muscular AEH, editor. The history of a genetic disease: Duchenne muscular dystrophy. dystrophy or Meryons´s disease. London: The Royal Society of To correlate TRP channel expression with the course of Medicine Press Ltd; 1995. p. 89–99. the dystrophic process, we analysed samples from mice of [4] Hoffman EP, Gorospe JRM. The animal models of Duchenne different stages. Mdx muscles exhibit early necrosis, begin- muscular dystrophy: windows on the pathophysiological conse- quences of dystrophin deficiency. Curr Top Membr 1991;38:113–54. ning at day 5 in the muscles of the head, trunk and girdle. [5] Ru¨del R, Brinkmeier H. 76th ENMC international workshop: Necrotic and apoptotic processes emerge at approximately pathophysiology and therapy in the mdx mouse 21–23 January 3 weeks of age in the limbs [54]. Regeneration processes are 2000, Naarden, The Netherlands. Neuromuscul Disord initiated around the age of 6 weeks and continue until 2002;12:415–20. 12 weeks of age [55]. At three months, 80–90% of the [6] Alderton JM, Steinhardt RA. How calcium influx through calcium leak channels is responsible for the elevated levels of calcium- mdx skeletal fibres have central nuclei indicating a preced- dependent proteolysis in dystrophic myotubes. Trends Cardiovasc ing cycle of degeneration and regeneration [56]. At later Med 2000;10:268–72. stages mdx mice show a decline in their regeneration capac- [7] Dowling P, Doran P, Ohlendieck K. Drastic reduction of sarcalu- ity while the necrotic processes persist [57], affects that lead menin in Dp427 (dystrophin of 427 kDa)-deficient fibres indicates to progressive muscle wasting and fibrosis. Based on these that abnormal calcium handling plays a key role in muscular dystrophy. Biochem J 2004;379:479–88. observations and in view of the upregulation of TRPA1 [8] Gailly P. New aspects of calcium signaling in skeletal muscle cells: and TRPM1 at 100 d and 1 year (Fig. 6) we suggest that implications in Duchenne muscular dystrophy. Biochim Biophys the two channels may be related to regeneration and fibro- Acta 2002;1600:38–44. sis. On the other hand, the increased expression of TRPC5 [9] Berchtold MW, Brinkmeier H, Mu¨ntener M. Calcium ion in skeletal may be related to fibre degeneration or proliferation of muscle: its crucial role for muscle function, plasticity, and disease. Physiol Rev 2000;80:1215–65. muscle precursor cells. [10] Gillis JM. Membrane abnormalities and Ca homeostasis in muscles In conclusion our results show the mRNA expression, of the mdx mouse, an animal model of the Duchenne muscular protein levels and localization of major non-voltage gated dystrophy: a review. Acta Physiol Scand 1996;156:397–406. cation channel in murine skeletal muscle. We suggest that [11] Bodensteiner JB, Engel AG. Intracellular calcium accumulation in TRPC3, TRPC6, TRPV4 and TRPM7 are the most prom- Duchenne dystrophy and other myopathies: a study of 567,000 muscle fibers in 114 biopsies. Neurology 1978;28:439–46. ising candidates to allow store-operated, stretch-activated [12] Jackson MJ, Jones DA, Edwards RH. Measurements of calcium and 2+ and background Ca -influx into muscle fibres. Mechano- other elements in muscle biopsy samples from patients with sensitive channels of the DEG/ENaC family of cation Duchenne muscular dystrophy. Clin Chim Acta 1985;147:215–21. channels do not seem to play a significant role. The [13] Glesby MJ, Rosenmann E, Nylen EG, Wrogemann K. Serum CK, increased Ca2+-influx into dystrophin-deficient mdx fibres calcium, magnesium, and oxidative phosphorylation in mdx mouse muscular dystrophy. Muscle Nerve 1988;11:852–6. cannot be explained by increased gene expression of TRP [14] Gailly P, Boland B, Himpens B, Casteels R, Gillis JM. Critical 2+ channels. However, the weakened Ca -handling systems evaluation of cytosolic calcium determination in resting muscle in combination with a constant TRP channel expression fibres from normal and dystrophic (mdx) mice. Cell Calcium may indicate an imbalance between Ca2+-influx and cellu- 1993;14:473–83. lar Ca2+-control in mdx muscle. Further investigations are [15] Head SI. Membrane potential, resting calcium and calcium transients in isolated muscle fibres from normal and dystrophic mice. J Physiol required to decide whether TRP channels could be promis- 1993;469:11–9. ing targets for a pharmacotherapy of Duchenne muscular [16] Pressmar J, Brinkmeier H, Seewald MJ, Naumann T, Ru¨del R. dystrophy. Intracellular Ca2+ concentrations are not elevated in resting cultured Author's personal copy

