DOCSLIB.ORG

A Thesis Entitled an Investigation of Personal Ancestry Using

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Thesis Entitled an Investigation of Personal Ancestry Using A Thesis entitled An Investigation of Personal Ancestry Using Haplotypes by Patrick Brennan Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Master of Science Degree in Biomedical Science: Bioinformatics, Proteomics, and Genomics ________________________________________ Dr. Alexei Fedorov, Committee Chair ________________________________________ Dr. Robert Blumenthal, Committee Member ________________________________________ Dr. Sadik Khuder, Committee Member ________________________________________ Dr. Amanda Bryant-Friedrich, Dean College of Graduate Studies The University of Toledo August 2017 Copyright 2017, Patrick John Brennan This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of An Investigation of Personal Ancestry Using Haplotypes by Patrick Brennan Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Master of Science Degree in Biomedical Science: Bioinformatics, Proteomics, and Genomics The University of Toledo August 2017 Several companies over the past decade have started to offer ancestry analysis, the most notable company being 23andMe. For a relatively low price, 23andMe will sequence select variants in a person’s genome to determine where their ancestors came from. Since 23andMe is a private company, the exact techniques and algorithms it uses to determine ancestry are proprietary. Many customers have wondered about the accuracy of these results, often citing their own genealogical research of recent ancestors. To bridge the gap between 23andMe and the public, we sought to provide a tool that could assess the ancestry results of 23andMe. Using publicly available 23andMe genotype files, we constructed a program pipeline that takes these files and compares them against genomes from the 1000 Genomes Project. We constructed haplotypes from the 23andMe file by converting 50 adjacent SNPs (single nucleotide polymorphisms) into haplotypes and comparing them against the haplotypes of 2504 individuals in the Phase 3 data from the 1000 Genome Project. To smooth the data, we bundled together six of our haplotype segments to form an “IBD segment” (Identity-by-descent segment) and used a point scoring system to calculate the highest matching population. Our pipeline determined iii ancestry results for 57 individuals with similar results to 23andMe. Fifty of our subjects showed European ancestry, while the other seven subjects showed ancestry from East Asia, Africa, America, and South Asia. Of our 5 geographic categories (South Asia, Africa, America, Europe, East Asia), 98% of our subjects showed ancestral representation from 4 of the 5 categories. In addition to ancestry, we also investigated IBD sharing across populations, particularly IBD segments in the Human Leukocyte Antigen (HLA) region on chromosome 6. We hope this tool will help 23andMe customers and those of similar genotyping companies understand the methods used to determine ancestry and verify their results. iv I dedicate this thesis to my wife, Madeline. She has been incredibly supportive of me throughout my two years at The University of Toledo. Her encouragement and trust has allowed me to flourish and become a better student and person. Acknowledgements I would like to thank Dr. Alexei Fedorov for accepting me into his lab and teaching me how to program. Programming is something I have come to enjoy immensely, and I owe it to him for introducing me to the world of computer programming. I would also like to thank my committee members Dr. Robert Blumenthal and Dr. Sadik Khuder for the guidance they provided as I worked though this thesis. I also give thanks to Jo Anne Gray who has provided enormous help over the past two years. Lastly, I would like to thank my lab colleagues Basil Khuder, Sharmistha Chakrabortty, and Rajib Dutta for their friendship and help throughout this project. v Table of Contents Abstract .............................................................................................................................. iii Acknowledgements ..............................................................................................................v Table of Contents ............................................................................................................... vi List of Tables ................................................................................................................. viii List of Figures .................................................................................................................... ix List of Abbreviations ...........................................................................................................x 1 Chapter 1: An Investigation of Ancestry Using Haplotypes ...................................1 1. Introduction ..................................................................................................1 1.1 History of 23andMe .........................................................................1 1.2 Haplotypes .......................................................................................3 1.3 IBD Background……………………………………………….….5 1.4 Current Tools……………………………………...………………6 2. Material & Methods……………………………………………………….8 3. Results……………………………………………………………………..9 3.1 23andMe File……………………………………………………...9 3.2 Extracting Data from Phase 3……………………………………10 3.3 Haplotype Construction………………………………………….11 3.4 Ancestry Analysis……………………………………………..…12 vi 3.5 European Ancestry………………………………………………15 3.6 IBD Sharing……………………………………………………..15 4. Discussion……………………………………………………………….31 4.1 Future Work……………………………………………………….…34 References ..........................................................................................................................36 Appendix A ........................................................................................................................39 vii List of Tables 1 Format of the 23andMe File ..................................................................................17 2 Table Used for Haplotype Construction ................................................................18 3 Ancestry Results for 57 Subjects using IBD Analysis...............................28, 29, 30 A.1 Characterization of Populations in Phase 3 1000 Genomes Data ..........................39 viii List of Figures 1 Characterization of 23andMe File with Filtering...................................................18 2 Haplotype Construction and Characterization .......................................................20 3 Before and After IBD Smoothing Technique ........................................................21 4 Haplotype Segments Created by build_haplo_v2.pl ..............................................22 5 Creation of IBD Segments and Scoring………………………………………….23 6 Amount of IBD Sharing by Chromosome……………………………………….24 7 IBD Results vs 23andMe Results for Control 1…………………………………25 8 IBD Results vs 23andMe Results for Control 3…………………………………26 9 IBD Results vs 23andMe Results for Control 4…………………………………27 ix List of Abbreviations DNA………………… Deoxyribonucleic Acid HLA ………………… Human Leukocyte Antigen IBD ………………….. Identical - by – Descent Mb …………………… Megabase (1 Million Base Pairs) SNP ............................Single Nucleotide Polymorphism VCF ............................Variant Call Format x Chapter 1 An Investigation of Personal Ancestry Using Haplotypes 1. Introduction: 1.1 History of 23andMe: 23andMe is a genomics company that was cofounded by Linda Avey and Anne Wojcicki in 2006 (Goetz, et al. 2007). 23andMe offers an ancestry and health analysis service based on the customer’s DNA. It sends the customer a kit that includes a tube, a specimen bag, and a prepaid shipping box; the customer is instructed to spit in the tube and return the kit to the company. When 23andMe receives the kit, the DNA is extracted from the saliva and is genotyped at variants that are important for health and ancestry determination. Once the DNA has been genotyped, the customer receives a health report that lets them know whether they are at risk for select common diseases. The ancestry report gives the customer a percentage breakdown of the geographical regions from which their ancestors came (Goetz, et al. 2007). When it started in 2007, 23andMe’s service was $999 (Baertlein, et al. 2007.. Now, ten years later, the price has dropped to as low as $99. With reduced cost and greater availability, one of Wojcicki’s goals is to bring the field of genetics to the public to allow