US 2010O267569A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2010/0267569 A1 Salmon et al. (43) Pub. Date: Oct. 21, 2010
(54) COMPOSITIONS, METHODS AND KITS FOR (30) Foreign Application Priority Data THE DAGNOSS OF CARRIERS OF MUTATIONS IN THE BRCA1 AND BRCA2 Jul. 8, 2007 (IL) ...... 184478 GENES AND EARLY DAGNOSS OF CANCEROUS DISORDERS ASSOCATED Publication Classification WITH MUTATIONS IN BRCA1 AND BRCA2 GENES (51) Int. Cl. CI2O I/68 (2006.01) (75) Inventors: Asher Salmon, Jerusalem (IL); C40B 40/06 (2006.01) Tamar Peretz, Jerusalem (IL) C40B 30/00 (2006.01) GOIN 33/53 (2006.01) Correspondence Address: GOIN 33/50 (2006.01) KEVIN D. MCCARTHY ROACH BROWN MCCARTHY & GRUBER, P.C. (52) U.S. Cl...... 506/7; 435/6:506/16:435/7.1; 424 MAIN STREET, 1920 LIBERTY BUILDING 435/7.92; 436/86 BUFFALO, NY 14202 (US) (73) Assignee: Hadasit Medical Research (57) ABSTRACT Services and Development Ltd., The present invention relates to diagnostic compositions Jerusalem (IL) methods and kits for the detection of carriers of mutations in Appl. No.: 12/668,154 the BRCA1 and BRCA2 genes. The detection is based on the (21) use of detecting nucleic acids oramino acid based molecules, (22) PCT Fled: Jul. 8, 2008 specific for determination of the expression of at least six marker genes of the invention, in a test sample. The invention (86) PCT NO.: PCT/ILO8/OO934 thereby provides methods compositions and kits for the diag nosis of cancerous disorders associated with mutations in the S371 (c)(1), BRCA1 and BRCA2 genes, specifically, of ovarian and breast (2), (4) Date: Apr. 8, 2010 CCC.
PCA Ma. (36.7%) 8000 6600 5200 3800 É 2400 N 1000 -399 - 1799
-3199
-4599 & sSS Š SS. & &S. Š xxyyxx-xxxx -7399 -5799 -41.99 -2599 -1000 600 22OO 38OO 54OO 7 PC #116.4%
9.
BRCA1 (SBRCA2 SC Patent Application Publication Oct. 21, 2010 Sheet 1 of 6 US 2010/0267,569 A1
BRCA1 VS. Cont. BRCA2 VS. Cont.
SS
Š
SSSSSSS
s S SS Š
SSESSsal
BRCA2 1B
'.Cont. BRCA1BRCA2 Fig. 1C Patent Application Publication Oct. 21, 2010 Sheet 2 of 6 US 2010/0267,569 A1
PCA Ma. (36.7%) 8000 x
xxx'ssys'ssy'ssys'sssssssssss NS 66OO S 5200 3800 2400 1 OOO
-399
: - 1799 m SS...Sy
-3199 SS
-4599 S: . . .'' S.''' , , , , s - - - - - , , , , w r S.& SSSSSSSSSS Š S SSSSSSSSSSSSSSSSSSSSSSSSS SS SSSSSSS SS -6000 SS S& S. -7399 -5799 -4199 -2599 -1000 600 2200 3800 5400 7
PC #116.4%
Fig. 2
Patent Application Publication Oct. 21, 2010 Sheet 4 of 6 US 2010/0267,569 A1
on too Fig. 4A is 60 %
40
S s & 8.& S SSS::SxS T C D E S. n h - U COCD s g O. Se 5 g D U 2 D c CA) Ot CD CA) so
50
s 40 F 4 B 8awaaaaaaas. 8 3. 3 O
- 2 O
1 O
S. O Patent Application Publication Oct. 21, 2010 Sheet 5 of 6 US 2010/0267,569 A1
Fig. 5A
s
Fig. 5B
D O CD C s C C go O. D Patent Application Publication Oct. 21, 2010 Sheet 6 of 6 US 2010/0267,569 A1
Seq. Spec. bin. DNA bin. PrOt. bin.
S$ NuC. ac.bin. Trans. reg. act. Trans. fa. act.
Fig. 6 US 2010/0267,569 A1 Oct. 21, 2010
COMPOSITIONS, METHODS AND KITS FOR EMBO Journal 20:4704-4716 (2001). Several groups have THE DAGNOSIS OF CARRIERS OF demonstrated that BRCA1- or BRCA2-deficient rodent cells MUTATIONS IN THE BRCA1 AND BRCA2 or human tumors are specifically deficient in DNA repair via GENES AND EARLY DAGNOSS OF homologous recombination, whereas, when measured, non CANCEROUS DISORDERS ASSOCATED homologous recombination remains intact after double WITH MUTATIONS IN BRCA1 AND BRCA2 strand DNA breaks. Moreover, the correlation between GENES BRCA1 or BRCA2 mutation and alterations in p53, HER2 and Myc gene expression as well as alterations in cell-cycle FIELD OF THE INVENTION regulation have been shown in breast carcinoma patients 0001. The invention relates to early diagnosis of cancerous Venkitaraman A. R. Journal of Cell Science. 114:3591-8 disorders. More particularly, the invention relates to compo (2005). Together, these data imply that accumulation of sitions methods and kits based on measuring differential Somatic genetic changes during tumor progression may fol expression of specific marker genes, for the diagnosis of low a unique pathway in individuals genetically predisposed carriers of mutations in the BRCA1 and BRCA2 genes and tO Cancer. thereby, the diagnosis of cancerous disorders associated 0007 As mentioned above, BRCA1 and BRCA2 proteins therewith, specifically, of ovarian and breast cancer. maintain genomic stability through an involvement in DNA repair processes. Mutations in BRCA1 and BRCA2 seem to BACKGROUND OF THE INVENTION predispose cells to an increased risk of mutagenesis and trans formation after exposure to radiation. It was shown recently 0002 All publications mentioned throughout this applica that normal human fibroblasts and lymphoblastoid cells with tion are fully incorporated herein by reference, including all heterozygous BRCA1 and BRCA2 mutations seem to have references cited therein. increased radio sensitivity Buchholz, T. A. et al. Interna 0003 Diagnostic markers are important for early diagno tional Journal of Cancer 97:557-561 (2002). Previous study sis of many diseases, as well as predicting response to treat of the present inventors on short-term lymphocyte cultures, ment, monitoring treatment and determining prognosis of provided additional evidence that heterozygous mutation car Such diseases. riers have a different response to DNA damage compared 0004 Mutations in the breast and ovarian cancer suscep with non-carriers Kote-Jarai, Z. et al. British Journal of Can tibility genes BRCA1 and BRCA2 are found in a high pro cer 94:308-310 (2006). The characterization of BRCA1/2 portion of multiple-case families with breast and ovarian RNA expression profile of human fibroblasts from healthy cancer Antoniou, A. C. et al. Genetic Epidemiology 25:190 mutation carriers has been described using spotted cDNA 202 (2003). Carriers of mutations in BRCA1 or BRCA2 microarray Kote-Jarai, Z. et al. Clinical Cancer Research genes have up to 80% lifetime risk of developing breast and 12:3896-901 (2006). This study shows a significant differ ovarian cancers and elevated risk of developing other types of ence in gene expression profiling in heterozygous BRCA1 cancer. Such as prostate and pancreas. Mutations in the and BRCA2 mutation carriers as compared to non-carriers BRCA1 gene account for 50% of familial breast cancer cases. following induced DNA damage caused by exposure to irra Mutations in BRCA2 account for 30% of familial breast diation. cancer cases and are also linked to male breast cancer. 0005. About 80% of all alterations in BRCA1 and BRCA2 0008. The present invention discloses marker genes dif tumors are frame shift or nonsense mutations, and yield a ferentially expressed in lymphocytes from BRCA1 and truncated protein product Breast cancer Information Core— BRCA2 carriers versus non-carriers following irradiation BIC at http://www.nhgri.nih.gov/Intramural research/Lab stress. These marker genes are used by the compositions, kits transfer/Bic. The types of mutation differ in distribution and methods of the invention as a tool for detecting carriers depending on ethnicity and geographic location. There is and thereby for early detection of proliferative disorders and increasing evidence that hereditary cancer syndromes result particularly, of breast and ovarian carcinomas. ing from germ line mutations in cancer Susceptibility genes 0009. It is therefore one object of the invention to provide lead to organ-specific cancers with distinct histological phe a simple diagnostic composition comprising at least one notypes. The hereditary breast tumors that result from germ detecting molecule specific for quantitative determination of line BRCA1 and BRCA2 mutations exemplify this phenom the expression profile of a collection of marker genes. enon. In recent years, it has been demonstrated that BRCA1 Another object of the invention is to provide a set of pre and BRCA2 breast carcinomas differs from sporadic breast determined marker genes expression level cutoff values use cancer of age-matched controls and from non-BRCA1/2 ful for comparison with the corresponding expression levels familial breast carcinomas in their morphological, immu in a tested subject for the diagnosis of BRCA1 or BRCA2 nophenotypic and molecular characteristics Phillips K. A. genes mutation carriers. Journal of Clinical Oncology 18:107s-112s (2000). 0010 Yet another object of the invention is to provide a 0006. The structurally distinct proteins encoded by simple, inexpensive, and clear test to distinguish between BRCA1 and BRCA2 regulate numerous cellular functions, BRCA1 or BRCA2 genes mutation carriers and non-carriers. including DNA repair, chromosomal segregation, gene tran 0011. As indicated above, carriers of mutations in BRCA1 Scription, cell-cycle arrest and apoptosis. BRCA1 and or BRCA2 genes exhibit increased predisposition to cancer BRCA2 are considered to be “gatekeepers': genes which, ous disorders Therefore, another object of the invention is to when mutated or abnormally expressed, cause disruption of provide diagnostic method for early detection of cancerous normal cell biology, interrupt cell division or death control, disorders associated with mutations in these genes, particu and promote the outgrowth of cancer cells. Recent reports larly of breast and ovarian cancer. This method is based on have provided insight into the role of BRCA1 and BRCA2 in quantitative determination of the expression of at least one the cellular response to DNA damage Tutt A. et al. The marker gene described by the invention. US 2010/0267,569 A1 Oct. 21, 2010
0012. A further object of the invention is to provide diag 0017. In another aspect, the invention contemplates a nostic kit for detection of carriers of BRCA1 and BRCA2 method for the detection of at least one mutation in at least gene mutations and thereby the diagnosis of cancerous dis one of BRCA1 and BRCA2 genes in a biological test sample orders associated with mutations in BRCA1 or BRCA2 ofa mammalian Subject. According to a specific embodiment, genes. the method of the invention comprises the steps of: 0013 These and other objects of the invention will 0018 (a) determining the level of expression of at least six become apparent as the description proceeds. marker genes in said test sample and optionally in a Suitable control sample, wherein said at least six marker genes are SUMMARY OF THE INVENTION selected from any one of: 0014. In a first aspect, the invention relates to a composi 0019 (i) a group consisting of: MRPS6, mitochondrial tion comprising detecting molecules specific for determina ribosomal protein S6; CDKN1B, cyclin-dependent kinase tion of the expression of at least six marker genes, wherein inhibitor 1B (p27, Kip1); ELF1, E74-like factor 1 (ets domain said detecting molecules are selected from isolated detecting transcription factor); NFAT5, nuclear factor of activated nucleic acid molecules and isolated detecting amino acid T-cells 5, tonicity-responsive; NR3C1, nuclear receptor sub molecules. It should be noted that at least six marker genes are family 3, group C, member 1 (glucocorticoid receptor); selected from the group consisting of: MRPS6, mitochondrial SARS, seryl-tRNA synthetase; SMURF2, SMAD specific E3 ribosomal protein S6; CDKN1B, cyclin-dependent kinase ubiquitin protein ligase 2: STAT5A, signal transducer and inhibitor 1B (p27, Kip1); ELF1, E74-like factor 1 (ets domain activator of transcription 5A;YTHDF3, YTH domain family, transcription factor); NFAT5, nuclear factor of activated member 3; AUH, AU RNA binding protein/enoyl-Coenzyme T-cells 5, tonicity-responsive; NR3C1, nuclear receptor sub A hydratase: EIF3D, eukaryotic translation initiation factor 3, family 3, group C, member 1 (glucocorticoid receptor); subunit D; IFI44L, interferon-induced protein 44-like; and SARS, seryl-tRNA synthetase; SMURF2, SMAD specific E3 NR4A2, nuclear receptor subfamily 4, group A, member 2: ubiquitin protein ligase 2: STAT5A, signal transducer and 0020 (ii) the group as defined in (i) further consisting of: activator of transcription 5A;YTHDF3, YTH domain family, RAB3GAP1, RAB3 GTPase activating protein subunit 1 member 3; AUH, AU RNA binding protein/enoyl-Coenzyme (catalytic); MID1 IP1, MID1 interacting protein 1 (gastrula A hydratase: EIF3D, eukaryotic translation initiation factor 3, tion specific G12 homolog (Zebrafish)); RGS16, regulator of subunit D; IFI44L, interferon-induced protein 44-like: G-protein signaling 16; MARCH7, membrane-associated NR4A2, nuclear receptor subfamily 4, group A, member 2: ring finger (C3HC4) 7; and SFRS18 (C6orfl 11), splicing RAB3GAP1, RAB3 GTPase activating protein subunit 1 factor, arginine/serine-rich 18; (catalytic); MID1 IP1, MID1 interacting protein 1 (gastrula 0021 (iii) the group as defined in (i) further consisting of: tion specific G12 homolog (Zebrafish)); RGS16, regulator of RAB3GAP1, RAB3 GTPase activating protein subunit 1 G-protein signaling 16: MARCH7, membrane-associated (catalytic); MID1 IP1, MID1 interacting protein 1 (gastrula ring finger (C3HC4) 7; SFRS18 (C6orfl 11), splicing factor, tion specific G12 homolog (Zebrafish)); RGS16, regulator of arginine/serine-rich 18; RPS6KB1, ribosomal protein S6 G-protein signaling 16; MARCH7, membrane-associated kinase, 70 kDa, polypeptide 1; and DNAJC12. DnaJ (Hsp40) ring finger (C3HC4) 7; SFRS18 (C6orf111), splicing factor, homolog, subfamily C, member 12, as set forth in Table 4. arginine/serine-rich 18; RPS6KB1, ribosomal protein S6 According to this embodiment, the composition of the inven kinase, 70 kDa, polypeptide 1; and DNAJC12. DnaJ (Hsp40) tion is used for determining the level of expression of at least homolog, subfamily C, member 12, as set forth in Table 4; six of said marker genes in a biological test sample of a 0022 (b) determining the level of expression of at least mammalian Subject. one control gene in said test sample and optionally, in a 0015. According to another embodiment, the composition Suitable control sample: of the invention comprises detecting molecules specific for at 0023 (c) comparing the expression values obtained in least six marker genes selected from the group consisting of steps (a) and (b) of each marker gene in said test sample with MRPS6, mitochondrial ribosomal protein S6: CDKN1B, a corresponding predetermined cutoff value of each of said cyclin-dependent kinase inhibitor 1B (p27, Kip1); ELF1 marker genes; E74-like factor 1 (ets domain transcription factor); NFAT5, nuclear factor of activated T-cells 5, tonicity-responsive; 0024 (d) determining whether said expression value of NR3C1, nuclear receptor subfamily 3, group C, member 1 each said marker gene is positive and thereby belongs to a (glucocorticoid receptor); SARS, seryl-tRNA synthetase: pre-established carrier population or is negative and belongs SMURF2, SMAD specific E3 ubiquitin protein ligase 2: to a pre-established non-carrier population; STAT5A, signal transducer and activator of transcription 5A; 0025. It should be appreciated that the presence of at least YTHDF3, YTH domain family, member 3: AUH, AU RNA six marker genes with a positive expression value indicates binding protein/enoyl-Coenzyme A hydratase: EIF3D, that said subject is a carrier of at least one mutation of at least eukaryotic translation initiation factor 3, subunit D: IFI44L, one of BRCA1 or BRCA2 gene. interferon-induced protein 44-like; and NR4A2, nuclear 0026. Another aspect of the invention relates to a kitcom receptor Subfamily 4, group A, member 2, as set forth in Table prising: 8. It should be appreciated that the composition of the inven 0027 (a) means for obtaining a sample of a mammalian tion is specifically used for determining the level of expres Subject; sion of at least six of the marker genes indicated by the 0028 (b) detecting molecules specific for determining the invention in a biological test sample of a mammalian Subject. level of expression of at least six marker genes, wherein said 0016. According to one specific embodiment, the compo detecting molecules are selected from isolated detecting sition of the invention is specifically applicable for the detec nucleic acid molecules and isolated detecting amino acid tion of at least one mutation in at least one of BRCA1 and molecules, and wherein said at least six marker genes are BRCA2 genes in a biological sample of a mammalian Subject. selected from any one of: US 2010/0267,569 A1 Oct. 21, 2010
0029 (i) a group consisting of: MRPS6, mitochondrial enlargement of a sample cluster. FIG.3C. Cluster of 11 genes ribosomal protein S6; CDKN1B, cyclin-dependent kinase that were significantly under-expressed in BRCA1 in com inhibitor 1B (p27, Kip1); ELF1, E74-like factor 1 (ets domain parison to BRCA2 and control. transcription factor); NFAT5, nuclear factor of activated 0041 FIG. 4A-4B. Graphic presentation of functional T-cells 5, tonicity-responsive; NR3C1, nuclear receptor sub groups of all genes having differentionl expression in Samples family 3, group C, member 1 (glucocorticoid receptor); of BRCA1 mutation carriers. FIG. 4A demonstrate genes SARS, seryl-tRNA synthetase; SMURF2, SMAD specific E3 which are up regulated as compared to a non-carrier control ubiquitin protein ligase 2: STAT5A, signal transducer and and FIG. 4B demonstrate genes which are down regulated in activator of transcription 5A;YTHDF3, YTH domain family, BRCA1 mutation sample. Abbreviations: bin. (binding), sig. member 3; AUH, AU RNA binding protein/enoyl-Coenzyme (signal), trans. (transducer), ac. (activity), tm. (transmem A hydratase: EIF3D, eukaryotic translation initiation factor 3, brane). Rec. (receptor). Ag. (antigen), reg. (regulator), Ha. subunit D; IFI44L, interferon-induced protein 44-like; and (heavy), met. (metal), pr. (protein). Unf. (unfolded), Enz (en NR4A2, nuclear receptor subfamily 4, group A, member 2: Zymatic). 0030 (ii) the group as defined in (i) further consisting of: 0042 FIG. 5A-5B. Graphic presentation of functional RAB3GAP1, RAB3 GTPase activating protein subunit 1 groups of all genes having differentionl expression in Samples (catalytic); MID1 IP1, MID1 interacting protein 1 (gastrula of BRCA2 mutation carriers. FIG. 5A demonstrate genes tion specific G12 homolog (Zebrafish)); RGS16, regulator of which are up regulated as compared to a non-carrier control G-protein signaling 16: MARCH7, membrane-associated and FIG. 5B demonstrate genes which are down regulated in ring finger (C3HC4) 7; and SFRS18 (C6orf111), splicing BRCA2 mutation sample. Abbreviations: bin. (binding), ac. factor, arginine/serine-rich 18; (activity), cat. (catalytic), nuc. (nucleotide), pr. (protein), Enz 0031 (iii) the group as defined in (i) further consisting of: (enzymatic), kin. (kinase), sin. (single), Str. (Strand), lip. RAB3GAP1, RAB3 GTPase activating protein subunit 1 (lipid), cons. (constituent), stru. (Structured). (catalytic); MID1 IP1, MID1 interacting protein 1 (gastrula 0043 FIG. 6. Gene Ontology analysis of the genes differ tion specific G12 homolog (Zebrafish)); RGS16, regulator of entially expressed, with most similar gene expression consis G-protein signaling 16: MARCH7, membrane-associated tent into each group. ring finger (C3HC4) 7; and SFRS18 (C6orf111), splicing factor, arginine/serine-rich 18; RPS6KB1, ribosomal protein DETAILED DESCRIPTION OF THE INVENTION S6 kinase, 70 kDa, polypeptide 1; and DNAJC12, DnaJ 0044) The present invention discloses characterization of (Hsp40) homolog, subfamily C, member 12, as set forth in the gene expression profile in freshly cultured lymphocytes Table 4; obtained from non-carrier women as compared to carriers of 0032 (c) at least one detecting molecule specific for deter mutations in either BRCA1 or BRCA2. mining the expression of at least one control gene; 0045 BRCA1 and BRCA2 up-regulate tumor suppressor 0033 (d) optionally, at least one control sample selected and growth-inhibitory genes and repress cell proliferation from a negative control sample and a positive control sample: genes, serving as transcriptional co-activators depending on 0034 (e) instructions for carrying out the detection and the specific target gene. Despite a large number of studies on quantification of expression of said at least six marker genes BRCA1 and BRCA2 genes, the exact role of BRCA1 and and of at least one control gene in said sample, and for BRCA2 regulators of DNA repair, transcription, and the cell obtaining expression values of each of said marker genes; and cycle in response to DNA damage is still unclear, and mecha 0035 (f) instructions for comparing the expression values nisms underlying the tissue specificity of their tumor-Sup of each marker gene in said test sample with a corresponding pressive property remain speculative. predetermined cutoff value of each of said marker genes and 0046. As shown by the following Examples, the inventors determining a positive or negative results thereby evaluating assessed gene expression variation between irradiated and the differential expression of said marker gene in said sample. non-irradiated lymphocytes isolated from non-carrier Sub 0036. These and other aspects of the invention will jects and carriers of mutations in BRCA1, BRCA2 or both. become apparent by the hand of the following figures and This comparison revealed significant differences in gene examples. expression profile of a particular group of twenty, and more specifically eighteen marker genes, between groups of carri BRIEF DESCRIPTION OF THE FIGURES ers of mutations in any one of BRCA1 and BRCA2 genes and 0037 FIG. 1A-1C. Heat map of gene expression profile of the control non-carrier groups. lymphocytes from BRCA1 mutation carriers and control non 0047 A further study of the gene expression differences carriers (A) or BRCA2 carriers and control non-carriers (B). between normal non-carrier subjects and carriers of BRCA1 Data analysis by Expression Console Software (Affymetrix) and BRCA2 mutations revealed specific expression values represented in Figure (C) Only the genes expressed in signifi for the marker gene group, a deviation from which of at least cantly distinct manner (with p-value <0.05) were selected for six Such genes is indicative of an increased likelihood for the analysis. Abbreviations: cont. (control). presence of at least one mutation in any one of BRCA1 and/or 0038 FIG. 2. Principal components analysis (PCA) of BRCA2 in a tested subject. This discovery is beneficial, for gene profile in BRCA1 and BRCA2 mutation carriers and example, as a cost-effective screening method for detection of control. Abbreviations: gr. (group), C (control), Ma (map cancer-predisposed subjects for follow up and possible pro ping). phylaxis as well as Suitable treatment upon detection of rel 0039 FIG. 3A-3C. ANOVA analysis of BRCA1 (yellow), eVant tumorS. BRCA2 (blue) and control (red) gene expression. 0048 Thus, according to a first aspect, the invention 0040 FIG. 3A. Clustering of the whole gene set. Note the relates to a composition comprising at least one detecting homogenous clustering of BRCA2 as compared to the some molecule or a collection of at least two detecting molecules what more heterogeneous clustering of BRCA1. FIG.3B. An specific for determination of the expression of at least one US 2010/0267,569 A1 Oct. 21, 2010
marker gene or a collection of at least two marker genes. More homolog, subfamily C, member 12, as set forth in Table 4. specifically, these marker genes may be selected from the The purpose of this composition is the determination of the group consisting of RAB3GAP1, RAB3 GTPase activating level of expression of at least six of the marker genes in a protein subunit 1 (catalytic); NFAT5, nuclear factor of acti biological test sample of a mammalian Subject. vated T-cells 5, tonicity-responsive: MRPS6, mitochondrial 0050. According to another embodiment of this composi ribosomal protein S6; AUH, AU RNA binding protein/enoyl tion, at least six marker genes may be selected from the group Coenzyme A hydratase; MID1 IP1, MID1 interacting protein consisting of: MRPS6, mitochondrial ribosomal protein S6; 1 (gastrulation specific G12 homolog (Zebrafish); RGS16, CDKN1B, cyclin-dependent kinase inhibitor 1B (p27, Kip1); regulator of G-protein signaling 16; MARCH7, membrane ELF1, E74-like factor 1 (ets domain transcription factor); associated ring finger (C3HC4) 7: NR3C1, nuclear receptor NFAT5, nuclear factor of activated T-cells 5, tonicity-respon Subfamily 3, group C, member 1 (glucocorticoid receptor); sive; NR3C1, nuclear receptor subfamily 3, group C, member ELF1, E74-like factor 1 (ets domain transcription factor); 1 (glucocorticoid receptor); SARS, seryl-tRNA synthetase: RPS6KB1, ribosomal protein S6 kinase, 70 kDa, polypeptide SMURF2, SMAD specific E3 ubiquitin protein ligase 2: 1: STAT5A, signal transducer and activator of transcription STAT5A, signal transducer and activator of transcription 5A; 5A: YTHDF3, YTH domain family, member 3: DNAJC12, YTHDF3, YTH domain family, member 3: AUH, AU RNA DnaJ (Hsp40) homolog, subfamily C, member 12; IFI44L, binding protein/enoyl-Coenzyme A hydratase: EIF3D, interferon-induced protein 44-like; SARS, seryl-tRNA syn eukaryotic translation initiation factor 3, subunit D: IFI44L, thetase: SMURF2, SMAD specific E3 ubiquitin protein interferon-induced protein 44-like: NR4A2, nuclear receptor ligase 2; SFRS18 (C6orf111), splicing factor, arginine/ subfamily 4, group A, member 2: RAB3GAP1, RAB3 serine-rich 18; NR4A2, nuclear receptor subfamily 4, group GTPase activating protein subunit 1 (catalytic); MID1 IP1, A, member 2: CDKN1B, cyclin-dependent kinase inhibitor MID1 interacting protein 1 (gastrulation specific G12 1B (p27, Kip1); and EIF3D, eukaryotic translation initiation homolog (Zebrafish)); RGS16, regulator of G-protein signal factor 3, subunit D, and are as set forth in Table 4, or any ing 16: MARCH7, membrane-associated ring finger collection or combination thereof. It should be noted that the (C3HC4) 7; and SFRS18 (C6orf111), splicing factor, argin composition of the invention may be specifically applicable ine?serine-rich 18, as set forth in Table 7. for determining the level of expression (also referred to herein 0051. In yet another embodiment, the marker genes may as “profiling' or “expression pattern') of at least one of said be selected from the group consisting of: MRPS6, mitochon marker genes in a biological test sample of a mammalian drial ribosomal protein S6: CDKN1B, cyclin-dependent subject. According to certain embodiments, the composition kinase inhibitor 1B (p27, Kip1); ELF1, E74-like factor 1 (ets of the invention may be specifically applicable for determin domain transcription factor); NFAT5, nuclear factor of acti ing the level of expression of at least two, at least three, at least vated T-cells 5, tonicity-responsive; NR3C1, nuclear receptor four, at least five, at least six, at least seven, at least eight, at Subfamily 3, group C, member 1 (glucocorticoid receptor); least nine, at least ten, at least eleven, at least twelve, at least SARS, seryl-tRNA synthetase; SMURF2, SMAD specific E3 thirteen, at least fourteen, at least fifteen, at least sixteen, at ubiquitin protein ligase 2: STAT5A, signal transducer and least seventeen, at least eighteen, at least nineteen or at least activator of transcription 5A;YTHDF3, YTH domain family, twenty of said marker genes in a biological test sample of a member 3; AUH, AU RNA binding protein/enoyl-Coenzyme mammalian Subject. A hydratase: EIF3D, eukaryotic translation initiation factor 3, 0049. In certain embodiments, the present invention pro subunit D; IFI44L, interferon-induced protein 44-like; and vides a composition comprising detecting molecules specific NR4A2, nuclear receptor Subfamily 4, group A, member 2, as for determination of the expression of at least six marker set fourth in Table 8. genes. The detecting molecules of the invention may be any 0052. In a particular embodiment, the invention further one of isolated detecting nucleic acid molecules and isolated provides a composition comprising detecting molecules spe detectingamino acid molecules, or any combinations thereof. cific for: MRPS6, mitochondrial ribosomal protein S6; These at least six marker genes may be selected from the CDKN1B, cyclin-dependent kinase inhibitor 1B (p27, Kip1); group consisting of: MRPS6, mitochondrial ribosomal pro ELF1, E74-like factor 1 (ets domain transcription factor); tein S6; CDKN1B, cyclin-dependent kinase inhibitor 1B NFAT5, nuclear factor of activated T-cells 5, tonicity-respon (p27, Kip1); ELF1, E74-like factor 1 (ets domain transcrip sive; NR3C1, nuclear receptor subfamily 3, group C, member tion factor); NFAT5, nuclear factor of activated T-cells 5, 1 (glucocorticoid receptor); SARS, seryl-tRNA synthetase: tonicity-responsive; NR3C1, nuclear receptor subfamily 3, SMURF2, SMAD specific E3 ubiquitin protein ligase 2: group C, member 1 (glucocorticoid receptor); SARS, Seryl STAT5A, signal transducer and activator of transcription 5A; tRNA synthetase; SMURF2, SMAD specific E3 ubiquitin YTHDF3, YTH domain family, member 3: AUH, AU RNA protein ligase 2: STAT5A, signal transducer and activator of binding protein/enoyl-Coenzyme A hydratase: EIF3D, transcription 5A;YTHDF3, YTH domain family, member 3: eukaryotic translation initiation factor 3, subunit D: IFI44L, AUH, AU RNA binding protein/enoyl-Coenzyme A interferon-induced protein 44-like; and NR4A2, nuclear hydratase: EIF3D, eukaryotic translation initiation factor 3, receptor Subfamily 4, group A, member 2. According to cer subunit D; IFI44L, interferon-induced protein 44-like: tain embodiments, said composition may further comprises NR4A2, nuclear receptor subfamily 4, group A, member 2: detecting molecules specific for at least one of RAB3GAP1, RAB3GAP1, RAB3 GTPase activating protein subunit 1 RAB3 GTPase activating protein subunit 1 (catalytic); (catalytic); MID1 IP1, MID1 interacting protein 1 (gastrula MID1 IP1, MID1 interacting protein 1 (gastrulation specific tion specific G12 homolog (Zebrafish)); RGS16, regulator of G12 homolog (Zebrafish)); RGS16, regulator of G-protein G-protein signaling 16: MARCH7, membrane-associated signaling 16: MARCH7, membrane-associated ring finger ring finger (C3HC4) 7; SFRS18 (C6orfl 11), splicing factor, (C3HC4) 7: SFRS18 (C60rf111), splicing factor, arginine/ arginine/serine-rich 18; RPS6KB1, ribosomal protein S6 serine-rich 18; RPS6KB1, ribosomal protein S6 kinase, 70 kinase, 70 kDa, polypeptide 1; and DNAJC12. DnaJ (Hsp40) kDa, polypeptide 1; and DNAJC12, DnaJ (Hsp40) homolog, US 2010/0267,569 A1 Oct. 21, 2010
subfamily C, member 12. It should be noted that any of the to refer to a chain of amino acids linked together by peptide methods and kits of the invention described herein after may bonds. In a specific embodiment, a protein is composed of use Such particular composition as indicated herein. less than 200, less than 175, less than 150, less than 125, less 0053 According to one embodiment, the detecting mol than 100, less than 50, less than 45, less than 40, less than 35, ecules are specific for quantitative or qualitative determina less than 30, less than 25, less than 20, less than 15, less than tion of expression of said marker genes. Preferably, the 10, or less than 5 amino acids linked together by peptide detecting molecules used by the invention may be specifically bonds. Suitable for quantitative determination of expression of any of 0059. In another embodiment, a protein is composed of at the marker genes used by the composition of the invention, as least 200, at least 250, at least 300, at least 350, at least 400, set forth in any one of Table 4, Table 7 and Table 8. at least 450, at least 500 or more amino acids linked together 0054 According to one embodiment, the detecting mol by peptide bonds. ecule used by the composition of the invention may be an 0060 According to one specific embodiment, the isolated isolated nucleic acid molecule oran isolated amino acid mol detecting nucleic acid molecules comprised within the com ecule. It should be appreciated that the composition of the position of the invention may be isolated oligonucleotides. invention may comprise both, nucleic acid based detecting Each oligonucleotide specifically or/and selectively hybrid molecules and amino acid based detecting molecules. Thus, izes to a nucleic acid sequence of the RNA products of at least the invention further contemplates the use of a combination of one marker gene selected from the group consisting of proteins or polypeptides in combination with polynucleotides RAB3GAP1, RAB3 GTPase activating protein subunit 1 So as to measure one or more products of one or more of the (catalytic): NFAT5, nuclear factor of activated T-cells 5, marker genes of the invention, in any combination thereof. tonicity-responsive; MRPS6, mitochondrial ribosomal pro 0055 As used herein, “nucleic acid(s) is interchangeable tein S6; AUH, AU RNA binding protein/enoyl-Coenzyme A with the term “polynucleotide(s)' and it generally refers to hydratase; MID1 IP1, MID1 interacting protein 1 (gastrula any polyribonucleotide or poly-deoxyribonucleotide, which tion specific G12 homolog (Zebrafish)); RGS16, regulator of may be unmodified RNA or DNA or modified RNA or DNA G-protein signaling 16; MARCH7, membrane-associated or any combination thereof. "Nucleic acids' include, without ring finger (C3HC4)7; NR3C1, nuclear receptor subfamily 3, limitation, single- and double-stranded nucleic acids. As used group C, member 1 (glucocorticoid receptor); ELF1, E74 herein, the term “nucleic acid(s) also includes DNAS or like factor 1 (ets domain transcription factor); RPS6KB1, RNAS as described above that contain one or more modified ribosomal protein S6 kinase, 70 kDa, polypeptide 1: bases. Thus, DNAS or RNAs with backbones modified for STAT5A, signal transducer and activator of transcription 5A; stability or for other reasons are “nucleic acids”. The term YTHDF3, YTH domain family, member 3: DNAJC12, DnaJ “nucleic acids as it is used herein embraces such chemically, (Hsp40) homolog, subfamily C, member 12; IFI44L, inter enzymatically or metabolically modified forms of nucleic feron-induced protein 44-like; SARS, seryl-tRNA syn acids, as well as the chemical forms of DNA and RNA char thetase: SMURF2, SMAD specific E3 ubiquitin protein acteristic of viruses and cells, including for example, simple ligase 2; SFRS18 (C6orf111), splicing factor, arginine/ and complex cells. A “nucleic acid' or “nucleic acid serine-rich 18; NR4A2, nuclear receptor subfamily 4, group sequence' may also include regions of single- or double A, member 2: CDKN1B, cyclin-dependent kinase inhibitor stranded RNA or DNA or any combinations. 1B (p27, Kip1); and EIF3D, eukaryotic translation initiation 0056. As used herein, the term "oligonucleotide' is factor 3, subunit D, as set forth in Table 4. defined as a molecule comprised of two or more deoxyribo 0061. In some embodiments, where the composition's nucleotides and/or ribonucleotides, and preferably more than detecting nucleic acid molecules are isolated oligonucle three. Its exact size will depend upon many factors which in otides, each oligonucleotide specifically hybridizing to a turn, depend upon the ultimate function and use of the oligo nucleic acid sequence of the RNA products of at least one of nucleotide. The oligonucleotides may be from about 8 to the at least six marker genes. According to certain embodi about 1,000 nucleotides long. Although oligonucleotides of 5 ments, these at least six marker genes may be selected from to 100 nucleotides are useful in the invention, preferred oli the group consisting of: MRPS6, mitochondrial ribosomal gonucleotides range from about 5 to about 15 bases in length, protein S6; CDKN1B, cyclin-dependent kinase inhibitor 1B from about 5 to about 20 bases in length, from about 5 to about (p27, Kip1); ELF1, E74-like factor 1 (ets domain transcrip 25 bases in length, from about 5 to about 30 bases in length, tion factor); NFAT5, nuclear factor of activated T-cells 5, from about 5 to about 40 bases in length or from about 5 to tonicity-responsive; NR3C1, nuclear receptor subfamily 3, about 50 bases in length. More specifically, the detecting group C, member 1 (glucocorticoid receptor); SARS, Seryl oligonucleotides molecule used by the composition of the tRNA synthetase; SMURF2, SMAD specific E3 ubiquitin invention may comprise any one of 5,6,7,8,9, 10, 11, 12, 13, protein ligase 2: STAT5A, signal transducer and activator of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, transcription 5A;YTHDF3, YTH domain family, member 3: 35, 40, 45, 50 bases in length. AUH, AU RNA binding protein/enoyl-Coenzyme A 0057 The term “about as used herein indicates values hydratase: EIF3D, eukaryotic translation initiation factor 3, that may deviate up to 1%, more specifically 5%, more spe subunit D; IFI44L, interferon-induced protein 44-like: cifically 10%, more specifically 15%, and in some cases up to NR4A2, nuclear receptor subfamily 4, group A, member 2: 20% higher or lower than the value referred to, the deviation RAB3GAP1, RAB3 GTPase activating protein subunit 1 range including integer values, and, if applicable, non-integer (catalytic); MID1 IP1, MID1 interacting protein 1 (gastrula values as well, constituting a continuous range. tion specific G12 homolog (Zebrafish)); RGS16, regulator of 0058 As indicated above, the detecting molecules of the G-protein signaling 16; MARCH7, membrane-associated invention may be amino acid based molecules that may be ring finger (C3HC4) 7; SFRS18 (C6orf111), splicing factor, referred to as protein/s or polypeptide?s. As used herein, the arginine/serine-rich 18; RPS6KB1, ribosomal protein S6 terms “protein’ and “polypeptide are used interchangeably kinase, 70 kDa, polypeptide 1; and DNAJC12. DnaJ (Hsp40) US 2010/0267,569 A1 Oct. 21, 2010 homolog, Subfamily C, member 12, as indicated in the twenty the test sample as compared to a control population is indica gene list as set forth in Table 4. The aforementioned detecting tive of at least one mutation in at least one of BRCA1 and oligonucleotide molecules are used for determining the level BRCA2 genes in the subject, and thereby of an increased of expression of at least six marker genes in the test sample, genetic predisposition of the Subject to a cancerous disorder and a differential expression of at least six Such genes in the associated with mutations in any one of BRCA1 and BRCA2 test sample as compared to a control population is indicative genes. of at least one mutation in at least one of BRCA1 and BRCA2 0064. As indicated above, the compositions of the inven genes in the Subject, and thereby of an increased genetic tion comprise oligonucleotides that specifically hybridize to predisposition of the Subject to a cancerous disorder associ nucleic acid sequences of RNA products of the marker gene. ated with mutations in any one of BRCA1 and BRCA2 genes. As used herein, the term “hybridize” refers to a process where 0062. In another embodiment, the composition of the two complementary nucleic acid strands anneal to each other invention may comprise oligonucleotides that specifically under appropriately stringent conditions. Hybridizations are hybridize to nucleic acid sequences of RNA products of at typically and preferably conducted with probe-length nucleic least one of at least six marker genes selected from the group acid molecules, preferably 5-200 nucleotides in length, consisting of: MRPS6, mitochondrial ribosomal protein S6; 5-100, 5-50, 5-40, 5-30 or 5-20. CDKN1B, cyclin-dependent kinase inhibitor 1B (p27, Kip1); 0065. As used herein “selective or specific hybridization' ELF1, E74-like factor 1 (ets domain transcription factor); in the context of this invention refers to a hybridization which NFAT5, nuclear factor of activated T-cells 5, tonicity-respon occurs between a polynucleotide encompassed by the inven sive; NR3C1, nuclear receptor subfamily 3, group C, member tion and an RNA product of any of the marker gene of the 1 (glucocorticoid receptor); SARS, seryl-tRNA synthetase: invention, wherein the hybridization is such that the poly SMURF2, SMAD specific E3 ubiquitin protein ligase 2: nucleotide binds to the RNA products of the marker gene of STAT5A, signal transducer and activator of transcription 5A; the invention preferentially to any RNA products of other YTHDF3, YTH domain family, member 3: AUH, AU RNA gene products in the tested Sample. In a preferred embodi binding protein/enoyl-Coenzyme A hydratase: EIF3D, ment a polynucleotide which “selectively hybridizes” is one eukaryotic translation initiation factor 3, subunit D: IFI44L, which hybridizes with a selectivity of greater than 60%, interferon-induced protein 44-like: NR4A2, nuclear receptor greater than 70%, greater than 80%, greater than 90% and subfamily 4, group A, member 2: RAB3GAP1, RAB3 most preferably on 100% (i.e. cross hybridization with other GTPase activating protein subunit 1 (catalytic); MID1 IP1, RNA species preferably occurs at less than 40%, less than MID1 interacting protein 1 (gastrulation specific G12 30%, less than 20%, less than 10%). As would be understood homolog (Zebrafish)); RGS16, regulator of G-protein signal to a person skilled in the art, a detecting polynucleotide which ing 16: MARCH7, membrane-associated ring finger “selectively hybridizes to the RNA product of a marker gene (C3HC4) 7; and SFRS18 (C6orf111), splicing factor, argin of the invention can be designed taking into account the ine/serine-rich 18, as indicated in the eighteen genes list as set length and composition. forth in Table 7. The detecting oligonucleotide molecules are 0066. As used herein, “specifically hybridizes”, “specific used for determining the level of expression of the at least six hybridization” refers to hybridization which occurs when two marker gene in a sample, and a differential expression of at nucleic acid sequences are Substantially complementary (at least six Such genes in the test sample as compared to a control least about 60% complementary over a stretch of at least 5 to population is indicative of at least one mutation in at least one 25 nucleotides, preferably at least about 70%, 75%, 80% or of BRCA1 and BRCA2 genes in the subject, and thereby of an 85% complementary, more preferably at least about 90% increased genetic predisposition of the Subject to a cancerous complementary, and most preferably, about 95% comple disorder associated with mutations in any one of BRCA1 and mentary). BRCA2 genes. 0067. The measuring of the expression of the RNA prod 0063 Still another embodiment relates to the composition uct of any one of the marker genes and combination of marker of the invention which comprises isolated detecting oligo genes of the invention can be done by using those polynucle nucleotides, each oligonucleotide specifically hybridizes to a otides as detecting molecules, which are specific and/or selec nucleic acid sequences of RNA products of at least one of at tive for the RNA products of the marker genes of the invention least six marker genes selected from the group consisting of to quantitate the expression of the RNA product. In a specific MRPS6, mitochondrial ribosomal protein S6: CDKN1B, embodiment of the invention, the polynucleotides which are cyclin-dependent kinase inhibitor 1B (p27, Kip1); ELF1 specific and/or selective for the RNA products may be probes E74-like factor 1 (ets domain transcription factor); NFAT5, or primers. It should be further appreciated that the compo nuclear factor of activated T-cells 5, tonicity-responsive; sition of the invention may comprise, as an oligonucleotide NR3C1, nuclear receptor subfamily 3, group C, member 1 based detection molecule, both primers and probes. (glucocorticoid receptor); SARS, seryl-tRNA synthetase: 0068. The term, “primer', as used herein refers to an oli SMURF2, SMAD specific E3 ubiquitin protein ligase 2: gonucleotide, whether occurring naturally as in a purified STAT5A, signal transducer and activator of transcription 5A; restriction digest, or produced synthetically, which is capable YTHDF3, YTH domain family, member 3: AUH, AU RNA of acting as a point of initiation of synthesis when placed binding protein/enoyl-Coenzyme A hydratase: EIF3D, under conditions in which synthesis of a primer extension eukaryotic translation initiation factor 3, subunit D: IFI44L, product, which is complementary to a nucleic acid strand, is interferon-induced protein 44-like; and NR4A2, nuclear induced, i.e., in the presence of nucleotides and an inducing receptor Subfamily 4, group A, member 2, as shown in the agent such as a DNA polymerase and at a Suitable tempera thirteen genes list as set forth in Table 8. The detecting oligo ture and pH. The primer may be single-stranded or double nucleotide molecules are used for determining the level of Stranded and must be sufficiently long to prime the synthesis expression of the at least six marker gene in a sample, and a of the desired extension product in the presence of the induc differential expression of at least six of the marker genes in ing agent. The exact length of the primer will depend upon US 2010/0267,569 A1 Oct. 21, 2010