J. Kru¨ger et al. / Neuromuscular Disorders 18 (2008) 501–513 513

muscle from Duchenne (DMD) patients and in MDX mouse muscle [37] Lansman JB, Franco-Obregon A. Mechanosensitive ion channels in fibres. Pflu¨gers Arch 1994;426:499–505. skeletal muscle: a link in the membrane pathology of muscular [17] Basset O, Boittin FX, Dorchies OM, Chatton JY, van Breemen dystrophy. Clin Exp Pharmacol Physiol 2006;33:649–56. C, Ru¨egg UT. Involvement of inositol 1,4,5-trisphosphate in [38] Vandebrouck A, Sabourin J, Rivet J, et al. Regulation of capacitative nicotinic calcium responses in dystrophic myotubes assessed by calcium entries by alpha1-syntrophin: association of TRPC1 with near-plasma membrane calcium measurement. J Biol Chem dystrophin complex and the PDZ domain of alpha1-syntrophin. 2004;279:47092–100. FASEB J 2007;21:608–17. [18] Mallouk N, Jacquemond V, Allard B. Elevated subsarcolemmal Ca2+ [39] Feske S, Gwack Y, Prakriya M, et al. A mutation in Orai1 causes in mdx mouse skeletal muscle fibers detected with Ca2+-activated K+ immune deficiency by abrogating CRAC channel function. Nature channels. Proc Natl Acad Sci USA 2000;97:4950–5. 2006;441:179–85. [19] MacLennan PA, McArdle A, Edwards RH. Effects of calcium on [40] Ambudkar IS, Ong HL, Liu X, Bandyopadhyay B, Cheng KT. protein turnover of incubated muscles from mdx mice. Am J Physiol TRPC1: the link between functionally distinct store-operated calcium 1991;260:E594–8. channels. Cell Calcium 2007;42:213–23. [20] Jimena I, Pena J, Luque E, Vaamonde R. Muscle hypertrophy [41] Turk R, Sterrenburg E, de Meijer EJ, van Ommen GJ, den Dunnen experimentally induced by administration of denervated muscle JT, Hoen PA. Muscle regeneration in dystrophin-deficient mdx mice extract. J Neuropathol Exp Neurol 1993;52:379–86. studied by gene expression profiling. BMC Genomics 2005;6:98. [21] Culligan K, Banville N, Dowling P, Ohlendieck K. Drastic reduction [42] Rouger K, Le Cunff M, Steenman M, et al. Global/temporal gene of calsequestrin-like proteins and impaired calcium binding in expression in diaphragm and hindlimb muscles of dystrophin- dystrophic mdx muscle. J Appl Physiol 2002;92:435–45. deficient (mdx) mice. Am J Physiol Cell Physiol 2002;283:C773–84. [22] Friedrich O, Both M, Gillis JM, Chamberlain JS, Fink RH. Mini- [43] Smyth JT, Lemonnier L, Vazquez G, Bird GS, Putney Jr JW. dystrophin restores L-type calcium currents in skeletal muscle of Dissociation of regulated trafficking of TRPC3 channels to the transgenic mdx mice. J Physiol 2004;555:251–65. plasma membrane from their activation by phospholipase C. J Biol [23] Yeung EW, Whitehead NP, Suchyna TM, Gottlieb PA, Sachs F, Chem 2006;281:11712–20. 2+ Allen DG. Effects of stretch-activated channel blockers on [Ca ]i [44] Dietrich A, Mederos YSM, Gollasch M, et al. Increased vascular and muscle damage in the mdx mouse. J Physiol 2005;562:367–80. smooth muscle contractility in TRPC6À/À mice. Mol Cell Biol [24] Fraysse B, Liantonio A, Cetrone M, et al. The alteration of calcium 2005;25:6980–9. homeostasis in adult dystrophic mdx muscle fibers is worsened by a [45] Nilius B, Prenen J, Tang J, et al. Regulation of the Ca2+ sensitivity of chronic exercise in vivo. Neurobiol Dis 2004;17:144–54. the nonselective cation channel TRPM4. J Biol Chem [25] Rolland JF, De Luca A, Burdi R, Andreetta F, Confalonieri P, Conte 2005;280:6423–33. Camerino D. Overactivity of exercise-sensitive cation channels and [46] Liedtke W. TRPV4 