them to make decisions about their health. In 1 an interview Wojicicki stated, “I want 25 million people. Once you get 25 million people, there's just a huge power of what types of discoveries you can make. Big data is going to make us all healthier. What kind of diet should certain people be on? Are there things people are doing that make them really high-risk for cancer? There's a whole group of people who are 100-plus and have no disease. Why?" (Murphy, et al. 2013). Genomics has suddenly become accessible to the public, and there is more and more curiosity about what our DNA can tell us. While 23andMe remains a leader in the public’s relationship to genomics, one potential issue is that since 23andMe is a private company, transparency in their methods and data is limited. Skeptics may wonder, “How did they determine that?”, “What methods do they use?”, and “How might I verify their results?”. There are numerous examples of
Load more

Recommended publications
  • Association Between Haplotypes and Specific Mutations in Swiss Cystic Fibrosis Families
    003 I -3'19Xj9 1/3004-0304903.00/0 PEDIATRIC RESEARCH Vol. 30. No. 4, 199 1 Copyright (5 1991 International Pediatric Research Foundation. Inc. h.i~~rc,d~n U..S .,I Association between Haplotypes and Specific Mutations in Swiss Cystic Fibrosis Families SABINA LIECHTI-GALLATI. NASEEM MALIK, MUALLA ALKAN, MARC0 MAECHLER, MICHAEL MORRIS, FRANCINE THONNEY, FELIX SENNHAUSER. AND HANS MOSER Mrclic.al Gcnctics Unii, Dcy~ur/mo~to/'Pedinfrics (In.vel.~pitol). Universirv of Bun. 3010 Bern. S+t.itzerlancl [S.L.-G.. H. \I./: Dc,[)a~.~n~e/i/c!f Gc~ndics, Urli~~rr:cilj~ C'lli/dr.c,n'.c Ho.sl)ital. 4058 Rct.scl. S~.t'il~er.lr~tlrl/N.iC/., M.A I, 117slitrrcc~of iLlcelicol G'enclic.~,U~ri~~er.eitj~ c?fZuric/z, 8001 Zz~ricIi,Swi~z~rland /.IJLI.Mu.]; 11i.cfil~rle of Medicrcl Genetics, Uni1~wvi11,of Geticvu, Centre M6dical Uniro-situire, I21 1 Gencva 4. S~t~irzerluncl/Mi.Mo.J; Mediccrl Gcnrtic.~L'/li/. Uni~~c~r.sit~~of Lu~l.sc~nne, C'c~nrrc Hospitnlier U~iil~c~~sitaircI.i~ucloi.c.. 101 1 Larl.trrtlne. S~~~itserlanci [F T.];NIICI C/II/C/~CII'SHo.el~;tal. SI. Gallen, S~t.itzerlu~lc//F.S.] ABSTRACT. Cystic fibrosis (CF) is the most common CF is the most common severe autosomal recessive genetic severe autosomal recessive genetic disorder in Caucasian disorder in Caucasian populations. with an incidence of about 1 populations, with an incidence of about 1 in 2000 live in 2000 live births, implying a carrier frequency of about 1 in births, implying a carrier frequency of about 1 in 22.
    [Show full text]
  • Family Tree Dna Complaints
    Family Tree Dna Complaints If palladous or synchronal Zeus usually atrophies his Shane wadsets haggishly or beggar appealingly and soberly, how Peronist is Kaiser? Mongrel and auriferous Bradford circlings so paradigmatically that Clifford expatiates his dischargers. Ropier Carter injects very indigestibly while Reed remains skilful and topfull. Family finder results will receive an answer Of torch the DNA testing companies FamilyTreeDNA does not score has strong marks from its users In summer both 23andMe and AncestryDNA score. Sent off as a tree complaints about the aclu attorney vera eidelman wrote his preteen days you hand parts to handle a tree complaints and quickly build for a different charts and translation and. Family Tree DNA Reviews Legit or Scam Reviewopedia. Want to family tree dna family tree complaints. Everything about new england or genetic information contained some reason or personal data may share dna family complaints is the results. Family Tree DNA 53 Reviews Laboratory Testing 1445 N. It yourself help to verify your family modest and excellent helpful clues to inform. A genealogical relationship is integrity that appears on black family together It's documented by how memory and traditional genealogical research. These complaints are dna family complaints. The private history website Ancestrycom is selling a new DNA testing service called AncestryDNA But the DNA and genetic data that Ancestrycom collects may be. Available upon request to family tree dna complaints about family complaints and. In the authors may be as dna family tree complaints and visualise the mixing over the match explanation of your genealogy testing not want organized into the raw data that is less.
