DOCSLIB.ORG

Wolbachia Infection in Cricket 2505 Gene in the Template DNA Solution Was Determined by Analysis Table 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Wolbachia Infection in Cricket 2505 Gene in the Template DNA Solution Was Determined by Analysis Table 1 The Journal of Experimental Biology 203, 2503–2509 (2000) 2503 Printed in Great Britain © The Company of Biologists Limited 2000 JEB2738 WOLBACHIA INFECTION AND CYTOPLASMIC INCOMPATIBILITY IN THE CRICKET TELEOGRYLLUS TAIWANEMMA SATORU KAMODA, SHINJI MASUI, HAJIME ISHIKAWA AND TETSUHIKO SASAKI* Department of Biological Sciences, Graduate School of Science, University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113-0033, Japan *Author for correspondence (e-mail: [email protected]) Accepted 25 May; published on WWW 20 July 2000 Summary Wolbachia are cytoplasmically inherited bacteria found chain reaction assays; they were detected in the antennae, in many arthropods. They induce various reproductive heads, forewings, hindwings, testes, ovaries, Malpighian alterations in their hosts, including cytoplasmic tubules, foot muscles and fat bodies. Quantitative incompatibility, thelytokous parthenogenesis, feminization polymerase chain reaction assays showed that the bacterial and male-killing. In this study, we examined Wolbachia density was highest in the fat bodies, followed by the infection and its effects on the host cricket Teleogryllus ovaries and testes. Wolbachia were not detected in the taiwanemma. In a phylogenetic study based on the wsp gene haemolymph or in mature spermatozoa. The spermatozoa coding for a Wolbachia surface protein, the Wolbachia of the infected male may be modified by the presence of strain harboured by T. taiwanemma was clustered together Wolbachia during its development. To examine this with those harboured by Laodelphax striatellus, Tribolium possibility, we compared the profiles of sperm proteins confusum, Acraea encedon, Trichogramma deion and Adalia between the infected and uninfected males using two- bipunctata. Crossing experiments using the Wolbachia- dimensional gel electrophoresis. However, no differences in infected and uninfected strains of cricket showed that the the protein profiles were observed. infection is associated with the expression of unidirectional cytoplasmic incompatibility: the egg hatch rate in the incompatible cross between the infected males and Key words: Wolbachia, cricket, Teleogryllus taiwanemma, uninfected females was 20.3 %. We also examined the cytoplasmic incompatibility, bacterial density, two-dimensional gel distribution of Wolbachia within the host using polymerase electrophoresis. Introduction Wolbachia are intracellular bacteria present in a wide range cross is compatible. In addition, bidirectional incompatibilities of arthropods, particularly in insects. In a previous field survey are observed when males and females carry different by Werren et al. (1995b), Wolbachia were found in more than Wolbachia strains. It has been reported that cytoplasmic 16 % of the insects sampled. Phylogenetic analyses of the incompatibility arises from defects in paternal chromatin Wolbachia harboured by various host species have shown that condensation during mitosis in Drosophila simulans (O’Neill the Wolbachia clade can be divided into two major groups, and Karr, 1990; Lassy and Karr, 1996; Callaini et al., 1997), designated A and B (Werren et al., 1995a). Nasonia vitripennis (Reed and Werren, 1995) and Culex Wolbachia are known to induce various reproductive pipiens (Jost, 1971). Cytological examinations in several alterations in their hosts, including cytoplasmic species have revealed that the bacteria in spermatids are incompatibility, thelytokous parthenogenesis, feminization released during spermatogenesis and are absent from the and male-killing (for reviews, see Werren, 1997; Stouthamer mature spermatozoa (Wright