DOCSLIB.ORG

The Role of Haplotypes in Candidate Gene Studies

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of Haplotypes in Candidate Gene Studies Genetic Epidemiology 27: 321–333 (2004) The Role of Haplotypes in Candidate Gene Studies Andrew G. Clarkn Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York Human geneticists working on systems for which it is possible to make a strong case for a set of candidate genes face the problem of whether it is necessary to consider the variation in those genes as phased haplotypes, or whether the one-SNP- at-a-time approach might perform as well. There are three reasons why the phased haplotype route should be an improvement. First, the protein products of the candidate genes occur in polypeptide chains whose folding and other properties may depend on particular combinations of amino acids. Second, population genetic principles show us that variation in populations is inherently structured into haplotypes. Third, the statistical power of association tests with phased data is likely to be improved because of the reduction in dimension. However, in reality it takes a great deal of extra work to obtain valid haplotype phase information, and inferred phase information may simply compound the errors. In addition, if the causal connection between SNPs and a phenotype is truly driven by just a single SNP, then the haplotype- based approach may perform worse than the one-SNP-at-a-time approach. Here we examine some of the factors that affect haplotype patterns in genes, how haplotypes may be inferred, and how haplotypes have been useful in the context of testing association between candidate genes and complex traits. Genet. Epidemiol. & 2004 Wiley-Liss, Inc. Key words: haplotype inference; haplotype association testing; candidate genes; linkage equilibrium Grant sponsor: NIH; Grant numbers: GM65509, HL072904. n Correspondence to: Andrew G. Clark, Department of Molecular Biology and Genetics, Cornell University, Ithaca, NY 14853. E-mail: [email protected] Received 23 June 2004; Accepted 29 June 2004 Published online 14 September 2004 in Wiley InterScience (www.interscience.wiley.com) DOI: 10.1002/gepi.20025 WHY STUDY HAPLOTYPES? is found in a population is the result of the past transmission of that variation through the popula- The primary focus of this review is on the tion, and this historical past produces a structure problem of identifying DNA sequence variation to the SNP variation that can be of considerable that is segregating in a population and has a value in trying to solve the primary goal of causal connection to variation in risk of complex finding variants associated with disease risk. The disease. One could perform tests of this associa- three primary reasons for considering the haplo- tion without consideration of the fact that the type organization of variation discussed here are: SNPs are not independent of one another, but the 1) that the unit of biological function, the protein- determination of critical values must be made in coding gene, produces proteins whose sequences the context of linkage disequilibrium among correspond to maternal and paternal haplotypes, SNPs. Fortunately, permutation tests accomplish 2) that variation in a population is in fact this reasonably well [Churchill and Doerge, 1994; structured into haplotypes that are likely to be Doerge and Churchill, 1996]. For each SNP, the transmitted as a unit, and 3) that regardless of the distribution of phenotypes would be compared population genetic reasons, haplotypes serve to among the 2 or 3 genotypes observed in the reduce the dimensionality of the problem of sample. The statistical inference would need to testing association, and so they may increase the take into account the multiplicity of tests being power of those tests. Let’s look at these three ideas performed, and the biological interpretation in more detail. would need to account for the fact that some SNPs are in linkage disequilibrium with one HAPLOTYPES DEFINE FUNCTIONAL UNITS another. But the basic idea of testing association OF GENES with individual SNPs is often where the analysis For each protein-coding gene, regardless of the begins. In reality, the DNA sequence variation that number of heterozygous amino-acid sites an & 2004 Wiley-Liss, Inc. 322 Clark individual has, he or she will only produce at HAPLOTYPES REDUCE THE DIMENSION OF most two polypeptide chains, one corresponding ASSOCIATION TESTS, AND MAY GAIN to the maternal