    [Show full text]
  • The Role of Haplotypes in Candidate Gene Studies
    Genetic Epidemiology 27: 321–333 (2004) The Role of Haplotypes in Candidate Gene Studies Andrew G. Clarkn Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York Human geneticists working on systems for which it is possible to make a strong case for a set of candidate genes face the problem of whether it is necessary to consider the variation in those genes as phased haplotypes, or whether the one-SNP- at-a-time approach might perform as well. There are three reasons why the phased haplotype route should be an improvement. First, the protein products of the candidate genes occur in polypeptide chains whose folding and other properties may depend on particular combinations of amino acids. Second, population genetic principles show us that variation in populations is inherently structured into haplotypes. Third, the statistical power of association tests with phased data is likely to be improved because of the reduction in dimension. However, in reality it takes a great deal of extra work to obtain valid haplotype phase information, and inferred phase information may simply compound the errors. In addition, if the causal connection between SNPs and a phenotype is truly driven by just a single SNP, then the haplotype- based approach may perform worse than the one-SNP-at-a-time approach. Here we examine some of the factors that affect haplotype patterns in genes, how haplotypes may be inferred, and how haplotypes have been useful in the context of testing association between candidate genes and complex traits. Genet. Epidemiol. & 2004 Wiley-Liss, Inc. Key words: haplotype inference; haplotype association testing; candidate genes; linkage equilibrium Grant sponsor: NIH; Grant numbers: GM65509, HL072904.
    [Show full text]
  • The Canada's History Beginner's Guide to Genetic
    THE CANADA’S HISTORY BEGINNER’S GUIDE TO GENETIC GENEALOGY Read in sequence or browse as you see fit by clicking on any navigation item below. Introduction C. How to proceed A. To test or not Testing strategies for beginners Reasons for testing Recovery guide for those who tested and were underwhelmed Bogus reasons for not testing Fear of the test D. Case studies “The tests are crap” Confirming a hypothesis with autosomal DNA Price Refuting a hypothesis with autosomal DNA Substantive reasons for not testing Confirming a hypothesis with Y DNA Privacy concerns Developing (and then confirming) a hypothesis with Unexpected findings autosomal DNA Developing a completely unexpected hypothesis from B. The ABCs of DNA testing autosomal DNA The four major testing companies (and others) Four types of DNA and three major genetic genealogy tests E. Assorted observations on interpreting DNA tests Mitochondrial DNA (mtDNA) Y DNA F. More resources Autosomal DNA (atDNA) Selected recent publications X DNA Basic information about genetic genealogy Summarizing the tests Blogs by notable genetic genealogists (a selective list) Tools and utilities © 2019 Paul Jones The text of this guide is protected by Canadian copyright law and published here with permission of the author. Unless otherwise noted, copyright of every image resides with the image’s owner. You should not use any of these images for any purpose without the owner’s express authorization unless this is already granted in a cited license. For further information or to report errors or omissions, please contact Paul Jones. CANADASHISTORY.CA ONLINE SPECIAL FEATURE 2019 1 Introduction The “bestest best boy in the land” recently had his DNA tested.
    [Show full text]
  • Haplotype Tagging Reveals Parallel Formation of Hybrid Races in Two Butterfly Species
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.113688; this version posted May 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title: Haplotype tagging reveals parallel formation of hybrid races in two butterfly species One-sentence summary: Haplotagging, a novel linked-read sequencing technique that enables whole genome haplotyping in large populations, reveals the formation of a novel hybrid race in parallel hybrid zones of two co-mimicking Heliconius butterfly species through strikingly parallel divergences in their genomes. Short title: Haplotagging reveals parallel formation of hybrid races Keywords: Butterfly, Genomes, Clines, Hybrid zone, [local] adaptation, haplotypes, population genetics, evolution bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.113688; this version posted May 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Authors: Joana I. Meier1,2,*, Patricio A. Salazar1,3,*, Marek Kučka4,*, Robert William Davies5, Andreea Dréau4, Ismael Aldás6, Olivia Box Power1, Nicola J. Nadeau3, Jon R. Bridle7, Campbell Rolian8, Nicholas H. Barton9, W. Owen McMillan10, Chris D. Jiggins1,10,†, Yingguang Frank Chan4,† Affiliations: 1. Department of Zoology, University of Cambridge, Downing Street, Cambridge, CB2 3EJ, United Kingdom 2. St John’s College, University of Cambridge, Cambridge, CB2 1TP, United Kingdom 3.