many factors, including temperature, Source of primer and the ods, rolling circle methods, etc., are well known to the skilled method used. For example, for diagnostic applications, artisan. More specifically, as used herein, the term “ampli depending on the complexity of the target sequence, the oli fied', when applied to a nucleic acid sequence, refers to a gonucleotide primer typically contains 10-30 or more nucle process whereby one or more copies of a particular nucleic otides, although it may contain fewer nucleotides. More spe acid sequence is generated from a template nucleic acid, cifically, the primer used by the composition of the invention preferably by the method of polymerase chain reaction. may comprise 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22. “Polymerase chain reaction” or "PCR" refers to an in vitro 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides. The factors method for amplifying a specific nucleic acid template involved in determining the appropriate length of primer are sequence. The PCR reaction involves a repetitive series of readily known to one of ordinary skill in the art. temperature cycles and is typically performed in a Volume of 0069. As used herein, the term “probe' means oligonucle 50-100 ul. The reaction mix comprises dNTPs (each of the otides and analogs thereof and refers to a range of chemical four deoxynucleotides dATP, dCTP, dGTP, and dTTP), prim species that recognize polynucleotide target sequences ers, buffers, DNA polymerase, and nucleic acid template. The through hydrogen bonding interactions with the nucleotide PCR reaction comprises providing a set of polynucleotide bases of the target sequences. The probe or the target primers wherein a first primer contains a sequence comple sequences may be single- or double-stranded RNA or single mentary to a region in one strand of the nucleic acid template or double-stranded DNA or a combination of DNA and RNA sequence and primes the synthesis of a complementary DNA bases. A probe is at least 5 or preferably, 8 nucleotides in Strand, and a second primer contains a sequence complemen length and less than the length of a complete gene. A probe tary to a region in a second strand of the target nucleic acid may be 5, 6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, sequence and primes the synthesis of a complementary DNA 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 75, 100, 150, 200, Strand, and amplifying the nucleic acid template sequence 250, 400, 500 and up to 2000 nucleotides in length as long as employing a nucleic acid polymerase as a template-depen it is less than the full length of the target gene. Probes can dent polymerizing agent under conditions which are permis include oligonucleotides modified so as to have a tag which is sive for PCR cycling steps of(i) annealing of primers required detectable by fluorescence, chemiluminescence and the like. for amplification to a target nucleic acid sequence contained The probe can also be modified so as to have both a detectable within the template sequence, (ii) extending the primers tag and a quencher molecule, for example TaqMan R and wherein the nucleic acid polymerase synthesizes a primer Molecular Beacon R probes, that will be described in detail extension product. A set of polynucleotide primers”, “a set below. of PCR primers' or “pair of primers' can comprise two, three, 0070 The oligonucleotides and analogs thereof may be four or more primers. RNA or DNA, or analogs of RNA or DNA, commonly 0075 Real time nucleic acid amplification and detection referred to as antisense oligomers or antisense oligonucle methods are efficient for sequence identification and quanti otides. Such RNA or DNA analogs comprise, but are not fication of a target since no pre-hybridization amplification is limited to, 2-O-alkyl Sugar modifications, methylphospho required. Amplification and hybridization are combined in a nate, phosphorothiate, phosphorodithioate, formacetal, single step and can be performed in a fully automated, large 3-thioformacetal, sulfone, sulfamate, and nitroxide backbone scale, closed-tube format. modifications, and analogs wherein the base moieties have 0076 Methods that use hybridization-triggered fluores been modified. In addition, analogs of oligomers may be cent probes for real time PCR are based either on a quench polymers in which the Sugar moiety has been modified or release fluorescence of a probe digested by DNA Polymerase replaced by another Suitable moiety, resulting in polymers (e.g., methods using TaqMan(R), MGB-TaqMan(R), or on a which include, but are not limited to, morpholino analogs and hybridization-triggered fluorescence of intact probes (e.g., peptide nucleic acid (PNA) analogs. molecular beacons, and linear probes). In general, the probes 0071 Probes may also be mixtures of any of the oligo are designed to hybridize to an internal region of a PCR nucleotide analog types together or in combination with product during annealing stage (also referred to as amplicon). native DNA or RNA. At the same time, the oligonucleotides For those methods utilizing TaqMan(R) and MGB-TaqMan(R) and analogs thereofmay be used alone or in combination with the 5'-exonuclease activity of the approaching DNA Poly one or more additional oligonucleotides or analogs thereof. merase cleaves a probe between fluorophore and quencher 0072 According to another preferred embodiment, when thus releasing fluorescence. the detecting molecule is an oligonucleotide, the expression (0077. Thus, a “real time PCR assay provides dynamic level of any of the marker genes may be determined using at fluorescence detection of amplified marker gene products least one nucleic acid amplification assay, such as a Real produced in a PCR amplification reaction. During PCR, the Time PCR, micro arrays, PCR, in situ Hybridization or Com amplified products created using Suitable primers hybridize parative Genomic Hybridization. to probe nucleic acids (TaqMan(R) probe, for example), which 0073. In further embodiments, the oligonucleotides are may be labeled according to some embodiments with both a any one of a pair of primer or nucleotide probe. Thus, it should reporter dye and a quencher dye. When these two dyes are in be appreciated that also the level of expression of at least six close proximity, i.e. both are present in an intact probe oligo of the marker genes is determined using a nucleic acid ampli nucleotide, the fluorescence of the reporter dye is Suppressed. fication assay selected from the group consisting of a Real However, a polymerase, such as AmpliTaq GoldTM, having Time PCR, micro arrays, PCR, in situ Hybridization and 5'-3' nuclease activity can be provided in the PCR reaction. Comparative Genomic Hybridization. This enzyme cleaves the fluorogenic probe if it is bound 0074 The term “amplify, with respect to nucleic acid specifically to the target nucleic acid sequences between the sequences, refers to methods that increase the representation priming sites. The reporter dye and quencher dye are sepa of a population of nucleic acid sequences in a sample. Nucleic rated upon cleavage, permitting fluorescent detection of the acid amplification methods, such as PCR, isothermal meth reporter dye. Upon excitation by a laser provided, e.g., by a US 2010/0267,569 A1 Oct. 21, 2010
sequencing apparatus, the fluorescent signal produced by the I0085. As defined herein, a “nucleic acid array refers to a reporter dye is detected and/or quantified. The increase in plurality of nucleic acids (or “nucleic acid members’), fluorescence is a direct consequence of amplification of target optionally attached to a Support where each of the nucleic acid nucleic acids during PCR. members is attached to a Support in a unique pre-selected and 0078. The method and hybridization assays using self defined region. These nucleic acid sequences are used herein quenching fluorescence probes with and/or without internal as detecting nucleic acid molecules. In one embodiment, the controls for detection of nucleic acid application products are nucleic acid member attached to the Surface of the Support is known in the art, for example, U.S. Pat. Nos. 6.258,569; DNA. In a preferred embodiment, the nucleic acid member 6,030,787; 5,952,202; 5,876,930; 5,866,336; 5,736,333; attached to the surface of the support is either cDNA or 5,723,591; 5,691,146; and 5,538,848. oligonucleotides. In another embodiment, the nucleic acid 0079 More particularly, QRT-PCR or “qPCR” (Quantita member attached to the surface of the support is clNA syn tive RT-PCR), which is quantitative in nature, can also be thesized by polymerase chain reaction (PCR). In another performed to provide a quantitative measure of gene expres embodiment, a “nucleic acid array' refers to a plurality of sion levels. In QRT-PCR reverse transcription and PCR can unique nucleic acid detecting molecules attached to nitrocel be performed in two steps, or reverse transcription combined lulose or other membranes used in Southern and/or Northern with PCR can be performed. One of these techniques, for blotting techniques. which there are commercially available kits such as Taq I0086 For oligonucleotide-based arrays, the selection of Man(R) (PerkinElmer, Foster City, Calif.), is performed with oligonucleotides corresponding to the gene of interest which a transcript-specific antisense probe. This probe is specific for are useful as probes is well understood in the art. the PCR product (e.g. a nucleic acid fragment derived from a I0087 More particularly, it is important to choose regions gene) and is prepared with a quencher and fluorescent which will permit hybridization to the target nucleic acids. reporter probe attached to the 5' end of the oligonucleotide. Factors such as the Tm of the oligonucleotide, the percent GC Different fluorescent markers are attached to different report content, the degree of secondary structure and the length of ers, allowing for measurement of at least two products in one nucleic acid are important factors. reaction. I0088 According to this embodiment, the detecting mol 0080 When Taq DNA polymerase is activated, it cleaves ecule may be in the form of probe corresponding and thereby off the fluorescent reporters of the probe bound to the tem hybridizing to any region or part of the marker gene. For plate by virtue of its 5-to-3' exonuclease activity. In the example, these probes may be a set of corresponding 5' ends absence of the quenchers, the reporters now fluoresce. The or a set of corresponding 3' ends or a set of corresponding color change in the reporters is proportional to the amount of internal coding regions. Of course, mixtures of a 5' end of one each specific product and is measured by a fluorometer; there gene may be used as a target or a probe in combination with fore, the amount of each color is measured and the PCR a 3' end of another gene to achieve the same result of mea product is quantified. The PCR reactions can be performed in Suring the levels of expression of the marker gene. any Solid Support, for example, slides, microplates, 96 well 0089. As used herein, the “5' end refers to the end of an plates, 384 well plates and the like so that samples derived mRNA up to the first 1000 nucleotides or one third of the from many individuals are processed and measured simulta mRNA (where the full length of the mRNA does not include neously. The TaqMan(R) system has the additional advantage the poly A tail), starting at the first nucleotide of the mRNA. of not requiring gel electrophoresis and allows for quantifi The “5” region' of a gene refers to a polynucleotide (double cation when used with a standard curve. stranded or single-stranded) located within or at the 5' end of 0081. A second technique useful for detecting PCR prod a gene, and includes, but is not limited to, the 5' untranslated ucts quantitatively without is to use an intercalating dye Such region, if that is present, and the 5' protein coding region of a as the commercially available QuantiTect SYBR Green PCR gene. The 5' region is not shorter than 8 nucleotides in length (Qiagen, Valencia Calif.). RT-PCR is performed using SYBR and not longer than 1000 nucleotides in length. Other possible green as a fluorescent label which is incorporated into the lengths of the 5' region include but are not limited to 10, 20, PCR product during the PCR stage and produces fluorescence 25, 50, 100, 200, 400, and 500 nucleotides. proportional to the amount of PCR product. 0090. As used herein, the “3' end refers to the end of an I0082. Both TaqMan(R) and QuantiTect SYBR systems can mRNA up to the last 1000 nucleotides or one third of the be used subsequent to reverse transcription of RNA. Reverse mRNA, where the 3' terminal nucleotide is that terminal transcription can either be performed in the same reaction nucleotide of the coding or untranslated region that adjoins mixture as the PCR step (one-step protocol) or reverse tran the poly-A tail, if one is present. That is, the 3' end of an scription can be performed first prior to amplification utiliz mRNA does not include the poly-A tail, if one is present. The ing PCR (two-step protocol). “3' region' of a gene refers to a polynucleotide (double 0083. Additionally, other known systems to quantitatively stranded or single-stranded) located within or at the 3' end of measure mRNA expression products include Molecular Bea a gene, and includes, but is not limited to, the 3' untranslated cons(R which uses a probe having a fluorescent molecule and region, if that is present, and the 3' protein coding region of a a quencher molecule, the probe capable of forming a hairpin gene. The 3' region is not shorter than 8 nucleotides in length structure such that when in the hairpin form, the fluorescence and not longer than 1000 nucleotides in length. Other possible molecule is quenched, and when hybridized the fluorescence lengths of the 3' region include but are not limited to 10, 20, increases giving a quantitative measurement of gene expres 25, 50, 100, 200, 400, and 500 nucleotides. As used herein, S1O. the “internal coding region' of a gene refers to a polynucle 0084. In one embodiment, the polynucleotide-based otide (double-stranded or single-stranded) located between detection molecules of the invention may be in the form of the 5' region and the 3' region of a gene as defined herein. nucleic acid probes which can be spotted onto an array to 0091. The “internal coding region' is not shorter than 8 measure RNA from the sample of a subject to be diagnosed. nucleotides in length and not longer than 1000 nucleotides in US 2010/0267,569 A1 Oct. 21, 2010 length. Other possible lengths of the “internal coding region' art, the measure of the level of expression of the protein includebut are not limited to 10, 20, 25, 50, 100, 200, 400, and products of the marker genes of the invention requires a 500 nucleotides. The 5', 3' and internal regions are non-over protein which specifically and/or selectively binds to one or lapping and may, but need not be, contiguous, and may, but more of the protein products corresponding to each marker need not, add up to the full length of the corresponding gene. genes of the invention. 0092. As indicated above, assay based on micro array or 0098. Thus, according to a particular embodiment, the RT-PCR may involve attaching or spotting of the probes in a invention provides an alternative composition comprising as Solid Support. As used herein, the terms “attaching” and the detection molecules, isolated amino acid molecules. 'spotting refer to a process of depositing a nucleic acid onto Accordingly, each of Such detection molecules may be an a Substrate to form a nucleic acid array Such that the nucleic isolated polypeptide which binds selectively and specifically acid is stably bound to the substrate via covalent bonds, to a protein product of at least one marker gene selected from hydrogen bonds or ionic interactions. the group consisting of RAB3GAP1, RAB3 GTPase activat 0093. As used herein, “stably associated” or “stably ing protein subunit 1 (catalytic); NFAT5, nuclear factor of bound” refers to a nucleic acid that is stably bound to a solid activated T-cells 5, tonicity-responsive: MRPS6, mitochon Substrate to forman array via covalent bonds, hydrogen bonds drial ribosomal protein S6; AUH, AU RNA binding protein/ or ionic interactions such that the nucleic acid retains its enoyl-Coenzyme A hydratase; MID1 IP1, MID1 interacting unique pre-selected position relative to all other nucleic acids protein 1 (gastrulation specific G12 homolog (Zebrafish)); that are stably associated with an array, or to all other pre RGS16, regulator of G-protein signaling 16; MARCH7. selected regions on the Solid Substrate under conditions in membrane-associated ring finger (C3HC4) 7: NR3C1, which an array is typically analyzed (i.e., during one or more nuclear receptor Subfamily 3, group C, member 1 (glucocor steps of hybridization, washes, and/or scanning, etc.). ticoid receptor); ELF1, E74-like factor 1 (ets domain tran 0094. As used herein, “substrate” or “support” or “solid scription factor); RPS6KB1, ribosomal protein S6 kinase, 70 Support', when referring to an array, refers to a material kDa, polypeptide 1: STAT5A, signal transducer and activator having a rigid or semi-rigid surface. The Support may be of transcription 5A:YTHDF3, YTH domain family, member biological, non-biological, organic, inorganic, or a combina 3; DNAJC12, DnaJ (Hsp40) homolog, subfamily C, member tion of any of these, existing as particles, strands, precipitates, 12; IFI44L, interferon-induced protein 44-like; SARS, seryl gels, sheets, tubing, spheres, beads, containers, capillaries, tRNA synthetase; SMURF2, SMAD specific E3 ubiquitin pads, slices, films, plates, slides, chips, etc. Often, the Sub protein ligase 2; SFRS18 (C6orf111), splicing factor, argin strate is a silicon or glass surface, (poly) tetrafluoroethylene, ine?serine-rich 18; NR4A2, nuclear receptor subfamily 4, (poly) vinylidendifluoride, polystyrene, polycarbonate, a group A, member 2: CDKN1B, cyclin-dependent kinase charged membrane. Such as nylon or nitrocellulose, or com inhibitor 1B (p27, Kip1); and EIF3D, eukaryotic translation binations thereof. Preferably, at least one surface of the sub initiation factor 3, subunit D, as set forth in Table 4. strate will be substantially flat. The support may optionally 0099. In specific embodiments, the detecting amino acid contain reactive groups, including, but not limited to, car molecules are isolated antibodies, with each antibody binding boxyl, amino, hydroxyl, thiol, and the like. In one embodi selectively to a protein product of at least one of the at least six ment, the Support may be optically transparent. marker genes. Using these antibodies, the level of expression 0095. It should be noted that other nucleic acid based of the at least six marker genes is determined using an immu assays may be used for quantitative measurement of the noassay which is selected from the group consisting of an marker genes expression level. For example, Nuclease pro ELISA, a RIA, a slot blot, a dot blot, immunohistochemical tection assays (including both ribonuclease protection assays assay, FACS, a radio-imaging assay and a Western blot. and S1 nuclease assays) can be used to detect and quantitate 0100. According to certain embodiments, the specific the RNA products of the marker genes of the invention. In antibodies may be used by the invention for determining the nuclease protection assays, an antisense probe (labeled with, level of expression of at least six, at least seven, at least eight, e.g., radiolabeled or nonisotopic) hybridizes in Solution to an at least nine, at least ten, at leasteleven, at least twelve, at least RNA sample. Following hybridization, single-stranded, thirteen, at least fourteen, at least fifteen, at least sixteen, at unhybridized probe and RNA are degraded by nucleases. An least seventeen, at least eighteen, at least nineteen or at least acrylamide gel is used to separate the remaining protected twenty of the twenty marker genes listed in Table 4, in a fragments. biological test sample of a mammalian Subject. 0096. It should be further noted that a standard Northern 0101. In yet other embodiments, the specific antibodies blotassay can also be used to ascertain an RNA transcript size may be used by the invention for determining the level of and the relative amounts of RNA products of the marker gene expression of at least six, at least seven, at least eight, at least of the invention, in accordance with conventional Northern nine, at least ten, at least eleven, at least twelve, at least hybridization techniques known to those persons of ordinary thirteen, at least fourteen, at least fifteen, at least sixteen, at skill in the art. least seventeen, or at least eighteen of the eighteen marker 0097. The invention further contemplates the use of amino genes listed in Table 7, in a biological test sample of a mam acid based molecules such as proteins or polypeptides as malian Subject. detecting molecules disclosed herein and would be known by 0102. In other embodiments, the specific antibodies may a person skilled in the art to measure the protein products of be used by the invention for determining the level of expres the marker genes of the invention. Techniques known to per sion of at least six, at least seven, at least eight, at least nine, Sons skilled in the art (for example, techniques such as West at least ten, at least eleven, at least twelve or at least thirteen, ern Blotting, Immunoprecipitation, ELISAS, protein microar of the thirteen marker genes listed in Table 8, in a biological ray analysis and the like) can then be used to measure the level test sample of a mammalian Subject. of protein products corresponding to the marker genes of the 0103) As indicated above, the specific antibodies used by invention. As would be understood to a person skilled in the the invention selectively bind to the protein product of the US 2010/0267,569 A1 Oct. 21, 2010
marker genes. “selectively bind' in the context of proteins 0107. Where the detection molecule is an antibody, the encompassed by the invention refers to the specific interac expression of any of the marker genes may be determined tion of a any two of a peptide, a protein, a polypeptide an according to a specific embodiment, using an immunoassay antibody, wherein the interaction preferentially occurs as such as for example, an ELISA, a RIA, a slot blot, a dot blot, between any two of a peptide, protein, polypeptide and anti immunohistochemical assay, FACS, a radio-imaging assay or body preferentially as compared with any other peptide, pro a Western blot. It should be noted that any combination of tein, polypeptide and antibody. For example, when the two these assays may be also applicable. molecules are protein molecules, a structure on the first mol 0.108 Immuno-assays for a protein of interest typically ecule recognizes and binds to a structure on the second mol comprise incubating a biological sample of a detectably ecule, rather than to other proteins. “Selective binding', as the labeled antibody capable of identifying a protein of interest, term is used herein, means that a molecule binds its specific and detecting the bound antibody by any of a number of binding partner with at least 2-fold greater affinity, and pref techniques well-known in the art. erably at least 10-fold, 20-fold, 50-fold, 100-fold or higher 0.109 As discussed in more detail, below, the term affinity than it binds a non-specific molecule. “labeled can refer to direct labeling of the antibody via, e.g., 0104. As indicated above, according to some embodi coupling (i.e., physically linking) a detectable Substance to ment, the detecting molecules of the composition of the the antibody, and can also refer to indirect labeling of the invention may be an isolated and purified antibody specific antibody by reactivity with another reagent that is directly for the protein product of any of the marker genes used by the labeled. Examples of indirect labeling include detection of a invention. primary antibody using a fluorescently labeled secondary 0105. The term “antibody” also encompasses antigen antibody. binding fragments of an antibody. The term “antigen-binding 0110. It should be appreciated that all the detecting mol fragment of an antibody (or simply “antibody portion.” or ecules (either nucleic acid based oramino acid based) used by "fragment'), as used herein, refers to one or more fragments any of the compositions of the invention are isolated and/or of a full-length antibody that retain the ability to specifically purified molecules. As used herein, “isolated or “purified bind to a polypeptide encoded by one of the marker genes of when used in reference to a nucleic acid means that a naturally the invention, or the control reference genes. Examples of occurring sequence has been removed from its normal cellu binding fragments encompassed within the term “antigen lar (e.g., chromosomal) environment or is synthesized in a binding fragment of an antibody include (i) a Fab fragment, non-natural environment (e.g., artificially synthesized). Thus, a monovalent fragment consisting of the VLVH, CL and CHI an "isolated” or “purified” sequence may be in a cell-free domains; (ii) a F(ab')2 fragment, a bivalent fragment com solution or placed in a different cellular environment. The prising two Fab fragments linked by a disulfide bridge at the term “purified' does not imply that the sequence is the only hinge region; (iii) a Fd fragment consisting of the VH and nucleotide present, but that it is essentially free (about CH1 domains; (iv) a Fv fragment consisting of the VL and VH 90-95% pure) of non-nucleotide material naturally associated domains of a single arm of an antibody, (v) a dAb fragment, with it, and thus is distinguished from isolated chromosomes. which consists of a VH domain; and (vi) an isolated comple As used herein, the terms “isolated' and “purified in the mentarity determining region (CDR). Furthermore, although context of a proteinaceous agent (e.g., a peptide, polypeptide, the two domains of the Fv fragment, VL and VH, are coded protein or antibody) refer to a proteinaceous agent which is for by separate genes, they can be joined, using recombinant substantially free of cellular material and in some embodi methods, by a synthetic linker that enables them to be made as ments, Substantially free of heterologous proteinaceous a single protein chain in which the VL and VH regions pair to agents (i.e. contaminating proteins) from the cell or tissue form monovalent molecules (known as single chain FV source from which it is derived, or substantially free of chemi (scFV). Such single chain antibodies are also intended to be cal precursors or other chemicals when chemically synthe encompassed within the term “antigen-binding fragment of sized. The language “substantially free of cellular material' an antibody. These antibody fragments are obtained using includes preparations of a proteinaceous agent in which the conventional techniques known to those with skill in the art, proteinaceous agent is separated from cellular components of and the fragments are screened for utility in the same manner the cells from which it is isolated or recombinantly produced. as are intact antibodies. The antibody is preferably monospe Thus, a proteinaceous agent that is Substantially free of cel cific, e.g., a monoclonal antibody, or antigen-binding frag lular material includes preparations of a proteinaceous agent ment thereof. The term “monospecific antibody” refers to an having less than about 30%, 20%, 10%, or 5% (by dry weight) antibody that displays a single binding specificity and affinity of heterologous proteinaceous agent (e.g. protein, polypep for a particular target, e.g., epitope. This term includes a tide, peptide, orantibody; also referred to as a “contaminating “monoclonal antibody' or “monoclonal antibody composi protein'). When the proteinaceous agent is recombinantly tion', which as used herein refer to a preparation of antibodies produced, it is also preferably substantially free of culture or fragments thereof of single molecular composition. medium, i.e. culture medium represents less than about 20%, 0106. It should be recognized that the antibody can be a 10%, or 5% of the volume of the protein preparation. When human antibody, a chimeric antibody, a recombinant anti the proteinaceous agent is produced by chemical synthesis, it body, a humanized antibody, a monoclonal antibody, or a is preferably substantially free of chemical precursors or polyclonal antibody. The antibody can be an intact immuno other chemicals, i.e., it is separated from chemical precursors globulin, e.g., an IgA, IgG, IgE, Ig|D, 1 gM or subtypes or other chemicals which are involved in the synthesis of the thereof. The antibody can be conjugated to a functional moi proteinaceous agent. Accordingly, such preparations of a pro ety (e.g., a compound which has a biological or chemical teinaceous agent have less than about 30%, 20%, 10%, 5% function. The antibody of the invention interacts with a (by dry weight) of chemical precursors or compounds other polypeptide, encoded by one of the marker genes of the than the proteinaceous agent of interest. Preferably, proteina invention, with high affinity and specificity. ceous agents disclosed herein are isolated. US 2010/0267,569 A1 Oct. 21, 2010
0111. As used herein the term “product of the marker 0114. According to one specific embodiment, the inven gene' or “products of the marker genes of the invention' tion provides a diagnostic composition for the detection of at refers to the RNA and/or the protein expressed by the marker least one mutation of BRCA1 gene in a biological sample of gene of the invention. In the case of RNA it refers to the RNA a subject. This particular diagnostic composition comprises at transcripts transcribed from the marker gene of the invention. least one isolated oligonucleotide or a collection of at least In the case of protein it refers to proteins translated from the two isolated oligonucleotides which specifically hybridizes genes corresponding to the marker gene of the invention. The to a nucleic acid sequence of RNA products of at least one “RNA product of a marker gene of the invention includes marker gene or a collection of at least two marker genes mRNA transcripts, and/or specific spliced variants of mRNA selected from the group consisting of AUH, AU RNA binding whose measure of expression can be used as a marker gene in protein/enoyl-Coenzyme A hydratase; RGS16, regulator of accordance with the teachings disclosed herein. The “protein G-protein signaling 16; MARCH7, membrane-associated product of a marker gene of the invention' includes proteins ring finger (C3HC4) 7: DNAJC12, DnaJ (Hsp40) homolog, translated from the RNA products of the marker genes of the subfamily C, member 12; IFI44L, interferon-induced protein invention. 44-like; SARS, seryl-tRNA synthetase; and SMURF2, 0112. As shown by the following examples, samples SMAD specific E3 ubiquitin protein ligase 2. obtained from carriers of mutations in at least one of BRCA1 0.115. It should be further appreciated that in case of detec and BRCA2 genes exhibit differential expression of at least tion of BRCA1 mutation, the marker gene may be selected one of said marker genes as compared to control samples from even a larger group of genes demonstrated by the inven obtained from non-carrier subjects. Therefore, the composi tion as having most consistent gene expression patterns tion of the invention may be used for detecting carriers of among all the samples. These genes are represented by genes BRCA1 and BRCA2 gene mutations. Thus, the invention 1 to 16 of the list disclosed by Table 2. In yet another embodi further provides a diagnostic composition for the detection of ment, marker genes for BRCA1 gene mutations may be at least one mutation in at least one of BRCA1 and BRCA2 selected form genes exhibiting differential expression of genes in a biological sample of a mammalian Subject. This about 1.5 folds. Such genes may be selected from any of the particular diagnostic composition comprises at least one iso genes set forth in Table 5. lated oligonucleotide or a collection of at least two isolated 0116. In yet another alternative specific embodiment, the detecting oligonucleotides which specifically hybridizes to a invention provides a composition for the detection of at least nucleic acid sequence of RNA products of at least one marker one mutation of BRCA2 gene in a biological sample of said gene or a collection of at least two marker genes. More spe subject. This particular composition comprises at least one cifically, such marker genes may be selected from the group isolated oligonucleotide or a collection of at least two isolated consisting of RAB3GAP1, RAB3 GTPase activating protein oligonucleotides which specifically hybridizes to a nucleic subunit 1 (catalytic); NFAT5, nuclear factor of activated acid sequence of RNA products of at least one marker gene or T-cells 5, tonicity-responsive; MRPS6, mitochondrial riboso a collection of at least two marker genes selected from the mal protein S6: AUH, AU RNA binding protein/enoyl-Coen group consisting of RAB3GAP1, RAB3 GTPase activating Zyme A hydratase; MID1 IP1, MID1 interacting protein 1 protein subunit 1 (catalytic); NFAT5, nuclear factor of acti (gastrulation specific G12 homolog (Zebrafish)); RGS16, vated T-cells 5, tonicity-responsive: MRPS6, mitochondrial regulator of G-protein signaling 16; MARCH7, membrane ribosomal protein S6; MID1 IP1, MID1 interacting protein 1 associated ring finger (C3HC4) 7: NR3C1, nuclear receptor (gastrulation specific G12 homolog (Zebrafish); MARCH7. Subfamily 3, group C, member 1 (glucocorticoid receptor); membrane-associated ring finger (C3HC4) 7: NR3C1, ELF1, E74-like factor 1 (ets domain transcription factor); nuclear receptor Subfamily 3, group C, member 1 (glucocor RPS6KB1, ribosomal protein S6 kinase, 70 kDa, polypeptide ticoid receptor); ELF1, E74-like factor 1 (ets domain tran 1: STAT5A, signal transducer and activator of transcription scription factor); RPS6KB1, ribosomal protein S6 kinase, 70 5A: YTHDF3, YTH domain family, member 3: DNAJC12, kDa, polypeptide 1: STAT5A, signal transducer and activator DnaJ (Hsp40) homolog, subfamily C, member 12; IFI44L, of transcription 5A:YTHDF3, YTH domain family, member interferon-induced protein 44-like; SARS, seryl-tRNA syn 3; SFRS18 (C6orfl 11), splicing factor, arginine/serine-rich thetase: SMURF2, SMAD specific E3 ubiquitin protein 18; NR4A2, nuclear receptor subfamily 4, group A, member ligase 2; SFRS18 (C6orf111), splicing factor, arginine/ 2: CDKN1B, cyclin-dependent kinase inhibitor 1B (p27, serine-rich 18; NR4A2, nuclear receptor subfamily 4, group Kip1); and EIF3D, eukaryotic translation initiation factor 3, A, member 2: CDKN1B, cyclin-dependent kinase inhibitor subunit D. 1B (p27, Kip1); and EIF3D, eukaryotic translation initiation 0117. It should be further appreciated that in case of detec factor 3, subunit D, as set forth in Table 4. tion of BRCA2 mutations, the marker gene may be selected 0113. It should be noted that these marker genes were from even a larger group of genes demonstrated by the inven shown by the invention as exhibiting a differential expression tion as having most consistent gene expression patterns in lymphocytes from samples obtained from BRCA1 or among all the samples. These genes are represented by genes BRCA2 carriers under irradiation stress. Differential expres 17 to 37 of the list disclosed by Table 2. In yet another sion of at least one of the marker genes of the invention as embodiment, marker genes for BRCA2 gene mutations may compared to a control sample or alternatively, a control non be selected form genes exhibiting differential expression of carrier population or predetermined values of expression that about 2 folds. Such genes may be selected from any of the characterize non-carrier population, reflects the existence of genes set forth in Table 6. at least one mutation in any one of BRCA1 and BRCA2 and 0118. Some of the invention's particular embodiments may therefore be indicative of an increased genetic predispo describe the composition for the detection of at least one sition of said Subject to a cancerous disorder, disease or con mutation in at least one of BRCA1 and BRCA2 genes in a dition associated with mutations in any one of BRCA1 or biological test sample of a mammalian Subject, as comprising BRCA2. isolated detecting oligonucleotides, with each oligonucle US 2010/0267,569 A1 Oct. 21, 2010 otide specifically hybridizing to a nucleic acid sequences of genetic predisposition of the Subject to a cancerous disorder RNA products of at least one of at least six marker genes associated with mutations in any one of BRCA1 and BRCA2 selected from the group consisting of: MRPS6, mitochondrial genes. ribosomal protein S6; CDKN1B, cyclin-dependent kinase I0120 Still another embodiment the composition for the inhibitor 1B (p27, Kip1); ELF1, E74-like factor 1 (ets domain detection of at least one mutation in at least one of BRCA1 transcription factor); NFAT5, nuclear factor of activated and BRCA2 genes in a biological test sample of a mammalian T-cells 5, tonicity-responsive; NR3C1, nuclear receptor sub Subject, comprises isolated detecting oligonucleotides, each family 3, group C, member 1 (glucocorticoid receptor); oligonucleotide specifically hybridizes to a nucleic acid SARS, seryl-tRNA synthetase; SMURF2, SMAD specific E3 sequences of RNA products of at least one of the at least six ubiquitin protein ligase 2: STAT5A, signal transducer and marker genes. According to this particular embodiment, said activator of transcription 5A;YTHDF3, YTH domain family, at least six marker genes are selected from the group consist member 3; AUH, AU RNA binding protein/enoyl-Coenzyme ing of: MRPS6, mitochondrial ribosomal protein S6; A hydratase: EIF3D, eukaryotic translation initiation factor 3, CDKN1B, cyclin-dependent kinase inhibitor 1B (p27, Kip1); subunit D; IFI44L, interferon-induced protein 44-like: ELF1, E74-like factor 1 (ets domain transcription factor); NR4A2, nuclear receptor subfamily 4, group A, member 2: NFAT5, nuclear factor of activated T-cells 5, tonicity-respon RAB3GAP1, RAB3 GTPase activating protein subunit 1 sive; NR3C1, nuclear receptor subfamily 3, group C, member (catalytic); MID1 IP1, MID1 interacting protein 1 (gastrula 1 (glucocorticoid receptor); SARS, seryl-tRNA synthetase: tion specific G12 homolog (Zebrafish)); RGS16, regulator of SMURF2, SMAD specific E3 ubiquitin protein ligase 2: G-protein signaling 16: MARCH7, membrane-associated STAT5A, signal transducer and activator of transcription 5A; ring finger (C3HC4) 7; SFRS18 (C6orfl 11), splicing factor, YTHDF3, YTH domain family, member 3: AUH, AU RNA arginine/serine-rich 18; RPS6KB1, ribosomal protein S6 binding protein/enoyl-Coenzyme A hydratase: EIF3D, kinase, 70 kDa, polypeptide 1; and DNAJC12. DnaJ (Hsp40) eukaryotic translation initiation factor 3, subunit D: IFI44L, homolog, subfamily C, member 12, as set forth in Table 4. interferon-induced protein 44-like; and NR4A2, nuclear The aforementioned detecting oligonucleotide molecules are receptor Subfamily 4, group A, member 2, as set forth in Table used for determining the level of expression of at least six 8. It should be noted that the detecting oligonucleotide mol marker genes in the test sample. As shown in Table 5, a ecules are used for determining the level of expression of the differential expression of at least six Such genes in the test at least six marker gene in a sample. It should be further noted sample as compared to a control population is indicative of at that a differential expression of at least six of the marker genes least one mutation in at least one of BRCA1 and BRCA2 in the test sample as compared to a control population is genes in the Subject, and thereby of an increased genetic indicative of at least one mutation in at least one of BRCA1 predisposition of the Subject to a cancerous disorder associ and BRCA2 genes in the subject, and thereby of an increased ated with mutations in any one of BRCA1 and BRCA2 genes. genetic predisposition of the Subject to a cancerous disorder 0119. In another embodiment, the composition for the associated with mutations in any one of BRCA1 and BRCA2 detection of at least one mutation in at least one of BRCA1 genes. and BRCA2 genes in a biological test sample of a mammalian I0121. As indicated above, the diagnostic compositions of Subject comprises isolated detecting oligonucleotides. These the invention are specifically used for detection of at lease one oligonucleotide specifically hybridize to nucleic acid mutation in any one of BRCA1 and BRCA2 genes and com sequences of RNA products of at least one of at least six prise a nucleic acid based detection molecule. According to marker genes selected from the group consisting of: MRPS6, this embodiment, the expression of the marker genes may be mitochondrial ribosomal protein S6: CDKN1B, cyclin-de determined using a nucleic acid amplification assay selected pendent kinase inhibitor 1B (p27, Kip1); ELF1, E74-like from the group consisting of a Real-Time PCR, microarrays, factor 1 (ets domain transcription factor): NFAT5, nuclear PCR, in situ Hybridization and Comparative Genomic factor of activated T-cells 5, tonicity-responsive: NR3C1, Hybridization. nuclear receptor Subfamily 3, group C, member 1 (glucocor ticoid receptor); SARS, seryl-tRNA synthetase; SMURF2, I0122) According to another specific embodiment, the SMAD specific E3 ubiquitin protein ligase 2: STAT5A, signal composition of the invention may comprise detecting mol transducer and activator of transcription 5A:YTHDF3, YTH ecules specifically adopted for Real Time PCR assay as domain family, member 3: AUH, AU RNA binding protein/ described herein before. enoyl-Coenzyme A hydratase: EIF3D, eukaryotic translation I0123. It should be further appreciated that these specific initiation factor 3, subunit D: IFI44L, interferon-induced pro diagnostic compositions of the invention may alternatively tein 44-like; NR4A2, nuclear receptor Subfamily 4, group A, comprise an amino-acid based detecting molecules, for member 2: RAB3GAP1, RAB3 GTPase activating protein example, an isolated antibody. In Such case, the expression of subunit 1 (catalytic); MID1 IP1, MID1 interacting protein 1 the marker genes may be determined by immunoassays, as (gastrulation specific G12 homolog (Zebrafish)); RGS16, described above. regulator of G-protein signaling 16; MARCH7, membrane 0.124. According to a specific embodiment, the diagnostic associated ring finger (C3HC4)7; and SFRS18 (C6ORF111), composition of the invention may be used for detecting at splicing factor, arginine/serine-rich 18, as shown by the eigh least one mutation in any one of BRCA1 and BRCA2 genes. teen marker genes in Table 7. The detecting oligonucleotide Existence of mutations in any of these genes may be indica molecules are used for determining the level of expression of tive of an increased genetic predisposition of a subject to a at least six marker genes in a sample. It should be further cancerous disorder associated with mutations in any one of noted that a differential expression of at least six Such genes BRCA1 and/or BRCA2. According to another embodiment, in the test sample as compared to a control population is this cancerous disorder may be breast, ovarian, pancreas or indicative of at least one mutation in at least one of BRCA1 prostate carcinoma. More specifically, Such carcinoma may and BRCA2 genes in the subject, and thereby of an increased be any one of breast carcinoma and ovarian carcinoma. US 2010/0267,569 A1 Oct. 21, 2010