and Barr, 1980; Binnington and et al., 1999). Cytoplasmic incompatibility is a crossing Hoffmann, 1989; O’Neill, 1989). It is assumed that Wolbachia incompatibility that results in embryonic mortality in diploid modify the spermatozoa during spermatogenesis and that this species. In haplodiploid species such as wasps, in which modification is responsible for the expression of cytoplasmic haploid embryos develop into males, cytoplasmic incompatibility. However, few investigations have attempted incompatibility causes male-biased sex ratios. The effect of to detect the modification in the spermatozoa of Wolbachia- cytoplasmic incompatibility on crossability is typically infected insects, mainly because it is difficult to obtain sperm unidirectional: the cross between infected males and samples from insects in which cytoplasmic incompatibility has uninfected females is incompatible, whereas the reciprocal been expressed. 2504 S. KAMODA AND OTHERS Males of orthopteran insects release spermatophores GAAAC-3′) and wsp691R (5′-AAAAATTAAACGCTACT- containing pure spermatozoa when they mate. Because of this CCA-3′). These primers amplify a DNA fragment of habit, samples of pure spermatozoa can be collected from the approximately 600 base pairs (bp). The cycling conditions males of this insect group. However, despite this advantage, no consisted of 5 min at 94 °C, followed by 35 cycles of 30 s at laboratory strain of an orthopteran insect has been established 94 °C, 30 s at 52 °C, and 1 min at 72 °C, and a final cycle of as an insect model for the study of cytoplasmic incompatibility. 5 min at 72 °C. The PCR products were directly ligated into Masui et al. (1997) previously reported that a laboratory pGEM-T vectors (Promega), and five independent clones were strain of the cricket Teleogryllus taiwanemma was infected with sequenced using an ABI PRISM 310 genetic analyzer (PE B-group Wolbachia, although the effect of the infection was Applied Biosystems). The wsp sequence has been submitted to unclear. In this study, we further investigated Wolbachia the GenBank database under accession number AB035514. infection in T. taiwanemma. The phylogenetic position of the This sequence was aligned to the wsp sequences reported by Wolbachia was estimated on the basis of the wsp gene that Zhou et al. (1998) and Hurst et al. (1999). A 41 bp region codes for a Wolbachia surface protein. To clarify the phenotype (positions 519–559) corresponding to the third hypervariable induced by the Wolbachia, we performed crossing experiments region of the gene (Braig et al., 1998) was omitted from the and demonstrated that cytoplasmic incompatibility is expressed, analysis because it could not be aligned with confidence (Zhou giving relatively high embryonic mortality. We also examined et al., 1998). Sites with gaps were also excluded from the the presence of Wolbachia in various tissues of the host using aligned data set. The resulting alignment of approximately 500 the polymerase chain reaction (PCR). In addition, the bacterial bases was used to construct a neighbour-joining tree (Saitou density in each tissue was determined by quantitative PCR and Nei, 1987) with Kimura’s two-parameter distance assays. After we had confirmed that the spermatozoa did not (Kimura, 1980) using the program package Clustal W contain Wolbachia, we compared the profiles of sperm proteins (Thompson et al., 1994). A bootstrap test (Felsenstein, 1981) between the infected and uninfected males. was performed with 1000 replications. Detection of Wolbachia Materials and methods The presence of Wolbachia in various tissues of T. Insects taiwanemma was tested by PCR using the primer sets ftsZBf A strain of the cricket Teleogryllus taiwanemma infected with (5′-CCGATGCTCAAGCGTTAGAG-3′) and ftsZBr (5′- a B-group Wolbachia strain (wTai) was maintained under 16 h:8 h CCACTTAACTCTTTCGTTTG-3′), which specifically