plays an evolutionary conserved role in the their impaired modulation by IGF-1 in mdx native muscle fibers: transduction of osmotic and mechanical stimuli in live animals. J beneficial effect of pentoxifylline. Neurobiol Dis 2006;24:466–74. Physiol 2005;567:53–8. [26] Boittin FX, Petermann O, Hirn C, et al. Ca2+-independent phos- [47] Monteilh-Zoller MK, Hermosura MC, Nadler MJ, Scharenberg AM, pholipase A2 enhances store-operated Ca2+ entry in dystrophic Penner R, Fleig A. TRPM7 provides an ion channel mechanism for skeletal muscle fibers. J Cell Sci 2006;119:3733–42. cellular entry of trace metal ions. J Gen Physiol 2003;121:49–60. [27] Ducret T, Vandebrouck C, Cao ML, Lebacq J, Gailly P. Functional [48] Chakkalakal JV, Michel SA, Chin ER, Michel RN, Jasmin BJ. role of store-operated and stretch-activated channels in murine adult Targeted inhibition of Ca2+/calmodulin signaling exacerbates the skeletal muscle fibres. J Physiol 2006;575:913–24. dystrophic phenotype in mdx mouse muscle. Hum Mol Genet [28] Tutdibi O, Brinkmeier H, Ru¨del R, Fo¨hr KJ. Increased calcium entry 2006;15:1423–35. into dystrophin-deficient muscle fibres of MDX and ADR-MDX [49] Zhu MX. Multiple roles of calmodulin and other Ca2+-binding mice is reduced by ion channel blockers. J Physiol 1999;515:859–68. proteins in the functional regulation of TRP channels. Pflu¨gers Arch [29] Vandebrouck C, Martin D, Colson-Van Schoor M, Debaix H, Gailly 2005;451:105–15. P. Involvement of TRPC in the abnormal calcium influx observed in [50] Schaefer M, Plant TD, Obukhov AG, Hofmann T, Gudermann T, dystrophic (mdx) mouse skeletal muscle fibers. J Cell Biol Schultz G. Receptor-mediated regulation of the nonselective cation 2002;158:1089–96. channels TRPC4 and TRPC5. J Biol Chem 2000;275:17517–26. [30] Montell C. The TRP superfamily of cation channels. Sci STKE [51] Plant TD, Schaefer M. Receptor-operated cation channels formed by 2005;2005:re3. TRPC4 and TRPC5. Naunyn Schmiedebergs Arch Pharmacol [31] Iwata Y, Katanosaka Y, Arai Y, Komamura K, Miyatake K, 2005;371:266–76. Shigekawa M. A novel mechanism of myocyte degeneration involving [52] Xu XZ, Moebius F, Gill DL, Montell C. Regulation of melastatin, a the Ca2+-permeable growth factor-regulated channel. J Cell Biol TRP-related protein, through interaction with a cytoplasmic isoform. 2003;161:957–67. Proc Natl Acad Sci USA 2001;98:10692–7. [32] Kunert-Keil C, Bisping F, Kru¨ger J, Brinkmeier H. Tissue-specific [53] Liu X, Bandyopadhyay BC, Singh BB, Groschner K, Ambudkar IS. expression of TRP channel genes in the mouse and its variation in Molecular analysis of a store-operated and 2-acetyl-sn-glycerol- three different mouse strains. BMC Genomics 2006;7:159. sensitive non-selective cation channel. Heteromeric assembly of [33] Smith PK, Krohn RI, Hermanson GT, et al. Measurement of protein TRPC1–TRPC3. J Biol Chem 2005;280:21600–6. using bicinchoninic acid. Anal Biochem 1985;150:76–85. [54] Bulfield G, Siller WG, Wight PA, Moore KJ. X chromosome-linked [34] Allen DG, Whitehead NP, Yeung EW. Mechanisms of stretch- muscular dystrophy (mdx) in the mouse. Proc Natl Acad Sci USA induced muscle damage in normal and dystrophic muscle: role of 1984;81:1189–92. ionic changes. J Physiol 2005;567:723–35. [55] Dangain J, Vrbova G. Muscle development in mdx mutant mice. [35] Constantin B, Sebille S, Cognard C. New insights in the regulation of Muscle Nerve 1984;7:700–4. calcium transfers by muscle dystrophin-based cytoskeleton: implica- [56] Torres LF, Duchen LW. The mutant mdx: inherited myopathy in the tions in DMD. J Muscle Res Cell Motil 2006;27:375–86. mouse. Morphological studies of nerves, muscles and end-plates. [36] Imbert N, Vandebrouck C, Duport G, et al. Calcium currents and Brain 1987;110:269–99. transients in co-cultured contracting normal and Duchenne muscular [57] Pastoret C, Sebille A. mdx mice show progressive weakness and dystrophy human myotubes. J Physiol 2001;534:343–55. muscle deterioration with age. J Neurol Sci 1995;129:97–105.