0.125 Thus, according to another embodiment, the com carcinoma. Ovarian cancer is the most common cause of position of the invention may be applicable for detection, and cancer death from gynecologic tumors in the United States. preferably for early detection of breast cancer. Breast cancer Early disease causes minimal, nonspecific, or no symptoms. is a cancer of the glandular breast tissue. Worldwide, breast Therefore, most patients are diagnosed in an advanced stage. cancer is the fifth most common cause of cancer death (after Overall, prognosis for these patients remains poor. Standard lung cancer, stomach cancer, liver cancer, and colon cancer). treatment involves aggressive debulking Surgery followed by In 2005, breast cancer caused 502,000 deaths (7% of cancer chemotherapy. deaths; almost 1% of all deaths) worldwide. Among women 0.133 Ovarian carcinoma can spread by local extension, worldwide, breast cancer is the most common cancer. It lymphatic invasion, intraperitoneal implantation, hematog should be indicated that pathological and clinical categories enous dissemination, and transdiaphragmatic passage. Intra of breast cancer are encompassed by the invention and peritoneal dissemination is the most common and recognized include ductal carcinoma (65-90%), Lobular carcinoma 10%, characteristic of ovarian cancer. Malignant cells can implant Inflammatory breast cancer, Medullary carcinoma of the anywhere in the peritoneal cavity but are more likely to breast, Colloid carcinoma, Papillary carcinoma and Meta implant in sites of stasis along the peritoneal fluid circulation. plastic carcinoma. 0.134. It should be noted that in some embodiments, the 0126 Early breast cancer can in some cases present as marker genes of the invention or any polypeptides and/or breast pain (mastodynia) or a painful lump. Since the advent polynucleotides derived therefrom may be used in the diag of breast mammography, breast cancer is most frequently nosis of ovarian cancer, alone or in combination with one or discovered as an asymptomatic nodule on a mammogram, more polypeptides and/or polynucleotides of this invention, before any symptoms are present. A lump under the arm or and/or in combination with known markers for ovarian can above the collarbone that does not go away may be present. cer, including but not limited to CEA, CA125 (Mucin 16), When breast cancer associates with skin inflammation, this is CA72-4TAG, CA-50, CA 54-61, CA-195 and CA 19-9 in known as inflammatory breast cancer. In inflammatory breast combination with CA-125, and/or in combination with the cancer, the breast tumor itself is causing an inflammatory known protein(s) associated with the indicated polypeptide or reaction of the skin, and this can cause pain, Swelling, polynucleotide, as described herein. warmth, and redness throughout the breast. Changes in the 0.135 According to another embodiment, the diagnostic appearance or shape of the breast can raise Suspicions of composition of the invention may be used for detection of breast cancer. prostate carcinoma. Prostate cancer is an important growing 0127. Another reported symptom complex of breast can health problem, presenting a challenge to urologists, radiolo cer is Paget’s disease of the breast. This syndrome presents as gists, and oncologists. Prostate cancer is the most common eczematoid skin changes at the nipple, and is a late manifes nondermatologic cancer, yet despite this frequent occurrence, tation of an underlying breast cancer. the clinical course is often unpredictable. Most prostate can 0128 Most breast symptoms do not turn out to represent cers are slow growing and do not manifest themselves during underlying breast cancer. Benign breast diseases such as the man's lifetime. Approximately 95% of prostate cancers fibrocystic mastopathy, mastitis, functional mastodynia, and are adenocarcinomas that develop in the acini of the prostatic fibroadenoma of the breast are more common causes of breast ducts. Other rare histopathologic types of prostate cancer symptoms. The appearance of a new breast symptom should occur in approximately 5% of patients, these include Small be taken seriously by both patients and their doctors, because cell carcinoma, mucinous carcinoma, endometrioid carci of the possibility of an underlying breast cancer at almost any noma (prostatic ductal carcinoma), transitional cell carci age. noma, squamous cell carcinoma, basal cell carcinoma, 0129 Occasionally, breast cancer presents as metastatic adenoid cystic carcinoma (basaloid), signet-ring cell carci disease, that is, cancer that has spread beyond the original noma, and neuroendocrine carcinoma. organ. Metastatic breast cancer will cause symptoms that 0.136 Still further, the composition of the invention may depend on the location of metastasis. be useful for the diagnosis of pancreatic carcinoma. 0130. Moreover, it should be noted that each marker gene 0.137 Pancreatic cancer is the fourth leading cause of of the present invention, is described herein as a marker for death from cancer in the United States. The disease is slightly detection of carriers of BRCA1 or BRCA2 gene mutations, more common in men than in women, and risk increases with and therefore may be regarded as a potential marker for breast age. cancer. The marker genes of the invention might optionally be 0.138. The cause is unknown, but it is more common in used alone or in combination with one or more other breast Smokers and in obese individuals. There is controversy as to cancer marker genes described herein, and/or in combination whether type 2 diabetes is a risk factor for pancreatic cancer. with known markers for breast cancer, including but not lim A Small number of cases are known to be related to Syn ited to Calcitonin, CA15-3 (Mucin 1), CA27-29, TPA, a com dromes that are passed down through families. Pancreatic bination of CA 15-3 and CEA, CA. 27.29 (monoclonal anti cancers can arise from both the exocrine and endocrine por body directed against MUC1), Estrogen 2 (beta), HER-2 tions of the pancreas. Of pancreatic tumors, 95% develop (c-erbB2), and/or in any combination thereof. from the exocrine portion of the pancreas, including the duc 0131. It should be therefore appreciated that in certain tal epithelium, acinar cells, connective tissue, and lymphatic embodiments, where at least six marker genes are used, these tissue. marker genes may be also combined with one or more other 0.139. According to certain embodiments of the present breast cancer marker genes described herein, and/or in com invention, any marker gene according to the present invention bination with known markers for breast cancer indicated may optionally be used alone or in combination. Such a above. combination may optionally comprise a plurality of marker 0.132. In yet another embodiment, the compositions of the genes described herein, optionally including any Sub-combi invention may be applicable for the diagnosis of ovarian nation of marker genes, and/or a combination featuring at US 2010/0267,569 A1 Oct. 21, 2010
least one other marker genes, for example a known marker least fourteen, at least fifteen, at least sixteen, at least seven gene. Furthermore, such a combination may optionally and teen, or at least eighteen of the eighteen marker genes listed in preferably be used as described above with regard to deter Table 7. mining a ratio between a quantitative or semi-quantitative 0146 In yet another embodiment, the diagnostic compo measurement of any marker gene described herein to any sition of the invention may comprise detecting molecules other marker gene described herein, and/or any other known specific for at least six, at least seven, at least eight, at least marker gene, and/or any other marker. As used herein, “a nine, at least ten, at least eleven, at least twelve or at least plurality of “a collection of “a combination of or “a set of thirteen, of the thirteen marker genes listed in Table 8. refers to more than two, for example, 3 or more, 4 or more, 5 0.147. It should be noted that preferred detecting mol or more, 6 or more, 7 or more, 8 or more, 9 or more and 10 or ecules may be probes and primers derived from these genes. more. The present invention thus encompasses any combina More specifically, such primers and probes are suitable for Real-Time RT-PCR reaction, specifically, the TaqMan(R) reac tion of the genes described by Table 4. For example, a com tion as described by the examples. According to a particularly bination of 11 or more, 12 or more, 13 or more, 14 or more, 15 specific embodiment, Such primers and probes may be or more, 16 or more, 17 or more, 18 or more, 19 or more and derived from any of the amplicons as presented by Table 4. 20 or more genes. 0.148. In yet another optional embodiment, any of the com 0140. According to certain embodiments, the composition positions of the invention may further comprise at least one of the invention may be used for determining the expression detecting molecule or a collection of at least two detecting of at least six marker genes. In one particular embodiment, the molecules specific for determination of the expression of at composition of the invention may be used for determining the least one control reference gene. Such reference control genes expression of at least six, at least seven, at least eight, at least may be for example, RPS9, HSPCB, Eukaryotic 18S-rRNA nine, at least ten, at least eleven, at least twelve, at least and B-actin. thirteen, at least fourteen, at least fifteen, at least sixteen, at 014.9 Thus, in certain embodiments, the compositions of least seventeen, at least eighteen, at least nineteen or at least the invention may further comprise detecting molecules spe twenty of the twenty marker genes listed in Table 4, in a cific for control reference genes. Such genes may be used for biological test sample of a mammalian Subject. normalizing the detected expression levels for each of the 0141. In another particular embodiment, the composition marker genes. of the invention may be used for determining the expression 0150. The present invention can point at mechanistically of at least six, at least seven, at least eight, at least nine, at least important genes involved with the use of radiation therapy for ten, at least eleven, at least twelve, at least thirteen, at least treating breast cancer. Loss of one allele of BRCA1 leads to fourteen, at least fifteen, at least sixteen, at least seventeen, or impaired repair of double strand breakage (DSB) and sensi at least eighteen of the eighteen marker genes listed in Table tivity to ionization caused by irradiation. DSB repair defi 7, in a biological test sample of a mammalian Subject. ciency could lead to cell death by apoptosis. However, haplo insufficient BRCA1 cells often escape cell death and develop 0142. In yet another particular embodiment, the composi tumors. This may be due to spontaneous hyper-recombina tion of the invention may be used for determining the expres tion, triggering genome instability Cousineau, I. and Bel sion of at least six, at least seven, at least eight, at least nine, maaza, A. Cell Cycle 6(8):962-971 (2007). BRCA1 het at least ten, at least eleven, at least twelve or at least thirteen, erozygous female mice had a higher incidence of ovarian of the thirteen marker genes listed in Table 8, in a biological tumors after irradiation without losing the second BRCA1 test sample of a mammalian Subject. allele Jeng, Y. M. et al. Oncogene 26(42):6160-6166 (2007). 0143 According to one optional embodiment, the compo Moreover, reduction in BRCA1 protein impairs homologous sitions described by the invention or any components thereof, recombination (HR) processes Cousineau, I. and Belmaaza, specifically, the detecting molecules may be attached to a A. (2007) ibid., indicating that haplo-insufficiency alone can Solid Support. The Solid Support may include polymers. Such compromise genome stability and lead to additional cancer as polystyrene, agarose, Sepharose, cellulose, glass, glass causing mutations. The importance of early and cost-effective beads and magnetizable particles of cellulose or other poly detection and diagnosis of carriers of gene mutations in at mers. The Solid-Support can be in the form of large or Small least one of BRCA1 and BRCA2 by any of the compositions, beads, chips or particles, tubes, plates, or other forms. methods and kits of the invention is thus clear. 0144. A particular and non-limiting example of a diagnos 0151. Accordingly, in another aspect, the invention relates tic composition for detecting carriers of BRCA1 and BRCA2 to a method for the detection of at least one mutation in at least gene mutations, may comprises at least one or a collection of one of BRCA1 and BRCA2 genes in a biological test sample at least two detecting molecules specific for at least one of the of a mammalian Subject. The method of the invention com marker genes as set forth in Table 4. According to certain prises the steps of: (a) determining the level of at least one embodiments, the diagnostic composition of the invention marker gene in the test biological sample and optionally, in a may comprise detecting molecules specific for at least six, at Suitable control sample. In a particular embodiment, these least seven, at least eight, at least nine, at least ten, at least marker genes may be selected from the group consisting of eleven, at least twelve, at least thirteen, at least fourteen, at RAB3GAP1, RAB3 GTPase activating protein subunit 1 least fifteen, at least sixteen, at least seventeen, at least eigh (catalytic): NFAT5, nuclear factor of activated T-cells 5, teen, at least nineteen or at least twenty of the twenty marker tonicity-responsive; MRPS6, mitochondrial ribosomal pro genes listed in Table 4. tein S6; AUH, AU RNA binding protein/enoyl-Coenzyme A 0145. In another embodiment, the diagnostic composition hydratase; MID1 IP1, MID1 interacting protein 1 (gastrula of the invention may comprise detecting molecules specific tion specific G12 homolog (Zebrafish)); RGS16, regulator of for at least six, at least seven, at least eight, at least nine, at G-protein signaling 16; MARCH7, membrane-associated least ten, at least eleven, at least twelve, at least thirteen, at ring finger (C3HC4)7; NR3C1, nuclear receptor subfamily 3, US 2010/0267,569 A1 Oct. 21, 2010 group C, member 1 (glucocorticoid receptor); ELF1, E74 NR4A2, nuclear receptor Subfamily 4, group A, member 2; as like factor 1 (ets domain transcription factor); RPS6KB1, set forth in Table 8. Alternatively, these at least six marker ribosomal protein S6 kinase, 70 kDa, polypeptide 1: genes may be selected from (ii) that is the group of (i) further STAT5A, signal transducer and activator of transcription 5A; consisting of RAB3GAP1, RAB3 GTPase activating protein YTHDF3, YTH domain family, member 3: DNAJC12, DnaJ subunit 1 (catalytic); MID1 IP1, MID1 interacting protein 1 (Hsp40) homolog, subfamily C, member 12; IFI44L, inter (gastrulation specific G12 homolog (Zebrafish)); RGS16, feron-induced protein 44-like; SARS, seryl-tRNA syn regulator of G-protein signaling 16; MARCH7, membrane thetase: SMURF2, SMAD specific E3 ubiquitin protein associated ring finger (C3HC4)7; and SFRS18 (C6ORF111), ligase 2; SFRS18, splicing factor, arginine/serine-rich 18; splicing factor, arginine/serine-rich 18, as set forth in Table 7. NR4A2, nuclear receptor subfamily 4, group A, member 2: In yet another alternative embodiment, at least six marker CDKN1B, cyclin-dependent kinase inhibitor 1B (p27, Kip1); genes may be selected from group (iii) that is the group of (i) and EIF3D, eukaryotic translation initiation factor 3, subunit further consisting of RAB3GAP1, RAB3 GTPase activating D, as set forth in Table 4. The second step (b) involves deter protein subunit 1 (catalytic); MID1 IP1, MID1 interacting mining the level of expression of at least one control gene in protein 1 (gastrulation specific G12 homolog (Zebrafish)); the test sample and optionally in a Suitable control sample or RGS16, regulator of G-protein signaling 16; MARCH7. population. According to a specific embodiment, the control membrane-associated ring finger (C3HC4) 7; and SFRS18 gene may be at least one of RPS9, HSPCB, Eukaryotic 18S (C60RF111), splicing factor, arginine/serine-rich 18; rRNA and B-actin. The third step (c) involves comparing the RPS6KB1, ribosomal protein S6 kinase, 70 kDa, polypeptide level of expression as obtained by step (a) of each of the 1; and DNAJC12, DnaJ (Hsp40) homolog, subfamily C, marker genes in the test sample with the level of expression in member 12, as set forth in Table 4. The next step (b), involves the control sample or with predetermined expression levels or determining the level of expression or the expression value of values of a control non-carrier population; and optionally (d) at least one control gene in the test sample and optionally, in comparing the level of expression as obtained by step (b) of a suitable control sample. It should be appreciated that the each of the control reference genes in the test sample with the method of the invention further comprises the step of normal level of expression in the control sample or with predeter izing the level of expression or the expression value of the mined expression levels or values of a control non-carrier marker genes obtained in step (a) with the level of expression population. of control reference genes obtained in step (b) and thereby 0152. It should be appreciated that the detection of a dif obtaining a normalized expression value of each marker gene ference in the level of expression of at least one of the marker in the test sample. The next step (c) involves comparing the genes in the test sample as compared to a control sample normalized expression values obtained in steps (a) and (b) of according to step (c) may indicate that the test Subject is a each marker gene in the test sample with a corresponding carrier of at least one mutation in at least one of BRCA1 and predetermined cutoff value of each marker gene. The follow BRCA2 genes. Moreover, it should be noted that were control ing step (d) involves determining whether the normalized genes are also examined, detection of no difference in the expression value of each marker gene is positive and thereby level of expression of the control genes in the test sample as belongs to a pre-established carrier population or is negative compared to the control sample according to step (d), and a and thereby belongs to a pre-established non-carrier popula differential expression of the marker genes, even reinforce the tion. The presence of at least six marker genes with a positive indication that the test sample is of a carrier of BRCA1 or normalized expression value indicates that the Subject is a BRCA2 gene mutation. carrier of at least one mutation of at least one of BRCA1 or 0153. As explained earlier, the inventors have analyzed the BRCA2 gene. marker gene expression values further and discovered spe 0154 According to certain embodiments a “positive cific cutoff values for each gene, a deviation from which of at result may be determined where a normalized value of a least six said marker genes is indicative of an increased like specific marker gene is lower than the cutoff value. In Such lihood of the presence of BRCA1 or BRCA2 mutations in a cases, the specific examined marker gene being down-regu tested subject. Therefore, another aspect of the invention lated in the established pre-determined carrier population, contemplates a method for the detection of at least one muta and therefore, any normalized value higher than the cutoff tion in at least one of BRCA1 and BRCA2 genes in a biologi value, indicates that the examined sample belongs to non cal test sample of a mammalian Subject, the method compris carrier Subject. ing the steps of (a) determining the level of expression of at 0155 According to other alternative embodiments, a nor least six marker genes in the test sample and optionally in a malized value obtained for a specific marker gene that is Suitable control sample. According to specific embodiments, higher than the cutoff value may be determined as “positive' said at least six marker genes may be selected from any one in case said gene being overexpressed in BRCA1 or BRCA2 of: (i) a group consisting of: MRPS6, mitochondrial riboso mutation carrier population. Therefore, any normalized value mal protein S6; CDKN1B, cyclin-dependent kinase inhibitor that is lower than the cutoff, indicates that said subject 1B (p27, Kip1); ELF1, E74-like factor 1 (ets domain tran belongs to the non-carrier population. scription factor); NFAT5, nuclear factor of activated T-cells 5, 0156. As used herein, the term “expression value”, “level tonicity-responsive; NR3C1, nuclear receptor subfamily 3, of expression” or “expression level” refers to numerical rep group C, member 1 (glucocorticoid receptor); SARS, Seryl resentation of a quantity of a gene product, which herein is tRNA synthetase; SMURF2, SMAD specific E3 ubiquitin any one of RNA and protein product. For example, gene protein ligase 2: STAT5A, signal transducer and activator of expression values measured in Real-Time Polymerase Chain transcription 5A;YTHDF3, YTH domain family, member 3: Reaction, sometimes also referred to as RT-PCR or quantita AUH, AU RNA binding protein/enoyl-Coenzyme A tive PCR (qPCR), represent luminosity measured in a tested hydratase: EIF3D, eukaryotic translation initiation factor 3, sample, where an intercalating fluorescent dye is integrated subunit D; IFI44L, interferon-induced protein 44-like; and into double-stranded DNA products of the qPCR reaction US 2010/0267,569 A1 Oct. 21, 2010
performed on reverse-transcribed sample RNA, i.e., test 0.161 It should be noted that the terms “sensitivity” and sample RNA converted into DNA for the purpose of the assay. “specificity’ are used herein with respect to the ability of one The luminosity is captured by a detector that converts the or more marker genes to correctly classify a sample as a signal intensity into a numerical representation which is said carrier sample or a non-carrier sample (a non-carrier sample expression value, in terms of RNA gene product. may be interchangeably referred to as a “normal”, “control”. or “healthy” sample), respectively. “Sensitivity” indicates the 0157 Another example is a microarray RNA assay, where, performance of the marker genes with respect to correctly according to one method, test sample RNA is conjugated to a classifying carrier samples. “Specificity' indicates the per fluorescent dye and allowed to specifically hybridize with formance of the marker genes with respect to correctly clas complementary oligonucleotide probes fixed in pre-deter Sifying non-carrier samples. mined positions on a stationary phase. After excess RNA is 0162 For an illustrative example, 84% specificity and washed away, a detector converts the luminosity of each 90% sensitivity for a panel of at least six marker genes used to bound fluorescent-dye conjugated RNA species to a numeri test a set of control and tumor samples indicates that 84% of cal representation, which are expression values. There are the control samples were correctly classified as control non also various methods for analysis of protein expression Val carrier samples by the panel, and 90% of the carrier sample ues. For example, in Some Enzyme-Linked Immunosorbent were correctly classified as carrier samples by the panel. assay (ELISA) methods, protein samples are incubated in 0163. It should be further noted that, for example, it is contact with antibodies fixed to a stationary phase and spe possible to determine the diagnostic efficiency (ratio of the cifically bind a protein of interest. Excess test sample is sum of the number of true positive cases and the number of washed away, and secondary antibodies, conjugated, for true negative cases to the total number of all cases examined) example, to a fluorescent dye, are incubated with the protein at each detected expression level, and use the expression level of interest bound to the fixed specific antibodies. Excess for the highest diagnostic efficiency as a cutoff value. In a secondary antibody is washed away, and a detector converts particular embodiment presented by Example 5 below, cutoff the luminosity of the bound secondary antibodies to a numeri values for thirteen of the marker genes were established cal representation of the gene expression value, in this case, in between non-carrier Subjects and carriers of mutations in terms of protein expression rather than RNA. Examples of BRCA1, BRCA2 or both as presented in Table 8. expression values are given in Table 9. 0164. As indicated above, the measured levels of expres 0158. It should be noted that a “cutoff value', sometimes sion of each of the examined marker genes are routinely referred to as "cutoff herein, is a value that meets the require normalized using data of expression levels of the control ments for both high diagnostic sensitivity (true positive rate) reference genes. The term “normalization” as used herein and high diagnostic specificity (true negative rate). Marker refers to any process that makes something more normal, gene expression level values that are higher or lower in com which typically means returning from Some state of abnor parison with said gene's corresponding cutoff value indicate mality. In general Scientific context, normalization is a pro that the examined sample belongs to a non-carrier or carrier cess by which a measurement raw data is converted into data populations, according to the specific criterion for said gene that may be directly compared with other so normalized data. and limited to the said sensitivity and specificity. In the context of the present invention, measurements of 0159 Cutoff values may be used as a control sample, said marker genes expression levels are prone to errors caused by, cutoff values being the result of a statistical analysis of marker for example, unequal degradation of measured samples, dif genes expression value differences in pre-established muta ferent loaded quantities per assay and other various errors. To tion non-carrier and carrier populations. overcome these errors, expression levels for control, stably 0160 The method of calculating a cutoff value is well expressed genes, are measured from the same sample from known in the relevant field. In the case of BRCA1/2 muta which the marker gene expression data is extracted. The tions, for example, marker genes expression levels are deter marker gene expression value is divided by the control gene mined in a large number of BRCA1, BRCA2 or BRCA1 and expression value yielding a normalized marker gene expres BRCA2 mutation carriers and non-carrier Subjects, the diag sion value, which is, in fact, marker gene expression value per nostic sensitivity and diagnostic specificity at each marker control gene expression value. Since control gene expression gene expression level are determined, and a ROC (Receiver values are equal in different samples, they constitute a com Operating Characteristic) curve is generated on the basis of mon reference point that is valid for Such normalization. these values using, for example, a commercially available (0165. The term “ROC or “Receiver Operator Character analytical Software program. Then, the marker gene expres istic' as used herein refers to a receiver operating character sion level for a diagnostic sensitivity and diagnostic specific istic (ROC), or simply ROC curve, a graphical plot of the ity as close to 100% as possible is determined, and this value sensitivity versus (1—specificity) for a binary classifier sys can be used as the cutoff value that distinguishes between a tem as its discrimination threshold is varied. The same graph population of carriers and a population of non-carriers. For can also be represented equivalently by plotting the fraction example, a diagnostic specificity of the cutoff value for each of true positives versus the fraction of false positives. ROC marker gene may be about 40%, 45%, 50%, 55%, 60%. 65%, analysis provides tools to select possibly optimal threshold 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% and values for binary discrimination and to discard Suboptimal 100%. In another embodiment, the diagnostic sensitivity of ones. In the context of this invention, ROC is used to select a the cutoff value for each marker gene may be about 40%, cutoff value for marker genes expression levels, a deviation 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, from which indicating a specific likelihood for the presence of 95%, 96%, 97%, 98%, 99% and 100%. Non-limiting at least one of BRCA1 and BRCA2 gene mutations is a tested examples for specificity and sensitivity of cutoff values of the Subject with optimal specificity and sensitivity. different marker genes of the invention are presented by Table (0166 The term “area under the curve' or “AUC” as used 8. herein refers to a ROC statistic or measure which can be US 2010/0267,569 A1 Oct. 21, 2010 interpreted as the probability that, for a specific test, when one using spotted oligonucleotide microarrays, while in this study randomly picks one positive and one negative example, the the Affymetrix microarray platform was used; and different classifier, or specific tested marker gene cutoff in this inven microarray systems are not always comparable to each other tion, will assign a higher score (indicating a carrier of at least Hardiman, G. Pharmacogenomics 5(5): 487-502 (2004). one of BRCA1 and BRCA2 gene mutations) to the positive 0171 Next, several statistical filters were applied to the example than to the negative. High AUC values are herein results. The first filter adjusted for a 5% false discovery rate, interpreted as better providing correct diagnosis of BRCA1 which left 596 differentially-expressed genes for BRCA2 and BRCA2 mutations in a tested subject. carriers (but could not be applied to differentially-expressed 0167 Thus, the term “specificity' as used herein refers to genes of BRCA1 carriers). Of the filtered genes, those with a the proportion of BRCA1/2 mutations non-carrier subjects minimum of a two-fold expression difference between the which are correctly identified (e.g. the percentage of normal, BRCA1 or BRCA2 groups and the control groups were non-carrier subjects of at least one of BRCA1 and BRCA2 selected, creating a set of 86 genes in BRCA1 carriers and 97 gene mutations, who are identified as not carrying the muta genes in BRCA2 carriers. Next, genes with the most repro tion). Conversely, the term “sensitivity” as used herein refers ducible pattern of expression in all samples within the same to the proportion of actual positive i.e., carriers of at least one group were selected. This process resulted in a list of a total of of BRCA1 and/or BRCA2 gene mutations which are cor 38 genes. The filtered results were subsequently analyzed rectly identified as Such (e.g. the percentage of carriers of at using RT-PCR, a reliable quantitative technique considered least one of BRCA1 and BRCA2 gene mutations who are the golden standard of RNA semi-quantitation. In this analy identified as carrying the mutation). It should be noted that the sis, seventeen samples in the BRCA1 group, ten from the term “BRCA1/2 indicates at least one of BRCA1, BRCA2 or BRCA2 group and twelve samples of non-carriers of muta both. tions were assayed. Five known housekeeping genes which 0168 The term “positive predictive value' as used herein were similarly expressed in the three groups were served as refers to the proportion of test subjects with positive test internal controls. In total, forty three genes were tested by results (i.e. diagnosed as carriers of at least one of BRCA1 TaqMan(R) gene cards RT-PCR. Of those, twenty genes were and BRCA2 gene mutations) that are correctly diagnosed. expressed differentially in a statistically-significant (p<0.05) Conversely, the “negative predictive value' as used herein is manner. The eighteen genes that demonstrated the most sig the proportion of test subjects with negative test results who nificant differential expression were chosen for validation are correctly diagnosed. and the calculated expression cutoff values for the chosen 0169. It is important to note that the specific group of genes were assessed for diagnostic value. Lymphocytes from genes selected herein for detection of carriers of mutations in twenty-one female carriers of BRCA1, BRCA2, or both and BRCA1 and/or BRCA2 was defined through a multi-stage 19 non-carriers were isolated, and the differential expression stringent process of filtration and validation, which included of the filtered marker gene group was assayed in irradiated a microarray analysis, three statistical filtration steps, versus non-irradiated cells. Through the use of a ROC curve repeated RT-PCR analysis, and validation of the results, thus analysis of the results obtained in said validation experiment, ensuring high confidence and reproducibility. Initially, a a further five candidate marker genes were discarded. Fur microarray analysis was used to identify differentially-ex thermore, the ROC analysis provided standardized expres pressed genes in irradiated versus non-irradiated lympho sion threshold values representing control sample marker cytes isolated from nine proven unaffected carriers of gene expression values that allowed comparison of the BRCA1, eight BRCA2 carriers and from ten non-carrier expression values of the test sample marker genes with said healthy women. MAS 5.0 and RMA algorithm were used to threshold values and demonstrated that the accumulation of at provide a baseline expression level and detection for each least six positive results as compared to said thresholds from probe set. For each probe set, the ratio between expression the thirteen rigorously-filtered marker genes indicated the level of the BRCA1 and/or BRCA2 mutation carriers and presence of a BRCA1 and BRCA2 mutation or mutations control samples was calculated and finally, ANOVA analysis with a sensitivity of about 75% to 100%, more specifically was used to single out the statistically-significant (ps 0.05) 80% to 98%, more specifically 85% to 96%, more specifically differentially-expressed genes. 137 probe sets in BRCA1 and 87% to 94%, more specifically 89% to 92%, particularly any 1345 probe sets in BRCA2 mutation carriers were so chosen. one of 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, Intriguingly, the expression patterns in the tested BRCA2 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, mutation group were highly conserved among all samples, 94%. 95%,96%.97%, 98%.99% and 99.9% sensitivity, and a while BRCA1 mutation carriers showed greater heterogene specificity of about 65% to 100%, more specifically 70% to ity in gene expression than in BRCA2 carriers. This could be 98%, more specifically 75% to 96%, more specifically 80% to explained by the numerous biological functions of the 94%, more specifically 82% to 92%, particularly any one of BRCA1 protein. 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 0170 The results set forth in the Examples herein are 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, slightly incongruous with the results of a previous study 85%. 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, aimed at BRCA1 and/or BRCA2 genotype prediction by 95%, 96%, 97%, 98%, 99% and 99.9%. In a specific illustra expression profiling in fibroblasts using spotted microarray tive example, the sensitivity may be about 90% and specific technology Kote-Jarai, Z. et al. Clin. Cancer Res. 12(13): ity may be about 84%. 3.896-901 (2006). That study inversely demonstrated a more 0172. It is interesting to note that according to a Gene consistent pattern of gene expression in the BRCA1 mutation Ontology analysis, the most differently expressed genes from carrier group. This apparent discrepancy could be explained BRCA1/2 mutation groups are related to a small number of by different molecular responses to the same injury agents in GO terms, namely: regulation pathways, DNA repair pro different tissues (i.e. fibroblasts vs. lymphocytes). Addition cesses, cell cycle regulation and cancer. STAT5 funnels extra ally, the previous study was based on expression analysis cellular signals of cytokines, hormones, and growth factors US 2010/0267,569 A1 Oct. 21, 2010