light:dark cycle at 25 °C. The crickets were fed an insect food amplify the ftsZ cell cycle gene of B-group Wolbachia (Werren purchased from Oriental Yeast, Tokyo, Japan, and provided with et al., 1995a). The PCR cycling conditions consisted of 5 min tap water. To establish a Wolbachia-free strain, the infected at 94 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at 55 °C, insects were given an aqueous solution of tetracycline and 1 min at 72 °C, and a final cycle of 5 min at 72 °C. To hydrochloride (0.5 % w/v) for two generations. This strain was confirm successful DNA extraction, the samples were also reared without tetracycline for at least two generations subjected to PCR using primers specific for the insect (approximately 5 months) before being subjected to experiments. pgi gene that codes phosphoglucose isomerase (Katz and Harrison, 1997). The primers used were pgiF DNA extraction (5′-AACAAGGAGATATGGAATCTAATGG-3′) and pgiR The antennae, heads, forewings, hindwings, testes, ovaries, (5′-TTCCAGGTTCACCCCACA-3′). The cycling conditions Malpighian tubules, foot muscles and fat bodies were obtained were the same as those for the amplification of the ftsZ gene. by dissection from adult insects. Haemolymph, which oozed out through the incision when a hindleg was cut, was collected in Quantitative PCR a small pipette. To obtain pure sperm samples, we cut the end To determine the Wolbachia density in each tissue, of a spermatophore and immersed it in phosphate-buffered quantitative PCR was performed in a LightCycler (Roche −1 −1 saline (PBS; 137 mmol l NaCl, 8.1 mmol l Na2HPO4, Diagnostics). A 294 bp fragment of the internal region −1 −1 2.68 mmol l KCl, 1.47 mmol l KH2PO4, pH 7.5). The of the VirD4 gene (GenBank accession number spermatozoa released into PBS was collected by centrifugation. AB041342) was amplified using the primers VirD4F (5′- These samples were homogenized in saline/Tris/EDTA (STE; ATCAGAGAAAGACATACGAAAAGCAGG) and VirD4R 100 mmol l−1 NaCl, 10 mmol l−1 Tris pH 8.0, 1 mmol l−1 EDTA, (5′-CAATGGCTTACCCCATCTGGC). The 20 µl
Load more

Recommended publications
  • The Efficiency of Sound Production in Two Cricket Species, Gryllotalpa Australis and Teleogryllus Commodus (Orthoptera: Grylloidea)
    J. exp. Biol. 130, 107-119 (1987) 107 Printed in Great Britain © The Company of Biologists Limited 1987 THE EFFICIENCY OF SOUND PRODUCTION IN TWO CRICKET SPECIES, GRYLLOTALPA AUSTRALIS AND TELEOGRYLLUS COMMODUS (ORTHOPTERA: GRYLLOIDEA) BY MARK W. KAVANAGH Department of Zoology, University of Melbourne, Parkville, Victoria, 3052, Australia Accepted 27 February 1987 SUMMARY 1. Males of Gryllotalpa australis (Erichson) (Gryllotalpidae) and Teleogryllus commodus (Walter) (Gryllidae) produced their calling songs while confined in respirometers. 2. G. australis males used oxygen during calling at a mean rate of 4-637 ml O2h^', equivalent to 27-65mW of metabolic energy, which was 13 times higher than the resting metabolic rate. T. commodus males used oxygen during calling at a rate of 0-728 ml O2h~', equivalent to 4-34mW, which was four times the resting metabolic rate. 3. The sound field during calling by males represents a sound power output of 0-27 mW for G. australis and l-51XlO~3mW for T. commodus. 4. The efficiency of sound production was 1-05% for males of G. australis and 0-05 % for males of T. commodus. Comparison with other insect species suggests that none is more than a few percent efficient in sound production. INTRODUCTION Many insect species produce stereotyped acoustic signals that are important in intraspecific communication. In most species that communicate by sound, the male's calling song, which seems to attract conspecific females, is the most obvious and the most important component of the repertoire. Production of the calling song will involve a cost to the producer in the form of an increased use of metabolic energy.