and one to the paternal haplo- STATISTICAL POWER type (ignoring for now the complexities of This is easiest to see by example. Suppose a alternative splicing, RNA editing, posttransla- gene has 8 SNPs, and you want to test for tional modification, etc.). The point is that the associations in a way that allows any and all of folding kinetics, stability, or any other physical these SNPs to interact in their effects on disease properties of the protein may depend on inter- causation. You may start by testing each of the 8 actions between pairs or higher-order combina- SNPs, asking whether the incidence of cases and tions of amino-acid sites. If these interactions are controls (or measures of a physiological risk important, then haplotypes are of direct biologi- factor) differs among the 3 genotypes for each cal relevance. Relatively few cases of directly SNP. You may then test all pairs of SNPs, and for showing functional interaction exist, but there are each pair you construct a 3 Â 3 table of genotypes convincing ways to demonstrate such interac- {(AABB, AABb, Aabb), (AaBB, AaBb, Aabb), (aaBB, tions from population-level data. ApoE is one aaBb, aabb)}, and within each cell of this table you example of a protein whose function is influ- assemble the observed phenotypic distribution (or enced by a pair of polymorphic amino acids. The counts of cases and controls). Any of a number of major alleles E2, E3, and E4 differ at two amino- standard statistical tests would let you ask acid residues, but the fourth haplotype is missing whether the two SNPs impact the phenotype from the population [Fullerton et al., 2000]. The and whether they do so independent of one two-site haplotypes that do exist have functional another or in a synergistic manner. Note that the differences that are best described by the E2, E3, true genotypic complexity is greater than this, and E4 allelic classes rather than by the indivi- because the test just described pools the cis- and dual SNPs in the gene. Similarly, many trans- trans-phase doubly heterozygous genotypes into membrane xenobiotic transporters exhibit the AaBb class. In other words, it ignores the structural interactions between two or more linkage phase. One can systematically and ex- residues [Leabman et al., 2003]. haustively test the null hypothesis of equal phenotypic means for all partitions of the geno- type classes, and this approach, known as the GENETIC VARIATION IN POPULATIONS IS combinatorial partitioning method [Nelson et al., INTRINSICALLY ORGANIZED INTO 2001], has an appeal for its exhaustiveness. This HAPLOTYPES procedure can be continued: with three SNPs Each new mutation arises on a particular there are now 27 genotypic classes, and so on. By haplotype background. The haplotype bearing the time you consider 8 SNPs, there are 38 possible the novel mutation may rise to high frequency genotype classes, and the test has a very large by random genetic drift, and it may subse- number of degrees of freedom. quently be cleaved into segments by recombina- By the time one considers 4 or more SNPs at a tion. The combination of mutation, drift, time, most of the genotypic classes will have an selection, migration/population mixing, and observed count of zero, and so testing the recombination results in genetic variation that significance of interactions is difficult. Rather has a strong segmentwise haplotype structure to than thinking of this problem as a contingency it. Population geneticists have a good handle on table, it makes more sense to realize that the SNPs the determinants of linkage disequilibrium, but do not arise independently, but rather there is an predictions about haplotypes go beyond infer- intrinsic dependency of SNPs one with another ences of pairwise LD. Of course, any factor that due to the population history of their entry into erodes pairwise LD will also break up haplotype the population. By explicitly considering the structuring, but the two features are not haplotype structure of the SNPs, and how they inseparable. Strong haplotype structure arises arose in the population through a genealogical from multiple sites having shared ancestry, and process (a gene tree), one no longer needs to this is best imagined by considering the topol- consider this astronomical number of potential ogy of the gene genealogy. We will return to genotypes. In this way, using haplotype informa- this, but the point here is that haplotypes arise tion may collapse the dimensionality