into transcriptional activity in the mammary gland. It causes 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or a ratio less than 1, for example tumorigenesis, but delays metastasis progression. Conse 0.9, 0.8, 0.6, 0.4, 0.3, 0.2, 0.1, 0.05 or 0.01. In another quently, STAT5 activity in breast-cancer specimens marks a embodiment of the invention, a nucleic acid transcript is better prognosis for survival Barash, I. J. Cell Physiol. 209 differentially expressed if the ratio of its level of expression in (2):305-313 (2006), and its radiation-induced increase likes a first sample as compared with the mean of the second notes a protective feedback reaction. Another gene, population is greater than or less than 1.0 and includes for RPS6KB1, a kinase, has been shown to be overexpressed in example, a ratio of greater than 1.2, 1.5, 1.7, 2, 3, 4, 5, 6, 7, 8, some breast cancer cell lines Sinclair, C. S. et al., Breast 9, 10, 20, or a ratio less than 1, for example 0.9, 0.8, 0.6,0.4, Cancer Res. Treat. 78(3):313-22 (2003). 0.3, 0.2, 0.1, 0.05 or 0.01. 0173 The analysis results provide an additional insight towards the role of the biological effect of heterozygous 0176 More specifically, “Differentially increased expres mutations in BRCA1 and BRCA2 genes in cellular response sion” or “up regulation” refers to genes which demonstrate at to irradiation DNA damage and constitute a molecular func least 10% or more, for example, 20%, 30%, 40%, or 50%, tional tool that can be used to predict the presence of 60%, 70%, 80%, 90% or more, or 1.1 fold, 1.2 fold, 1.4 fold, BRCA1/2 mutations in individual in a sensitive, simple, inex 1.6 fold, 1.8 fold, or more increase in gene expression (as pensive and easily obtained fashion. measured by RNA expression or protein expression), relative 0.174 As used herein in this specific embodiment, the term to a control sample. “marker gene' refers to a gene that is differentially regulated (0177) “Differentially decreased expression” or “down between a carrier or a population of carriers of mutations in regulation” refers to genes which demonstrate at least 10% or any one of BRCA1 or BRCA2 genes and a non-carrier indi more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, vidual or a population of non-carriers. 80%, 90% or a less than 1.0 fold, 0.8 fold, 0.6 fold, 0.4 fold, 0175 “Differentially expressed” can also include a mea 0.2 fold, 0.1 fold or less decrease in gene expression (as surement of the RNA or protein encoded by the marker gene measured by RNA expression or protein expression), relative of the invention in a sample or plurality of samples as com to a control. pared with the amount or level of RNA or protein expression 0178. It should be further noted that in case the expression in a second sample or population or plurality of samples, level of more than one marker gene is examined by the diag specifically, a control sample of non-carrier Subject. Differ nostic method of the invention, it may reflect and result in ential expression can be determined as described herein and “gene expression pattern” or “gene expression profile' of the as would be understood by a person skilled in the art. The term diagnosed individual. As used herein, a “gene expression “differentially expressed’ or “changes or difference in the pattern” or “gene expression profile' indicates the combined level of expression” refers to an increase or decrease in the pattern of the results of the analysis of the level of expression measurable expression level of a given marker gene as mea of at least one, preferably, at least two or more marker genes sured by the amount of RNA and/or the amount of protein in of the invention including 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, a sample as compared with the measurable expression level of 15, 16, 17, 18, 19, 20 or more or all of the markers of the a given marker gene in a second sample, specifically, a control invention. More specifically, at least one, at least two, at least sample. The term “differentially expressed’ or “changes or three, at least four, at least five, at least six, at least seven, at differences in the level of expression' can also refer to an least eight, at least nine, at least ten, at least eleven, at least increase or decrease in the measurable expression level of a twelve, at least thirteen, at least fourteen, at least fifteen, at given marker gene in a population of samples as compared least sixteen, at least seventeen, at least eighteen, at least with the measurable expression level of a marker gene in a nineteen or at least twenty of the twenty marker genes listed second population of samples, for example, a control sample in Table 4. In another embodiment, at least one, at least two, obtained from a non-carrier subject. As used herein, “differ at least three, at least four, at least five, at least six, at least entially expressed can be measured using the ratio of the seven, at least eight, at least nine, at least ten, at least eleven, level of expression of a given marker gene(s) as compared at least twelve, at least thirteen, at least fourteen, at least with the mean expression level of the given marker gene(s) of fifteen, at least sixteen, at least seventeen or at least eighteen a control sample wherein the ratio is not equal to 1.0. Differ of the eighteen marker genes listed in Table 7. According to entially expressed can also be measured using p-value. When another embodiment, at least one, at least two, at least three, using p-value, a marker gene is identified as being differen at least four, at least five, at least six, at least seven, at least tially expressed as between a first and second population eight, at least nine, at least ten, at least eleven, at least twelve when the p-value is less than 0.1. More preferably the p-value or at least thirteen, of the thirteen marker genes listed in Table is less than 0.05. Even more preferably the p-value is less than 8. According to one particular embodiment, 'gene expression 0.01. More preferably, the p-value is less than 0.005. Most profile’ indicates the combined pattern of the results of the preferably, the p-value is less than 0.001. When determining analysis of the level of expression of at least six marker genes differentially expression on the basis of the ratio, an RNA or selected from the group of marker genes indicated in any one protein is differentially expressed if the ratio of the level of of Tables 4, 7 or 8. A gene expression pattern or gene expres expressionina first sample as compared with a second sample sion profile can result from the measurement of expression of is greater than or less than 1.0. For example, a ratio of greater the RNA or protein products of the marker genes of the than 1.2, 1.5, 1.7, 2,3,4,5,6,7,8,9, 10, 20 or a ratio less than invention and can be done using any known technique. For 1, for example 0.8, 0.6,0.4,0.2, 0.1.0.05. In another specific example, techniques to measure expression of the RNA prod embodiment of the invention, a nucleic acid transcript is ucts of the marker genes of the invention includes, PCR based differentially expressed if the ratio of the mean of the level of methods (including RT-PCR) and non PCR based method as expression of a first population as compared with the mean well as micro-array analysis. To measure protein products of level of expression of the second population is greater than or the marker genes of the invention, techniques include western less than 1.0. For example, a ratio of greater than 1.2, 1.5, 1.7, blotting and ELISA analysis. US 2010/0267,569 A1 Oct. 21, 2010
0179 More particularly, according to this embodiment, be distinguished from each other by previously establishing determination of the expression of the marker genes as well as marker genes cutoff values and comparing the detected of the control genes may be performed by the following steps: marker gene expression level values to said cutoff values. 0180. The first step (i) involves providing an array com 0185. As indicated above, the different detecting mol prising: ecules of the invention are provided attached, comprised, or 0181 (A) at least one detecting nucleic acid or amino acid connected to an array. The term “array' as used by the meth molecule specific for determination of the expression of at ods and kits of the invention refers to an “addressed spatial least one of said marker genes. The detecting molecule may arrangement of the detecting molecules specific for the be a set of primers, a probe or both or alternatively or addi marker genes of (A) and, the detecting molecules specific for tionally, an antibody. It should be noted that each of said the control genes of (B). Each “address” of the array is a detecting molecules is located in a defined position in said predetermined specific spatial region containing a detecting array. This array further comprise (B) at least one detecting molecule. For example, an array may be a plurality of vessels nucleic acid or amino acid molecule specific for determina (test tubes), plates (or even different predetermined locations tion of the expression of at least one of the control genes. Each in one plate or one slide, micro-wells in a micro-plate each of the detecting molecules is located in a defined position in containing a different detecting molecule. An array may also the array. be any solid Support holding in distinct regions (dots, lines, 0182. The second step (ii), involves contacting aliquots of columns) different detecting molecules. The array preferably the test sample and particularly, nucleic acids (RNA samples) includes built-in appropriate controls, for example, regions or protein product prepared from the irradiated lymphocytes, without the sample, regions without any detecting molecules, and aliquots of the control samples with the detecting mol regions without either, namely with solvent and reagents ecules (primers, probes or both or antibodies) comprised in alone. Solid support used for the array of the invention will be said array of (i) under conditions allowing for detection of the described in more detail herein after, in connection with the expression of the marker genes and the control genes in both kits provided by the invention. the test and the optional the control samples. The third step 0186 Reference to “determining as used by the methods (iii), involves determining the level of the expression of the of the present invention, includes estimating, quantifying, marker genes and the control genes in the test and in the calculating or otherwise deriving a level of expression of the optional control samples by suitable means. Preferably, by marker or control genes by measuring an end point indication RealTime-PCR or micro-arrays, as indicated in detail herein that may be for example, the appearance of a detectable before. product. 0183. As stated earlier, gene expression “profiles' or “pat 0187. It should be appreciated that the detection step may terns have indeed been found by the inventors to correlate be performed using the tested sample as obtained from the with the presence of BRCA11 and/or 2 mutations in subjects. tested Subject, or alternatively, may be performed using any Hence, the method of detecting Such Subjects can be materi constituent or material derived or prepared therefrom. As a alized in various ways, for example, in a specific embodi non-limiting example, it should be noted that the method of ment, the determination of the level of expression of at least the invention further encompasses the use of nucleic acid six of the marker genes according to step (a) and of at least one molecules and or proteins prepared from the tested sample. of the control gene according to step (b), in a test sample and 0188 Thus, according to one preferred embodiment the optionally in a control sample is performed by a method detecting molecule used for the diagnostic method of the comprising the steps of (I) providing an array comprising: invention may be an isolated nucleic acid molecule or an (A) detecting molecules specific for determining the expres isolated amino acid molecule, or any combination thereof. sion of at least six of the marker genes, where each of the 0189 According to one alternative and specific embodi detecting molecules is located in a defined position in the ment, the method of the invention uses as detecting molecules array, and the detecting molecules are selected from isolated isolated nucleic acid molecules. More specifically, Such detecting nucleic acid molecules and isolated detecting nucleic acid molecule may be an isolated oligonucleotide amino acid molecules; and (B) at least one detecting molecule which specifically hybridizes to a nucleic acid sequence of the specific for determination of the expression of at least one of RNA products of at least one marker gene selected from the the control genes, where each of the detecting molecules is group consisting of RAB3GAP1, RAB3 GTPase activating located in a defined position in the array and where the detect protein subunit 1 (catalytic); NFAT5, nuclear factor of acti ing molecule is selected from isolated detecting nucleic acid vated T-cells 5, tonicity-responsive: MRPS6, mitochondrial molecule and isolated detecting amino acid molecule. The ribosomal protein S6; AUH, AU RNA binding protein/enoyl second step (II) involves contactingaliquots of the test sample Coenzyme A hydratase; MID1 IP1, MID1 interacting protein or any nucleic acid oramino acid productobtained therefrom, 1 (gastrulation specific G12 homolog (Zebrafish); RGS16, and optionally, aliquots of the control sample or any nucleic regulator of G-protein signaling 16; MARCH7, membrane acid or amino acid product obtained therefrom with the associated ring finger (C3HC4) 7: NR3C1, nuclear receptor detecting molecules comprised in the array of (I) under con Subfamily 3, group C, member 1 (glucocorticoid receptor); ditions allowing for detection of the expression of at least six ELF1, E74-like factor 1 (ets domain transcription factor); marker genes and the control genes in the test and optionally, RPS6KB1, ribosomal protein S6 kinase, 70 kDa, polypeptide in the control samples. Finally, step (III) determining the level 1: STAT5A, signal transducer and activator of transcription of the expression of the at least six marker genes and of at least 5A: YTHDF3, YTH domain family, member 3: DNAJC12, one control gene in the test and optionally, control samples DnaJ (Hsp40) homolog, subfamily C, member 12; IFI44L, contacted with detecting molecules comprised in the array of interferon-induced protein 44-like; SARS, seryl-tRNA syn (I) by suitable means. thetase: SMURF2, SMAD specific E3 ubiquitin protein 0184. In a specific mode of embodiment of the present ligase 2; SFRS18 (C60RF111), splicing factor, arginine/ invention, carriers of mutations in BRCA1 and BRCA2 can serine-rich 18; NR4A2, nuclear receptor subfamily 4, group US 2010/0267,569 A1 Oct. 21, 2010 20
A, member 2: CDKN1B, cyclin-dependent kinase inhibitor selectively to a protein product of at least one control refer 1B (p27, Kip1); and EIF3D, eukaryotic translation initiation ence gene. For example, RPS9, HSPCB, Eukaryotic 18S factor 3, subunit D, as set forth in Table 4. rRNA and B-actin. 0190. In another specific embodiment, the detecting 0198 According to a specifically preferred embodiment, nucleic acid molecules are isolated oligonucleotides and each the detecting molecule used by the method of the invention, oligonucleotide specifically hybridizes to a nucleic acid may be an isolated antibody and the marker genes expression sequence of the RNA products of at least one of the at least six may be determined using an immunoassay selected from the marker genes or of at least one of the control genes. group consisting of an ELISA, a RIA, a slot blot, a dot blot, 0191 It should be appreciated that further genes may immunohistochemical assay, FACS, a radio-imaging assay or serve as marker genes by the method of the invention. For a Western blot, as described herein before. example, any of the genes demonstrating a significant differ 0199. In yet another embodiment, the isolated detecting ential expression listed in Table 2. amino acid molecules are isolated antibodies, and each anti 0.192 Accordingly, the detecting molecule specific for the body binds selectively to a protein product of at least one of control reference genes may be therefore an isolated nucleic the at lest six marker genes or of the at least one control genes. acid molecule, and preferably, an isolated oligonucleotide 0200. According to a particular embodiment, the inven which specifically hybridizes to a nucleic acid sequence of the tion provides a specific method for the detection of at least RNA products of at least one control reference gene. one mutation of BRCA1 gene in a biological sample of a Examples for possible control genes may be RPS9, HSPCB, tested Subject. According to this particular embodiment, the Eukaryotic 18S-rRNA and B-actin. marker gene or a collection of at least two marker genes may be selected from the group consisting of AUH, AU RNA 0193 According to a specifically preferred embodiment, binding protein/enoyl-Coenzyme A hydratase; RGS16, regu the oligonucleotide used as a detecting molecule by the lator of G-protein signaling 16; MARCH7, membrane-asso method of the invention may be for example, a pair of prim ciated ring finger (C3HC4) 7: DNAJC12, DnaJ (Hsp40) ers, a nucleotide probe or any combination thereof. homolog, subfamily C, member 12; IFI44L, interferon-in 0194 In a specific embodiment, the primers and probes duced protein 44-like; SARS, seryl-tRNA synthetase; and used by the method of the invention may be selected from the SMURF2, SMAD specific E3 ubiquitin protein ligase 2. amplicons defined by Table 4. Nevertheless, it should be 0201 It should be further appreciated that in case of detec appreciated that any region of such marker genes may be used tion of BRCA1 mutation, the marker gene may be selected as an amplicon and therefore as a possible region for targeting from even a larger group of genes demonstrated by the inven primers and probes. tion as having most consistent gene expression patterns 0.195 Accordingly, the expression of the marker gene and among all the samples. These genes are represented by genes of the control reference gene may be determined according to 1 to 16 of the list disclosed by Table 2. In yet another embodi a preferred embodiment, using a nucleic acid amplification ment, marker genes for BRCA1 gene mutations may be assay such as Real Time PCR, micro arrays, PCR, in situ selected form genes exhibiting differential expression of Hybridization and Comparative Genomic Hybridization, as about 1.5 folds. Such genes may be selected from any of the described in detail herein before. genes set forth in Table 5. 0196. According to an alternative embodiment, the 0202 According to another particular embodiment, the method of the invention uses an isolated amino acid molecule invention provides a specific method for the detection of at as the detecting molecule. Such detecting molecule may be least one mutation of BRCA2 gene in a biological sample of therefore an isolated polypeptide which binds selectively to a tested Subject. According to this particular embodiment, the the protein product of at least one marker gene selected from marker gene or a collection of at least two marker genes may the group consisting of RAB3GAP1, RAB3 GTPase activat be selected from the group consisting of RAB3GAP1, RAB3 ing protein subunit 1 (catalytic); NFAT5, nuclear factor of GTPase activating protein subunit 1 (catalytic); NFAT5, activated T-cells 5, tonicity-responsive: MRPS6, mitochon nuclear factor of activated T-cells 5, tonicity-responsive; drial ribosomal protein S6; AUH, AU RNA binding protein/ MRPS6, mitochondrial ribosomal protein S6; MID1 IP1, enoyl-Coenzyme A hydratase; MID1 IP1, MID1 interacting MID1 interacting protein 1 (gastrulation specific G12 protein 1 (gastrulation specific G12 homolog (Zebrafish)); homolog (Zebrafish)); MARCH7, membrane-associated ring RGS16, regulator of G-protein signaling 16; MARCH7. finger (C3HC4) 7: NR3C1, nuclear receptor subfamily 3, membrane-associated ring finger (C3HC4) 7: NR3C1, group C, member 1 (glucocorticoid receptor); ELF1, E74 nuclear receptor Subfamily 3, group C, member 1 (glucocor like factor 1 (ets domain transcription factor); RPS6KB1, ticoid receptor); ELF1, E74-like factor 1 (ets domain tran ribosomal protein S6 kinase, 70 kDa, polypeptide 1: scription factor); RPS6KB1, ribosomal protein S6 kinase, 70 STAT5A, signal transducer and activator of transcription 5A; kDa, polypeptide 1: STAT5A, signal transducer and activator YTHDF3, YTH domain family, member 3: SFRS18 of transcription 5A:YTHDF3, YTH domain family, member (C60RF111), splicing factor, arginine/serine-rich 18; 3; DNAJC12, DnaJ (Hsp40) homolog, subfamily C, member NR4A2, nuclear receptor subfamily 4, group A, member 2: 12; IFI44L, interferon-induced protein 44-like; SARS, seryl CDKN1B, cyclin-dependent kinase inhibitor 1B (p27, Kip1); tRNA synthetase; SMURF2, SMAD specific E3 ubiquitin and EIF3D, eukaryotic translation initiation factor 3, subunit protein ligase 2; SFRS18 (C6ORF111), splicing factor, argi D nine/serine-rich 18; NR4A2, nuclear receptor subfamily 4, 0203. It should be further appreciated that in case of detec group A, member 2: CDKN1B, cyclin-dependent kinase tion of BRCA2 mutations, the marker gene may be selected inhibitor 1B (p27, Kip1); and EIF3D, eukaryotic translation from even a larger group of genes demonstrated by the inven initiation factor 3, subunit D, as set forth in Table 4. tion as having most consistent gene expression patterns 0.197 Accordingly, the detecting molecule for the control among all the samples. These genes are represented by genes reference genes may be an isolated polypeptide which binds 17 to 37 of the list disclosed by Table 2. In yet another US 2010/0267,569 A1 Oct. 21, 2010
embodiment, marker genes for BRCA2 gene mutations may rearrangements, antisense or missense mutations or any other be selected form genes exhibiting differential expression of modifications that render the products of said genes non about 2 folds. Such genes may be selected from any of the functional. Although non-carriers have a lower likelyhood to genes set forth in Table 6. develop breast cancer, ovarian, fallopian tube and prostate 0204 The present invention relates, in some embodi cancers, precancerous lesions (dysplasia) within the fallopian ments, to diagnostic assays, which in Some embodiments, tube or a Subset of leukemias and lymphomas as compared to utilizes a biological sample taken from a subject (patient or carriers, said non-carriers may present any of the above can healthy person, in Some embodiments or carrier or non-car certypes in the present or in the past, and may also not present rier Subject), which for example may comprise any biological any of the above cancer types in the present or in the past sample, Such as body fluid or secretion including but not 0207. According to a particular and specific optional limited to blood, blood cells such as lymphocytes, seminal embodiment, where the sample used comprises cells obtained plasma, serum, urine, prostatic fluid, seminal fluid, semen, from the tested subject, the method of the invention may the external Secretions of the skin, respiratory, intestinal, and comprise an additional step. The additional step includes genitourinary tracts, tears, cerebrospinal fluid, sputum, induction of DNA damage by treating the cells with an agent saliva, milk, peritoneal fluid, pleural fluid, cyst fluid, secre inducing Such damage. This may be performed by exposing tions of the breast ductal system (and/or lavage thereof), the cells to irradiation as demonstrated by the following broncho alveolar lavage, lavage of the reproductive system, examples. It should be noted that such additional step may be lavage of any other part of the body or system in the body, preferably performed as a preliminary step prior to determi samples of any organ including but not limited to lung, colon, nation of the expression levels or profile of the marker genes ovarian and/or breast tissue, feaces or a tissue sample, any or the control reference genes. Thus, according to a specific cells derived therefrom, or any combination thereof. In some embodiment, the sample used for the compositions, methods embodiments, the term encompasses samples of in vitro or ex and kits of the invention are irradiated lymphocytes obtained vivo cell culture or cell culture constituents. The sample can from a tested subject. optionally be diluted with a suitable eluant before contacting 0208 Thus, according to a specific and particular embodi the sample with the detecting molecule?s of the invention ment, the invention provides a method for the detection of at and/or performing any other diagnostic assay. least one mutation in at least one of BRCA1 and BRCA2 0205 As used herein, “patient”, “subject”, “carrier” or genes in a biological test sample of a mammalian Subject. “individual refers to a mammal, preferably human, that is According to this embodiment, the diagnostic method com diagnosed by the method of the invention. More specifically, prises the steps of: the term “carrier' or “carrier subject' as used herein refers to 0209 (a) providing a nucleic acid sample prepared from a person or organism whose genotype includes at least one lymphocytes of a tested mammalian Subject and optionally, a mutated allele of at least one of BRCA1 and BRCA2. Said nucleic acid sample obtained from lymphocytes of a Suitable mutations may be any one or a combination of deletions, control. It should be noted that in order to induce DNA dam insertions, truncations, rearrangements, antisense or mis age, the lymphocytes were irradiated prior to nucleic acid sense mutations or any other modifications that render the preparation; products of said genes non-functional. Said carrier may be a 0210 (b) determining the level of expression of at least symptomatic or an asymptomatic carrier, that is, the carrier one of the marker genesidentified by the invention, in said test may present pathophysiological signs as the result of said sample and optionally, in a suitable control sample. mutations, typically in the form of the development of breast 0211 Step (c) involves determining the level of expression cancer and in some cases other cancer types. Carriers have an of at least one control gene in said test sample and in a Suitable increased likelyhood of developing cancer, particularly breast control sample, wherein said at least one control gene may be cancer. For example, women carriers of an abnormal BRCA1 any one of RPS9, HSPCB, Eukaryotic 18S-rRNA and B-ac or BRCA2 gene have up to an 85% risk of developing breast cancer by age 70 and an increased risk of developing ovarian 0212 (d) comparing the level of expression as obtained by cancer, which is about 55% for women with BRCA1 muta step (b) of each of the marker genes in the test sample option tions and about 25% for women with BRCA2 mutations. In ally with the level of expression in the control sample; and (e) addition to breast cancer, mutations in the BRCA1 gene also comparing the level of expression as obtained by the optional increase the risk on ovarian, fallopian tube and prostate can step (c) of each of the control genes in said test sample cers. Moreover, precancerous lesions (dysplasia) within the optionally with the level of expression in the control sample. Fallopian tube have been linked to BRCA1 gene mutations. 0213. It should be appreciated that the expression level of Pathogenic mutations anywhere in a model pathway contain each of the marker genes in the test and optionally in the ing BRCA1 and BRCA2 greatly increase risks for a subset of control sample is normalized by comparing to the levels of the leukemias and lymphomas. The carrier may present any of the control reference genes. above cancer types in the present or in the past, and may also 0214. It should be noted that detecting a difference in the not present any of the above cancer types in the present or in level of expression, or as also indicated by the invention a the past. More specifically, according to certain embodi “differential expression of at least one of the marker genes in ments, a carrier is a non-symptomatic Subject that has never the test sample as compared to the control sample according presented or developed any proliferative disorder, particu to step (c), is indicative of that the tested subject is a carrier of larely the cancerous disorders indicated above. at least one mutation in at least one of BRCA1 and BRCA2 0206 Conversly, the term “non-carrier' or “non-carrier genes. Subject’ as used herein refers to a person or organism whose 0215. Alternatively, or in addition to comparison of the genotype does not include at least one mutated allele of at normalized levels of expression of any of the marker genes in least one of BRCA1 and BRCA2. Said mutations may be any the tested sample to the levels in a pre-determined control one or a combination of deletions, insertions, truncations, non-carrier sample, the levels of expression may be compared US 2010/0267,569 A1 Oct. 21, 2010 22 to a predetermined value representing each distinguished 0226. It should thus be appreciated that the method of the population. Such values may be represented by a cutoff value invention may provide early detection of such cancerous dis for each marker gene, that distinguish between a control orders. Therefore, the invention may be applicable and there non-carrier population and a carrier population. By compar fore provides a diagnostic method for the diagnosis, prefer ing the normalized expression values obtained for each ably, early detection of breast, ovarian, pancreas and prostate marker gene to said cutoff value, one can determine if the carcinoma, and particularly of breast carcinoma and ovarian tested Sample is of a carrier or of a non-carrier Subject. It carcinoma. should be noted that according to Example 5, “positive' result obtained for at least six marker genes adequately indicates 0227. It should be thus noted that this invention may pro that said sample is of a carrier subject. It should be noted that vides diagnostic methods optionally applicable in the selec a “positive result' is in the range of values detected for a tion of a particular therapy, or optimization of a given therapy predetermined carrier population for each marker gene. A for a disease, disorder or condition. “negative result” is in the range of values detected for a 0228 To facilitate convenience and ease of use of the predetermined non-carrier population for each marker gene. aforesaid method, the inventors contemplated a kit for the 0216. It should be further appreciated, that when the con detection of carriers of at least one mutation in BRCA1 or/and trol reference gene are also examined and compared to a BRCA2 genes. Thus, another aspect of the present invention non-carrier population, no difference in the level of expres contemplates a diagnostic kit comprising: sion of the control genes is expected when the tested sample 0229 (a) means for obtaining a sample of a mammalian is compared to a control sample according to step (d). There Subject; (b) at least one detecting molecule or a collection of fore, a differential expression in the marker genes and no at least two detecting molecules specific for determination of difference in the expression of the control genes, indicates the expression of at least one marker gene or a collection of at that the tested Subject is a carrier of at least one gene mutation least two marker genes selected from the group consisting of in at least one of BRCA1 and BRCA2. RAB3GAP1, RAB3 GTPase activating protein subunit 1 0217 More particularly, according to this embodiment, (catalytic): NFAT5, nuclear factor of activated T-cells 5, determination of the expression of the marker genes and of tonicity-responsive; MRPS6, mitochondrial ribosomal pro the control genes may be performed by the following steps: tein S6; AUH, AU RNA binding protein/enoyl-Coenzyme A 0218. The first step (i), involves providing an array com hydratase; MID1 IP1, MID1 interacting protein 1 (gastrula prising: tion specific G12 homolog (Zebrafish)); RGS16, regulator of 0219 (A) at least one detecting nucleic acid molecule G-protein signaling 16; MARCH7, membrane-associated specific for determination of the expression of at least one of ring finger (C3HC4)7; NR3C1, nuclear receptor subfamily 3, said marker genes. The detecting nucleic acid molecule may be a set of primers, a probe or both. It should be noted that group C, member 1 (glucocorticoid receptor); ELF1, E74 each of said detecting molecules is located in a defined posi like factor 1 (ets domain transcription factor); RPS6KB1, tion in said array; and optionally, ribosomal protein S6 kinase, 70 kDa, polypeptide 1: STAT5A, signal transducer and activator of transcription 5A; 0220 (B) at least one detecting nucleic acid molecule YTHDF3, YTH domain family, member 3: DNAJC12, DnaJ specific for determination of the expression of at least one of (Hsp40) homolog, subfamily C, member 12; IFI44L, inter the control genes. Each of the detecting nucleic acid mol feron-induced protein 44-like; SARS, seryl-tRNA syn ecules is located in a defined position in the array. thetase: SMURF2, SMAD specific E3 ubiquitin protein 0221. The second step (ii), involves contacting aliquots of ligase 2; SFRS18 (C60RF111), splicing factor, arginine/ the test sample and particularly, nucleic acids (RNA samples) serine-rich 18; NR4A2, nuclear receptor subfamily 4, group product prepared from the irradiated lymphocytes, and A, member 2: CDKN1B, cyclin-dependent kinase inhibitor optionally, aliquots of the control sample with the detecting 1B (p27, Kip1); and EIF3D, eukaryotic translation initiation nucleic acid molecules (primers, probes or both) comprised in factor 3, subunit D, as set forth in Table 4. (c) at least one said array of (i) under conditions allowing for detection of the detecting molecule or a collection of at least two detecting expression of the marker genes and the control genes in the molecules specific for determination of the expression of at test and optionally, the control samples; and least one control reference gene or a collection of at least two 0222. The third step (iii), involves determining the level of control reference genes. According to a specific embodiment, the expression of the marker genes and the control genes in these control reference genes may be selected from the group the test and optional control samples by suitable means. Pref consisting of RPS9, HSPCB, Eukaryotic 18S-rRNA and erably, by Real Time-PCR or micro-arrays, as indicated in 3-actin; (d) optionally, at least one control sample that may detail herein before. be at least one of a negative control sample and a positive 0223. It should be noted that the resulting expression val control sample; (e) instructions for carrying out the detection ues measured for each marker gene are normalized with the and quantification of expression of the marker genes and of expression values of a control reference gene to obtain a the control reference gene in the tested sample, and for nor normalized expression value for each marker gene examined. malizing the expression values measured for each marker 0224. It should be further noted that the detection of a gene with a control reference gene; carrier of at least one mutation in any one of BRCA1 or 0230 (f) instructions for evaluating the differential BRCA2 genes by the method of the invention may be an expression of the marker gene in the tested Sample and of a indicative of an increased genetic predisposition of the diag control reference gene in the sample as compared to the nosed subject to a cancerous disorder associated with at least expression of the marker gene and the control reference gene one mutation in at least one of BRCA1 and BRCA2 genes. in the optional control sample. 0225. Such cancerous disorders may be for example, 0231. It should be noted that the detecting molecule of the breast, ovarian, pancreas and prostate carcinoma. marker genes (b) or the control genes (c), may be provided by US 2010/0267,569 A1 Oct. 21, 2010