    [Show full text]
  • Haplotype Inference from Pedigree Data and Population Data
    HAPLOTYPE INFERENCE FROM PEDIGREE DATA AND POPULATION DATA by XIN LI Submitted in partial ful¯llment of the requirements For the Degree of Doctor of Philosophy Dissertation Advisor: Jing Li Department of Electrical Engineering and Computer Science CASE WESTERN RESERVE UNIVERSITY January, 2010 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of _____________________________________________________ candidate for the ______________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. Table of Contents List of Tables iv List of Figures v Acknowledgments vi Abstract vii Chapter 1. Introduction 1 1.1 Statistical methods . 3 1.2 Rule-based methods . 4 1.2.1 MRHC . 4 1.2.2 ZRHC . 5 Chapter 2. Problem statement and solutions 8 2.1 Large Pedigrees: manipulation of Mendelian constraints . 9 2.2 Families with many markers: dealing with recombinations . 9 2.3 Mixed data: use of population information . 10 Chapter 3. Preliminaries 12 3.1 Mendelian and zero-recombinant constraints . 14 3.2 Locus graphs . 15 3.3 Linear constraints on h variables . 17 Chapter 4. Linear Systems on Mendelian Constraints 19 4.1 Methods to solve the linear systems . 19 4.1.1 Split nodes to break cycles . 20 4.1.2 Detect path constraints from locus graphs . 21 4.1.3 Encode path constraints in disjoint-set structure D . 26 ii 4.2 Analysis of the algorithm on tree pedigrees with complete data 31 4.3 Extension to General Cases . 33 4.3.1 Pedigrees with mating loops .
    [Show full text]
  • Statistical Genetics – Part I
    Statistical Genetics –Part I Lecture 3: Haplotype reconstruction Su‐In Lee, CSE & GS, UW [email protected] 1 Outline Basic concepts Allele, allele frequencies, genotype frequencies Haplotype, haplotype frequency Recombination rate Linkage disequilibrium Haplotype reconstruction Parsimony‐based approach EM‐based approach Next topic Disease association studies 2 1 Alleles Alternative forms of a particular sequence Each allele has a frequency, which is the proportion of chromosomes of that type in the population C, G and -- are alleles …ACTCGGTTGGCCTTAATTCGGCCCGGACTCGGTTGGCCTAAATTCGGCCCGG … …ACTCGGTTGGCCTTAATTCGGCCCGGACTCGGTTGGCCTAAATTCGGCCCGG … …ACCCGGTAGGCCTTAATTCGGCCCGGACCCGGTAGGCCTTAATTCGGCCCGG … …ACCCGGTAGGCCTTAATTCGGCC--GGACCCGGTAGGCCTTAATTCGGCCCGG … …ACCCGGTTGGCCTTAATTCGGCCGGGACCCGGTTGGCCTTAATTCGGCCGGG … …ACCCGGTTGGCCTTAATTCGGCCGGGACCCGGTTGGCCTTAATTCGGCCGGG … single nucleotide polymorphism (SNP) allele frequencies for C, G, -- 3 Allele Frequency Notations For two alleles Usually labeled p and q = 1 –p e.g. p = frequency of C, q = frequency of G For more than 2 alleles Usually labeled pA, pB, pC ... … subscripts A, B and C indicate allele names 4 2 Genotype The pair of alleles carried by an individual If there are n alternative alleles … … there will be n(n+1)/2 possible genotypes In most cases, there are 3 possible genotypes Homozygotes The two alleles are in the same state (e.g. CC, GG, AA) Heterozygotes The two alleles are different (e.g. CG, AC) 5 Genotype Frequencies Since alleles occur in pairs, these
    [Show full text]
  • Searching the Internet for Genealogical and Family History Records