    [Show full text]
  • THE QUARTERLY REVIEW of BIOLOGY
    VOL. 43, NO. I March, 1968 THE QUARTERLY REVIEW of BIOLOGY LIFE CYCLE ORIGINS, SPECIATION, AND RELATED PHENOMENA IN CRICKETS BY RICHARD D. ALEXANDER Museum of Zoology and Departmentof Zoology The Universityof Michigan,Ann Arbor ABSTRACT Seven general kinds of life cycles are known among crickets; they differ chieff,y in overwintering (diapause) stage and number of generations per season, or diapauses per generation. Some species with broad north-south ranges vary in these respects, spanning wholly or in part certain of the gaps between cycles and suggesting how some of the differences originated. Species with a particular cycle have predictable responses to photoperiod and temperature regimes that affect behavior, development time, wing length, bod)• size, and other characteristics. Some polymorphic tendencies also correlate with habitat permanence, and some are influenced by population density. Genera and subfamilies with several kinds of life cycles usually have proportionately more species in temperate regions than those with but one or two cycles, although numbers of species in all widely distributed groups diminish toward the higher lati­ tudes. The tendency of various field cricket species to become double-cycled at certain latitudes appears to have resulted in speciation without geographic isolation in at least one case. Intermediate steps in this allochronic speciation process are illustrated by North American and Japanese species; the possibility that this process has also occurred in other kinds of temperate insects is discussed. INTRODUCTION the Gryllidae at least to the Jurassic Period (Zeuner, 1939), and many of the larger sub­ RICKETS are insects of the Family families and genera have spread across two Gryllidae in the Order Orthoptera, or more continents.
    [Show full text]
  • Flexibility in Male Phonotaxis Behavior and the Loss of Singing Ability In
    Behavioral Ecology doi:10.1093/beheco/arp052 Advance Access publication 9 April 2009 Preexisting behavior renders a mutation adaptive: flexibility in male phonotaxis behavior and the loss of singing ability in the field cricket Teleogryllus oceanicus Downloaded from Robin M. Tinghitella, Jeffrey M. Wang, and Marlene Zuk Department of Biology, University of California-Riverside, Riverside, CA 92521, USA http://beheco.oxfordjournals.org/ Flexibility in behavior and other traits can pave the way for rapid evolutionary change. A wing mutation, ‘‘flatwing,’’ eliminates the ability of .90% of male field crickets (Teleogryllus oceanicus) from one Hawaiian population to produce song to attract females. The morphological change was favored because calling is risky in Hawaii, attracting deadly parasitoid flies. An earlier study suggested that instead of calling, silent flatwing males use satellite behavior, approaching one of the few remaining callers and intercepting females attracted to them. Satellite-like behavior may have existed as a behavioral option prior to the wing mutation, accommodating the loss of singing ability, or behavior may have changed simultaneously with the spread of the mutation. In phonotaxis trials, males from different populations across the crickets’ range varied in the distance at which they settled from the source of broadcast song, behaving more or less like satellites. Anecdotally, we noted satellite behavior in all populations, and importantly, males from the mutated population and its direct ancestor behaved similarly. This suggests that the alternative behavior is not strictly associated with the mutation and instead predated the change in morphology. We hypothesized at University of Minnesota,Walter Library Serial Processing on May 28, 2014 further that satellite behavior may have been preexisting because it is beneficial under other circumstances, such as poor mating success.