the kit of the invention attached, connected, embedded, expression of the at least six marker genes and of control linked, placed, glued or fused to a solid Support or to an array, genes in the test as compared to the expression of at least six as described herein before. marker genes and optionally control genes in the control 0232. As used herein, the term “control’ or “control sample. sample' includes positive or negative controls. In the context 0237. It should be recognized that the levels of expression of this invention the term “positive control refers to one or measured for each marker gene are normalized as indicated more samples isolated from an individual or group of indi herein before, with the levels of expression obtained for the viduals who are classified as carrier of mutations in any one of control marker genes. The present kit therefore may also BRCA1 or BRCA2 genes. The term “negative control” refers include instructions for Such normalization procedure. to one or more samples isolated from an individual or group 0238. In particular embodiments, the kits of the invention of individuals who are classified as non-carrier of mutations may also include cutoff tables, schematic plots, diagrams, in any one of BRCA1 or BRCA2 genes. software or other means that facilitate the evaluation of each 0233. According to an alternative or additional embodi marker gene normalized expression value and conversion of ment, instead of control samples, the kit of the invention may said at least six marker genes normalized expression values comprise a standard curve?'s illustrating the expression of the into an indication of the presence of at least one mutation in at marker genes and optionally of the control genes in predeter least one of BRCA1 and BRCA2 in a subject from which the mined positive or negative control samples, e.g. values tested Sample originates. For example, the kit may include a obtained from a population of carriers or values of expression computer program that manually or automatically receives obtained for population of non-carriers. marker genes and, optionally, control genes expression val 0234 Thus, as another more specific embodiment, the ues, optionally performs normalization, compares the nor invention provides a kit comprising: malized values to pre-determined cutoff values, counts the 0235 (a) means for obtaining a sample of a mammalian number of marker genes that exceed the corresponding cutoff Subject; (b) detecting molecules specific for determining the values and indicates whether the tested sample originates level of expression of at least six marker genes, wherein the from a carrier or non-carrier of at least one of BRCA1 and detecting molecules are selected from isolated detecting BRCA2 mutations. In another example, the kit includes a nucleic acid molecules and isolated detecting amino acid colored cutoff table that facilitates the conversion of said at molecules. According to this embodiment, at least six marker least six marker genes normalized expression values into an genes may be selected from any one of: indication of the presence of at least one mutation in at least 0236 (i) a group consisting of: MRPS6, mitochondrial one of BRCA1 and BRCA2 in a subject from which the tested ribosomal protein S6; CDKN1B, cyclin-dependent kinase sample originates by easily identifying values above and inhibitor 1B (p27, Kip1); ELF1, E74-like factor 1 (ets domain below specific marker gene cutoff values and providing a transcription factor); NFAT5, nuclear factor of activated Summation of the number of marker genes deviating from T-cells 5, tonicity-responsive; NR3C1, nuclear receptor sub said cutoffs, thus indicating the presence or absence of said family 3, group C, member 1 (glucocorticoid receptor); mutations. SARS, seryl-tRNA synthetase; SMURF2, SMAD specific E3 0239 According to one embodiment, the detecting mol ubiquitin protein ligase 2: STAT5A, signal transducer and ecules comprised within any of the kits of the invention may activator of transcription 5A;YTHDF3, YTH domain family, be isolated nucleic acid molecules or isolated amino acid member 3; AUH, AU RNA binding protein/enoyl-Coenzyme molecules, or any combination thereof. A hydratase: EIF3D, eukaryotic translation initiation factor 3, 0240 According to one specific and preferred embodi subunit D; IFI44L, interferon-induced protein 44-like; and ment, the detecting molecule comprised within the kit of the NR4A2, nuclear receptor Subfamily 4, group A, member 2, as invention may be an isolated nucleic acid molecule. Such set forth in Table 8, (ii) the group as defined in (i) further molecule may be preferably, an isolated oligonucleotide consisting of RAB3GAP1, RAB3 GTPase activating protein which specifically hybridizes to a nucleic acid sequence of the subunit 1 (catalytic); MID1 IP1, MID1 interacting protein 1 RNA products of at least one marker gene selected from the (gastrulation specific G12 homolog (Zebrafish)); RGS16, group consisting of RAB3GAP1, RAB3 GTPase activating regulator of G-protein signaling 16; MARCH7, membrane protein subunit 1 (catalytic); NFAT5, nuclear factor of acti associated ring finger (C3HC4)7; and SFRS18 (C6ORF111), vated T-cells 5, tonicity-responsive: MRPS6, mitochondrial splicing factor, arginine/serine-rich 18, as set forth in Table 7: ribosomal protein S6; AUH, AU RNA binding protein/enoyl (iii) the group as defined in (i) further consisting of Coenzyme A hydratase; MID1 IP1, MID1 interacting protein RAB3GAP1, RAB3 GTPase activating protein subunit 1 1 (gastrulation specific G12 homolog (Zebrafish); RGS16, (catalytic); MID1 IP1, MID1 interacting protein 1 (gastrula regulator of G-protein signaling 16; MARCH7, membrane tion specific G12 homolog (Zebrafish)); RGS16, regulator of associated ring finger (C3HC4) 7: NR3C1, nuclear receptor G-protein signaling 16: MARCH7, membrane-associated Subfamily 3, group C, member 1 (glucocorticoid receptor); ring finger (C3HC4) 7; and SFRS18 (C6ORF111), splicing ELF1, E74-like factor 1 (ets domain transcription factor); factor, arginine/serine-rich 18; RPS6KB1, ribosomal protein RPS6KB1, ribosomal protein S6 kinase, 70 kDa, polypeptide S6 kinase, 70 kDa, polypeptide 1; and DNAJC12, DnaJ 1: STAT5A, signal transducer and activator of transcription (Hsp40) homolog, subfamily C, member 12, as set forth in 5A: YTHDF3, YTH domain family, member 3: DNAJC12, Table 4; (c) at least one detecting molecule specific for deter DnaJ (Hsp40) homolog, subfamily C, member 12; IFI44L, mining the expression of at least one control gene; (d) option interferon-induced protein 44-like; SARS, seryl-tRNA syn ally, at least one control sample selected from a negative thetase: SMURF2, SMAD specific E3 ubiquitin protein control sample and a positive control sample; (e) instructions ligase 2; SFRS18 (C60RF111), splicing factor, arginine/ for carrying out the detection and quantification of expression serine-rich 18; NR4A2, nuclear receptor subfamily 4, group of the at least six marker genes and of at least one control gene A, member 2: CDKN1B, cyclin-dependent kinase inhibitor in the sample: (f) instructions for evaluating the differential 1B (p27, Kip1); and EIF3D, eukaryotic translation initiation US 2010/0267,569 A1 Oct. 21, 2010 24 factor 3, subunit D, as set forth in Table 4. It should be noted at least one marker gene selected from the group consisting that the marker genes may be also selected from any of the of RAB3GAP1, RAB3 GTPase activating protein subunit 1 genes listed in Table 2. (catalytic): NFAT5, nuclear factor of activated T-cells 5, 0241. It should be further noted that according to certain tonicity-responsive; MRPS6, mitochondrial ribosomal pro embodiments, the isolated detecting nucleic acid molecules tein S6; AUH, AU RNA binding protein/enoyl-Coenzyme A provided with the kit of the invention may be isolated oligo hydratase; MID1 IP1, MID1 interacting protein 1 (gastrula nucleotides. Each oligonucleotide specifically hybridizes to a tion specific G12 homolog (Zebrafish)); RGS16, regulator of nucleic acid sequence of the RNA products of at least one of G-protein signaling 16; MARCH7, membrane-associated said at least six marker genes or of at least one of said control ring finger (C3HC4)7; NR3C1, nuclear receptor subfamily 3, gene. It should be further indicated that these at least six group C, member 1 (glucocorticoid receptor); ELF1, E74 marker genes may be selected from the marker genes pre sented by any one of Tables 4, 7 or 8. According to certain like factor 1 (ets domain transcription factor); RPS6KB1, embodiments, the detecting molecules provided by the kits of ribosomal protein S6 kinase, 70 kDa, polypeptide 1: the invention may be specifically suitable for determining the STAT5A, signal transducer and activator of transcription 5A; expression of at least six, at least seven, at least eight, at least YTHDF3, YTH domain family, member 3: DNAJC12, DnaJ nine, at least ten, at least eleven, at least twelve, at least (Hsp40) homolog, subfamily C, member 12; IFI44L, inter thirteen, at least fourteen, at least fifteen, at least sixteen, at feron-induced protein 44-like; SARS, seryl-tRNA syn least seventeen, at least eighteen, at least nineteen or at least thetase: SMURF2, SMAD specific E3 ubiquitin protein twenty of the twenty marker genes listed in Table 4, in a ligase 2; SFRS18 (C60RF111), splicing factor, arginine/ biological test sample of a mammalian Subject. serine-rich 18; NR4A2, nuclear receptor subfamily 4, group 0242. According to another embodiment, the detecting A, member 2: CDKN1B, cyclin-dependent kinase inhibitor molecules provided by the kits of the invention may be spe 1B (p27, Kip1); and EIF3D, eukaryotic translation initiation cifically suitable for determining the expression of at least six, factor 3, subunit D, as set forth in Table 4. at least seven, at least eight, at least nine, at least ten, at least 0249 According to specific embodiment, the isolated eleven, at least twelve, at least thirteen, at least fourteen, at detecting amino acid molecules provided by the kit of the least fifteen, at least sixteen, at least seventeen or at least invention may be isolated antibodies. Each antibody binds eighteen of the eighteen marker genes listed in Table 7, in a selectively to the protein product of at least one of at least six biological test sample of a mammalian Subject. marker genes or of at least one of said control gene. It should 0243 In yet another embodiment, the detecting molecules be further indicated that these at least six marker genes may provided by the kits of the invention may be specifically be selected from the marker genes presented by any one of Suitable for determining the expression of at least six, at least Tables 4, 7 or 8. According to certain embodiments, the anti seven, at least eight, at least nine, at least ten, at least eleven, bodies provided by the kits of the invention may be specifi at least twelve or at least thirteen, of the thirteen marker genes cally suitable for determining the expression of at least six, at listed in Table 8, in a biological test sample of a mammalian least seven, at least eight, at least nine, at least ten, at least Subject. eleven, at least twelve, at least thirteen, at least fourteen, at 0244. Accordingly, the kit of the invention may therefore least fifteen, at least sixteen, at least seventeen, at least eigh comprises as the detecting molecule for the control reference teen, at least nineteen or at least twenty of the twenty marker genes, an oligonucleotide which specifically hybridizes to a genes listed in Table 4, in a biological test sample of a mam nucleic acid sequence of the RNA products of at least one malian Subject. control reference gene selected from the group consisting of 0250. According to another embodiment, the antibodies RPS9, HSPCB, Eukaryotic 18S-rRNA and B-actin. provided by the kits of the invention may be specifically 0245 According to another embodiment, such oligo Suitable for determining the expression of at least six, at least nucleotide may be a pair of primers or nucleotide probe or any seven, at least eight, at least nine, at least ten, at least eleven, combination, mixture or collection thereof. at least twelve, at least thirteen, at least fourteen, at least 0246 According to such specific and particular embodi fifteen, at least sixteen, at least seventeen or at least eighteen ment, the primers and probes used by the kits of the invention of the eighteen marker genes listed in Table 7, in a biological may be derived from regions of the genes that are also defined test sample of a mammalian Subject. as amplicons (selected regions for amplification). Examples 0251. In yet another embodiment, the antibodies provided for amplicons used are demonstrated by Table 4, which also by the kits of the invention may be specifically suitable for discloses partial sequences of the amplicons (SEQID NO. 25 determining the expression of at least six, at least seven, at to 48) used in the following Examples. It should be appreci least eight, at least nine, at least ten, at least eleven, at least ated that primers and probes may be derived from any other twelve or at least thirteen, of the thirteen marker genes listed amplicon in the listed marker genes described by the inven in Table 8, in a biological test sample of a mammalian Subject. tion. 0252) Accordingly, the detecting molecule specific for the 0247 According to another optional embodiment, the kits control reference genes may be an isolated polypeptide which of the invention may further comprise at least one reagent for binds selectively to the protein product of at least one control performing a nucleic acid amplification based assay. Such reference gene selected from the group consisting of RPS9, nucleic acid amplification assay may be any one of PCR, Real HSPCB, Eukaryotic 18S-rRNA and B-actin. Time PCR, micro arrays, in situ Hybridization and Compara 0253) In such specific embodiment where the detecting tive Genomic Hybridization. molecule may bean isolated antibody the kits of the invention 0248. According to an alternative embodiment, the detect may optionally further comprise at least one reagent for per ing molecule comprised within the kits of the invention may forming an immunoassay, Such as ELISA, a RIA, a slot blot, be an isolated amino acid molecule, for example, an isolated a dot blot, immunohistochemical assay, FACS, a radio-imag polypeptide which binds selectively to the protein product of ing assay, Western blot or any combination thereof. US 2010/0267,569 A1 Oct. 21, 2010
0254 According to a preferred embodiment, the kits pro control may be obtained from a subject which is a carrier of at vided by the invention may further comprise suitable means least one mutation in at least one of BRCA1 and BRCA2 and reagents for preparing or isolating at least one of nucleic genes. acids and amino acids from the examined sample. 0260 According to one embodiment, the detecting mol 0255 As shown by the following examples, the marker ecules comprised within the kits of the invention may be genes of the invention demonstrate a clear differential expres isolated nucleic acid molecules or isolated amino acid mol sion in carries of BRCA1 and/or BRCA2 gene mutations. ecules, or any combination thereof. Thus, the invention further provides a particular kit for detect 0261 According to one specific and preferred embodi ing of at least one mutation in at lest of BRCA1 and BRCA2 ment, the detecting molecules comprised within the kits of the genes in a mammalian test Subject. This particular kit of the invention may be isolated nucleic acid molecules. Such mol invention comprises: (a) means for obtaining a sample of said ecules may be preferably, isolated oligonucleotides, each oli Subject; (b) at least one detecting molecule or a collection of gonucleotide specifically hybridizes to a nucleic acid at least two detecting molecules specific for determination of sequence of the RNA products of at least one of the marker the expression of at least one marker gene or a collection of at gene of the invention, as set forth in Table 4. least two marker genes. According to a particular embodi 0262 Accordingly, the kit of the invention may therefore ment, these marker genes may be selected from the group comprise as the detecting molecule for the control reference consisting of RAB3GAP1, RAB3 GTPase activating protein genes, oligonucleotides which specifically hybridize to a subunit 1 (catalytic); NFAT5, nuclear factor of activated nucleic acid sequence of the RNA products of at least one T-cells 5, tonicity-responsive; MRPS6, mitochondrial riboso control reference gene selected from the group consisting of mal protein S6: AUH, AU RNA binding protein/enoyl-Coen RPS9, HSPCB, Eukaryotic 18S-rRNA and B-actin. Zyme A hydratase; MID1 IP1, MID1 interacting protein 1 0263. According to a preferred embodiment, such oligo (gastrulation specific G12 homolog (Zebrafish)); RGS16, nucleotide may be a pair of primers or nucleotide probe or any regulator of G-protein signaling 16; MARCH7, membrane combination, mixture or collection thereof. associated ring finger (C3HC4) 7: NR3C1, nuclear receptor 0264. According to such specific and particular embodi Subfamily 3, group C, member 1 (glucocorticoid receptor); ment, the primers and probes used by the kit of the invention ELF1, E74-like factor 1 (ets domain transcription factor); may be derived from regions of the genes that are also defined RPS6KB1, ribosomal protein S6 kinase, 70 kDa, polypeptide as amplicons (selected regions for amplification). Examples 1: STAT5A, signal transducer and activator of transcription for amplicons used are demonstrated by Table 4, which also 5A: YTHDF3, YTH domain family, member 3: DNAJC12, discloses partial sequences of the amplicons (SEQID NO. 25 DnaJ (Hsp40) homolog, subfamily C, member 12; IFI44L, to 48) used in the following Examples. It should be appreci interferon-induced protein 44-like; SARS, seryl-tRNA syn ated that primers and probes may be derived from any other thetase: SMURF2, SMAD specific E3 ubiquitin protein amplicon in the listed marker genes described by the inven ligase 2; SFRS18 (C6ORF111), splicing factor, arginine/ tion. serine-rich 18; NR4A2, nuclear receptor subfamily 4, group 0265. In another embodiment, the present invention A, member 2: CDKN1B, cyclin-dependent kinase inhibitor relates in part to kits comprising Sufficient materials for per 1B (p27, Kip1); and EIF3D, eukaryotic translation initiation forming one or more of the diagnostic methods described by factor 3, subunit D, as set forth in Table 4. the invention. In preferred embodiments, a kit includes one or 0256 (c) at least one detecting molecule or a collection of more materials selected from the following group in an at least two detecting molecules specific for determination of amount Sufficient to perform at least one assay. the expression of at least one control reference gene or a 0266 Thus, according to another optional embodiment, collection of at least two control reference genes. According the kit of the invention may further comprise at least one to a specific embodiment, these control reference genes may reagent for performing a nucleic acid amplification based be selected from the group consisting of RPS9, HSPCB, assay. Such nucleic acid amplification assay may be any one Eukaryotic 18S-rRNA and B-actin. The kit of the invention of Real Time PCR, micro arrays, PCR, in situ Hybridization may optionally further comprise (d) optionally, at least one and Comparative Genomic Hybridization. control sample, that may be at least one of a negative control 0267 Control nucleic acid members may be present on the sample and a positive control sample. Alternatively or addi array including nucleic acid members comprising oligonucle tionally, the kit of the invention may comprise a standard otides or nucleic acids corresponding to genomic DNA, curve?'s illustrating the expression of the marker genes and housekeeping genes, vector sequences, plant nucleic acid optionally of the control genes in a control sample. sequence, negative and positive control genes, and the like. 0257 The kit of the invention may further comprise (e) Control nucleic acid members are calibrating or control genes instructions for carrying out the detection and quantification whose function is not to tell whether a particular “key of expression of the marker genes and of the control reference marker gene of interest is expressed, but rather to provide gene in the tested sample; other useful information, such as background or basal level of 0258 Still further, the kit of the invention comprises (f) expression. Therefore, it should be appreciated that the mea instructions for evaluating the differential expression of the Sured expression levels for each marker gene is being normal marker gene in the tested Sample and of a control reference ized with the expression levels of a reference control gene. gene in the sample as compared with the expression of the 0268 Preferred control samples may be selected from marker gene and control reference gene in the control sample, HSPCB, RPS9, Eukaryotic 18S-rRNA and B-actin. Option or as compared with a predetermined value indicating and ally, other control nucleic acids may be spotted on the array distinguishing between the carrier and the non-carrier popu and used as target expression control nucleic acids. lations. 0269. According to an alternative embodiment, the detect 0259. According to one embodiment, the negative control ing molecule comprised within the kits of the invention may may be obtained from a non-carrier Subject and a positive be an isolated amino acid molecule, for example, isolated US 2010/0267,569 A1 Oct. 21, 2010 26 polypeptides, each polypeptide binds selectively to the pro nuclear receptor Subfamily 3, group C, member 1 (glucocor tein product of at least one of the marker genes of the inven ticoid receptor); ELF1, E74-like factor 1 (ets domain tran tion, as set forth in Table 4. Alternatively, the detecting scription factor); RPS6KB1, ribosomal protein S6 kinase, 70 polypeptides provided by the kits of the invention bind selec kDa, polypeptide 1: STAT5A, signal transducer and activator tively oat least six, at least seven, at least eight, at least nine, of transcription 5A:YTHDF3, YTH domain family, member at least ten, at least eleven, at least twelve, at least thirteen, at 3; SFRS18 (C6ORF111), splicing factor, arginine/serine-rich least fourteen, at least fifteen, at least sixteen, at least seven 18; NR4A2, nuclear receptor subfamily 4, group A, member teen, at least eighteen, at least nineteen or at least twenty of 2: CDKN1B, cyclin-dependent kinase inhibitor 1B (p27, the twenty marker genes listed in Table 4, at least six, at least Kip1); and EIF3D, eukaryotic translation initiation factor 3, seven, at least eight, at least nine, at least ten, at least eleven, subunit D. at least twelve, at least thirteen, at least fourteen, at least 0276. It should be further appreciated that in case of detec fifteen, at least sixteen, at least seventeen or at least eighteen tion of BRCA2 mutations, the marker gene may be selected of the eighteen marker genes listed in Table 7, or at least six, from genes demonstrated by the invention as exhibiting dif at least seven, at least eight, at least nine, at least ten, at least ferential expression of about 2 folds. Such genes may be eleven, at least twelve or at least thirteen, of the thirteen selected from any of the genes set forth in Table 6. marker genes listed in Table 8. 0277. It should be noted that detection of a mutation in any 0270. Accordingly, the detecting molecules specific for one of BRCA1 or BRCA2 genes may be an indicative of an the control reference genes may be isolated polypeptides. increased genetic predisposition of the carrier Subject to a Each polypeptide binds selectively to the protein product of at cancerous disorder associated with mutations in at least one least one control reference gene selected from the group of BRCA1 and BRCA2. Such cancerous disorder may be any consisting of RPS9, HSPCB, Eukaryotic 18S-rRNA and disorder of the group consisting of breast, ovary, pancreas B-actin. and prostate carcinomas. Therefore, the kits of the invention 0271 According to a specific embodiment where the may be applicable for the detection and preferably, the early detecting molecule is an isolated antibody the kit of the inven detection of Such cancerous disorders, particularly of breast tion may further comprise at least one reagent for performing carcinoma and ovarian carcinoma. an immunoassay, such as ELISA, a RIA, a slot blot, a dot blot, 0278 More specifically, for nucleic acid microarray kits, immunohistochemical assay, FACS, a radio-imaging assay, the kits may generally comprise probes attached to a Support Western blot or any combination thereof. surface. The probes may be labeled with a detectable label. In 0272 According to another embodiment, the kits pro a specific embodiment, the probes are specific for an exon(s), vided by the invention may further comprise suitable means an intron(s), an exonjunction(s), or an exon-intronjunction and reagents for preparing or isolating at least one of nucleic (s)), of RNA products of 1,2,3,4,5,6,7,8,9, 10, 11, 12, 13, acids and amino acids from said sample. 14, 15, 16, 17, 18.19 and 20 or more or any combination of the 0273. The invention further provides specific kits for the marker genes of the invention. According to one specific detection of at least one mutation of BRCA1 gene in a bio embodiment, the probes provided by the kit of the invention logical sample of a Subject, according to a preferred embodi may be specific for an exon(s), an intron(s), an exonjunction ment, such kit may comprises detection molecule specific for (S), oran exon-intronjunction(s)), of RNA products of at least a marker gene or a collection of at least two marker genes. six, at least seven, at least eight, at least nine, at least ten, at These specific genes exhibiting a differential expression in least eleven, at least twelve, at least thirteen, at least fourteen, BRCA1 carriers may be selected from the group consisting at least fifteen, at least sixteen, at least seventeen, at least of AUH, AU RNA binding protein/enoyl-Coenzyme A eighteen, at least nineteen or at least twenty of the twenty hydratase; RGS16, regulator of G-protein signaling 16: marker genes listed in Table 4, at least six, at least seven, at MARCH7, membrane-associated ring finger (C3HC4) 7: least eight, at least nine, at least ten, at least eleven, at least DNAJC12, DnaJ (Hsp40) homolog, subfamily C, member twelve, at least thirteen, at least fourteen, at least fifteen, at 12; IFI44L, interferon-induced protein 44-like; SARS, seryl least sixteen, at least seventeen or at least eighteen of the tRNA synthetase; and SMURF2, SMAD specific E3 ubiq eighteen marker genes listed in Table 7, at least six, at least uitin protein ligase 2. seven, at least eight, at least nine, at least ten, at least eleven, 0274. It should be further appreciated that in case of detec at least twelve or at least thirteen, of the thirteen marker genes tion of BRCA1 mutation, the marker gene may be selected listed in Table 8, or any combination of the marker genes of from genes demonstrated by the invention as exhibiting dif the invention. The microarray kits may comprise instructions ferential expression of about 1.5 folds. Such genes may be for performing the assay and methods for interpreting and selected from any of the genes set forth in Table 5. analyzing the data resulting from the performance of the 0275 Still further, the invention also provides a specific kit assay. The kits may also comprise hybridization reagents for the detection of at least one mutation of BRCA2 gene in a and/or reagents necessary for detecting a signal produced biological sample of a Subject. According to a preferred when a probe hybridizes to a target nucleic acid sequence. embodiment, such kit may comprises detection molecule spe Generally, the materials and reagents for the microarray kits cific for a marker gene or a collection of at least two marker are in one or more containers or compartments. Each com genes. These specific genes exhibiting a differential expres ponent of the kit is generally in its own a Suitable container. sion in BRCA2 carriers may be selected from the group (0279. For Real-Time RT-PCR kits, the kits generally com consisting of RAB3GAP1, RAB3 GTPase activating protein prise pre-selected primers specific for particular RNA prod subunit 1 (catalytic); NFAT5, nuclear factor of activated ucts (e.g., an exon(s), an intron(s), an exonjunction(s), and an T-cells 5, tonicity-responsive; MRPS6, mitochondrial riboso exon-intronjunction(s)) of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, mal protein S6; MID1 IP1, MID1 interacting protein 1 (gas 13, 14, 15, 16, 17, 18, 19, 20 or all or any combination of the trulation specific G12 homolog (Zebrafish)); MARCH7. marker genes of the invention. The RT-PCR kits may also membrane-associated ring finger (C3HC4) 7: NR3C1, comprise enzymes Suitable for reverse transcribing and/or US 2010/0267,569 A1 Oct. 21, 2010 27 amplifying nucleic acids (e.g., polymerases such as Taq), and chemical, or chemical means Such as fluorescence, chemif deoxynucleotides and buffers needed for the reaction mixture luoresence, or chemiluminescence, or any other appropriate for reverse transcription and amplification. The RT-PCR kits means. Preferred detectable labels are fluorescent dye mol may also comprise probes specific for RNA products of 1, 2, ecules, or fluorochromes. Such fluorescein, phycoerythrin, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or CY3, CY5, allophycocyanine, Texas Red, peridenin chloro more or all, or any combination of the marker genes of the phyll, cyanine, FAM, JOE, TAMRA, tandem conjugates such invention. The probes may or may not be labeled with a as phycoerythrin-CY5, and the like. These examples are not detectable label (e.g., a fluorescent label). According to one meant to be limiting. specific embodiment, the probes or primers provided by the 0285. It is to be understood that any polynucleotide or kit of the invention may be specific for an exon(s), an intron polypeptide or any combination thereof described by the (s), an exon junction(s), or an exon-intron junction(s)), of invention may be useful as a marker for a disease, disorder or RNA products of at least six, at least seven, at least eight, at condition, and Such use is to be considered a part of this least nine, at least ten, at least eleven, at least twelve, at least invention. thirteen, at least fourteen, at least fifteen, at least sixteen, at 0286. It should be appreciated that all methods and kits least seventeen, at least eighteen, at least nineteen or at least described herein, preferably comprise any of the composi twenty of the twenty marker genes listed in Table 4, at least tions of the invention. six, at least seven, at least eight, at least nine, at least ten, at 0287. It should be recognized that the nucleic acid least eleven, at least twelve, at least thirteen, at least fourteen, sequences and/oramino acid sequences used by the kits of the at least fifteen, at least sixteen, at least seventeen or at least present invention relate, in Some embodiments, to their iso eighteen of the eighteen marker genes listed in Table 7, at lated form, as isolated polynucleotides (including for all tran least six, at least seven, at least eight, at least nine, at least ten, Scripts), oligonucleotides (including for all segments, ampli at least eleven, at least twelve or at least thirteen, of the cons and primers), peptides (including for all tails, bridges, thirteen marker genes listed in Table 8, or any combination of insertions or heads, optionally including other antibody the marker genes of the invention. Each component of the epitopes as described herein) and/or polypeptides (including RT-PCR kit is generally in its own suitable container. Thus, for all proteins). It should be noted that the terms "oligonucle these kits generally comprise distinct containers Suitable for otide' and “polynucleotide', or “peptide' and “polypeptide'. each individual reagent, enzyme, primer and probe. Further, may optionally be used interchangeably. the RT-PCR kits may comprise instructions for performing 0288 According to a specifically preferred embodiment, the assay and methods for interpreting normalizing and ana the marker genes used by any of the compositions, methods lyzing the data resulting from the performance of the assay. and kits of the invention may be selected from the genes as set 0280 For antibody based kits, the kit can comprise, for forth in any one of Tables 4, 7 and 8. example: (1) a first antibody (which may or may not be 0289 Table 8 discloses the 13 most statistically significant attached to a Support) which binds to protein of interest (e.g., differentially-expressed genes. Go analysis demonstrated a protein product of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, that the genes are related to apoptosis, cell signaling, and cell 15, 16, 17, 18, 19 or 20 or any combination of the marker cycle that may be of importance to cancer pathophysiology. genes of the invention); and, optionally, (2) a second, differ All the selected 13 genes were under-expressed compared to ent antibody which binds to either the protein, or the first controls. antibody and is conjugated to a detectable label (e. g., a 0290 According to another embodiment, the marker gene fluorescent label, radioactive isotope or enzyme). may be RAB3 GTPase activating protein subunit 1 (cata 0281. The antibody-based kits may also comprise beads lytic). for conducting an immuno-precipitation assay. 0291 Members of the RAB3 protein family are implicated 0282. Each component of the antibody-based kits is gen in regulated exocytosis of neurotransmitters and hormones. erally in its own Suitable container. Thus, these kits generally RAB3GAP1, which is involved in regulation of RAB3 activ comprise distinct containers suitable for each antibody. Fur ity, is a heterodimeric complex consisting of a 130-kD cata ther, the antibody-based kits may comprise instructions for lytic subunit and a 150-kD noncatalytic subunit. RAB3GAP1 performing the assay and methods for normalizing interpret specifically converts active RAB3-GTP to the inactive form ing and analyzing the data resulting from the performance of RAB3-GDP. NCBI accession number: NM 012233.1, as the assay. also denoted by SEQ ID NO. 1. It should be noted that the 0283. It should be thus appreciated that any of the kits of assay ID of this marker gene (by Applied Biosystems) is the invention may optionally further comprise Solid Support, Hs00326824 m1. Such as plates, beads, tube or containers. These may be spe 0292 According to another embodiment, the marker gene cifically adopted for performing different detection steps or may be Nuclear factor of activated T-cells 5, tonicity-respon any nucleic acid amplification based assay or immunoassay, sive. as described for example by the method of the invention. It 0293 NFAT5 is an integrin, a receptor for extracellular should be further noted that any Substance or ingredient com matrix (ECM) ligands, and a critical regulator of the invasive prised within any of the kits of the invention may be attached, phenotype. Previous studies using cell lines derived from embedded, connected, linked, placed, glued or fused to any human breast and colon carcinomas provide evidence that Solid Support. NFAT5 is expressed in invasive human ductal breast carcino 0284. It should be noted that any of the detecting mol mas and participates in promoting carcinoma invasion. ecules used by the compositions, methods and kits of the 0294 NFAT5 is also involved in cellular proliferation. invention may be labeled by a detectable label. The term NFAT5 mRNA expression is particularly high in proliferating “detectable label' as used herein refers to a composition or cells. Inhibition of NFAT5 in embryonic fibroblasts resulted moiety that is detectable by spectroscopic, photochemical, in cell cycle arrest. Under-expression of NFAT5 mRNA in our biochemical, immunochemical, electromagnetic, radio study may indicate another effort of BRCA1/2 heterozygous US 2010/0267,569 A1 Oct. 21, 2010 28 lymphocytes to induce cell cycle arrest in response to an 0302 NCBI accession number: NM 021242, as also insufficient DNA repair process. The NFAT5 gene is widely denoted by SEQIDNO.5. It should be noted that the assay ID transcribed and encodes a protein of 1,455 aa. In contrast to of this marker gene (by Applied Biosystems) is Hs00221999 the conventional NFAT proteins, NFAT1-4, which shows high m1. and moderate sequence identity in their DNA-binding and 0303 According to another embodiment, the marker gene N-terminal regulatory domains, respectively, NFAT5 exhibits may be Regulator of G-protein signaling 16. Members of the a clear relation to NFAT proteins only in its Rel-like DNA regulator of G protein signaling (RGS) gene family encode binding domain. The DNA-binding specificity of NFAT5 is proteins that stimulate the GTPase activities of G protein similar to that of NFAT1, but the NFAT5 DNA-binding alpha-subunits. RGS16 is widely expressed as an approxi domain differs from the DNA-binding domains of NFAT1-4 mately 2.4-kb mRNA and that its expression is induced by in that it does not cooperate with Fos/Jun at NFAT:AP-1 mitogenic signals. Over-expression of RGS16 inhibits G pro composite sites. A striking feature of NFAT5 is its constitutive tein-coupled mitogenic signal transduction and activation of nuclear localization that is not modified on cellular activation. the mitogen-activated protein kinase (MAPK) signaling cas cade. NCBI accession number: NM 002928.3, as also Taken together, the data presented by the present invention denoted by SEQID NO. 6. It should be noted that the assay ID indicate that NFAT5 is a target of signaling pathways distinct of this marker gene (by Applied Biosystems) is Hs00161399 from those that regulates NFAT1-4, and that it is likely to m1. modulate cellular processes in a wide variety of cells. NCBI 0304. According to another embodiment, the marker gene accession number: NM 006599, as also denoted by SEQID may be Membrane-associated ring finger (C3HC4) 7. The NO. 2. It should be noted that the assay ID of this marker gene MARCH-family of proteins regulates endocytosis of cell sur (by Applied Biosystems) is Hs00232437 m1. face receptors (e.g., transferrin receptor, histocompatibility 0295 According to another embodiment, the marker gene antigens and Fas; type I as well as type II transmembrane may be the nuclear encoded Mitochondrial ribosomal protein domains) via ubiquitination. A RING finger consists of a S6 (MRPS6), a building block of the human mitoribosome of double ring structure containing 8 metal binding cysteine and the oxidative phosphorylation system (OXPHOS). Impair histidine residues that coordinate two zinc ions. RING fingers ments in mitochondrial OXPHOS have been linked to the of E3 ligases can be formed by different configurations of pathogenesis of tumor development. The mtDNA encoded histidine and cysteine residues. The most frequently found OXPHOS genes play a key role in transformation of breast classical C3HC4RING domains are involved in many dif epithelial cells. It was reported that down-regulation of clau ferent cellular events. Examples are c-CBL, which functions din-1 and -7 leads to neoplastic transformation of breast epi in ubiquitin-dependent lysosomal trafficking and BRCA1, thelial cells, and claudin-1 and -7 were also down-regulated in which affects cell cycle progression through its ligase activity primary breast tumors. Multiple pathways involved in mito via a mechanism that is still elusive. RING fingers with a chondria-to-nucleus retrograde regulation contribute to trans C3H2C3 configuration are found in membrane associated E3 formation of breast epithelial cells. ligases catalyzing ubiquitination of degradation Substrates 0296. The expression of a gene encoding the mitochondria occurring in the secretory pathway, especially the ER, and ribosomal protein S6 (MRPS6) had the highest combined endolysosomal compartments. NCBI accession number: mean fold change and topped the list of regulated genes. NM 022826.2, as also denoted by SEQID NO. 7. It should 0297 Multiregional gene expression profiling identifies be noted that the assay ID of this marker gene (by Applied MRPS6 as a possible candidate gene for Parkinson's disease. Biosystems) is Hs00224.521 m1. 0305 According to another embodiment, the marker gene NCBI accession number: NM 032476.2, as also denoted by may be Nuclear receptor subfamily 3 (glucocorticoid recep SEQ ID NO. 3. It should be noted that the assay ID of this tor) (NR3C1). Of the 2 isoforms of the glucocorticoid recep marker gene (by Applied Biosystems) is Hs00606808 m1. tor generated by alternative splicing, GR-alpha is a ligand 0298. According to another embodiment, the marker gene activated transcription factor that, in the hormone-bound may be AU RNA binding protein/enoyl-Coenzyme A state, modulates the expression of glucocorticoid-responsive hydratase. AUH gene encodes an RNA-binding protein with genes by binding to a specific glucocorticoid response ele intrinsic enzymatic activity. It was suggested, that its ment (GRE) DNA sequence. In contrast, GR-beta does not hydratase and AU-binding functions are located on different bind glucocorticoids and is transcriptionally inactive. It was domains within a single polypeptide. demonstrated that GR-beta is able to inhibit the effects of 0299. It was shown that 3-methylglutaconyl-CoA hormone-activated GR-alpha on a glucocorticoid-responsive hydratase, a key enzyme of leucine degradation, is encoded reporter gene in a concentration-dependent manner. The by the AUH gene. NCBI accession number: NM 001698, as inhibitory effect appeared to be due to competition for GRE also denoted by SEQ ID NO. 4. It should be noted that the target sites. Since RT-PCR analysis showed expression of assay ID of this marker gene (by Applied Biosystems) is H GR-beta mRNA in multiple human tissues, GR-beta may be s00156044 m1. a physiologically and pathophysiologically relevant endog 0300. According to another embodiment, the marker gene enous inhibitor of glucocorticoid action and may participate may be MID1 interacting protein 1 (gastrulation specific in defining the sensitivity of tissues to glucocorticoids. NCBI G12-like (Zebrafish). accession number: X03348, as also denoted by SEQID NO. 0301 MID1 is a gene which encodes a TRIM/RBCC pro 8. It should be noted that the assay ID of this marker gene (by tein that is anchored to the microtubules. The association of Applied Biosystems) is Hs00353740 ml Mid1 with the cytoskeleton is regulated by dynamic phospho 0306 According to another embodiment, the marker gene rylation, through the interaction with the alpha-4 subunit of may be E74-like factor 1 (ets domain transcription factor). phosphatase 2A (PP2A). Midl acts as an E3 ubiquitin ligase, E74-like factor (1 ELF1) is a lymphoid-specific ETS tran regulating PP2A degradation on microtubules. Scription factor that regulates inducible gene expression dur US 2010/0267,569 A1 Oct. 21, 2010 29 ing T cell activation and is known to be a key component in the 0311 More particularly, according to one embodiment, transcriptional program during hematopoietic stem cell Such marker gene may be DnaJ (Hsp40) homolog, Subfamily development. It has been demonstrated that ELF1 contains a C, member 12. DnaJ/HSP40 proteins, which are molecular sequence motif that is highly related to the RB (retinoblas chaperones of HSP70 proteins, contain all or a combination toma) binding sites of several viral oncoproteins and binds to of 4 domains: an N-terminal J domain; a glycine/phenylala the pocket region of RB both in vitro and in vivo. Other results nine (G/F)-rich domain; a central repeat region (CRR), and a demonstrated that RB interacts specifically with this lineage weakly conserved C-terminal domain. The J domain, which is restricted ETS transcription factor. The interaction may be believed to mediate interaction with HSP70 proteins, con important for the coordination of lineage-specific effector tains a highly conserved histidine-proline-aspartate (HPD) function. A comparative study of mouse and human breast cancer SAGE data revealed a very significant down-regula tripeptide. J domain-only proteins are members of a Subclass tion in expression of transcription factor ELF1 in mouse and of the HSP40/DnaJ family that possess the J domain as well as human breast carcinoma tumors. The decreased expression of a highly conserved C terminus, but lack the G/F-rich and CRR ELF1 observed in breast cancer appears contrary to most Ets domain. NCBI accession number NM 021800, as also transcription factors, where over-expression is usually asso denoted by SEQID NO. 13. It should be noted that the assay ciated with malignant processes. In a recent in vivo study, ID of this marker gene (by Applied Biosystems) is E74-like factor-1 (Elf-1) was found as a promoter binding Hs00222318 m1. factor of human Pygopus2 gene that is over-expressed in a 0312. According to another embodiment, the marker gene high proportion of breast and epithelial ovarian malignant maybe Interferon-induced protein 44-like (IFI44L). The bio tumors, and is required for the growth of several cell lines logical function of this gene is unknown. Suzuki, Y. et al., derived from these carcinomas. The control of hPygo2 Gene. 24:200(1-2):149-56 (1997). NCBI accession number: expression via Elf-1 may be regulated coordinately with the NM 006820, as also denoted by SEQID NO. 14. It should cell cycle via auto-activation of Wnt-dependent signaling be noted that the assay ID of this marker gene (by Applied components in cancer. The under-expression of ELF1 in Biosystems) is Hs001991 15 m1. BRCA1/2 heterozygous lymphocytes due to irradiation may 0313 According to another embodiment, the marker gene be a deviation from the normal process of Wnt-dependent may be Seryl-tRNA synthetase. The human seryl-tRNA syn signaling during cell cycle. NCBI accession number: thetase has been expressed in E. coli, purified (95% pure as NM 172373, as also denoted by SEQID NO. 9. It should be determined by SDS/PAGE). The human seryl-tRNA syn noted that the assay ID of this marker gene (by Applied thetase sequence (514 amino acid residues) shows significant Biosystems) is Hs00152844 m1. sequence identity with seryl-tRNA synthetases from E. coli 0307 According to another embodiment, the marker gene (25%), Saccharomyces cerevisiae (40%), Arabidopsis may be similar to ribosomal protein S6 kinase, polypeptide 1 thaliana (41%) and Caenorhabditis elegans (60%). The func (RPS6KB1). tional studies show that the enzyme aminoacylates calf liver 0308 RPS6KB1 mediates the rapid phosphorylation of tRNA and prokaryotic E. coli tRNA. NCBI accession num ribosomal protein S6 on multiple serine residues in response ber: NM 006513, as also denoted by SEQ ID NO. 15. It to insulin or several classes of mitogens. Acquisition of S6 should be noted that the assay ID of this marker gene (by protein kinase catalytic function is restricted to the most Applied Biosystems) is Hs00197856 m1. extensively phosphorylated polypeptides. In mammals, 0314. According to another embodiment, the marker gene mammalian target of rapamycin cooperates with PI3K-de may be SMAD specific E3 ubiquitin protein ligase 2. Ubiq pendent effectors in a biochemical signaling pathway to regu uitin-mediated proteolysis regulates the activity of diverse late the size of proliferating cells. NCBI accession number: receptor systems. SMAD specific E3 ubiquitin protein ligase NM 003161, as also denoted by SEQID NO. 10. It should 2 (SMURF2) associated constitutively with SMAD7. West be noted that the assay ID of this marker gene (by Applied ern blot analysis showed that SMURF2 selectively regulated Biosystems) is Hs00177357 m1. the expression of SMAD2 and, to some extent, SMAD1, but 0309 According to another embodiment, the marker gene not SMAD3, through an ubiquitination- and proteasome-de may be Signal transducer and activator of transcription 5A. pendent degradation process catalyzed by the HECT ligase. STATs, such as STAT5, are proteins that serve the dual func 0315. It was found that telomere attrition in human fibro tion of signal transducers and activators of transcription in blasts induced SMURF2 upregulation, and this upregulation cells exposed to signaling polypeptides. More than 30 differ was Sufficient to produce the senescence phenotype. Infection ent polypeptides cause STAT activation in various mamma of early passage fibroblasts with retrovirus carrying lian cells. STAT5 was identified as the protein most notably SMURF2 led to morphologic and biochemical alterations induced in response to T-cell activation with IL2. They characteristic of senescence, including altered gene expres hypothesized that STAT5 may govern the effects of IL2 dur sion and reversal of cellular immortalization by TERT. It was ing the immune response. NCBI accession number: further showed that SMURF2 activated senescence through NM 003 152, as also denoted by SEQID NO. 11. It should the RB (180200) and p53 pathways. NCBI accession number: be noted that the assay ID of this marker gene (by Applied NM 022739.3, as also denoted by SEQID NO. 16. It should Biosystems) is Hs00559643 m1. be noted that the assay ID of this marker gene (by Applied 0310. According to another embodiment, the marker gene Biosystems) is Hs00224203 m1. may be YTH domain family, member 3 Mehrle, A, et al. 0316. In yet another embodiment, the marker gene may be Nucleic Acids Res. 1; 34 (Database issue):D415-8. Related splicing factor, arginine/serine-rich 18 (SFRS18 Articles, Links (2006). NCBI accession number: (C60RF111)). This gene has an undefined function. NCBI NM 152758.4, as also denoted by SEQID NO.12. It should accession number: NM 032870.2, as also denoted by SEQ be noted that the assay ID of this marker gene (by Applied ID NO. 17. It should be noted that the assay ID of this marker Biosystems) is Hs00405590 m1. gene (by Applied Biosystems) is Hs00369090 m1. US 2010/0267,569 A1 Oct. 21, 2010 30