    Searching the Internet for Genealogical and Family History Records Welcome Spring 2019 1 Joseph Sell Gain confidence in your searching Using Genealogy sources to find records Course Objectives Improve your search skills Use research libraries and repositories 2 Bibliography • Built on the course George King has presented over several years • “The Complete Idiot’s Guide to Genealogy” Christine Rose and Kay Germain Ingalls • “The Sources – A Guidebook to American Genealogy” –(ed) Loretto Dennis Szuco and Sandra Hargreaves Luebking • “The Genealogy Handbook” – Ellen Galford • “Genealogy Online for Dummies” – Matthew L Helm and April Leigh Helm • “Genealogy Online” – Elizabeth Powell Crowe • “The Everything Guide to Online Genealogy” – Kimberly Powell • “Discover the 101 Genealogy Websites That Take the Cake in 2015” – David A Frywell (Family Tree Magazine Sept 2015 page 16) 3 Bibliography (Continued) • “Social Networking for Genealogist”, Drew Smith • “The Complete Beginner’s Guide to Genealogy, the Internet, and Your Genealogy Computer Program”, Karen Clifford • “Advanced Genealogy – Research Techniques” George G Morgan and Drew Smith • “101 of the Best Free Websites for Climbing Your Family Tree” – Nancy Hendrickson • “AARP Genealogy Online tech to connect” – Matthew L Helm and April Leigh Helm • Family Tree Magazine 4 • All records are the product of human endeavor • To err is human • Not all records are online; most General records are in local repositories Comments • Find, check, and verify the accuracy of all information • The internet is a dynamic environment with content constantly changing 5 • Tip 1: Start with the basic facts, first name, last name, a date, and a place. • Tip 2: Learn to use control to filter hits.
    [Show full text]
  • How Anne Wojcicki Took the Start-Up Firm from the Brink of Failure to Scientific Pre-Eminence
    THE RISE, FALL AND RISE AGAIN OF 23ANDME HOW ANNE WOJCICKI TOOK THE START-UP FIRM FROM THE BRINK OF FAILURE TO SCIENTIFIC PRE-EMINENCE. BY ERIKA CHECK HAYDEN 174 | NATURE | VOL 550 | 12 OCTOBER©2017 2017Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. FEATURE NEWS Anne Wojcicki founded the Alzheimer’s disease. Surfing a wave of positive news, the company has consumer-genetics firm since launched an advertising blitz to dramatically expand its customer 23andme in 2006 and aims base to 10 million people. to expand its customer 23andme has always been the most visible face of direct-to-consumer base to 10 million. genetic testing, and it is more formidable now than ever before. In September, the company announced that it had raised US$250 million: more than the total amount of capital raised by the company since its inception. Investors estimate that it is worth more than $1 billion, making it a ‘unicorn’ in Silicon Valley parlance — a rare and valuable thing to behold. But for scientists, 23andme’s real worth is in its data. With more than 2 million customers, the company hosts by far the largest collection of gene-linked health data anywhere. It has racked up 80 publications, signed more than 20 partnerships with pharmaceutical firms and started a therapeutics division of its own. “They have quietly become the largest genetic study the world has ever known,” says cardiologist Euan Ashley at Stanford University, California.
    [Show full text]
  • Why Is This $99 Home DNA Kit Causing Such an Uproar?