    [Show full text]
  • Release from Bats: Genetic Distance and Sensoribehavioural Regression in the Pacific Field Cricket, Teleogryllus Oceanicus
    Naturwissenschaften (2010) 97:53–61 DOI 10.1007/s00114-009-0610-1 ORIGINAL PAPER Release from bats: genetic distance and sensoribehavioural regression in the Pacific field cricket, Teleogryllus oceanicus James H. Fullard & Hannah M. ter Hofstede & John M. Ratcliffe & Gerald S. Pollack & Gian S. Brigidi & Robin M. Tinghitella & Marlene Zuk Received: 1 June 2009 /Revised: 1 September 2009 /Accepted: 9 September 2009 /Published online: 24 September 2009 # Springer-Verlag 2009 Abstract The auditory thresholds of the AN2 interneuron ary regression in the neural basis of a behaviour along a and the behavioural thresholds of the anti-bat flight-steering selection gradient within a single species. responses that this cell evokes are less sensitive in female Pacific field crickets that live where bats have never existed Keywords Neuroethology . Genetic isolation . Evolution . (Moorea) compared with individuals subjected to intense Sensory ecology. Island biology levels of bat predation (Australia). In contrast, the sensitiv- ity of the auditory interneuron, ON1 which participates in the processing of both social signals and bat calls, and the Introduction thresholds for flight orientation to a model of the calling song of male crickets show few differences between the Whereas the existence of vestigial characters in organisms two populations. Genetic analyses confirm that the two has long been documented (Darwin 1859), the mechanisms populations are significantly distinct, and we conclude that behind those regressive changes are less well understood the absence of bats has caused partial regression in the (Fong et al. 1995; Borowsky and Wilkens 2002; Romero nervous control of a defensive behaviour in this insect. This and Green 2005).
    [Show full text]
  • Orthoptera: Gryllidae: Gryllinae) from Korea
    Anim. Syst. Evol. Divers. Vol. 28, No. 2: 140-144, April 2012 http://dx.doi.org/10.5635/ASED.2012.28.2.140 Short communication First Record of the Field-Cricket Turanogryllus eous (Orthoptera: Gryllidae: Gryllinae) from Korea Tae-Woo Kim* National Institute of Biological Resources, Incheon 404-170, Korea ABSTRACT The field-cricket Turanogryllus eous Bey-Bienko, 1956 and its genus Turanogryllus Tarbinsky, 1940 were recorded for the first time from Chungcheongbuk-do province in Korea to carry out the project ‘The sound guides to Korean animals.’ Depending on the discovery of the cricket, its distributional ranges are more widened towards East Asia to the Korean peninsula from China mainland, the Turanogryllus was 10th to known Gryllinae genera in Korea. Description, photos of habitus, figure of male genitalia, oscillogram and spectrogram for the calling sound are provided for aid identification. Voucher specimens are deposited in the collection of National Institute of Biological Resources, Incheon, Korea. Keywords: Orthoptera, Gryllidae, Gryllinae, Turanogryllus eous, new record, Korea INTRODUCTION (hear Kim, 2011). Second year in 2011, my colleague Mr. Sung Ki-Soo informed me that he had found a habitat of the One of the field-cricket genus Turanogryllus was established field-cricket from the Jecheon City province near Chungju by Tarbinsky (1940). Until now, 32 species have been des- City. The collecting was successful for more confirmation. cribed throughout the world from Eurasia (Afghanistan, Ara- Based on the microscopic observation of the specimens bia, China, Iran, Israel, and Russia), Indo-Malaysia (India, and morphological comparison from the earlier literatures, Laos, Nepal, and Pakistan), and Africa (Angola, Egypt, Gui- the field-cricket was identified to be ‘Turanogryllus eous nea, Kenya, Sierra Leon, Zaire, and Zambia) (Otte, 1994).
    [Show full text]
  • Recognition of Courtship Song in the Field Cricket, Teleogryllus Oceanicus
    Anim. Behav., 1996, 51, 353–366 Recognition of courtship song in the field cricket, Teleogryllus oceanicus ROHINI BALAKRISHNAN & GERALD S. POLLACK Department of Biology, McGill University (Received 4 November 1994; initial acceptance 9 February 1995; final acceptance 9 June 1995; MS. number: 7146) Abstract. The courtship song of the cricket, Teleogryllus oceanicus plays an important role in inducing the female to mount the male, which is necessary for mating. The song consists of a short, amplitude-modulated chirp, followed by a long trill of constant intensity and high syllable rate. Using playback techniques, it was determined which physical parameters of courtship song are necessary and/or sufficient to evoke normal female mounting of muted, courting males. The higher harmonics of natural courtship song were neither necessary nor sufficient for the effectiveness of the song. The chirp component alone was sufficient to evoke normal levels of mounting, but the trill was only partially effective on its own. The conspicuous amplitude modulation of the chirp was not necessary to evoke normal responses. The results suggest that the high effectiveness of the chirp is due to its characteristic temporal pattern. As in other cricket species, the song repertoire of T. oceanicus also includes distinct calling and aggression songs, which contain chirps that are structurally similar to the courtship chirp. Both calling and aggression songs evoked normal mounting responses when played back in the context of courtship. ? 1996 The Association for the Study of Animal Behaviour Crickets use acoustic signals to communicate and courtship songs are recognized share common with each other. These signals take the form of or similar features.