0317. According to another embodiment, the marker gene 0324. According to another embodiment, the control ref may be Nuclear receptor Subfamily 4, group A, member 2. erence gene may be ribosomal protein S9. NCBI accession Nuclear receptor Subfamily 4, group A, member 2, is a gene number: NM 001013.3, as also denoted by SEQID NO. 22. encoding a member of the steroid/thyroid hormone family of It should be noted that the assay ID of this marker gene (by receptors. The receptor, called NOT (nuclear receptor of T Applied Biosystems) is Hs02339426 g1. cells) by them, has all of the structural features of steroid/ 0325 According to another embodiment, the control ref thyroid hormone receptors but is rapidly and only very tran erence gene may be Actin, beta. siently expressed after cell activation. NURR1 and PITX3 0326 Interaction of phospholipase D with actin microfila cooperatively promoted terminal maturation of murine and ments regulates cell proliferation, Vesicle trafficking, and human embryonic stem cell. NCBI accession number: secretion. Localization of beta-actin mRNA to sites of active NM 006186, as also denoted by SEQID NO. 18. It should actin polymerization modulates cell migration during be noted that the assay ID of this marker gene (by Applied embryogenesis, differentiation, and possibly carcinogenesis. Biosystems) is Hs00428691 m1. In immunoprecipitation studies of embryonic fibroblasts 0318 According to another embodiment, the marker gene from wild type and knockout mice deficient in the arginyla may be Cyclin-dependent kinase inhibitor 1B -CDKN1B tion enzyme Atel (607 103), Karakozova et al. (2006) found (p27, Kip1). that approximately 40% of intracellular beta-actin is arginy lated in vivo. Karakozova et al. (2006) found that arginylation 0319 Cyclin-dependent kinase (CDK) activation requires of beta-actin regulates cell motility. Mammalian cytoplasmic association with cyclins (e.g., CCNE1) and phosphorylation actins are the products of 2 different genes and differ by many by CAK (CCNH), and leads to cell proliferation. Inhibition of amino acids from muscle actin. NCBI accession number: cellular proliferation occurs upon association of CDK inhibi NM 001101, as also denoted by SEQID NO. 23. It should tor (e.g., CDKN1B) with a cyclin-CDK complex. It was be noted that the assay ID of this marker gene (by Applied showed that expression of CCNE1-CDK2 at physiologic lev Biosystems) is Hs99999903 m1. els of ATP results in phosphorylation of CDKN1B at thr187, 0327. According to another embodiment, the control ref leading to elimination of CDKN1B from the celland progres erence gene may be heat shock protein 90 kDa alpha (cyto sion of the cell cycle from G1 to S phase. At low ATP levels, the inhibitory functions of CDKN1B are enhanced, thereby solic), class B member 1. arresting cell proliferation. The CDKN1B gene encodes the 0328 NCBI accession number: NM 007355.2, as also p27(kip1) protein that functions as an inhibitor of cyclin denoted by SEQID NO. 24. It should be noted that the assay dependent kinase-2, and shows loss of expression in a large ID of this marker gene (by Applied Biosystems) is percentage of BRCA1 and BRCA2 breast cancer cases. Addi Hs00607336 gH. tionally, CDKN1B is a suspected genetic modifier that may 0329. According to another embodiment, the marker gene explain differences in the estimated risk that is found to be may be Sorting nexin 2. The Sorting nexins constitute a large higher in studies based on multiple case families than in conserved family of hydrophilic molecules that interact with population-based studies. Immuno-detection of p27 has been a variety of receptor types. These molecules contain an used as a prognostic factor in a variety of cancer types, with approximately 100-amino acid region termed the phoX low expression levels being correlated with reduced median homology (PX) domain. NCBI accession number: survival time. Furthermore, characterization of p27-deficient AFO43453. breast cancer cell lines which promoted progression in mouse 0330. According to another embodiment, the marker gene tumor migration experiments have provided evidence that may be Hypothetical protein MGC4504. MGC4504 is a p27 plays an essential role in the restriction of breast cancer homolog protein of ChaC, cation transport regulator homolog progression. 1 (E. coli) CHAC1. CHAC1 molecular function is regulation of cellular ion concentrations which is necessary to Sustain a 0320 NCBI accession number: BC001971, as also multitude of physiological processes including pH balance denoted by SEQID NO. 19. It should be noted that the assay and ion homeostasis. NCBI accession number: NM 024111, ID of this marker gene (by Applied Biosystems) PubMed ID: 12460671. isHs00153277 m1. 0331. According to another embodiment, the marker gene 0321. According to another embodiment, the marker ref may be Granulysin. Cytolytic T lymphocytes (CTLs) are erence gene may be Eukaryotic translation initiation factor 3. required for protective immunity against intracellular patho subunit 7 zeta, 66/67 kDa. gens. CTLS that kill infected cells through the granule-exo 0322 Eukaryotic initiation factor-3 (eIF3), the largest of cytosis pathway may release 1 or more effector molecules the eIFs, is a multiprotein complex of approximately 600 kD with the capacity to kill the intracellular microbial pathogen that binds to the 40S ribosome and helps maintain the 40S and directly showed that granulysin is a critical effector molecule 60S ribosomal subunits in a dissociated state. It is also of the antimicrobial activity of CTLS. Granulysin is a protein thought to play a role in the formation of the 40S initiation present in cytotoxic granules of CTLs and natural killer (NK) complex by interacting with the ternary complex of eIF2/ cells. Amino acid sequence comparison indicated that granu GTP/methionyl-tRNA, and by promoting mRNA binding. lysin is a member of the saposin-like protein (SAPLIP) fam NCBI accession number: NM 003753, as also denoted by ily. Granulysin is located in the cytotoxic granules of T cells, SEQ ID NO. 20. It should be noted that the assay ID of this which are released upon antigen stimulation. NCBI accession marker gene (by Applied Biosystems) is Hs00388727 m1. number: NM OO6433. 0323. According to one embodiment, the control refer 0332. According to another embodiment, the marker gene ence gene may be Eukaryotic 18S rRNA. NCBI accession may be Serine hydroxymethyltransferase 2 (mitochondrial). number: X03205.1, as also denoted by SEQ ID NO. 21. It The enzyme serine hydroxymethyltransferase (SHMT is a should be noted that the assay ID of this marker gene (by pyridoxal phosphate-dependent enzyme that catalyzes the Applied Biosystems) is Hs99999901 s1. reversible interconversion of serine and H4PteClu to glycine US 2010/0267,569 A1 Oct. 21, 2010
and 5, 10-CH2-H4PteClu with generating of one-carbon beta-chain, specifies the autoimmune response against insu units. SHMT is present in both the mitochondria (mSHMT) lin-producing islet cells that leads to insulin-dependent dia and the cytoplasm (cSHMT) in mammalian cells. The human betes mellitus. The extremely high polymorphism of HLA SHMT cDNAs encoding the two isozymes have been isolated class II transmembrane heterodimers is due to a few hyper and the genes localized to chromosomes 12q13 and 17p11.2, variable segments present in the most external domain of their respectively. Currently, the metabolic role of the individual alpha and beta chains. Some changes in amino acid sequence SHMT isozymes is not clearly understood. The central role of are critical in disease Susceptibility associations as well as the SHMT isozymes in producing one-carbon-substituted folate ability to present processed antigens to T cells. In addition to cofactors has suggested that the regulation of these enzymes insulin-dependent diabetes mellitus, an increased frequency may influence cell growth and proliferation and that they may of specific alleles at the DQB1 locus has been claimed for be targets for the development of antineoplastic agents. NCBI narcolepsy, pemphigus Vulgaris, and ocular cicatricial pem accession number: NM 005412. phigoid. It was found that HLA-DQB1 genotypes encoding 0333 According to another embodiment, the marker gene aspartate-57 are associated with 3-beta-hydroxysteroid dehy may be Annexin A2. Annexin II, a major cellular Substrate of drogenase autoimmunity in Premature ovarian failure. NCBI the tyrosine kinase encoded by the SRC oncogene belongs to accession number: NM 002123. the annexin family of Ca(2+)-dependent phospholipid- and 0338 According to another embodiment, the marker gene membrane-binding proteins. By screening a cDNA expres may be Tensin 3. sion library generated from highly purified human osteoclast 0339 Tensin 3 is a cytoplasmic phosphoprotein that local like multinuclear cells (MNC) formed in long-term bone ized to integrin-mediated focal adhesions. It binds to actin marrow cultures, a candidate clone that stimulated MNC filaments and contains a phosphotyrosine-binding (PTB) formation was identified. Sequence analysis showed that this domain, which interacts with the cytoplasmic tails of integrin. cDNA encoded annexin II. Further studies yielded results In addition, tensin has a Src Homology 2 (SH2) domain Suggesting that ANX2 is an autocrine factor that enhances capable of interacting with tyrosine-phosphorylated proteins. osteoclast formation and bone resumption, a previously Furthermore, several factors induce tyrosine phosphorylation unknown function for this molecule. NCBI accession num of tensin. Thus, tensin functions as a platform for dis?assem ber: BCOO1388. bly of signaling complexes at focal adhesions by recruiting 0334. According to another embodiment, the marker gene tyrosine-phosphorylated signaling molecules through the may be BTB and CNC homology, basic leucine Zipper tran SH2 domain, and also by providing interaction sites for other scription factor 2. Members of the small Maffamily are basic SH2-containing proteins. An elevated expression of tensin 3 region leucine Zipper (bZIP) proteins that can function as was demonstrated during tumorangiogenesis, so it serves as transcriptional activators or repressors. Mouse cDNAs tumor endothelial marker (TEM). NCBI accession number: encoding Bachl (602751) and Bach2 were previously iden NM 022748. tified. Both Bach proteins contain a BTB (broad complex 0340 According to another embodiment, the marker gene tramtrack-bric-a-brac) or POZ(poxvirus and zinc finger) pro may be Lysosomal-associated membrane protein 2. The lyso tein-interaction domain and a CNC (Cap'n' collar)-type bZIP Somal membrane plays a vital role in the function of lysos domain. omes by sequestering numerous acid hydrolases that are 0335 Bach1 and Bach2 functioned as transcription responsible for the degradation of foreign materials and for repressors in transfection assays using fibroblast cells, but specialized autolytic functions. LAMP2 is glycoprotein that they functioned as a transcriptional activator and repressor, constitutes a significant fraction of the total lysosomal mem respectively, in cultured erythroid cells. Gel shift analysis brane glycoproteins. It consists of polypeptides of about 40 showed that when overexpressed, BACH2 binds to MAF kD, with 16 to 20 N-linked saccharides attached to the core recognition elements (MARE). Over expression also resulted polypeptides. LAMP2 is thought to protect the lysosomal in a loss of clonogenic activity. BACH2/CA-1 microsatellite membrane from proteolytic enzymes within lysosomes and to analysis indicated that loss of heterozygosity occurred in 5 of act as a receptor for proteins to be imported into lysosomes. 25 non-Hodgkin lymphoma patients. NCBI accession num NCBI accession number: NM O13995. ber: NM 021813. 0341. According to another embodiment, the marker gene 0336 According to another embodiment, the marker gene may be Retinoblastoma-like 2 (p130). Retinoblastoma-like 2 may be E2F transcription factor 2. The ability of Myc to is transcription factor, which shown to related to DNA-de induce S phase and apoptosis requires distinct E2F activities. pendent cell cycle regulation and to negative regulation of Hence, the induction of specific E2F activities is an essential progression through cell cycle. RBL2 is essential for telomere component in the MYC pathways that control cell prolifera length control in human fibroblasts, with loss of either protein tion and cell fate decisions. The retinoblastoma tumor Sup leading to longer telomeres. It was proposed that RBL2 forms pressor (Rb) pathway is believed to have a critical role in the a complex with RAD50 through RINT1 to block telomerase control of cellular proliferation by regulating E2F activities. independent telomere lengthening. NCBI accession number: E2F1, E2F2, and E2F3 belong to a subclass of E2F factors NM 005611. thought to act as transcriptional activators important for pro 0342. According to another embodiment, the marker gene gression through the G1/S transition. NCBI accession num maybe Interleukin 15 receptor, alpha. Interleukin-2 (IL2) and ber: NM 004.091. interleukin-15 (IL15) are cytokines with overlapping but dis 0337 According to another embodiment, the marker gene tinct biologic effects. Their receptors share 2 subunits, the may be Major histocompatibility complex, class II, DQ beta IL2R beta and gamma chains, which are essential for signal 1. The genes for the heteromeric major histocompatibility transduction. The IL2 receptor requires an additional IL2 complex class II proteins, the alpha and beta Subunits, are specific alpha subunit (IL2RA) for high-affinity IL2 binding. clustered in the 6p21.3 region. It was suggested that the Confocal microscopy demonstrated that full-length IL15RA structure of the DQ molecule, in particular residue 57 of the was associated primarily with the nuclear membrane, with US 2010/0267,569 A1 Oct. 21, 2010 32 part of the receptor having an intranuclear localization. It was ferential expression of about 1.5 folds. Therefore, according shown that the IL15/IL15RA complex has enhanced effects to one embodiment, such genes may be selected from any of on T-cell survival compared with IL 15 alone. NCBI accession the genes set forth in Table 5 (disclosed at the end of the number: NM 002189. Examples). 0343 According to another embodiment, the marker gene 0352. In another embodiment, it should recognized that in may be Cyclin H. The cdk-activating kinase (CAK) is a multi case of detection of BRCA2 mutations, the marker gene may Subunit protein which phosphorylates and thus activates cer be selected from genes demonstrated by the invention as tain cyclin-dependent protein kinases in the regulation of cell exhibiting differential expression of about 2 folds. Therefore, cycle progression. Presence of the CAK complex as a distinct according to another embodiment, such genes may be component of TFIIH, suggesting a link between TFIIH (by selected from any of the genes set forth in Table 6 (disclosed the phosphorylation of CDC2 or CDK2) and the processes of at the end of the Examples). transcription, DNA repair, and cell cycle progression. 0353 All technical and scientific terms used herein should 0344 Phosphorylation of mammalian cyclin H by CDK 8 be understood to have the meaning commonly understood by represses both the ability of TFIIH to activate transcription a person skilled in the art to which this invention belongs, as and its C-terminal kinase activity. In addition, mimicking well as any other specified description. CDK8 phosphorylation of cyclin H in vivo has a dominant 0354. The following references provide one of skill with a negative effect on cell growth. NCBI accession number: general definition of many of the terms used in this invention: NM 001239. Singleton et al., Dictionary of Microbiology and Molecular 0345 According to another embodiment, the marker gene Biology (2nd ed. 1994); The Cambridge Dictionary of Sci may be Stromal antigen 2. A multi-subunit complex, termed ence and Technology (Walker ed., 1988); The Glossary of cohesin, is likely to be a central player in sister chromatid Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag cohesion. STAD is mammalian analog of Smc 1p, Smc3p, and (1991); and Hale & Marham, The Harper Collins Dic Scclp. Smclip and Smc3p belong to a large family of chro tionary of Biology (1991). All of these are hereby incorpo mosomal ATPases (the structural maintenance of chromo rated by reference as if fully set forth herein. somes SMC 1 family), members of which are involved in 0355 Disclosed and described, it is to be understood that many aspects of higher order chromosome architecture and this invention is not limited to the particular examples, meth dynamics. ods steps, and compositions disclosed hereinas Such methods 0346 NCBI accession number: BC001765. steps and compositions may vary somewhat. It is also to be 0347 According to another embodiment, the marker gene understood that the terminology used herein is used for the may be Ring finger protein 11. purpose of describing particular embodiments only and not 0348. The RING finger is a C3HC4-type zinc finger motif, intended to be limiting since the scope of the present inven and members of RING finger proteins are mostly nuclear tion will be limited only by the appended claims and equiva proteins and the motif is involved in both protein-DNA and lents thereof. protein-protein interactions. Some members of the RING 0356. It must be noted that, as used in this specification finger family have been implicated in carcinogenesis and cell and the appended claims, the singular forms 'a', 'an' and transformation. For example, a RING fingerprotein, BRCA1, “the include plural referents unless the content clearly dic is a tumor suppressor in an early onset breast cancer. The tates otherwise. approximate corresponding cytogenetic location of the ring 0357 Throughout this specification and the Examples and finger protein 11 gene is on chromosome 1 p31-p32 region. claims which follow, unless the context requires otherwise, This region is frequently involved in deletions and chromo the word “comprise', and variations such as “comprises' and somal translocations observed in T-cell acute lymphoblastic “comprising, will be understood to imply the inclusion of a leukemia (T-ALL). NCBI accession number: AB024703. stated integer or step or group of integers or steps but not the 0349 According to another embodiment, the marker gene exclusion of any other integer or step or group of integers or may be Cyclin T2. steps. 0350 Cyclin T2 is a part of positive transcription elonga 0358. The following examples are representative of tech tion factor b (P-TEFb) which is thought to facilitate the tran niques employed by the inventors in carrying out aspects of sition from abortive to productive elongation by phosphory the present invention. It should be appreciated that while lating the C-terminal domain (CTD) of the largest subunit of these techniques are exemplary of preferred embodiments for RNA polymerase II. cDNAs encoding human cyclins T1 and the practice of the invention, those of skill in the art, in light of T2 was identified. Immunoprecipitation studies demon the present disclosure, will recognize that numerous modifi strated that CDK9 is complexed with the cyclins T1 and T2 in cations can be made without departing from the spirit and HeLa cell nuclear extracts. Approximately 80% of CDK9 is intended scope of the invention. complexed with cyclin T1, 10% with cyclin T2a and 10% Examples with T2b. Each complex is an active P-TEFb molecule that can phosphorylate the CTD of RNA polymerase II and cause 0359 Experimental Procedures the transition from abortive elongation into productive elon 0360 Samples Information gation. When expressed in mammalian cells, all 3 CDK9/ 0361 Fresh blood samples were obtained from proven cyclin T combinations strongly activated a CMV promoter. unaffected carriers of BRCA1 mutations, 8 unaffected carri Northern blot analysis revealed that cyclin T2 was expressed ers of BRCA2 mutations, and healthy age-matched control as multiple mRNAs in all human tissues tested. NCBI acces women with no individual or family history of cancer. Indi Sion number: NM 001241. viduals heterozygous for BRCA1 and BRCA2 germline 0351. It should be further appreciated that in case of detec mutations were identified from the BRCA1 and BRCA2 pre tion of BRCA1 mutation, the marker gene may be selected dictive testing program in the Institute of Cancer Research from genes demonstrated by the invention as exhibiting dif Royal Marsden Foundation NHS Trust, Cancer Genetics Car US 2010/0267,569 A1 Oct. 21, 2010
rier Clinic, London, UK and from the Cancer Genetic Clinic BioB spike controls were found to be present on all chips, of Hadassah University Medical Center, Jerusalem, Israel. with BioC, BioD, and CreX also present in increasing inten Fresh blood samples were collected from unaffected sity. When scaled to a target intensity of 150 (using Affyme BRCA1/2 heterozygous gene mutation carriers and healthy trix MAS 5.0 array analysis software), scaling factors for all age-matched control women with no individual or family arrays were within acceptable limits as were background, Q history of cancer. The mutations in the BRCA1/2 carriers are values and mean intensities. listed in Table 1. Written informed consent was obtained from 0366 Data Analysis all participating individuals prior to inclusion into the study, 0367 Data analysis was done using GeneSpring GX soft and the study protocol was approved by the Royal Marsden ware (Agilent technologies). Background adjustment, quan Locoregional Ethics Committee. tile normalization and Summarization were done using RMA methodology. The relative expression data for each probe set TABLE 1. then generated by normalizes each gene to the median of its own expression intensities across the entire experiment set Characteristics of mutations in BRCA1 and BRCA2 (per gene normalization). Control probes and genes whose genes in carriers used for the present invention expression does not change across the experiment were Gene Mutation removed out from the list before statistical analysis was per BRCA1 5382 incC formed. Differentially expressed genes were analyzed by BRCA1 Del AG 185 One-way Welch ANOVA, with p-value cutoff of 0.05 after BRCA1 185 del AG Benjamini and Hochberg False Discovery Rate multiple test BRCA1 3875 del 4 ing correction. Average linkage hierarchical clustering of the BRCA1 Ins CS382 BRCA1 A > T 1182 different experimental samples was obtained for selected BRCA1 44.184 del genes using Pearson correlation as similarity measure. Boot BRCA1 185 del AG strapping analysis was carried out for the assessment of the BRCA1 3450 del CAAG robustness of the cluster dendogram topology. Cluster mem BRCA2 5950 del CT BRCA2 de TT6SO3 bers were categorized according to their biological functions BRCA2 C >T961O using The Database for Annotation, Visualization and Inte BRCA2 del CA995 grated Discovery (DAVID) tools Dennis G. Jr. et al. Genome BRCA2 6SO3 de TT Biol. 4(5): 3 (2003). Pathway express tool Khatri P. et al. BRCA2 4O75de GT BRCA2 del CA995 Nucleic Acids Res. 33(Web Server issue):W762-5 (2005) BRCA2 6174del T was used to characterize the responsive genes on molecular interactions networks in regulatory pathways. 0368 Tal Man R. Quantitative Gene Expression Measure 0362 Samples Preparation and RNA Extraction ment 0363 Lymphocytes were collected from blood samples 0369 To validate the results obtained by the Affymetrix using LymphoPrep kit (Sigma), short-term cultured for 6 days U133A chips, the inventors have performed TaqMan(R) veri and irradiated with 8 Gray (Gy) at a high dose rate (0.86 fication for expression of 42 selected genes in all experimen Gy/min) using Ortovoltage X-ray machine. One hour later tal samples, using an Applied Biosystems7900 HT Micro RNA was extracted using Qiagene EZ RNA kit according to Fluidic Card System. manufacturer's instruction for further analysis. The integrity 0370. The measurements were performed using an ABI of all RNA samples was verified by 2% agarose gel electro PRISM1 7900HT Sequence Detection Systems described in phoresis before use in microarray experiments. the products User Guide (http://www.appliedbiosystems. 0364 Microarray Assay com, CA, USA). 0365 Gene expression profile of the lymphocytes from 0371 TaqMan(R) Arrays 384-wells are pre-loaded with BRCA1/2 mutation carriers and non-carriers was performed TaqMan(R) Gene Expression Assays. Each TaqMan R. Array using Affymetrix GeneChip Human Genome U133A 2.0 oli evaluates from one to eight cDNA samples generated in a gonucleotide arrays. Total RNA from each sample was used reverse transcription step using random primers on 7900HT to prepare biotinylated target RNA. Briefly, 5ug was used to Systems. The TaqMan R. Array functions as an array of reac generate first-strand cDNA by using a T7-linked oligo(dT) tion vessels for the PCR step. Relative levels of gene expres primer. After second-strand synthesis, in vitro transcription sion are determined from the fluorescence data generated was performed with biotinylated UTP and CTP (Affymetrix), during PCR sing the ABIPRISM(R)7900HT Sequence Detec resulting in approximately 300-fold amplification of mRNA. tion System or Applied Biosystems 7900HT Fast Real-Time The target cDNA generated from each sample was processed PCR System Relative Quantitation software. The TaqMan(R) as per the manufacturer's recommendation using an Affyme array technology allows multiple targets to be analyzed per trix GeneChip instrument system. For this reason, spike con sample with very few pipetting steps, streamlining reaction trols were added to 15 lug of fragmented cRNA before over set-up time, and eliminating the need for liquid handling night hybridization. Arrays were then washed and stained robotics. TaqMan(R) arrays provide a standardized format for with Streptavidin-phycoerythrin, before being scanned on an gene expression studies that permits direct comparison of Affymetrix GeneChip scanner. A complete description of results across different researchers and laboratories. these procedures is available at: http://www.affymetrix.com/ 0372 cDNA samples for the PCR reaction were prepared Support/technical/manual/expression manual.affix. After by performing reverse transcription of the RNA samples scanning, array images were assessed by eye to confirm Scan using the High Capacity cDNA Reverse Transcription Kit ner alignment and the absence of significant bubbles or (Applied Biosystems). For this reaction 2 g of total RNA in scratches on the chip surface. The 3/5' ratios for GAPDH and a single 20 Jull reaction used to obtain up to 10 ug of single beta-actin were confirmed to be within acceptable limits and stranded cDNA from a single reaction. 100 ng of cDNA US 2010/0267,569 A1 Oct. 21, 2010 34 samples loaded to plastic tube together with RNase-free 0378. The rule-based clustering method used on the probe water up to total volume of 50 ul and add 50 ul of TaqMan(R) sets, demonstrated significantly different expression pattern Universal PCR Master Mix (2x). 100 uL of the desired between either BRCA1 or BRCA2 group as compared to sample-specific PCR reaction mix loaded into the fill reser control group (p-value 0.05). For each probe set, the ratio voir on the Place the TaqMan R. Array plate. The samples were between expression level of the mutation carriers and control loaded in triplicates. The TaqMan(R) Array plates with loaded samples was calculated. Each probe set was graded as samples centrifuged at 1200 rpm for 1-2 minutes to ensure increased, decreased or unchanged. As shown in FIG. 1, complete distribution of the sample specific PCR reaction clustering of up-regulated genes in BRCA2 mutation carrier mix. Following the centrifugation the plate were sealed to group when compared to control group can be clearly isolate the wells of a TaqMan R. Array after it is loaded with observed (FIG. 1) and a sharp distinction in gene expression cDNA samples and master mix. The sealer uses a precision pattern in BRCA2 mutation carriers is demonstrated. More stylus assembly (carriage) to seal the main fluid distribution over, expression patterns within a BRCA2 mutation group channels of the array. After sealing procedure, the TaqMan(R) were highly conserved among all samples (FIG.1B), whereas Arrays were running on the 7900HT instrument. gene expression profile of BRCA1 mutation carrier Samples 0373 The extracted delta Ct values (which represent the is much less homogenous (FIG. 1A). expression normalized to the ribosomal 18S expression) were 0379 The results of the principal components analysis grouped according to the resistance pattern of the cell lines. (PCA) of these genes as demonstrated by FIG. 2, strengthen Then, the Student's t-test was performed to compare the aforementioned findings. PCA clearly indicate that samples expression values in the resistant cell lines to the sensitive cell from BRCA2 mutation carriers are well assembled together lines. and almost completely separated from either control or BRCA1 groups. By contrast, BRCA1 group represents more Example 1 variable expression patterns. 0374 Expression Profile of BRCA1 and BRCA2 Muta 0380 Founder mutations 185delAG, and 5382insC in the tions Carriers BRCA1 gene and 6174delT in the BRCA2 gene are common 0375. In order to identify marker genes potentially appli among Jewish Ashkenazi population (-0.5%) Simard J. et al. cable for early diagnosis and prognosis of breast cancer Natural Genetics 8:392–398 (1994); Takahashi H. et al. Can patients, and specifically of BRCA1/2 mutation carriers, the cer Research 55:2998-3002 (1995); Tonin P. et al. American inventors analyzed expression profiles of control samples Journal of Human Genetics 57:189-189 (1995). In the gen compares to samples of BRCA1/2 mutation carriers under eral Ashkenazi population, the carrier frequencies of these irradiation stress. Therefore, fresh blood samples were mutations were estimated to be -0.9% for 185del AG obtained from seventeen proven unaffected carriers of Struewing, J. P. et al. Natural Genetics 11:198-200 (1995), BRCA1 mutations, ten unaffected carriers of BRCA2 muta 0.9%-1.5% for 6174delT, and 0.13% for 5382insC Ben tions and twelve healthy age-matched control women with no jamin, B. et al. Natural Genetics 14:185-187 (1996); Oddoux, individual or family history of cancer (were tested negatively C. et al. Natural Genetics 14:188-190 (1996). In more for mutations in the BRCA1/2 genes). Lymphocytes prepared detailed analysis shown in FIG. 3, there was a clear-cut dis from the samples were irradiated, and subsequently RNA tinction between up-regulated genes in the BRCA2 mutation extracted from these samples was analyzed using Affimetrix carrier group and the control group. Moreover, expression oligonucleotide arrays assay, as described in experimental patterns within the BRCA2 mutation group were highly con procedures. served among all samples. In contrast, the gene expression profile in BRCA1 mutation carrier samples was less homo 0376 To examine potential relationships between the geneous, but still showed a clearly distinct gene expression expression profiles of control and BRCA1/2 mutation carrier pattern from that of the control group. This is exemplified in samples, microarray analyses were performed. The Affyme FIG. 3C where a set of genes which were down regulated in trix GeneChip Human Genome U133A2.0 Array was probed BRCA1 is displayed in comparison to both BRCA2 and con using cDNA obtained from lymphocytes from nine proven trol cells. In total, 137 probe sets in BRCA1 and 1345 probe unaffected carriers of BRCA1, eight BRCA2 carriers and sets in BRCA2 mutation carriers were differentially from ten non-carrier healthy women. For each sample an expressed (ps30.05) when compared to the control samples. individual chip was used. Hybridization experiments were Using a 5% false discovery rate Reiner, A.D.Yekutieli andY. carried on RNA extracted from lymphocytes before irradia Benjamini. Bioinformatics 19(3):368-75 (2003), the number tion and 1 hour following exposure to 8 Gy of ionizing irra of BRCA2 differentiated genes was reduced to 596. This diation. method was not applicable for the BRCA1 group due to the 0377 No significant differences in gene expression pro lower homogeneity of the samples. files were detected in a preliminary study using RNA from non-irradiated lymphocytes from the three groups (data not Example 2 shown). This result is consistent with findings in previous studies Kote-Jarai Z. et al. Clin. Cancer Res. 12(13):3896 0381 Selection of Specific Genes Demonstrating Differ 901 (2006); Kote-Jarai Z. et al. Clin. Cancer Res. 10(3):958 ential Expression in BRCA1/2 Carriers as Compared to 63 (2004). Following irradiation, differences in gene expres Healthy Controls sion profiles between the three groups were observed. Data 0382. The inventors have further analyzed the results dif was processed used the MAS 5.0 and RMA algorithm to ferential expression of different genes in BRCA1/2 carriers. provide a baseline expression level and detection for each Therefore, an additional filtration of the probe Stets list was probe set. For each probe set, the ratio between expression applied. The selection criterion was a signal that is differen level of the BRCA1/2 mutation carriers and control samples tially expressed by at least two-fold between the tested groups was calculated. The results of the expression analysis are (BRCA1 or BRCA2 carriers vs. controls). As result of this demonstrated in FIG. 1. selection, a set of 86 genes in BRCA1 carriers and 97 genes in US 2010/0267,569 A1 Oct. 21, 2010
BRCA2 carriers was established. These genes were analyzed for Gene Ontology (GO) annotations. The results for BRCA2 TABLE 2-continued mutations revealed that genes related to the gene expression List of the genes demonstrating most consistent gene expression regulation pathways, DNA repair processes, cell cycle regu patterns among all the samples. These genes were demonstrated lation and cancer possess the highest score. As shown by FIG. to be differentially expressed among the tested groups using the 4 (BRCA1) and FIG. 5 (BRCA2), the next largest group of Kruskal-Wallis test. genes is related to the hematological system functioning and Gene defense system. Symbol Gene Title 0383 Genes expressing differentially at most samples of 33 PKCe Protein Kinase Cepsilon each of the groups were further selected (genes performing 34 NR4A2 Nuclear receptor subfamily 4, group A, higher alterations only in a part of the patients in each group, member 2 were not chosen). From these genes only those with the most 35 CCNT2 Cyclin T2 36 CDKN1B Cyclin-dependent kinase inhibitor 1B consistent pattern of expression in all samples within the (p27, Kip1) same group were chosen. This selection resulted in a list of 38 37 MID1IP1 MID1 interacting protein 1 (gastrulation genes shown in Table 2. Interestingly, the function of most of specific G12-like (Zebrafish)) the genes which differed between the BRCA1 carrier muta tion and the control group is related to transcription regulation processes and DNA binding, as illustrated by FIG. 6. Example 3 TABLE 2 (0384 Real-Time RT-PCR Validation Analysis of the Selected Transcripts List of the genes demonstrating most consistent gene expression patterns among all the samples. These genes were demonstrated (0385. The inventors next performed a real time RT-PCR to be differentially expressed among the tested groups using the analysis of those thirty-eight transcripts which were identi Kruskal-Wallis test. fied as being differentially expressed between the three groups (presented by Table 2). In this analysis a larger number Gene Symbol Gene Title of samples were tested: seventeen samples in the BRCA1 group, ten from the BRCA2 group and twelve samples of BRAC 1 1 DNAJC12 DnaJ (Hsp40) homolog, subfamily C, non-carriers of mutations. Five known housekeeping genes member 12 2 SNX2 Sorting nexin 2 which were similarly expressed in the three groups were 3 MGC4504 Hypothetical protein MGC4504 served as internal controls. In total, forty three genes were 4 IFI44L Interferon-induced protein 44-like tested by TaqMan(R) gene cards RT-PCR. As shown by Table 5 GNLY Granulysin 3, twenty genes out of the forty tree examined, demonstrate a 6 SHMT2 Serine hydroxymethyltransferase 2 (mitochondrial) significantly differential expression in BRCA1 or BRCA2 7 PROSC Proline synthetase co-transcribed homolog mutation carriers and control samples, with the p-0.05 (bacterial) threshold. These genes were therefore defined as the “marker 8 FBXL8 Seryl-tRNA synthetase genes. The control housekeeping genes showed no signifi 9 AUH AU RNA binding protein? enoyl-Coenzyme A hydratase cant difference between the BRCA1/2 and non-carrier con 10 ANXA2 Annexin A2 trol samples. Table 4 presents a Summary of the amplicon 11 BACH2 BTB and CNC homology 1, basic leucine chosen for each of the marker genes, as well as partial Zipper transcription factor 2 sequences thereof. 12 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 0386. It is worthwhile mentioning that some of the genes 13 E2F2 E2F transcription factor 2 found by the present invention as being differentially 14 HLA-DQB1 Major histocompatibility complex, expressed in BRCA1/2 mutation carriers are know as involve class II, DQ beta 1 in ubiquitination. Among them are the axotrophin 15 RGS16 Regulator of G-protein signaling 16 16 TNS3 Tensin 3 (MARCH7), a stem cell gene which can regulate immune BRAC 2 17 LAMP2 lysosomal-associated membrane protein 2 tolerance and the SMURF2, which participates in TGK sig 18 RBL2 Retinoblastoma-like 2 (p130) naling, causes degradation of the RUNX transcription factor 19 C3HC4) 7 Membrane-associated ring finger (C3HC4) 7 Kaneki H. et al. J. Biol. Chem. 281(7):4326-33 (2006) and 20 NR3C1 Nuclear receptor subfamily 3, group C, induces cell senescence. Another differentially expressed member 1 gene, ELF1, was found to be downregulated in mammary 21 ELF1 E74-like factor 1 (ets domain transcription cancer in mice Hu Y. et al. Cancer Res. 64(21):7748-55 actor) (2004). Other genes in this list regulate cell cycle or are DNA 22 RPS6KB1 RPS6KB1 BRAC 2 23 TMEM30A Transmembrane protein 30A binding proteins. 24 STATSA Signal transducer and activator of ranscription 5A TABLE 3 25 IL1 SRA interleukin 15 receptor, alpha 26 CCNH Cyclin H Twenty one genes that were significantly upregulated in BRCA1 and 27 YTHDF3 YTH domain family, member 3 BRCA2 mutation carriers as compared to the control group. The P 28 STAG2 Stromal antigen 2 value between BRCA2 and control was calculated by Wilcoxon 29 RAB3GAP1 RAB3 GTPase activating protein subunit 1 Rank-Sums test (Pvalues between BRCA1 and control are not shown. (catalytic) 30 RNF11 Ring finger protein 11 Gene BRCA1 control BRCA2 control PVALUE 31 MRPS6 Mitochondrial ribosomal protein S6 32 NFAT5 Nuclear factor of activated T-cells 5, RAB3GAP1 2.267857 2.7OO63 O.OOO9 onicity-responsive NFAT5 1.82O479 2.3O3268 O.OO36 US 2010/0267,569 A1 Oct. 21, 2010 36
TABLE 3-continued TABLE 3-continued Twenty one genes that were significantly upregulated in BRCA1 and Twenty one genes that were significantly upregulated in BRCA1 and BRCA2 mutation carriers as compared to the control group. The P BRCA2 mutation carriers as compared to the control group. The P value between BRCA2 and control was calculated by Wilcoxon value between BRCA2 and control was calculated by Wilcoxon Rank-Sums test (P values between BRCA1 and control are not shown. Rank-Sums test (P values between BRCA1 and control are not shown.