of the as an intrinsic attribute of population genetic statistical test, and thereby gain statistical power variation. over tests that do not reduce dimensions first Role of Haplotypes in Candidate Gene Studies 323 [Templeton et al., 1987]. In addition, Morris and organized in blocks where information about Kaplan [2002] showed that haplotype-based tests any SNP in the block applied, in a statistical can have greater power than unphased tests of correlation sense, to the whole block. The haplo- association in the case when the disease locus has type block idea has also stimulated theoretical multiple disease-causing alleles. work on the inference of haplotype phase, identification of haplotype blocks, identifying
Load more

Recommended publications
  • Association Between Haplotypes and Specific Mutations in Swiss Cystic Fibrosis Families
    003 I -3'19Xj9 1/3004-0304903.00/0 PEDIATRIC RESEARCH Vol. 30. No. 4, 199 1 Copyright (5 1991 International Pediatric Research Foundation. Inc. h.i~~rc,d~n U..S .,I Association between Haplotypes and Specific Mutations in Swiss Cystic Fibrosis Families SABINA LIECHTI-GALLATI. NASEEM MALIK, MUALLA ALKAN, MARC0 MAECHLER, MICHAEL MORRIS, FRANCINE THONNEY, FELIX SENNHAUSER. AND HANS MOSER Mrclic.al Gcnctics Unii, Dcy~ur/mo~to/'Pedinfrics (In.vel.~pitol). Universirv of Bun. 3010 Bern. S+t.itzerlancl [S.L.-G.. H. \I./: Dc,[)a~.~n~e/i/c!f Gc~ndics, Urli~~rr:cilj~ C'lli/dr.c,n'.c Ho.sl)ital. 4058 Rct.scl. S~.t'il~er.lr~tlrl/N.iC/., M.A I, 117slitrrcc~of iLlcelicol G'enclic.~,U~ri~~er.eitj~ c?fZuric/z, 8001 Zz~ricIi,Swi~z~rland /.IJLI.Mu.]; 11i.cfil~rle of Medicrcl Genetics, Uni1~wvi11,of Geticvu, Centre M6dical Uniro-situire, I21 1 Gencva 4. S~t~irzerluncl/Mi.Mo.J; Mediccrl Gcnrtic.~L'/li/. Uni~~c~r.sit~~of Lu~l.sc~nne, C'c~nrrc Hospitnlier U~iil~c~~sitaircI.i~ucloi.c.. 101 1 Larl.trrtlne. S~~~itserlanci [F T.];NIICI C/II/C/~CII'SHo.el~;tal. SI. Gallen, S~t.itzerlu~lc//F.S.] ABSTRACT. Cystic fibrosis (CF) is the most common CF is the most common severe autosomal recessive genetic severe autosomal recessive genetic disorder in Caucasian disorder in Caucasian populations. with an incidence of about 1 populations, with an incidence of about 1 in 2000 live in 2000 live births, implying a carrier frequency of about 1 in births, implying a carrier frequency of about 1 in 22.
    [Show full text]
  • Genome-Wide Association Identifies Candidate Genes That Influence The
    Genome-wide association identifies candidate genes that influence the human electroencephalogram Colin A. Hodgkinsona,1, Mary-Anne Enocha, Vibhuti Srivastavaa, Justine S. Cummins-Omana, Cherisse Ferriera, Polina Iarikovaa, Sriram Sankararamanb, Goli Yaminia, Qiaoping Yuana, Zhifeng Zhoua, Bernard Albaughc, Kenneth V. Whitea, Pei-Hong Shena, and David Goldmana aLaboratory of Neurogenetics, National Institute on Alcohol Abuse and Alcoholism, Rockville, MD 20852; bComputer Science Department, University of California, Berkeley, CA 94720; and cCenter for Human Behavior Studies, Weatherford, OK 73096 Edited* by Raymond L. White, University of California, Emeryville, CA, and approved March 31, 2010 (received for review July 23, 2009) Complex psychiatric disorders are resistant to whole-genome reflects rhythmic electrical activity of the brain. EEG patterns analysis due to genetic and etiological heterogeneity. Variation in dynamically and quantitatively index cortical activation, cognitive resting electroencephalogram (EEG) is associated with common, function, and state of consciousness. EEG traits were among the complex psychiatric diseases including alcoholism, schizophrenia, original intermediate phenotypes in neuropsychiatry, having been and anxiety disorders, although not diagnostic for any of them. EEG first recorded in humans in 1924 by Hans Berger, who documented traits for an individual are stable, variable between individuals, and the α rhythm, seen maximally during states of relaxation with eyes moderately to highly heritable. Such intermediate phenotypes closed, and supplanted by faster β waves during mental activity. appear to be closer to underlying molecular processes than are EEG can be used clinically for the evaluation and differential di- clinical symptoms, and represent an alternative approach for the agnosis of epilepsy and sleep disorders, differentiation of en- identification of genetic variation that underlies complex psychiat- cephalopathy from catatonia, assessment of depth of anesthesia, ric disorders.