    [Show full text]
  • Dim Artificial Light at Night Reduces the Cellular Immune Response of The
    Insect Science (2020) 27, 571–582, DOI 10.1111/1744-7917.12665 ORIGINAL ARTICLE Dim artificial light at night reduces the cellular immune response of the black field cricket, Teleogryllus commodus Joanna Durrant, Mark P. Green and Theresa´ M. Jones The School of BioSciences, Faculty of Science, University of Melbourne, Victoria, 3010, Australia Abstract A functioning immune system is crucial for protection against disease and ill- ness, yet increasing evidence suggests that species living in urban areas could be suffering from immune suppression, due to the presence of artificial light at night (ALAN). This study examined the effects of ecologically relevant levels of ALAN on three key measures of immune function (haemocyte concentration, lytic activity, and phenoloxidase activity) using a model invertebrate species, the Australian black field cricket, Teleogryllus com- modus. We reared crickets under an ecologically relevant daily light-cycle consisting of 12 hr bright daylight (2600 lx) followed by either 12 h darkness (0 lx) or dim environ- mentally relevant ALAN (1, 10, 100 lx), and then assessed immune function at multiple time points throughout adult life using haemolymph samples. We found that the presence of ALAN had a clear negative effect on haemocytes, while the effects on lytic activity and phenoloxidase activity were more complex or largely unaffected by ALAN. Further- more, the effects of lifelong exposure to ALAN of 1 lx were comparable to those of 10 and 100 lx. Our data suggest that the effects of ALAN could be large and widespread, and such reductions in the core immune response of individuals will likely have greater consequences for fitness and survival under more malign conditions, such as those of the natural environment.
    [Show full text]
  • The First Report of the Diversity of Ensifera (Insecta: Orthoptera) from Rokan Hulu District, Riau Province
    SCRIPTA BIOLOGICA | VOLUME 4 | NOMER 2 | JUNI 2017 | 99107 | HTTPS://DOI.ORG/10.20884/1.SB.2017.4.2.395 THE FIRST REPORT OF THE DIVERSITY OF ENSIFERA (INSECTA: ORTHOPTERA) FROM ROKAN HULU DISTRICT, RIAU PROVINCE SUTRISNO SYAHLAN, ROFIZA YOLANDA, RIKI RIHARJI LUBIS Biology Education Study Programme, Faculty of Teacher Training and Education, University of Pasir Pengaraian, Rokan Hulu District 28457, Riau Province, Indonesia A B S T R A C T The objective of this study was to determine the diversity of the suborder Ensifera in Dusun 3, Rambah Hilir Tengah, Rambah Hilir Sub- District, Rokan Hulu District, Riau Province, Indonesia. The study was conducted from September 2015 to January 2016 at six sampling locations by sweep net and hand picking at day and night hours. We recorded 17 species of the Ensifera belonging to 12 genera, 2 families, and 10 subfamilies. The diversity comprised of Conochepalus maculatus, Conochepalus melaenus, Conochepalus sp., Elbenia sp., Elimaea sp., Euscyrtus concinnus, Hexacentrus unicolor, Loxoblemus parabolicus, Mecopoda elongate, Mecopoda sp., Nisitrus vittatus, Orthelimaea sp., Podoscirtinae species 1 (unidentified), Teleogryllus emma, Teleogryllus sp., Trellius sp. and Xabea sp. The C. maculatus and E. concinnus were the predominant species in this study. KEY WORDS: crickets, katydids, grassland Corresponding Author: SUTRISNO SYAHLAN | email: [email protected] Submitted: 06-04-2017 | Accepted: 22-05-2017 run and jump readily on the water. Females of INTRODUCTION different groups lay eggs in stems or twigs, in wood, Indonesia is a mega-biodiversity country which under bark, in the ground, or in burrows (Resh & endowed rich and unique biodiversity in the tropical Cardé, 2003; Gillot, 2005).