    http://genomemag.com/ Your Health Is Personal Why Is This $99 Home DNA Kit Causing Such an Uproar? 23andMe says it can provide you with valuable health information about your genes. The FDA says prove it. What the consumer genetic testing battle means for you. BY JOSEPH GUINTO Would you give someone you love a small plastic vial for her birthday and ask her to spit into it? Rob Abrams did. His wife, Caitlin, couldn’t have been happier. She liked it so much she gave Rob the same thing for Christmas. “It was,” Caitlin says, “the most nerdy gift I have ever given and received.” The package — a small tube, removable cap, and sealable spit funnel — was a genetic testing kit from California company 23andMe. The Abramses spent $299 on each kit in 2011. Once the couple mailed in their tubes, 23andMe tested their saliva for hundreds of genetic markers. The markers pointed toward clinically useless but nevertheless interesting ancestral information (look, Caitlin had 2.9 percent Neanderthal DNA!). They also pointed toward dozens of potential health risks. By comparing some of the couple’s DNA to a database of genetic indicators, the company said it could tell them whether they were at increased risk for a range of diseases, including Alzheimer’s disease, breast or prostate cancer, type 2 diabetes, hypertension, heroin addiction, and amyotrophic lateral sclerosis. And celiac disease, which Caitlin already knew she had. “I was most interested in possible inherited diseases,” she says. “I’d been diagnosed with celiac disease only a year or two prior, and given that my husband and I planned to have children, I thought it might be helpful to see if I was genetically predisposed to it.
    [Show full text]
  • Dna Test Kit Showdown
    DNA TEST KIT SHOWDOWN Presented by Melissa Potoczek-Fiskin and Kate Mills for the Alsip-Merrionette Park Public Library Zoom Program on Thursday, May 28, 2020 For additional information from Alsip Librarians: 708.926.7024 or [email protected] Y DNA? Reasons to Test • Preserve and learn about the oldest living generation’s DNA information • Learn about family health history or genomic medicine • Further your genealogy research • Help with adoption research • Curiosity, fun (there are tests for wine preference and there are even DNA tests for dogs and cats) Y DNA? Reasons Not to Test • Privacy • Security • Health Scare • Use by Law Enforcement • Finding Out Something You Don’t Want to Know DNA Definitions (the only science in the program!) • Y (yDNA) Chromosome passed from father to son for paternal, male lines • X Chromosome, women inherit from both parents, men from their mothers • Mitochondrial (mtDNA), passed on to both men and women from their mothers (*New Finding*) • Autosomal (atDNA), confirms known or suspected relationships, connects cousins, determines ethnic makeup, the standard test for most DNA kits • Haplogroup is a genetic population or group of people who share a common ancestor. Haplogroups extend pedigree journeys back thousand of generations AncestryDNA • Ancestry • Saliva Sample • Results 6-8 Weeks • DNA Matching • App: Yes (The We’re Related app has been discontinued) • Largest database, approx. 16 million • 1000 regions • Tests: AncestryDNA: $99, AncestryDNA + Traits: $119, AncestryHealth Core: $149 Kate’s
    [Show full text]
  • Discovering Unknown Medieval Descents : a Genetic Approach – Medieval Genealogy for the Masses Graham S Holton
    Discovering unknown medieval descents : a genetic approach – medieval genealogy for the masses Graham S Holton Abstract Genetic genealogy, combining the use of documentary evidence with DNA test results, holds the potential to reveal previously unknown medieval descents for those with little documentary evidence of their ancestry. The work undertaken as part of the Battle of Bannockburn and the Declaration of Arbroath Family History Projects has developed methodologies to advance studies of this nature which are described in this article. Covering various aspects of the process including ethical issues, the role of documentary evidence and appropriate types of DNA testing, the article includes several case studies. The article argues that genetic genealogy can provide a gateway to medieval genealogy for the masses. This article examines a topic which has been central to the work we have been carrying out at Strathclyde University since 2013, as part firstly of the Battle of Bannockburn Family History Project1 and now the Declaration of Arbroath Family History Project2. Clearly everyone living today has medieval descents. Most of these are unknown, but many will be from landed gentry, noble and even royal families. This possibility provides the potential for uncovering these unknown medieval descents. How we can go about this is what I will introduce to you here. I will focus on methodologies for tracing medieval descents, based on the experience of the Battle of Bannockburn Family History Project and the Declaration of Arbroath Family History Project. These Projects consist of both a documentary and a genetic genealogy strand. The documentary strand in particular has been the major focus of the student work on these Projects, while the genetic genealogy strand is largely carried out by staff and is the area of interest in this article.
    [Show full text]