    [Show full text]
  • Linkage Disequilibrium
    Linkage Disequilibrium Biostatistics 666 Logistics: Office Hours Office hours on Mondays at 4 pm. Room 4614 School of Public Health Tower Previously … Basic properties of a locus • Allele Frequencies • Genotype Frequencies Hardy-Weinberg Equilibrium • Relationship between allele and genotype frequencies that holds for most genetic markers Exact Tests for Hardy-Weinberg Equilibrium Today … We’ll consider properties of pairs of alleles Haplotype frequencies Linkage equilibrium Linkage disequilibrium Let’s consider the history of two neighboring alleles… Alleles that exist today arose through ancient mutation events… Before Mutation A C G T A A G T A C G T A C G T G T A C G A C G After Mutation A C G T A A G T A C G T A C G T G T A C G A C G A C G T A C G T A CMutation G T A C G T G T A C G A C G Alleles that exist today arose through ancient mutation events… Before Mutation A After Mutation A C Mutation One allele arose first, and then the other… Before Mutation A G C G After Mutation A G C G C C Mutation Recombination generates new arrangements for ancestral alleles Before Recombination A G C G C C After Recombination A G C G C C A C Recombinant Haplotype Linkage Disequilibrium Chromosomes are mosaics Ancestor Extent and conservation of mosaic pieces depends on Present-day • Recombination rate • Mutation rate • Population size • Natural selection Combinations of alleles at very close markers reflect ancestral haplotypes Why is linkage disequilibrium important for gene mapping? Association Studies and Linkage Disequilibrium
    [Show full text]
  • Expression Quantitative Trait Loci and the Phenogen
    TECHNOLOGIES FROM THE FIELD EXPRESSION QUANTITATIVE TRAIT LOCI AND Like experimental technologies, techniques for analyz­ THE PHENOGEN DATABASE ing the data generated from the microarray technologies continue to evolve. Initially, researchers obtained data for several thousand genes but on a relatively small number of Laura Saba, Ph.D.; Paula L. Hoffman, Ph.D.; subjects. After applying the appropriate statistics and multi­ Cheryl Hornbaker; Sanjiv V. Bhave, Ph.D.; and ple comparison adjustment, the investigators would com­ Boris Tabakoff, Ph.D. pile from these a list of potential candidates that could contribute to the phenotype under investigation. In many KEY WORDS: Genetic theory of alcohol and other drug use; cases, this list would contain several hundred genes. For a microarray technologies; microarray analysis; phenotype; researcher who is looking to take a few candidate genes to candidate gene; qualitative trait locus (QTL); expression qualitative the next step of testing, such a long list was problematic. trait locus (eQTL); gene expression; gene transcription; genetics; With only limited resources and time available, the researcher genomics; transcriptomics; high-throughput analysis; messenger was forced to pick some “favorites” from the list for further RNA (mRNA); brain; laboratory mice; laboratory rats; PhenoGen testing. More recently, however, techniques have been Database developed to systematically narrow these lists. These approaches incorporate biological reasoning to avoid a subjective choice of candidate genes. The following section describes esearchers from a wide variety of backgrounds and one of these strategies. with a broad range of goals have utilized high- R throughput screening technologies (i.e., microarray technologies) to identify candidate genes that may be associ­ Behavioral and Expression Quantitative ated with an observable characteristic or behavior (i.e., phe­ Trait Loci for Selecting Candidate Genes notype) of interest.
    [Show full text]
  • Haplotype Tagging Reveals Parallel Formation of Hybrid Races in Two Butterfly Species
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.113688; this version posted May 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title: Haplotype tagging reveals parallel formation of hybrid races in two butterfly species One-sentence summary: Haplotagging, a novel linked-read sequencing technique that enables whole genome haplotyping in large populations, reveals the formation of a novel hybrid race in parallel hybrid zones of two co-mimicking Heliconius butterfly species through strikingly parallel divergences in their genomes. Short title: Haplotagging reveals parallel formation of hybrid races Keywords: Butterfly, Genomes, Clines, Hybrid zone, [local] adaptation, haplotypes, population genetics, evolution bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.113688; this version posted May 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Authors: Joana I. Meier1,2,*, Patricio A. Salazar1,3,*, Marek Kučka4,*, Robert William Davies5, Andreea Dréau4, Ismael Aldás6, Olivia Box Power1, Nicola J. Nadeau3, Jon R. Bridle7, Campbell Rolian8, Nicholas H. Barton9, W. Owen McMillan10, Chris D. Jiggins1,10,†, Yingguang Frank Chan4,† Affiliations: 1. Department of Zoology, University of Cambridge, Downing Street, Cambridge, CB2 3EJ, United Kingdom 2. St John’s College, University of Cambridge, Cambridge, CB2 1TP, United Kingdom 3.