Gene BRCA1 control BRCA2 control PVALUE Gene BRCA1 control BRCA2 control PVALUE
MRPS6 2.089909 2.321377 O.OO41 IFI44L 1.77931 1842596 O.O297 AUH 2.16 2.2 O.OO46 RPL32 1.54199 186O15S O.O333 MID1P1 1945218 2.187696 0.0075 SARS 1.7591.04 1.795918 O.O348 YTHDF3 1...SO9434 1957825 O.O145 RP6K-1B1 1494767 1.82S334 0.0377 MARCH7 1460844 1927.102 O.O147 CDK-1N1B 1.68 1.81 O.O41 ELF1 1.75 2 O.O15 RGS16 1364034 1.736471 O.O463 STATSA 148776 1.933504 O.O16 DNAJC12 1.68 1.71 O.0491 C6orf111 1.55 1.9 O.O2S EIF3S7 1.57 1.93 O.0491 NR3C1 1.356322 1.79716 0.0257 SMURF2 1487S74 1.78.2943 O.0491 NR4A2 14945S3 1869281 0.0275
TABLE 4
list of marker denes differentially expressed in carriers of BRCA1/2 dee mutations Gene Amplicon Exon Assay Partial Number Symbol Gene name RefSeq, length boundary location sequence of replicon 1. RAB3GAP1 RAB3 GTPase activating NMO12233.1 85 23-24 2738 GAATGCCCAGAGGGCTGCAGC protein subunit 1 SEO ID NO. 1 TATG (catalytic) SEQ ID NO. 25
2 NFAT5 nuclear factor of NMOO6599 70 5 - 6 2352 GACACTGGCGGGGACGCGT activated T-cells 5, SEO ID NO. 2 AGGG tonicity-responsive SEQ ID NO. 26
3 NRPS6 mitochondrial ribosomal NMO32476. 1OO 2-3 359 GCAGCACAACAGAGGCGGGTA protein S6 SEO ID NO. 3 TTTC SEO ID NO. 27 4. AUH AU RNA binding protein/ NMOO1698 61 7-8 878 TTTTTACCTCAGGGACCTGTT enoyl-Coenzyme A hydratase SEQ ID NO. 4 GCAA SEQ ID NO. 28 5 MID1IP1 MID1 interacting protein 1 NM 021242 70 1-2 596 AGAGGAGGCCAGGGCTCGACC (gastrulation specific G12 SEQ ID NO. 5 CACA homolog (zebrafish)) SEQ ID NO. 29
6 RGS16 regulator of G-protein NMOO2928. 108 1-2 2O3 GCCTGGAGAGAGCCAAAGAG Signaling 16 SEO ID NO. 6 TTCA SEQ ID NO. 30
7 MARCH7 membrane-associated ring NM022826 1O2 5 - 6 1738 AAAAGAGAGCCTCCTTAGA finger (C3HC4) 7 SEO ID NO. 7 GGAC SEQ ID NO. 31
8 NR3 C1 nuclear receptor subfamily XO3348 73 4 - 5 16O2 AATGAACCGGAAGCTCGAAA 3, group C, membrane 1 SEO ID NO. 8 AACA (glucocorticoid receptor) SEQ ID NO. 32
9 ELF1 E74-like factor 1 (ets NM 172373. 76 1-2 3O1 GGATGAACGACAGCTTGGTGA domain transcription SEO ID NO. 9 TCCA factor) SEQ ID NO. 33
10 RPS6KB1 ribosomal protein S6 NMOO3161. 97 6-7 69 O. AAGACACTGCCTGCTTTTACT kinase, 70 kDa, SEO ID NO. 10 TGGC polypeptide 1 SEQ ID NO. 34
11 STAT5A signal transducer and NMOO3151. 85 17-18 27O6 ACTCCTGIGCTGGCTAAAGCT activator of transcription SEQ ID NO. 11 GTTG 5A SEO ID NO. 35
12 YTHDF3 YTH domain family, NM 152758. 118 4 - 5 2O44 GGAAGCCAGCGTAGGGAGAG member 3 SEO ID NO. 12 AAA SEQ ID NO. 36 US 2010/0267,569 A1 Oct. 21, 2010 37
TABLE 4- Continued list of marker genes differentially expressed in carriers of BRCA1/2 gee mutations
Gene Amplicon Exon Assay Partial Number Symbol Gene name RefSeq, length boundary location sequence of replicon
3 DNAJC12 DnaJ (Hsp40) homolog, NM O218 OO 82 3 - 4 467 CAGTGAAGACGTCAATGCACT subfamily C, member 12 SEQ ID NO. 3 GGGT SEO ID NO. 37
4. IFI44L interferon-induced protein NM OO682O 124 4 - 5 9 OO CATAACCGAGCGGTATAGGAT 44-like SEQ ID NO. 4. ATA SEO ID NO. 38
5 SARS seryl-tRNA synthetase NMOO6513 1 O1 1-2 216 GCGACGAGTAGATCGGGC SEQ ID NO. 5 AGAC SEO ID NO. 39
6 SMURF2 SMAD specific E3 ubiquitin NM_022739. 3 1 OO 7-8 96.O GGAGCGCCCAACACGACCGGC protein ligase 2 SEQ ID NO. 6 ATCC SEO ID NO. 4 O
7 SFRS18 splicing factor, NMO3287 O.2 56 3 - 4 316 CAGGATCCAAGCCAGATTGAT (C6ORF111) arginine/serine-rich 18 SEQ ID NO. 7 TGGG SEO ID NO. 41
8 NR4A2 nuclear receptor subfamily NM_00618.6 69 5 - 6 1491 TGGACTATTCCAGGTTCCAGG 4, group A, member 2 SEQ ID NO. 8 CGAA SEO ID NO. 42
9 CDKN1B cyclin-dependent kinase BCOO 1971 71. 1-2 857 TGCAACCGACGATTCTTCTAC inhibitor 1B (p27, Kip1) SEQ ID NO. 9 CAA SEO ID NO. 43
2O EIF3D eukaryotic translation NMOO3753.3 32 12-13 1367 GAGGGGATTCCAGGCACTGT initiation factor 3, SEQ ID NO. 2O AATG subunit D SEO ID NO. 44
21 18S Eukaryotic 18S rRNA XO32O5.1 87 609 TGGAGGGCAAGTCGGGCCA SEQ ID NO. 21 GCAG SEO ID NO. 45
22 RPS9 ribosomal protein S9 NMOO1 O13.3 56 4 - 5 467 GCGCCAATCAGGGCCGCAA SEQ ID NO. 22 GCAG SEO ID NO. 46
23 ACTB actin, beta NMOO11 O1.2 71. 1-1 49 CCTTTGCCGATCCGCCGCCCG SEQ ID NO. 23 TCCA SEO ID NO. 47
24 HSPCB heat shock protein 90 kDa NM_007 355.2 55 11-12 2142 GCATGACAAGCTAGGTCTAG alpha (cytosolic), class SEQ ID NO. 24 GTAT B member 1 SEO ID NO. 48
Example 4 together (for example SMURF2 and RNF11). Mutations in (0387 GO Analysis of Differentially Expressed Genes BRCA1 have been shown to impair the homologous repair of Between BRCA1/2 Mutation Carriers Versus Non-Carriers double stranded breaks in the DNA, and the BRCA1 protein 0388 Gene Ontology analysis was performed on a list of has been shown to function in cell cycle regulation. There genes which had different expression patterns for either the fore, these results might be relevant to the function of BRCA1 BRCA1 or the BRCA2 groups as compared to the control and BRCA2. The next largest group of genes is related to the group. Analysis in the BRCA2 mutation group, revealed that hematological system functioning and the immune system most of the genes are related to gene expression regulation (i.e. HLA-DQB1, Granulysin), as can be expected when pathways involved in DNA repair processes (i.e. DNAJ, tested in lymphocytes. It have been previously shown that RAD51), cell cycle regulation (i.e. cyclin H. Kip1), cancer BRCA1 regulates targets of the innate immune system depen associated (i.e. RPS6KB1, RBL2) and apoptosis. Further dent on IFN signaling Buckley, N. E. et al. Mol. Cancer Res. more, a number of these genes were shown to function 5(3):261-70 (2007). US 2010/0267,569 A1 Oct. 21, 2010 38
TABLE 5 Genes differentially expressed (with p < 0.05 and >1.5 fold) in BRCA1 gene mutation carriers. Representative Aftimetrix ID Public ID Gene Title 204972 at NM 016817 2'-5'-oligoadenylate synthetase 2, 69.71 kDa 202672 s at NM OO1674 activating transcription factor 3 222108 at ACOO4010 adhesion molecule with Ipg-like domain 2 201000 at NM 001605 alanyl-tRNA synthetase 213503 X at BE908217 annexin A2 201590 X at NM 004039 annexin A2 201525 at NM 001647 apolipoprotein D 203747 at NM 004925 aquaporin 3 205047 s at NM OO1673 asparagine synthetase 211852 s at AF106861 attractin 211725 S. at BC005884 BH3 interacting domain death agonist; BH3 interacting domain death agonist 211190 X at AFO54817 CD84 antigen (leukocyte antigen) 218085 at NM O15961 chromatin modifying protein 5 220235 s at NM 018372 chromosome 1 open reading frame 103 206707 x at NM O15864 chromosome 6 open reading frame 32 218325 s at NM 022105 death associated transcription factor 1 Systematic Genbank Description 222154 S at AKO02064 DNA polymerase-transactivated protein 6 200880 at AL534104 DnaJ (Hsp40) homolog, subfamily A, member 1 200881. S. at ALS34104 DnaJ (Hsp40) homolog, subfamily A, member 1 209.015 S. at BC0024.46 DnaJ (Hsp40) homolog, subfamily B, member 6 219551 at NM 018456 ELL associated factor 2 37145 at M85276 Granulysin 206976 S. at NM OO6644 heat shock 105 kDa 110 kDa protein 1 208744 x at D86956 heat shock 105 kDa, 110 kDa protein 1 200799 at NM OO5345 heat shock 70 kDa protein 1A 200800 s a NM OO5345 heat shock 70 kDa protein 1A; heat shock 70 kDa protein 1B 202581 at NM OO5346 heat shock 70 kDa protein 1B 211968 S. at AI962.933 heat shock 90 kDa protein 1, alpha 215933 s at Z21533 hematopoietically expressed homeobox 220387 s at NM 007071 HERV-H LTR-associating 3 211597 s at AB0594.08 homeodomain-only protein; homeodomain-only protein 203914 x at NM OOO860 hydroxyprostaglandin dehydrogenase 15-(NAD) 205404 at NM 005525 hydroxysteroid (11-beta) dehydrogenase 1 213674 X at AI858004 immunoglobulin heavy constant delta 214973 X at AJ275469 immunoglobulin heavy constant delta 211798 x at ABOO1733 immunoglobulin lambda joining 3 211881 X at AB014341 immunoglobulin lambda joining 3 205786 s at NM 000632 integrin, alpha M. (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide); integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide) 219209 at NM 022168 interferon induced with helicase C domain 1 208436 s at NM 004030 interferon regulatory factor 7 202220 at NM O14949 KIAAO907 212714 at ALOSO2OS La ribonucleoprotein domain family, member 4 221274 s at NM O3O805 ectin, mannose-binding 2-like; lectin, mannose-binding 2-like 205569 at NM O14398 ysosomal-associated membrane protein 3 209199 S at LO8895 MADS box transcription enhancer factor 2, polypeptide C (myocyte enhancer factor 2C) 209200 at ALS365.17 MADS box transcription enhancer factor 2, polypeptide C (myocyte enhancer factor 2C) 213537 at AI128225 major histocompatibility complex, class II, DP alpha 1 2098.23 x at M17955 major histocompatibility complex, class II, DQ beta 1 208306 X at NM 021983 Major histocompatibility complex, class II, DR beta 3 2014.75 x at NM 004990 methionine-tRNA synthetase 213733 at BF74O152 myosin IF 21.0218 S at U365O1 nuclear antigen Sp100 219165 at NM 021630 PDZ and LIM domain 2 (mystique) US 2010/0267,569 A1 Oct. 21, 2010 39
TABLE 5-continued Genes differentially expressed (with p < 0.05 and >1.5 fold) in BRCA1 gene mutation carriers. Representative Aftimetrix ID Public ID Gene Title 204286 s at NM 021127 phorbol-12-myristate-13-acetate-induced protein 1 210617 at U87284 phosphate regulating endopeptidase homolog, X-linked (hypophosphatemia, vitamin D resistant rickets) 201397 at NM O06623 phosphoglycerate dehydrogenase 202446 s at AI825926 phospholipid scramblase 1 202430 S. at NM 021105 phospholipid scramblase 1 220892 s at NM 021154 phosphoserine aminotransferase 1 205267 at NM O06235 POU domain, class 2, associating factor 1 201703 s at NM 002714 protein phosphatase 1, regulatory subunit 10 219412 at NM 022337 RAB38, member RAS oncogene family 212125 at NM 002883 Ran GTPase activating protein 1 214369 S at AI688812 RAS guanyl releasing protein 2 (calcium and DAG-regulated) 206220 S. at NM 007368 RAS p21 protein activator 3 209325 s at U94829 regulator of G-protein signaling 16 213566 at NM 005615 ribonuclease, RNase A family, kó; ribonuclease, RNase A family, kó 213502 X at AA398569 similar to bK246H3.1 (immunoglobulin lambda ike polypeptide 1, pre-B-cell specific) 213820 S. at TS4159 START domain containing 5 209999 x at AB005043 Suppressor of cytokine signaling 1 209307 at ABO14540 SWAP-70 protein 216180 S. at AKO26758 synaptoanin 2 222010 at BF224O73 t-complex 1 220558 x at NM 005705 tetraspanin 32 210176 at ALOSO262 toll-like receptor 1 200629 at NM 004184 tryptophanyl-tRNA synthetase 213361 at AW129593 tudor domain containing 7 201535 at NM 007106 ubiquitin-like 3 206133 at NM 017523 XIAP associated factor-1
TABLE 6 Genes differentially expressed (with p < 0.05 and >2 fold) in BRCA2 gene mutation carriers. Affilmetrix Representative ID Public ID Gene Title 201963 at NM 021122 acyl-CoA synthetase long-chain family member 1 208002 s at NM 007274 acyl-CoA thioesterase 7 215728 s at AL031848 acyl-CoA thioesterase 7 200734 S. at BG341906 ADP-ribosylation factor 3 211622 S at M33384 ADP-ribosylation factor 3; ADP-ribosylation factor 3 221589 s at AW 612403 Aldehyde dehydrogenase 6 family, member A1 208859 s at AI650257 alpha thalassemiamental retardation syndrome X linked (RAD54 homolog, S. cerevisiae) 203566 s at NM 000645 amylo-1,6-glucosidase, 4-alpha-glucanotransferase (glycogen debranching enzyme, glycogen storage disease type III) 200602 at NM 000484 amyloid beta (A4) precursor protein (peptidase nexin II, Alzheimer disease) 213106 at AI769,688 ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1 207521 S at AFO68220 ATPase, Ca++ transporting, ubiquitous 201242 S at BC000006 ATPase, Na+/K+ transporting, beta 1 polypeptide 203140 at NM 001706 B-cell CLL/lymphoma 6 (zinc finger protein 51); B-cell CLL/lymphoma 6 (zinc finger protein 51) 221478 at AL132665 BCL2/adenovirus E1B 19 kDa interacting protein 3 like: BCL2 adenovirus E1B 19 kDa interacting protein 3-like 218090 s. at NM 018117 bromodomain and WD repeat domain containing 2 214450 at NM 001335 cathepsin W (lymphopain); cathepsin W (lymphopain) 218871 x at NM 018590 chondroitin Sulfate GalNAcT-2 US 2010/0267,569 A1 Oct. 21, 2010 40
TABLE 6-continued Genes differentially expressed (with p < 0.05 and >2 fold) in BRCA2 gene mutation carriers. Affilmetrix Representative ID Public ID Gene Title 205583 s at NM 024810 Chromosome X open reading frame 45 205518 S at NM 003570 cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase) 221628 S. at AF326966 cytokine-like nuclear factorn-pac 213998 s at AW188131 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 212107 s at BE561014 DEAH (Asp-Glu-Ala-His) box polypeptide 9 Systematic Genbank Description 204646 a NM 000110 dihydropyrimidine dehydrogenase 219237 S at NM 024920 DnaJ (Hsp40) homolog, subfamily B, member 14 201693 s at NM 001964 early growth response 1 206115 a. NM 004430 early growth response 3 209004 S a AF142481 F-box and leucine-rich repeat protein 5 201540 a NM OO1449 our and a half LIM domains 1 206492 a NM OO2012 ragile histidine triad gene 215001 S. at AL161952 glutamate-ammonia ligase (glutamine synthetase) 208798 x at AF204231 golgi autoantigen, golgin subfamily a 8A 212525 S. at AA760862 H2A histone family, member X 202979 S at NM 021212 HCF-binding transcription factor Zhangfei 213359 a W7462O Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37 kDa) 214753 a AWO84O68 Hypothetical gene CG012 221899 a AI809961 Hypothetical gene CG012 213375 S. at N80918 Hypothetical gene CG018 218051 s at NM 0229.08 Hypothetical protein FLJ12442 213212 X at AI632181 Hypothetical protein LOC161527 213931 a AI819238 inhibitor of DNA binding 2, dominant negative helix oop-helix protein; inhibitor of DNA binding 2B, dominant negative helix-loop-helix protein 203607 a NM 014937 inositol polyphosphate-5-phosphatase F 203628 a HOS812 insulin-like growth factor 1 receptor 38892 at D87077 KIAAO240 203 049 s at NM 014639 KIAAO372 207719 X at NM O14812 KIAAO470 212633 a AL132776 KIAAO776 218219 s a NM 018697 Lanc lantibiotic synthetase component C-like 2 (bacterial) 205668 a NM 002349 ymphocyte antigen 75 213975 S. at AV711904 ysozyme (renal amyloidosis); leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 220615 s at NM 018099 male sterility domain containing 1 201755 at NM OO6739 MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) 213158 at BG2S1521 MRNA, cDNA DKFZp586B211 (from clone DKFZp586B211) 201467 s at AIO39874 NAD(P)H dehydrogenase, quinone 1 205005 s a AW293531 N-myristoyltransferase 2 205006 s at NM 004808 N-myristoyltransferase 2 2O1577 at NM 000269 non-metastatic cells 1, protein (NM23A) expressed in 216321 S at XO3348 nuclear receptor Subfamily 3, group C, member 1 (glucocorticoid receptor) 207564 X at NM 003605 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N- acetylglucosaminyl transferase) 201246 s at NM O17670 OTU domain, ubiquitin aldehyde binding 1 201490 s. at NM 005729 peptidylprolyl isomerase F (cyclophilin F) 209422 at AYO27523 PHD finger protein 20 21864.0 s at BF439250 pleckstrin homology domain containing, family F (with FYVE domain) member 2 207002 s at NM 002656 pleiomorphic adenoma gene-like 1 222273 at AI419423 poly(A) polymerase gamma 212016 s at AA679988 Polypyrimidine tract binding protein 1 211791 s at AF044253 potassium voltage-gated channel, shaker-related Subfamily, beta member 2 201300 s at NM 000311 prion protein (p27-30) (Creutzfeld-Jakob disease, Gerstmann-Strausler-Scheinker syndrome, fatal familial insomnia) 208988 at BE67S843 PRO1880 protein 218668 s at NM 021183 RAP2C, member of RAS oncogene family US 2010/0267,569 A1 Oct. 21, 2010
TABLE 6-continued Genes differentially expressed (with p < 0.05 and >2 fold) in BRCA2 gene mutation carriers. Affilmetrix Representative ID Public ID Gene Title 221524 S at AL138717 Ras-related GTP binding D 209285 s at N38985 retinoblastoma-associated protein 140 205407 a NM 021111 reversion-inducing-cysteine-rich protein with kazal motifs 201167 X at NM 004309 Rho GDP dissociation inhibitor (GD1) alpha 213350 a BF68O2SS Ribosomal protein S11 209889 a AF274863 SEC31-like 2 (S. cerevisiae) 201996 S. at ALS24033 spen homolog, transcriptional regulator (Drosophila) 203455 s at NM OO2970 spermidine?spermine N1-acetyltransferase 210592 S at M55580 spermidine?spermine N1-acetyltransferase 210172 a D261.21 splicing factor 1 215113 s at AKOOO923 SUMO1/sentrin? SMT3 specific peptidase 3 213510 x at AW194543 TL132 protein 212983 a NM 005343 v-Ha-ras Harvey rat sarcoma viral oncogene homolog 209348 S. at BFSO8646 V-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) 22O118 a NM O14383 Zinc finger and BTB domain containing 32 203739 a NM 006526 zinc finger protein 217 212774 a AJ223321 Zinc finger protein 238 221645 S. at M27877 Zinc finger protein 83 (HPF1) 214670 a AA6533OO Zinc finger with KRAB and SCAN domains 1
0389. In summary, identification of marker genes differ- 0392. Where: entially expressed in carriers of BRCA1/2 gene mutations as 0393 ACt=(CT, X)-(CT, R); the difference in threshold compared to non-carrier controls, by the present invention, cycles for target and reference demonstrate the feasibility of using such marker genes or any 0394 CT, X=threshold cycle for test sample gene ampli combination thereof in the diagnosis of carriers. fication 0395 CT, R-threshold cycle for reference (control Example 5 sample) gene amplification, said threshold cycle being an RT-PCR cycle number that produces sufficient luminescent 0390 Establishment of a Predictive Marker Set and Asso product to exceed a specific luminosity value. ciated Expression Cutoff Values for BRCA1/BRCA2 Muta 0396 For the analysis of sensitivity-specificity relation of tions the assay, an ROC curve was constructed, and the area under 0391. In order to refine the set of markers for detection of this curve was calculated. BRCA1 and BRCA2 mutations that predispose subjects to 0397 A P value of <0.05 was considered significant. breast, ovarian and other cancers, the eighteen candidate Using a receiver-operator characteristic plot (ROC) analysis marker genes which displayed the most statistically signifi of the results, presented in Table 7, the candidate marker gene cant differential expression out of the twenty candidate group was restricted to thirteen genes presented in Table 8. marker genes presented in Table 4 were further analyzed. Furthermore, since all of the chosen genes displayed lower These genes were: MRPS6, CDKN1B, ELF1, NFAT5, expression levels in mutation carriers, a cutoff value was NR3C1, SARS, SMURF2, STAT5A, YTHDF3, AUH, calculated for each gene as presented in Table 8, below which EIF3D, IFI44L, MARCH7, MID1 IP1, NR4A2, RAB3GAP1, threshold each gene was assigned the value of “1”, indicating RGS16 and SFRS18 (C6Orfl 11). Twenty-one female carriers a possible mutation carrier, and above which “0”, indicating a of either BRCA1 or BRCA2 mutations, or both, and nineteen possible non-carrier. The cutoff value was optimized using normal females were chosen for RT-PCR validation analysis. ROC Such that it would produce maximal accuracy, i.e., an One mutation carrier and one normal Subject were disquali optimal combination of sensitivity and specificity to the pre fied due to low grade RT-PCR products that did not allow dicted mutations. reliable interpretation, leaving twenty mutation carriers (13 0398. Using the selected markers, threshold values and the BRCA1, 6 BRCA2 and one BRCA1+2 carriers) and eighteen given experiment population, it was calculated that any com normal Subjects. For normalization of expression values and bination of six positive (“1”) markers accumulated in a internal calibration, mRNA transcribed from the gene encod sample from a single subject is indicative of a mutation in ing ribosomal protein S9 (RPS9), a ubiquitously-as well as either BRCA1, BRCA2 or both in said subject, with a sensi consistently-expressed gene that is free of pseudogenes was tivity of 90%, a specificity of 84%, a positive predictive value used. For comparison of normalized expression values of 85.7% and a negative predictive value of 88.2%. The between different samples, or relative quantitation, the fol experimental population marker expression values are given lowing equation was used: in Table 9, and their marker indices according to the thresh RQ (Relative Quantitation)=2- olds of Table 8 are given in Table 10.
US 2010/0267,569 A1 Oct. 21, 2010 44
TABLE 10-continued b16 BRCA1 5382insC 1 O O O O 1 O b5 BRCA1 5382insC O 1 1 1 1 O 1 b10 BRCA2 6174delT 1 1 1 1 1 1 1 b11 BRCA2 6174delT 1 1 1 1 1 1 1 b17 BRCA2 6174delT O 1 O 1 1 1 1 b18 BRCA2 6174delT 1 1 1 1 1 1 1 b19 BRCA2 6174delT 1 O O O O O O b2O BRCA2 6174delT 1 O 1 1 1 1 1 b6 185delAG- 1 1 1 1 1 1 1 BRCA1 + 6174delT BRCA2 c10 None O O O 1 O O O c11 None O O O 1 O O O c12 None O O O O O O O c13 None O O O O O O O c14 None O O O O O O 1 c15 None O 1 O O 1 1 O c17 None 1 O O O O O O c18 None 1 O 1 O 1 O 1 c19 None O O O O O O O c2 None O 1 1 O 1 1 O c3 None O O O O O 1 1 c4 None O O O O O O 1 c None O O O 1 O O O CS None O O 1 O O O O c6 None O O O O O O O c7 None O 1 O O O O O c8 None O O O O O O O c1 None O 1 1 O 1 1 1 Diagnostic values for STAT5A, YTHDF3, AUH, EIF3D, IFI44 and, NR4A2 expression values
Sample Mutation STATSA YTHDF3 AUH EIF3D IFI44L NR4A2 b1 BRCA1 185del AG O O O O O b12 BRCA1 185del AG O O b13 BRCA1 185del AG O O b14 BRCA1 185del AG O O O O b1S BRCA1 185del AG O b2 BRCA1 185del AG O O b21 BRCA1 185del AG O O b3 BRCA1 185del AG O O b9 BRCA1 185del AG O O O b7 BRCA1 185del AG O b8 BRCA1 185del AG O O O b16 BRCA1 5382insC O O O O O b5 BRCA1 5382insC O O O O b10 BRCA2 6174delT b11 BRCA2 6174delT O b17 BRCA2 6174delT O O O O O b18 BRCA2 6174delT O O O b19 BRCA2 6174delT O b2O BRCA2 6174delT O O O b6 85delAG- O BRCA1 + 6174delT BRCA2 c10 None O O O O O 1 c11 None O O O O O 1 c12 None O O O 1 O O c13 None 1 O O 1 1 O c14 None O O O O O O c15 None O O 1 1 O O c17 None 1 1 O O O 1 c18 None 1 1 1 1 1 O c19 None O O O O O O c2 None 1 1 1 1 1 1 c3 None O O O O O O c4 None O O O 1 O O c None O O O 1 O O CS None O O O O 1 O c6 None O O O O O O c7 None O O 1 O 1 1 US 2010/0267,569 A1 Oct. 21, 2010
TABLE 10-continued c8 None O O 1 O c1 None O 1 1 1 0- if greater then cutoff value: 1- ifless then cutoff value;
0400. It will be evident to those skilled in the art that the respects as illustrative and not restrictive, reference being invention is not limited to the details of the foregoing illus made to the appended claims, rather than to the foregoing trative examples and that the present invention may be embodied in other specific forms without departing from the description, and all changes which come within the meaning essential attributes thereof, and it is therefore desired that the and range of equivalency of the claims are therefore intended present embodiments and examples be considered in all to be embraced therein.
SEQUENCE LISTING
<16 Os NUMBER OF SEO ID NOS: 48
<21 Os SEQ ID NO 1 &211s LENGTH: 4179 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens
<4 OOs SEQUENCE: 1 agcgc.caggc ccggcgctcc tdaagatggc tigc.cgacagt gagc.ccgaat Cogagg tatt 60
tgagat cacg gaCtt Cacca citgccticgga atgggaaagg tttatttcca aagttgaaga 12O agt ctitgaat gactggaaac tattggaaa ct ctittggga aagc cacticg aaaagggitat 18O
att tact tct ggcacatggg aagagaaatc agatgaaatt to ctittgct g acttcaagtt 24 O
cticagt cact catcattatic ttgtacaaga gtcc actgat aaagaaggaa aggatgagtt 3 OO attagaggat gttgttccac aatctatgca agatttgct g gg tatgaata atgactitt co 360 to Caagagca cattgcctgg talagatggta tiggctacgt gagttcgtgg tattgcc cc 42O
tgctgcacac agtgacgctg ttct cagcga atctaagtgc aaccttcttic tdagttctgt 48O
ttctattgcc ttgggaalaca citggctgtca ggtgccactic tttgttgcaaa tt caccacaa 54 O
atggcgaaga atgitatgtag gagaatgtca aggt cctggit gtacgaactg atttcaaat 6 OO
ggttcatctt agaaaagtgc caaat cagta cact cactta to aggt ctdc toggatat citt 660 caaatcaaag attggatgtc ctittaactcc attgcct coa gttagt attg ct attcgatt 72O tacctatgta cittcaagatt ggcagcagta tttittggcct cagdaacct c caga cataga 78O
tgccCttgta ggaggagaag ttggaggctt ggagtttggc aagttaccat ttggtgcctg 84 O
cgaagat colt attagtgaac to catttagc tact acatgg cct catctga cc.gaagggat 9 OO cattgttggat aatgatgttt attctgattt ggat.cctatt caagct coac attggtctgt 96.O
tagagttcga aaagctgaga atcct cagtg tittgctaggit gattttgtca citgaatttitt 102O
taaaatttgc cgt.cgaaagg agt caactga tigagatt Ctt ggacgatctg catttgagga 108O
agaaggcaaa galaactgctg atata actica totttgtca aaattgacag agc.cggcatc 114 O
agttccaatt cataaattat cagtttcaaa tatggtacac actgcaaaga agaaaatc.cg 12 OO
aaaacacaga ggtgtagagg agt caccgct aaataatgat gttcttaata ct attct c ct 1260
gttct tatt c cctogatgctg tttctgagaa accattagat ggaact actt caacagataa 132O
taataatcct coatcagaga gtgaagact a taatctotac aatcagttca agtctgcacc 138O
US 2010/0267,569 A1 Oct. 21, 2010 50
- Continued gaattaattig titattattitt cctagg.cgca atttic cittaa acgtacagtt taaattcaag 612 O gctggaccac toagittatta ttgct attag aaaataatat at catgttta ctitttgttct 618O t cattattitt ctitt cotgca ttgttittagt caagtaatgg ctitttgaaaa agtaaagttc 624 O aataataact aaggctgtga ttitttittcaa tataaaaggc acagotgttg gccaaagtga 63 OO aggaat ctitt titt cagttitt attggagaaa citgaagggta acattctaac aagtaaactg 636 O tatgtgcaga taaaagtact cittgatttaa cacaaaggca gatgatacac ttataaaact 642O gggalacagct ggaatgct tc ttgattitt at tttitt cagag agttgttagt t citctgggitt 648 O tctactaagg ggtttagcca taactgtgca tagaaaaata attatctgta aaaaatgaag 654 O gggataatat atgataaatt atgttctgat atcct cotac agtag tittaa attgacagaa 66OO aaatttgaat gttittcttct taacccagtic titaggctggit attcc ctittt tatatatatic 666 O tatatt actt ttcacct citt titt cactitta ctittagagaa citattaatat act actggct 672 O t catgaccct gtag catctt toggcc actitt aatctagggit gacctagdaa toctdcagoa 678 O.
Cagggcagag agtactgtct taggaatt at taggagttga titcCtgagala acaacacatt 6840 titt.ccc catgaacggtgctg ttctgaagtic ttcaaattitt tocct ctaat aggaalacagt 69 OO ataaattitta attaaaaaaa aaaggcaaac taaaatttct togaaat atca cittct coctd 696 O atctgcagtgagtataaatt cacttgtcac ct cagtgctt tacagtttga agtggtcact 7 O2O tacctgatgg ttc.ccacaag cct taggctt tacagggttg tat cattgac ttaaaatgaa 708 O gaattaactt gtgttacatc tataaagagc aaaataacac act coagaac ttggcagttg 714. O tagcattagt tatacagttt togggtgttct togccaccc.gt giggatgcct g c ttct cacta f2OO ccacctgtgt ctdgacacat gct tatgtct catttitcctt ttggcatgtg gaaagctgtc 726 O aatgcagtgt aaggccaacg ttgttgttggc titctatgtgt tagataatgttittggitatic 732O cittgtc.cgitt to atttattt tittaagtgta caaaaaataa cct gttaatt gttgaaggct 7380 acttittctgt totttitttitt tttittttitt c tat cotgtac atttagttga actgtgcgga 744. O attgtggtgt toggttttgtt tacacago ca gatttitt cott totttttgtt ttgttgatgat 75OO cittcctttgt totttgaatg togctcttttgtctttittcto tttitt totca totttitcttic 756 O cctic cacctic caccc.ctitt c titt Ctttct c tict ctdattg agaggcattgaattacgttt 762O t cagtag tac aggctt Cttg cc.gatatgaa gggaacttitt Cagaaagaga cct actctgg 768 O gtcatttaat tittgaataca gttittcaatc gttcaagttt toggatggittt at atctaatg 774. O tgttgttt cat ttttittggaa agctatattt td tatttagg aaatggtata ctattittgct 78OO atttgtactg agtgagtaca ttggcatalaa tatagaaatt tatatatata catatatata 786 O aact attctt ttittgccaca catttttgtg gtaaatttgt gagtttgtct gatgttctac 7920
Cacaacgtgg C9tctgataa cagtgagggggggtggggtt tittatgtct ttattgagta 798 O tittaagtatic titttgaaaca aatgacctgt to atctgtgg ccatt coat c aggcagttag 804 O titcCttgatgtcagtagtgg gctaaaggca gct tact.gtg tdtttgctgg agctitt cact 81OO
Cagccaagtg ttagagt cag gaalacccatt gaggcaatgg C9tcaaatgg ttitt cacala 816 O gaatgagcca ttcagt ctitt gct cactata tatttaatat titt attattgttgttattgt 822 O tatt attaat tdgctttctg. tatt citatgc ctitt tattta taaagacact aagaaaaccc 828O atgtttgtaa ttittaataac atttitt.ccca tottgtaata t coagagcta ctittataaat 834 O
US 2010/0267,569 A1 Oct. 21, 2010 52
- Continued gcatgagcca cca catccgg cctaattact tctittaatcc ccatttattt titatgcc att O68O ctagoc to at ttattaataa aattatgttt ttactitt citc titt caggaaa ttttittaaat Of 4 O taat attitta tat citagatc taatgctato gaaaagtgcc tttittat cat ttata atttic O8OO atttitt cact attitccaaaa acacataaac aaatagitttc agtaggit coc agcttt tact O 860 ttitt coattit aaacct tctt ttct coattt citt coctittg gcttaagaat aaaagaaaag O92O gtacattgct agaattgttt Ctttgggaga gggtaaaaga ttacagaatt agactgttca O98O gcctittatat aaactaaatt tdt citt catc. tcaac cagot aatgg taggit cittatctgaa O4 O tact catgag aattittagca totgtgaaac to catgcacc agatgtgttgt aaattitcagg 1OO aagaaagtgt togaaag catt ttct ctdatgttaattagat ggaaataaat cactaaaa.ca 16 O tagtttaggit aaa.gc.ctgat tatgccactt ttttittaact agacagggca aagttgttta 22 O tgttagtgta citt cittgtct atcct cagtt aatttaccta gacaaaaagt gtcaaaggaa 28O atgagaaaaa gottatat ct gactic cct co agacctaaga taatticcittt tdatcagata 34 O cagt cagatg gag togc ctitg gttitttgtta attittgcctic tatto cagot cottaccaca 4 OO gcggtggtgc titaaagaaag gat catcago aac aggt cag gat agttct a cct ttgggat 460 agggctgctt toccc.gtgct agt atttctg tactgttag tigcactgag gactgcaaac 52O ttittatgcaa tatt cittaat accct attga tattatgcac tittaatcatt coaaagaagic 58 O Caagaatgct gtatagtgat gattcct tcc taatgaattic atcttaacta tittagaatgt 64 O tatgtc. cctt ttcttittgga tagccaactt ggtataaatgttatatggat ttittctaaaa 7 OO tgactatata ggacittaaga ctittgaaatg taatt tactt ataaggggaa ataattatgc 760 tittago acat cattttagaa acgtcacatt ttagaaacat t cagottgct aacct acatg 82O tittgggaatt cattaaaacc agttgtctat at attttgtg ccatgtatat aagaacatta 88O caatatat ct ttittctacat atgtag tatgtgcaaccagt gigttct caga gitatggttct 94 O cagoccacca gctagtatica gitat cacctg ggaac tagtt agaaatgitaa attctittggc 2 OOO cc catcc.cag acatactgag to agaaactic tdgaataggg ccc.ccgcaat citgttitt cac 2O6 O aag.ccctic ca ggtgattctg atgcacactt taaagtt tag gaaccactgg gctaagactic 212 O tgttgagata tagagtttitt citt coactica gactgatata gttatacatt gttctt catg 218O taaatticago tta acctggit tat ctataat cittittattgg caaaagttaa ttct cagtac 224 O tgcctataga gatacagtgt attittatgta catacacaat tagt ctaatt cittgataatt 23 OO cagttaattit agtttggcat titt cotacca cittactaaaa gotttacatt aaatgactga 2360 tittaaatata taggtgcaat gttctatott tattittaatt gttatgacat ttaagtagct 242 O aatataattig accoggtgcta aagt citcc tig tittatccata aaatggg tac attatgggca 248O gtgtaataca agctitt ctitt to attgcc tag tactitt acc agcagaccac agttittgcc c 254 O tggctagacc aaccct caga acaaaatcat cattccttgt atttatattt gtatctgaga 26 OO tagtaaacaa gatggctggc caggt caa.ca tdgcaccitta act tatttitt ttaataggta 266 O aaacttcttcaaaagtagct togctttgt at aagaactaag citat cagtat agatatagot 272 O atcc ttggag cittatgtttc agacaagaat tatt tactaa aataaataat aaacaagata 2780 atgcattata caatttgggc atttct cott tot caagtgt atgcatcat g g taaatataa 284 O actalaccaca agataggtag attgatt cat tt cattittaa tot cottgttg taatticagta 29 OO
US 2010/0267,569 A1 Oct. 21, 2010 58
- Continued Ctcttggagc tigctgccaac agaccacaag Catctgcagc at Caagcagt gcc acaa.ca.g SOO gtggct ctac at Cagatt.cg gct Caaggtg gaagaaatac aggaat atca gggatt Ctt C 560 ctggttcc tt attic.cggttt gcagt ccctic cagcacttgg gagtaatttg accqacaatg 62O t catgat cac agtagatatt attcc titcag gttggaattic agctgatggit aaaagtgata 68O aalactaaaag tecgc.ctt.ca agagatccag aaagattgca gaaaataaaa gaga.gc.ct cc 74 O ttittagagga ct cagaagaa gaagaaggtg act tatgtag aatttgtcaa atggcagctg 8OO catcatcatc taatttgctgatagagc.cat gcaagtgcac aggaagtttg cagtatgtc.c 86 O accalagacitg tatgaaaaag toggttacagg ccaaaattaa citctggttct t cattagaag 92 O
Ctgtaaccac Ctgttgaacta totaaagaga agttggagct talacctggag gattittgata 98 O tt catgaact acatagagct catgcaaatgaacaa.gctgagtatgagttt atcagct citg 2O4. O gtct ctacct agtggtgtta ttgcacttgt gcgaacaaag Cttittctgat atgatgggaa 21OO atacaaatga accaag caca cqtgtc.cgat ttatt aacct togcaagaact citt caggcac 216 O atatggaaga t ct caaact t cagaggatg attic.cgalaga agacggagac catalacagga 222 O catttgat at tdcctaactt catataagac agatggatga t ctdtgaaca taagtgttta 228O ttaaaaatgg caattaaata taaattactt ttgtggggga atgcc taata aatacattga 234 O ctatatataa aatgaatata tacatacaca totatgcctg. tatatatata t t cattcticc 24 OO agtgttgctgaattaaaatt ctogctggact ttttaacata gcaaatc.cga totttataaa 246 O ctgg taatca aaaaggtttt ttcttittagg tdagtgggaa agt attaccc ttgttittaaa 252O tatictaagca atgcctatica acccttttitt gtgttatgat tactgtagt catatt tatga 2580 aaaaaggttt gtgttt tact cittgctagtg agaaaagtgg gacaaaatat acttittgaaa 264 O taaaatgcta tatggcacct aattatttitt tottt taaaa togc cittaagt togcagt citca 27 OO ttittgataat catttgct to cagtgtttaa aaattaaaaa aagaatgggg agaaggittat 276 O gagaagagca ttattaagtt to caaattta atttgaattic caaatticacic tag caataaa 282O atctaattitt taaaaagtat ataaatataa aatgtataaa tdatggatag attitttgtat 288O tgatttgcaa aatgcagatt at atttgata ggctatagta totagatatt cottt tagga 294 O at attacago totaaattat atgagacittg ccagt caaat gct atttggit ttaaaaaaat 3 OOO tattgcaatc. tcaagttaat ggaat attitt taaatcc cac attcagagtt taaaacactg 3 O 6 O gttittcaatg tdtttitt tag togttgtcact tdtttataga taaatatata aataacctgt 312 O ttggat.cctg gtc.ctttitta actgttcc tt ggtaattctg agcatttatt tdatgacitta 318O at atttitt ca citacctittgg agaacagatgaac attatto accatgaatg gatctatact 324 O gtgtggtcat gagttgtgta tact tccata acactgtatt titt cittctgt cagtacc citt 33 OO aggata cact ttaaaacacci ttalaggtotg atgttatggc aacaaactac tttittcaaac 3360 ctaaatagga accatgtaat ttct caaaag tdattgaaca gtttgcc cac act tagtttg 342O ttggtott at gtaaaacatt ggctcaaaat aaagtacaca citgatttaaa aaaaaaaaaa 3480 aaaa. 3484
<210s, SEQ ID NO 8 &211s LENGTH: 3791 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens
US 2010/0267,569 A1 Oct. 21, 2010 61
- Continued t cactggatgttgctgaaga agaaat cata gacgatgatg atgatgacat Cacccttaca 48O gttgaagctt Cttgtcatga C9gggatgala acaattgaaa Ctattgaggc tigctgaggca 54 O citcc to aata toggatt cocc toggcc ctato citggatgaaa aacgaataaa taataatata 6OO tittagttcac ctdaagatga catggttgtt gcc ccagtica cc catgtgtc. cqt cacatta 660 gatgggattic ctgaagtgat ggaalacacag Caggtgcaag aaaaatatgc agact caccg 72 O ggagcct cat Caccagaaca gcc talagagg aaaaaaggaa gaaaaactaa accaccacga 78O ccagattic cc cagccactac gccaaatata t ctgttgaaga agaaaaacaa agatggaaag 84 O ggaaacacaa tittatctittg ggagtttitta citggcactgc ticcaggacaa gogg tacttgt 9 OO