    [Show full text]
  • Edible Insects
    1.04cm spine for 208pg on 90g eco paper ISSN 0258-6150 FAO 171 FORESTRY 171 PAPER FAO FORESTRY PAPER 171 Edible insects Edible insects Future prospects for food and feed security Future prospects for food and feed security Edible insects have always been a part of human diets, but in some societies there remains a degree of disdain Edible insects: future prospects for food and feed security and disgust for their consumption. Although the majority of consumed insects are gathered in forest habitats, mass-rearing systems are being developed in many countries. Insects offer a significant opportunity to merge traditional knowledge and modern science to improve human food security worldwide. This publication describes the contribution of insects to food security and examines future prospects for raising insects at a commercial scale to improve food and feed production, diversify diets, and support livelihoods in both developing and developed countries. It shows the many traditional and potential new uses of insects for direct human consumption and the opportunities for and constraints to farming them for food and feed. It examines the body of research on issues such as insect nutrition and food safety, the use of insects as animal feed, and the processing and preservation of insects and their products. It highlights the need to develop a regulatory framework to govern the use of insects for food security. And it presents case studies and examples from around the world. Edible insects are a promising alternative to the conventional production of meat, either for direct human consumption or for indirect use as feedstock.
    [Show full text]
  • Variation in Song Patterns of Antipodean Teleogryllus Species (Orthoptera: Gryllidae) and a Proposed Phenetic Classification
    797 Variation in song patterns of Antipodean Teleogryllus species (Orthoptera: Gryllidae) and a proposed phenetic classification C. MADSEN Department ofZoology•, McGill University, Montreal, Que. V. R. VlCKERY Lyman Entomological Museum, Macdonald College of McGill University, Macdonald College P.O., Que. AND J. NOWOSIELSKI Institute of Parasitology, Macdonald College of McGill University, Macdonald College P.O., Que. Received March 12, 1970 MADSEN, C, V. R. VICKERY, and J. NOWOSIELSKI. 1970. Variation in song patterns of Antipodean Teleo­ gryllus species (Orthoptera; Gryllidae) and a proposed phenetic classification. Can, J. Zool. 48: 797-801. The stridulations of eight sample populations of Teleogryllus commodus servillei (Saussure) and T. oceanicus (Le Guillou) were recorded and analyzed. Sokal's "distance coefficient" formula was used to derive a phenetic classification of the populations. The analysis indicates the same relationships as were previously indicated, by Chen et al. (1967) on morphological evidence, and by Lim et al. (1969) on cyto- logical study. Introduction mania (Qt); South Australia, Adelaide, (Qa and Qd)i North Island, New Zealand (Qz); and South Island, New Chen et al. (1967), Lim et al. (1969), and Lim Zealand (Qk). Unfortunately the population of T. c. com­ (1970) have all stated that the common "black" modus (Qw) from Perth, Western Australia, was not avail­ field crickets of the Antipodean area belong to able for comparison. Two populations of T. oceanicus were included: Queensland, Australia (Qn); and Tahiti two species, Teleogryllus oceanicus (Le Guillou, (Qh). In all cases, the symbols used to designate the pop­ 1841) and T. commodus (F. Walker, 1869). The ulations are the same as those used by previous authors former species occurs in Australia in Queensland, (Bigelow 1962; Bigelow and Cochaux 1962; Cochaux Northern Territory, and in the Kimberly district 1965; Chen et al.