Cctaaataca t caagtggac C cago.gagag aaaggcattt ttaaattggit ggattictaaa 96.O gcagtgtc.ca ggttgttgggg galagcacalaa aacaaac Ctg atatgaatta tagacCatg O2O ggaagagcac to aggtacta ttaccalaagg gg tatt ctgg caaaagtgga agg to agcgc O8O ttggtgitatic agtttaaaga aatgccaaaa gat cittatat atataaatga tigaggat.cca 14 O agttccagca tagagt ctitc agatc catca citat citt cat cagcc acttic aaataggaat 2OO caaaccagcc ggtcgaga.gt at Cttcaagt c caggggtaa aaggaggagc Cactacagtt 26 O ctaaaaccag ggaattictaa agctgcaaaa cccaaagatc ctdtggaagt tdcacaacca 32O t cagaagttt tdagga cagt gcagoccacg cagtic to cat atcct accca gct ctitc.cgg 38O actgttcatg tagtacagcc agtacaggct gtCccagagg gagaa.gcagc tagaaccagt 44 O accatgcagg atgaaacatt aaattct tcc gttcagagta ttaggacitat acaggct coa SOO acccaagttc cagtggttgt gttct cotagg aat cago agit togcatacagt aac actic caa 560 acagtgccac toacaa.cagt tatagc.ca.gc acagatc cat cagcagg tac toggat ct cag 62O aagtttattt tacaa.gc.cat tcc at catca cagcc catga cagtactgaa agaaaatgtc 68O atgctgcagt cacaaaaggc gggct citcCt c ctitcaattgtcttgggcc c tec cc aggtt 74 O Cagcaggit co ttactagdaa titt Cagacic atttgcaatig galaccgt cag ttggct tcc 8OO tctic catcct tcagtgctac togcacctgtg gtgaccttitt citcct cqcag titcacagotg 86 O gttgct cacc cacctggcac totaat cact tcagttatca aaact caaga aacaaaaact 92 O Cttacacagg aagtagagaa aaaggaatct galagat catt taaagagala Cactgagaaa 98 O acggagcagc agccacagcc titatgtgatgg tagtgtc.ca gttccaatgg atttact tct 2O4. O caggtagota tdaaacaaaa cqaactgctg gaaccolaact cittitt tagtt aatataccala 21OO agct tatgaa taattgtttgttaattgaac attitt caatt atatgcagac tdactgattic 216 O taagataaat tctaaggagg tttctaattt totaattgtt aaaaatagag ttaattittga 222 O Ctttgttaga tigagggagga aaact caact gtttctic titt gttatctaaa tottt cagaa 228O ttcaatcgtg aaggaacagg cattttacac tatgaagaca ttcttittgag atttittattt 234 O cagttgctat at cataagca tttittaaagt ttcttittcta attitt acatt g tattagatt 24 OO ttctgattct tttgtaaata cagaacttaa atagaaggca acaggaaatt tatataggaa 246 O ctattitt cat tcc acttgtg taagttaagt cittgact citt toaaatgcaa aaaacctatt 252O titatgctttgttaaaattat gigtgtcactt agattgactt tagttgactg. cactatataa 2580 tatagalacta taatatgta gaataacatgaaaaattgga ggtgctggtg gtatggctga 264 O c cct gttt ca gaagcaggat agtataaaag cat cagocta agaatggcac toccactaac 27 OO
US 2010/0267,569 A1 Oct. 21, 2010 64
- Continued ggacatacac ctitttcaatt gtggcaataa ttgaaagaat cqataaaagt to atc.tttgg 354 O acagaaagcc tittaaaaaaa aaat cact co citct tcc ccc ticctic cctta ttgcago agc 36OO Ctactgagaa ctittgactgt totggtaaa ttagaagcta caataataat taagggcaga 366 O aattatactt aaaaagtgca gatcc ttgtt ctittgacaat ttgttgatgtc. tdaaaaaa.ca 372 O gaac cc galaa agctatggtg atatgtacag gcatt attt C agactgtaaa tigcttgttga 378 O tact cittgat acttgttittcaaatatgttt actaactgta gtgttgact g cctdaccaaa 384 O titccagtgaa acttatacac caaaatatt c titcc tagg to ctatttgcta gtaacatgag 3900 cactgttgatt ggctggctat aaccaccc.ca gttaaac cat titt cataatt agtag tigc.ca 396 O gcaatagtgg caaacactgc aacttittctg cataaaaag.c attaattgca cagctaccat 4 O2O ccacacaaat a catagitttt totgact tca cattt attaa gtgaaattta titt cocatgc 4 O8O tgtggaaagt ttattgagaa cittgttt cat aaatggatat ccc tactatg actgtgaaaa 414 O catgtcaagt gtcacattag togt cacagac agaaag.caca caccitatgca atatggctta 42OO tctatattta tttgtaaaaa tocaa.gcata gtttaaaata tdatgtcgat attac tagt c 426 O ttgagtttct aagagggttc tittatgtt at acc aggtaag titataaaag agattalagtg 432O
Ctttitttittc at cacttgat tattittctitt aaaat cagot attacaggat atttitttitat 438 O tittata catg ctgttttitta attaaaatat aat cactgaa gtt tactaat ttgattittat 4 44 O aaggtttgta gcattacaga ataactaaac togggattitat aaaccagotg tdattaacaa 4500 tgtaaagtat taattattga actittgaacc agattitt tag gaaaattatgttctttittcc 456 O c cctittatgg tottaactaa tittgaatcct tcaagaagga tttitt coat a citatttittta 462O agatagaaga taatttgttgg gCaggggtgg aggatgcatg tatgatactic catalaattica 468O acattctitta ctataggtaa togaatgatta taaacaagat gcatc.ttaga tag tattaat 474. O at actgagcc ttggattata tatttaatat agg acctatt ttgaatatt c agittaat cat 48OO atggttcc ta gcttacaagg gctagatcta agattatt co catgagaaat gttgaattta 486 O tgaagaatag attittaaggc tittgaaaatg gttaatttct caaaaacatc aatgtccaaa 492 O catctacctt ttitt catagg agtag acact agcaa.gctgg acaaactatic acaaaagtat 498O ttgtcacaca taacctgtgg totgttgctg attaatacag tactttitt ct tdtgtgattic 5040 ttaa cattat agcacaagta ttatctoragt gigattatccg gaataa.cat c tdaaagatgg 51OO gttcatctat gtttgttgttt gct ctittaaa citattgtttic ticcitatic cca agttcgctitt 516 O gcatctatica gtaaataaaa ttctt cagct gcc titat tag gag togctatgagggtaacac 522 O ctgttctgct titt catcttg tatttagttg actgt attat ttgattt cqg attgaatgaa 528 O tgtaaataga aattaaatgc aaatttgaat gaa cataaaa aaaaaaaaaa aa 5332
<210s, SEQ ID NO 11 &211s LENGTH: 4298 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 11 Cagacaggat attcactgct gtggcaaggc ctgtagagag titt Caagtt aggaggactic 6 O alagacggtco Ct c cctggac ttittctgaag gggct caaaa gatgacacgc gccagagctg 12 O gaaggcgt.cg cca attggtc. caacttitt co ctic ct coctt tttgcggatg agaaaaactg 18O
US 2010/0267,569 A1 Oct. 21, 2010 68
- Continued aacttitttct ttgttgtagt ttittaaattig togatttitta gct atttgac agattaaaag 252O caaaataatc atgccatatt tagt cctoga gttcaagt ct aaatgttgat gtgaaaaatt 2580 attgtagtaa acttittaata toggcaaag.ca accittaa.gct c tattittagc caaatgaaac 264 O ataatctgaa attatattag aacatttic cc ttgtc.ttcaa actgtttggit gtaacagaat 27 OO attgatatgc agcttggtgg attt caccag ttaatgcaca ttcttct tcc citcct coccc 276 O cattaatatg tatactgaaa aatgtgcatt tdtctgagga attattttgt ttgctaccac 282O ttaatgaatc. tcaaaattitt gagtaaatgt acct cagt ct aat cagacitt tittatgacct 288O ttataactac atttaaaacc cittaattic ct atttctgggit gtttgcgagc ctdattgcta 294 O t catgaagta aaaatttatt actictaggta t t cactagot aaataaa.cat agttcttgtt 3 OOO tagcaa.gcat atgttgttcc ticagotcttt tot coagctt ttgcagtgtc. citggcatcct 3 O 6 O taaaat actt togaaaatatg gcc ttgatco atggattaaa toagitaticta agtgaatgtg 312 O ttgatgttitt attgat caga tictatataag tdggaataca gcatatat ct ggatatt citt 318O atagittatct ttittaa catc ttatttittitt cattaattac at atcaa.cat taattttgta 324 O t cittgaagica aattgattitt gtata attaa atgtgtcaag catctgtatt aattgatttg 33 OO atgg cataag gttatgaaaa taatgtactg ccc catgitat tactgttcca aaaggagaaa 3360 gctatgtaga aagata catt aagggtgaaa at agcaatac agtagatttgaataccttga 342O tgttittgcat tacttcattt atgtttacat catgtttaga aatgtttitca tttactgtgg 3480 t ctittggtca citt cagotca aag acctagt gatggatatt totttgaggc titt catttat 354 O ataattitt at tttgtacaat gtttitttitta aatgtgcaaa tactg tatt c aagtgaaaaa 36OO aatacagtat ttgtagataa ccatagotac tacacagttc titcgg tagtic ccagtgtagt 366 O tatat cagtg titt actgaag ggaacatcaa aat attaatg gtatattata aaataaagac 372 O titt cittaaag gaaaattgca cct attttac Ctttittaaga gtaagc.catgaaatc.ttgta 378 O acatgtct ct taactattta taatgaaaag tdgcatttgg gtatagt cac cacagcaatg 384 O ttctacat co ctaagattat c tagg tagga catgtcaaag atgactgttg to attctgga 3900 ggtcct atta gagaat atta taaaagggitg accttgtagg aaggatctgagtic ct coccC 396 O tgaggttctic tttittcttgg togctitt atta gcaactctgg at atttittat aaaac tagtt 4 O2O acattataaa cqgtttcaaa catgtttaat ttacattagg tttittatgta agagtgt cat 4 O8O ggaagc actic agcaa.gcagg Ctgattgcaa tag acticaga catgcgaata aatgtaattg 414 O agagtc. tatt catggtgagg agtacatc.cc agtgc ctitta acctggattt ctaat cittaa 42OO gtgaaatggg togcago attc ctittggaaaa aaaaatc.ttt ttattittcaa gtgataattit 426 O tgttgtttittc. tcatataagt tttct coaga gcacccacct tct ctitcctt cittggtctgt 432O cattatattg caaaat attt titcct ctdaa tdaaattatc acaggttgtc. tcaag cacaa 438 O cCaactgaat gtctcittaac ttggggacc aaaagggaga gag cctgggg. tct acaagag 4 44 O gaga cacatc atcaaatgtt togaatgatca caaattalaga cattatcago ccagtaaatt 4500 t cittgcttaa totttitt.cca agttctggct tdaat atttic titattaaagc tat cittatgt 456 O ggg tattitta ttittgaaagg tattatagitt totatattta acagtaagga gcaaactgta 462O accaaaatta gtatttct ct atacg tattg gtacttgaag attcc titt.ca aaagaaatcc 468O agcgttitt co taattittagt acttaatttic tictttittaat ttaagtgat c tittctaattic 474. O
US 2010/0267,569 A1 Oct. 21, 2010 71
- Continued titt catttat atctgaatga aaatatgaat gactictaagt aattgaatta attaaaatga 246 O gccaacttitt ttittaacaat ttacatttta tittctatggg aaaaaataaa tatt cotctt 252O ctaacaaacc catgcttgat titt cattaat tdaattic caa atcatcc tag ccatgtgtc.c 2580 titccatttag gttactgggg caaat cagta agaaagttct tatatttat g c to caaataa 264 O ttctgaagtic ct cittactag ctgtgaaag.c tag tactatt aagaaagaaa acaaaatticc 27 OO caaaagatag ctitt cactitt ttitttitt.cct taaag acttic ctaattctict tct coaaatt 276 O cittagt ctitc ttcaaaataa tatgctittgg ttcaatagitt atccacatt c tdacagticta 282O atttagttitt aat cagaatt atact catct tttggg tagt catagatatt aagaaagcaa. 288O gagttt Ctta t t c cagtta tigaatattt CCtaaagcaa ggctgcaggt gaagttgttgc 294 O t caagtgaat gttcaggaga cacaatticag taagaaat taagt ctitta aaaaagacict 3 OOO aggaatagga galaccatgga aattgaggag gtaggcctac aagtagatat tdggaacaaa 3 O 6 O attagagagg caaccagaaa aagttattitt aggct cacca gagttgttct tattgcacag 312 O taacacacca atataccalaa acago aggta ttgcagtaga gaaagagttt aataattgaa 318O tggcagaaaa atgaggaagg ttgaggaaac Ctcaaatcta cct Coctgct gag totalagt 324 O ttaggattitt taa.gagaaag gCagg talagg totgaaggt Ctggagctgc tigatttgttg 33 OO gggtataggg aatgaaatga aac at acaga gatgaaaact ggaagtttitt ttttgtttgt 3360 tttgttttitt ttttgttgtt gttttitttitt tttitttgttt ttttgctgag toaattic ctt 342O ggaggggg.tc titcagactga Ctggtgtcag Cagacccatg ggatt Coaag atctggaaaa 3480
Ctttittagat agaaacttga tigttt cittaa cqttacatat attat cittat agaaataact 354 O aagggaagtt agtgccttgt gacca Catct atgtgactitt taggcagtaa gaalactataa 36OO ggaaaggagc taa.cagt cat gctgtaagta gct acaggga attggcttaa agggcaagtt 366 O ggittag tact tagctgtgtt tittatt caaa gtctacattt tatgtag tigg ttaatgtttg 372 O ctgttcatta ggatggitttc acagttacca tacaaatgta gaa.gcaa.cag gtccaaaaag 378 O tagggcatga titt totCcat gtaatcCagg gagaaaacaa gcc atgacca ttgttggttg 384 O ggagactgaa gotgattgaa gottcaccat catcct cacc aacttittggg ccataattica 3900
Ccca accctt tdtggagcc taaaaaaat Ctgggcagaa ttaggactt Ctttattittg 396 O tittaaagggg taacacagag tec cctitatg aaggagttgg agatcCtgca aggaagagaa 4 O2O ggagtgaagg agagat Caag agagagaaac aatgaggaac attt catttg acccalacat C 4 O8O ctittaggagc ataaatgttg acactaagtt atc ccttittg togctaaaatg gacag tattg 414 O gcaaaatgat accacaactt cittatt ct ct ggctictatat tdctittggala acacttaaac 42OO atcaaatgga gttaaataca tatttgaaat ttaggittagg aaatattggit gaggaggcct 426 O caaaaagggg gaalacatctt ttgtctggga ggatattitt C cattttgttgg atttic cctga 432O t ctittittcta ccaccctgag giggtggtggg aattatcatt ttgctacatt ttagagg to a 438 O tccaggattt ttgaaactitt acattctitta cqgittaa.gca agatgtacag ct cagtcaaa 4 44 O gacactaaat t cittcttaga aaaatagtgc taaggagtat agcagatgac ctatatgtgt 4500 gttggctggg agaat atcat Cttaaagtga gagtgatgtt gtggaga cag ttgaaatgtc. 456 O aatgctagag cct Ctgtggt gtgaatgggc acgttaggitt gttgcattag aaagtgactg 462O tittctgacag aaatttgtag citttgttgcaa act cacccac catctacct c aataaaatat 468O
US 2010/0267,569 A1 Oct. 21, 2010 76
- Continued attctgctgg atgtcacaga tigaagaaatt tattacgtag ccaaagatgc acaccgcaaa 32O gcaa.cgaaag Ctic ctgcaaa acagctggca Cagtic cagtg cactggctt C cct cactgga 38O
Ctcggtggac tdgtggitta tigat cagga gacagtgaag atgagaggag tacagagga 44 O tctgagt cat Ctgacactga tigatgaagaa ttacggcatc gaatc.cggca aaaac aggaa SOO gctttittgga gaaaagaaaa agaac agcag ct attacatg ataalacagat ggaagaagaa 560 alagcagcaaa Cagaaagggit tacaaaagag atgaatgaat titatic catala agagcaaaat 62O agtttatcac tact agaa.gc aagagaagca gacggtgatg tdgttaatga aaagaagaga 68O actic caaatgaaacca catc agttittagaa ccaaaaaaag agcataaaga aaaagaaaaa 74 O Caaggaagga gtaggit cqgg aagttctagt agtgg tagtt C cagtagcaa tag cagaact 8OO agtag tacta gtag tact.gt citctagotct tcatacagtt ctagotcagg tag tagt cqt 86 O acttcttctic ggit cittctitc. tcc taaaagg aaaaagagac acagtaggag tagat ct coa 92 O acaatcaaag Ctagacgtag caggagtaga agctatt citc gcaga attaa aatagagagc 98 O aatagggcta gggtaaagat tagagataga aggagat cta atagaaatag cattgaaaga 2O4. O gaaagacgac gaaatcggag ticct tcc.cga gagagacgta galagtagaag ticgct calagg 21OO gatagacgaa c caatcgtgc cagtc.gcagt aggagtic gag at aggcgtaa aattgatgat 216 O
Caacgtggaa at Cttagtgg galacagt cat aag cataaag gtgaggctaa agaacaagag 222 O aggaaaaagg agaggagt cd aagtatagat aaagatagga aaaagaaaga caaagaaagg 228O gaacgtgaac aggataaaag aaaagagalaa Caaaaaaggg aagaaaaaga ttittaagttc 234 O agtagt cagg atgatagatt aaaaaggaaa Cagaaagtgaaagaacatt ttctaggagt 24 OO ggttctatat citgttaaaat cataagacat gattictagac aggatagitaa gaaaagtact 246 O accalaagata gtaaaaaa.ca tt Caggct ct gattic tagtg gaaggagcag ttctgagtict 252O cCaggaagta gcaaagaaaa gaaggctaag aag cctaaac at agt catc gcgat.ccgtg 2580 gagaaatcto aaaggt ctgg taagaaggca agcc.gcaaac acaagttctaa gtc.ccgatca 264 O agg tagtata citttittaaag tattttgtct gatttittaaa aaaaattgac tdaatttatt 27 OO caaagttgaaagtgtc.ctitt citct citct ct ttaataaact cagtttggta cittgataaat 276 O aatcat agtic ttaaatgtta gaaatccitat ataat attat ttatttaaaa ttgcagattit 282O ttaatttaaa atacatttitt atttittaa at tttgtcttitt ccc.tttittitt toagat caac 288O alacc cct c cc ct cqtaaac gctgaggaat gatgtggcaa gaatgcc atg atgttctitta 294 O aaaaaatt CC atgagttitta agggcttgtc. t cattataga ggcacattgt ggctgtgtag 3 OOO gtgaaaccag aatcttttitt ttttittaatc td taaatagg td tactttitt ccaatgctgc 3 O 6 O tccaagttac ttaataggat ttctttgt at tacgtttittt toaaaaaata tagtgcataa 312 O taagactata aacatgcc at t ct ctitt cag citgitaatgtt cittaaaatta ttcttgaatg 318O tactgttgatgtcaataaagc tictittagttc attitttgtta aa 3222
<210s, SEQ ID NO 18 &211s LENGTH: 3546 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 18 gctgacgc.gc gctgacgc.gc ggagactitta ggtgcatgtt ggcagcggca gcgcaa.gc.ca 6 O
US 2010/0267,569 A1 Oct. 21, 2010 87
- Continued
&211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens
<4 OOs, SEQUENCE: 46 gcgc.cat atc agggtc.cgca agcag 25
<210s, SEQ ID NO 47 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 47 c ctittgc.cga t cogcc.gc.cc gtc.ca 25
SEQ ID NO 48 LENGTH: 25 TYPE: DNA ORGANISM: Homo sapiens
SEQUENCE: 48 gcatgatcaa got aggtotaggitat 25
1. A composition comprising detecting molecule specific SMURF2, SMAD specific E3 ubiquitin protein ligase 2: for determination of the expression of at least six marker STAT5A, signal transducer and activator of transcription 5A; genes, wherein said detecting molecules are selected from YTHDF3, YTH domain family, member 3: AUH, AU RNA isolated detecting nucleic acid molecules and isolated detect binding protein/enoyl-Coenzyme A hydratase: EIF3D, ingamino acid molecules and wherein said at least six marker eukaryotic translation initiation factor 3, subunit D: IFI44L, genes are selected from the group consisting of: MRPS6, interferon-induced protein 44-like: NR4A2, nuclear receptor mitochondrial ribosomal protein S6: CDKN1B, cyclin-de subfamily 4, group A, member 2: RAB3GAP1, RAB3 pendent kinase inhibitor 1B (p27, Kip1); ELF1, E74-like GTPase activating protein subunit 1 (catalytic); MID1 IP1, factor 1 (ets domain transcription factor): NFAT5, nuclear MID1 interacting protein 1 (gastrulation specific G12 factor of activated T-cells 5, tonicity-responsive: NR3C1, homolog (Zebrafish)); RGS16, regulator of G-protein signal nuclear receptor Subfamily 3, group C, member 1 (glucocor ing 16: MARCH7, membrane-associated ring finger ticoid receptor); SARS, seryl-tRNA synthetase; SMURF2, (C3HC4)7; and SFRS18 (C6ORF111), splicing factor, argi SMAD specific E3 ubiquitin protein ligase 2: STAT5A, signal nine?serine-rich 18. transducer and activator of transcription 5A:YTHDF3, YTH 3. The composition according to claim 1, wherein said at domain family, member 3: AUH, AU RNA binding protein/ least six marker genes are selected from the group consisting enoyl-Coenzyme A hydratase: EIF3D, eukaryotic translation of: MRPS6, mitochondrial ribosomal protein S6: CDKN1B, initiation factor 3, subunit D: IFI44L, interferon-induced pro cyclin-dependent kinase inhibitor 1B (p27, Kip1); ELF1 tein 44-like; NR4A2, nuclear receptor Subfamily 4, group A, E74-like factor 1 (ets domain transcription factor); NFAT5, member 2: RAB3GAP1, RAB3 GTPase activating protein nuclear factor of activated T-cells 5, tonicity-responsive; subunit 1 (catalytic); MID1 IP1, MID1 interacting protein 1 NR3C1, nuclear receptor subfamily 3, group C, member 1 (gastrulation specific G12 homolog (Zebrafish)); RGS16, (glucocorticoid receptor); SARS, seryl-tRNA synthetase: regulator of G-protein signaling 16; MARCH7, membrane SMURF2, SMAD specific E3 ubiquitin protein ligase 2: associated ring finger (C3HC4) 7: SFRS18 (C6ORF111), STAT5A, signal transducer and activator of transcription 5A; splicing factor, arginine/serine-rich 18; RPS6KB1, ribosomal YTHDF3, YTH domain family, member 3: AUH, AU RNA protein S6 kinase, 70 kDa, polypeptide 1; and DNAJC12, binding protein/enoyl-Coenzyme A hydratase: EIF3D, DnaJ (Hsp40) homolog, subfamily C, member 12, as set forth eukaryotic translation initiation factor 3, subunit D: IFI44L, in Table 4, said composition is for determining the level of interferon-induced protein 44-like; and NR4A2, nuclear expression of at least one of said marker gene in a biological receptor Subfamily 4, group A, member 2. test sample of a mammalian Subject. 4. The composition according to claim 1, wherein said 2. The composition according to claim 1, wherein said at detecting nucleic acid molecules are isolated oligonucle least six marker genes are selected from the group consisting otides, each oligonucleotide specifically hybridizes to a of: MRPS6, mitochondrial ribosomal protein S6: CDKN1B, nucleic acid sequence of the RNA products of at least one of cyclin-dependent kinase inhibitor 1B (p27, Kip1); ELF1 said at least six marker genes. E74-like factor 1 (ets domain transcription factor); NFAT5, 5. The composition according to claim 4, wherein said nuclear factor of activated T-cells 5, tonicity-responsive; oligonucleotide is any one of a pair of primer or nucleotide NR3C1, nuclear receptor subfamily 3, group C, member 1 probe, and wherein the level of expression of at least one of (glucocorticoid receptor); SARS, seryl-tRNA synthetase: said marker genes is determined using a nucleic acid ampli US 2010/0267,569 A1 Oct. 21, 2010 fication assay selected from the group consisting of a Real binding protein/enoyl-Coenzyme A hydratase: EIF3D, Time PCR, micro arrays, PCR, in situ Hybridization and eukaryotic translation initiation factor 3, subunit D: IFI44L, Comparative Genomic Hybridization. interferon-induced protein 44-like: NR4A2, nuclear receptor 6. The composition according to claim 1, wherein said subfamily 4, group A, member 2: RAB3GAP1, RAB3 detecting amino acid molecules are isolated antibodies, each GTPase activating protein subunit 1 (catalytic); MID1 IP1, antibody binds selectively to a protein product of at least one MID1 interacting protein 1 (gastrulation specific G12 of said at least six marker genes, and wherein the level of homolog (Zebrafish)); RGS16, regulator of G-protein signal expression of said at least one marker gene is determined ing 16: MARCH7, membrane-associated ring finger using an immunoassay selected from the group consisting of (C3HC4)7; and SFRS18 (C6ORF111), splicing factor, argi an ELISA, a RIA, a slot blot, a dot blot, immunohistochemi nine?serine-rich 18, wherein said detecting oligonucleotide cal assay, FACS, a radio-imaging assay and a Western blot. molecules are used for determining the level of expression of 7. The composition according to claim 1, for the detection said at least six marker gene in a sample, and wherein a of at least one mutation in at least one of BRCA1 and BRCA2 differential expression of at least six of said marker genes in genes in a biological test sample of a mammalian Subject, said test sample as compared to a control population is indica which composition comprises isolated detecting oligonucle tive of at least one mutation in at least one of BRCA1 and otides, each oligonucleotide specifically hybridizes to a BRCA2 genes in said subject, and thereby of an increased nucleic acid sequences of RNA products of at least one of said genetic predisposition of said Subject to a cancerous disorder at least six marker genes selected from the group consisting associated with mutations in any one of BRCA1 and BRCA2 of: MRPS6, mitochondrial ribosomal protein S6: CDKN1B, genes. cyclin-dependent kinase inhibitor 1B (p27, Kip1); ELF1 9. The composition according to claim3, for the detection E74-like factor 1 (ets domain transcription factor); NFAT5, of at least one mutation in at least one of BRCA1 and BRCA2 nuclear factor of activated T-cells 5, tonicity-responsive; genes in a biological test sample of a mammalian Subject, NR3C1, nuclear receptor subfamily 3, group C, member 1 which composition comprises isolated detecting oligonucle (glucocorticoid receptor); SARS, seryl-tRNA synthetase: otides, each oligonucleotide specifically hybridizes to a SMURF2, SMAD specific E3 ubiquitin protein ligase 2: nucleic acid sequences of RNA products of at least one of said STAT5A, signal transducer and activator of transcription 5A; at least six marker genes selected from the group consisting YTHDF3, YTH domain family, member 3: AUH, AU RNA of: MRPS6, mitochondrial ribosomal protein S6: CDKN1B, binding protein/enoyl-Coenzyme A hydratase: EIF3D, cyclin-dependent kinase inhibitor 1B (p27, Kip1); ELF1 eukaryotic translation initiation factor 3, subunit D, IFI44L, E74-like factor 1 (ets domain transcription factor); NFAT5. interferon-induced protein 44-like: NR4A2, nuclear receptor nuclear factor of activated T-cells 5, tonicity-responsive; subfamily 4, group A, member 2: RAB3GAP1, RAB3 NR3C1, nuclear receptor subfamily 3, group C, member 1 GTPase activating protein subunit 1 (catalytic); MID1 IP1, (glucocorticoid receptor); SARS, seryl-tRNA synthetase: MID1 interacting protein 1 (gastrulation specific G12 SMURF2, SMAD specific E3 ubiquitin protein ligase 2: homolog (Zebrafish)); RGS16, regulator of G-protein signal STAT5A, signal transducer and activator of transcription 5A; ing 16: MARCH7, membrane-associated ring finger YTHDF3, YTH domain family, member 3: AUH, AU RNA (C3HC4) 7: SFRS18 (C6ORF111), splicing factor, arginine/ binding protein/enoyl-Coenzyme A hydratase: EIF3D, serine-rich 18; RPS6KB1, ribosomal protein S6 kinase, 70 eukaryotic translation initiation factor 3, subunit D: IFI44L, kDa, polypeptide 1; and DNAJC12, DnaJ (Hsp40) homolog, interferon-induced protein 44-like; and NR4A2, nuclear subfamily C, member 12, as set forth in Table 4, wherein said receptor Subfamily 4, group A, member 2, wherein said detecting oligonucleotide molecules are used for determining detecting oligonucleotide molecules are used for determining the level of expression of said at least six marker gene in a the level of expression of said at least six marker gene in a sample, and wherein a differential expression of at least six of sample, and wherein a differential expression of at least six of said marker genes in said test sample as compared to a control said marker genes in said test sample as compared to a control population is indicative of at least one mutation in at least one population is indicative of at least one mutation in at least one of BRCA1 and BRCA2 genes in said subject, and thereby of of BRCA1 and BRCA2 genes in said subject, and thereby of an increased genetic predisposition of said Subject to a can an increased genetic predisposition of said Subject to a can cerous disorder associated with mutations in any one of cerous disorder associated with mutations in any one of BRCA1 and BRCA2 genes. BRCA1 and BRCA2 genes. 8. The composition according to claim 2, for the detection 10. A method for the detection of at least one mutation in at of at least one mutation in at least one of BRCA1 and BRCA2 least one of BRCA1 and BRCA2 genes in a biological test genes in a biological test sample of a mammalian Subject, sample of a mammalian Subject, which method comprises the which composition comprises isolated detecting oligonucle steps of: otides, each oligonucleotide specifically hybridizes to a (a) determining the level of expression of at least six nucleic acid sequences of RNA products of at least one of said marker genes in said test sample and optionally in a at least six marker genes selected from the group consisting Suitable control sample, wherein said at least six marker of: MRPS6, mitochondrial ribosomal protein S6: CDKN1B, genes are selected from any one of: cyclin-dependent kinase inhibitor 1B (p27, Kip1); ELF1 (i) a group consisting of: MRPS6, mitochondrial ribo E74-like factor 1 (ets domain transcription factor); NFAT5, somal protein S6; CDKN1B, cyclin-dependent kinase nuclear factor of activated T-cells 5, tonicity-responsive; inhibitor 1B (p27, Kip1); ELF1, E74-like factor 1 (ets NR3C1, nuclear receptor subfamily 3, group C, member 1 domain transcription factor); NFAT5, nuclear factor (glucocorticoid receptor); SARS, seryl-tRNA synthetase: of activated T-cells 5, tonicity-responsive; NR3C1, SMURF2, SMAD specific E3 ubiquitin protein ligase 2: nuclear receptor subfamily 3, group C, member 1 STAT5A, signal transducer and activator of transcription 5A; (glucocorticoid receptor); SARS, seryl-tRNA syn YTHDF3, YTH domain family, member 3: AUH, AU RNA thetase: SMURF2, SMAD specific E3 ubiquitin pro US 2010/0267,569 A1 Oct. 21, 2010 89
tein ligase 2: STAT5A, signal transducer and activator optionally, aliquots of said control sample or any nucleic of transcription 5A; YTHDF3, YTH domain family, acid or amino acid product obtained therefrom with the member 3: AUH, AU RNA binding protein/enoyl detecting molecules comprised in said array of (I) under Coenzyme A hydratase: EIF3D, eukaryotic transla conditions allowing for detection of the expression of tion initiation factor 3. subunit D: IFI44L, interferon said marker genes and said control genes in said test and induced protein 44-like; and NR4A2, nuclear optionally, control samples; and receptor subfamily 4, group A, member 2: (III) determining the level of the expression of said at least (ii) the group as defined in (i) further consisting of: six marker genes and of at least one control gene in the RAB3GAP1, RAB3 GTPase activating protein sub test and optionally, control samples contacted with unit 1 (catalytic); MID1 IP1, MID1 interacting protein detecting molecules comprised in said array of (I) by 1 (gastrulation specific G12 homolog (Zebrafish)); suitable means. RGS16, regulator of G-protein signaling 16; 12. The method according to claim 11, wherein said detect MARCH7, membrane-associated ring finger ing nucleic acid molecules are isolated oligonucleotides, each (C3HC4)7; and SFRS18 (C6ORF111), splicing fac oligonucleotide specifically hybridizes to a nucleic acid tor, arginine/serine-rich 18; sequence of the RNA products of at least one of said at least (iii) the group as defined in (i) further consisting of: six marker genes or of at least one of said control genes. RAB3GAP1, RAB3 GTPase activating protein subunit 13. The method according to claim 11, wherein said iso 1 (catalytic); MID1 IP1, MID1 interacting protein 1 lated detecting amino acid molecules are isolated antibodies, (gastrulation specific G12 homolog (Zebrafish)); each antibody binds selectively to a protein product of at least RGS16, regulator of G-protein signaling 16; MARCH7. one of said at lest six marker genes or of said at least one membrane-associated ring finger (C3HC4) 7; and control genes. SFRS18 (C6ORF111), splicing factor, arginine/serine 14. The method according to claim 10, wherein said bio rich 18; RPS6KB1, ribosomal protein S6 kinase, 70 logical sample is any one of blood, blood cells, serum, kDa, polypeptide 1; and DNAJC12, DnaJ (Hsp40) plasma, urine, sputum, saliva, faeces, semen, spinal fluid or homolog, subfamily C, member 12, as set forth in Table CSF, lymph fluid, the external secretions of the skin, respira 4. tory, intestinal, and genitourinary tracts, tears, milk, any (b) determining the level of expression of at least one human organ or tissue, any sample obtained by lavage option control gene in said test sample and optionally, in a ally of the breast ductal system, plural effusion, samples of in suitable control sample: vitro or ex vivo cell culture and cell culture constituents. (c) comparing the expression values obtained in steps (a) 15. The method according to claim 14, wherein said sample and (b) of each marker gene in said test sample with a is a sample of in vitro, ex vivo cell culture, or blood cells and corresponding predetermined cutoff value of each said wherein said method further comprises the step of inducing a marker gene; and DNA damage in said cells by a suitable means. (d) determining whether said expression value of each said 16. A diagnostic kit comprising: marker gene is positive and thereby belongs to a pre (a) means for obtaining a sample of a mammalian Subject; established carrier population or is negative and belongs (b) detecting molecules specific for determining the level to a pre-established non-carrier population; of expression of at least six marker genes, wherein said Wherein the presence of at least six marker genes with a detecting molecules are selected from isolated detecting positive expression value indicates that said subject is a car nucleic acid molecules and isolated detecting amino rier of at least one mutation of at least one of BRCA1 or acid molecules, and wherein said at least six marker BRCA2 gene. genes are selected from any one of: 11. The method according to claim 10, wherein determin (i) a group consisting of: MRPS6, mitochondrial ribo ing the level of expression of at least six of said marker genes somal protein S6; CDKN1B, cyclin-dependent kinase according to step (a) and of at least one of said control gene inhibitor 1B (p27, Kip1); ELF1, E74-like factor 1 (ets according to step (b), in a test sample and optionally in a domain transcription factor); NFAT5, nuclear factor control sample is performed by a method comprising the of activated T-cells 5, tonicity-responsive; NR3C1, steps of: nuclear receptor subfamily 3, group C. member 1 (I) providing an array comprising: (glucocorticoid receptor); SARS, seryl-tRNA syn (A) detecting molecules specific for determining the thetase; SMURF2, SMAD specific E3 ubiquitin pro expression of at least six of said marker genes, tein ligase 2: STAT5A, signal transducer and activator wherein each of said detecting molecules is located in of transcription 5A: YTHDF3, YTH domain family, a defined position in said array, and wherein said member 3: AUH, AU RNA binding protein/enoyl detecting molecules are selected from isolated detect Coenzyme A hydratase: EIF3D, eukaryotic transla ing nucleic acid molecules and isolated detecting tion initiation factor 3, subunit D; IFI44L, interferon amino acid molecules; and induced protein 44-like; and NR4A2, nuclear (B) at least one detecting molecule specific for determi receptor subfamily 4, group A, member 2: nation of the expression of at least one of said control (ii) the group as defined in (i) further consisting of: gene, wherein each of said detecting molecules is RAB3GAP1, RAB3 GTPase activating protein sub located in a defined position in said array and wherein unit 1 (catalytic); MID1 IP1, MID1 interacting protein said detecting molecule is selected from isolated 1 (gastrulation specific G12 homolog (Zebrafish)); detecting nucleic acid molecule and isolated detecting RGS16, regulator of G-protein signaling 16: amino acid molecule: MARCH7, membrane-associated ring finger (II) contacting aliquots of said test sample or any nucleic (C3HC4)7; and SFRS18 (C6orf111), splicing factor, acid or amino acid product obtained therefrom, and arginine/serine-rich 18; US 2010/0267,569 A1 Oct. 21, 2010 90
(iii) the group as defined in (i) further consisting of: nucleic acid sequence of the RNA products of at least one of RAB3GAP1, RAB3 GTPase activating protein sub said at least six marker genes or of at least one of said control unit 1 (catalytic); MID1 IP1, MID1 interacting protein gene. 1 (gastrulation specific G12 homolog (Zebrafish)); 18. The kit according to claim 17, wherein said oligonucle RGS16, regulator of G-protein signaling 16: otide is any one of a pair of primers or nucleotide probe. MARCH7, membrane-associated ring finger 19. The kit according to claim 18, further comprising at (C3HC4)7; and SFRS18 (C6orf111), splicing factor, least one reagent for performing a nucleic acid amplification arginine/serine-rich 18; RPS6KB1, ribosomal protein based assay selected from the group consisting of a Real S6 kinase, 70 kDa, polypeptide 1; and DNAJC12, Time PCR, micro arrays, PCR, in situ Hybridization and DnaJ (Hsp40) homolog, subfamily C, member 12, as Comparative Genomic Hybridization. set forth in Table 4; 20. The kit according to claim 16, wherein said isolated (c) at least one detecting molecule specific for determining detecting amino acid molecule is an isolated antibody which the expression of at least one control gene; binds selectively to the protein product of at least one of said at least six marker genes or of at least one of said control (d) optionally, at least one control sample selected from a genes. negative control sample and a positive control sample: 21. The kit according to claim 16, for performing the (e) instructions for carrying out the detection and quanti method according to claim 10. fication of expression of said at least six marker genes 22. The kit according to claim 16, for detecting of at least and of at least one control gene in said sample, and for one mutation in at least one of BRCA1 and BRCA2 genes in obtaining an expression value of each of said marker a mammalian Subject. genes; and 23. The kit according to claim 22, wherein detection of a (f) instructions for comparing the expression values of each mutation in any one of BRCA1 or BRCA2 genes is indicative marker gene in said test sample with a corresponding of an increased genetic predisposition of said Subject to a predetermined cutoff value of each said marker gene and cancerous disorder associated with mutations in at least one determining a positive or negative results thereby evalu of BRCA1 and BRCA2. ating the differential expression of said marker gene in 24. The kit according to claim 23, wherein said cancerous said sample. disorder is any disorder of the group consisting of breast, 17. The kit according to claim 16, wherein said isolated ovary, pancreas and prostate carcinomas. detecting nucleic acid molecules are isolated oligonucle otides, which oligonucleotide specifically hybridizes to a ck : * : *k