    [Show full text]
  • View Preprint
    Saving Waves: BioAcoustica Progress Report 1 Ed Baker March 2016 Abstract This report details work on the BioAcoustica project up to the end of March 2016. Functionality and datasets currently available are described and ongoing work is listed. Usage statistics are provided and future plans are presented. Outputs of the project are listed in appendices including a list of peer-reviewed papers generated by the project and peer-reviewed papers that have deposited their bioacoustic data in BioAcoustica. In ad- dition a list of species which are represented in the BioAcoustica database is provided. Contents 1 History 2 2 Current Functionality 3 2.1 Annotation . .3 2.2 Analysis . .3 2.3 bioacousticaR . .4 2.4 Collections . .4 2.5 Data Sharing . .5 2.5.1 Global Biodiversity Informatics Facility (GBIF) . .5 2.5.2 Encyclopedia of Life (EoL) . .5 3 Current Datasets 5 3.1 Global Cicada Sound Collection . .5 3.1.1 GCSC1: South Africa and Malawi . .5 3.1.2 GCSC2: Thailand . .5 3.1.3 GCSC4: Marshall et al, 2016; Lee et al, 2016 . .5 3.1.4 User Contributions . .6 3.2 Soundscapes . .6 3.3 BioAcoustica Talks . .6 3.3.1 BioAcoustica Talks Podcast . .6 3.4 3D Scans of Singing Burrows of Mole Crickets . .6 1 PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.1948v2 | CC-BY 4.0 Open Access | rec: 12 Apr 2016, publ: 12 Apr 2016 EWB7 1 HISTORY 4 Usage 6 4.1 Wikipedia . .6 5 Ongoing Collections Work 7 5.1 NHM Sound Collection . .7 5.1.1 Orthoptera: Grylloidea .
    [Show full text]
  • Testing the Role of Trait Reversal in Evolutionary Diversification Using Song Loss in Wild Crickets
    Testing the role of trait reversal in evolutionary diversification using song loss in wild crickets Nathan W. Baileya,1,2, Sonia Pascoalb,1, and Fernando Montealegre-Zc,2 aSchool of Biology, University of St. Andrews, St. Andrews KY16 9TH, United Kingdom; bDepartment of Zoology, University of Cambridge, Cambridge CB2 3EJ, United Kingdom; and cSchool of Life Sciences, University of Lincoln, Lincoln LN6 7DL, United Kingdom Edited by Günter P. Wagner, Yale University, New Haven, CT, and approved March 6, 2019 (received for review November 19, 2018) The mechanisms underlying rapid macroevolution are controver- Male crickets produce calls by stridulating: They rub modified sial. One largely untested hypothesis that could inform this debate forewings together to generate mechanical vibrations (Fig. 1A). is that evolutionary reversals might release variation in vestigial An individual producing an advertisement, courtship, or ag- traits, which then facilitates subsequent diversification. We eval- gressive song will draw a thickened ridge of tissue (the scraper) uated this idea by testing key predictions about vestigial traits on one wing across a corrugated vein (the file) on the opposing arising from sexual trait reversal in wild field crickets. In Hawaiian wing. In many species, the resulting vibrations are amplified by Teleogryllus oceanicus, the recent genetic loss of sound-producing resonating membranes formed from modified wing cells. When and -amplifying structures on male wings eliminates their acoustic coupled with wing motor behaviors that repeat this movement signals. Silence protects these “flatwing” males from an acousti- in succession, the pulse rate, pattern, and carrier frequency of cally orienting parasitoid and appears to have evolved indepen- chirps can convey information about mate location, identity, dently more than once.
    [Show full text]