    [Show full text]
  • Haplotype Inference from Pedigree Data and Population Data
    HAPLOTYPE INFERENCE FROM PEDIGREE DATA AND POPULATION DATA by XIN LI Submitted in partial ful¯llment of the requirements For the Degree of Doctor of Philosophy Dissertation Advisor: Jing Li Department of Electrical Engineering and Computer Science CASE WESTERN RESERVE UNIVERSITY January, 2010 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of _____________________________________________________ candidate for the ______________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. Table of Contents List of Tables iv List of Figures v Acknowledgments vi Abstract vii Chapter 1. Introduction 1 1.1 Statistical methods . 3 1.2 Rule-based methods . 4 1.2.1 MRHC . 4 1.2.2 ZRHC . 5 Chapter 2. Problem statement and solutions 8 2.1 Large Pedigrees: manipulation of Mendelian constraints . 9 2.2 Families with many markers: dealing with recombinations . 9 2.3 Mixed data: use of population information . 10 Chapter 3. Preliminaries 12 3.1 Mendelian and zero-recombinant constraints . 14 3.2 Locus graphs . 15 3.3 Linear constraints on h variables . 17 Chapter 4. Linear Systems on Mendelian Constraints 19 4.1 Methods to solve the linear systems . 19 4.1.1 Split nodes to break cycles . 20 4.1.2 Detect path constraints from locus graphs . 21 4.1.3 Encode path constraints in disjoint-set structure D . 26 ii 4.2 Analysis of the algorithm on tree pedigrees with complete data 31 4.3 Extension to General Cases . 33 4.3.1 Pedigrees with mating loops .
    [Show full text]
  • Candidate-Gene Criteria for Clinical Reporting: Diagnostic Exome Sequencing Identifies Altered Candidate Genes Among 8% of Patients with Undiagnosed Diseases
    ORIGINAL RESEARCH ARTICLE Official journal of the American College of Medical Genetics and Genomics Open Candidate-gene criteria for clinical reporting: diagnostic exome sequencing identifies altered candidate genes among 8% of patients with undiagnosed diseases Kelly D. Farwell Hagman, MS, CGC1, Deepali N. Shinde, PhD1, Cameron Mroske, MS1, Erica Smith, PhD1, Kelly Radtke, PhD1, Layla Shahmirzadi, MS, CGC1, Dima El-Khechen, MS, CGC1, Zöe Powis, MS, CGC1, Elizabeth C. Chao, MD, FACMG1,2, Wendy A. Alcaraz, PhD, DABMG1, Katherine L. Helbig, MS, CGC1, Samin A. Sajan, PhD1, Mari Rossi, MS, PhL1, Hsiao-Mei Lu, PhD1, Robert Huether, PhD1, Shuwei Li, PhD1, Sitao Wu, PhD1, Mark E. Nuñes, MD3 and Sha Tang, PhD, FACMG1 Purpose: Diagnostic exome sequencing (DES) is now a commonly ­corroborated in the peer-reviewed literature. This rate of corrobo- ordered test for individuals with undiagnosed genetic disorders. In ration increased to 51.9% (27/52) among patients whose gene was addition to providing a diagnosis for characterized diseases, exome reported at least 12 months previously. sequencing has the capacity to uncover novel candidate genes for Conclusions: Herein, we provide transparent, comprehensive, and disease. standardized scoring criteria for the clinical reporting of candidate Methods: Family-based DES included analysis of both characterized genes. These results demonstrate that DES is an integral tool for and novel genetic etiologies. To evaluate candidate genes for disease genetic diagnosis, especially for elucidating the molecular basis for in the clinical setting, we developed a systematic, rule-based classifi- both characterized and novel candidate genetic etiologies. Gene dis- cation schema. coveries also advance the understanding of normal human biology and more common diseases.
    [Show full text]
  • Statistical Genetics – Part I
    Statistical Genetics –Part I Lecture 3: Haplotype reconstruction Su‐In Lee, CSE & GS, UW [email protected] 1 Outline Basic concepts Allele, allele frequencies, genotype frequencies Haplotype, haplotype frequency Recombination rate Linkage disequilibrium Haplotype reconstruction Parsimony‐based approach EM‐based approach Next topic Disease association studies 2 1 Alleles Alternative forms of a particular sequence Each allele has a frequency, which is the proportion of chromosomes of that type in the population C, G and -- are alleles …ACTCGGTTGGCCTTAATTCGGCCCGGACTCGGTTGGCCTAAATTCGGCCCGG … …ACTCGGTTGGCCTTAATTCGGCCCGGACTCGGTTGGCCTAAATTCGGCCCGG … …ACCCGGTAGGCCTTAATTCGGCCCGGACCCGGTAGGCCTTAATTCGGCCCGG … …ACCCGGTAGGCCTTAATTCGGCC--GGACCCGGTAGGCCTTAATTCGGCCCGG … …ACCCGGTTGGCCTTAATTCGGCCGGGACCCGGTTGGCCTTAATTCGGCCGGG … …ACCCGGTTGGCCTTAATTCGGCCGGGACCCGGTTGGCCTTAATTCGGCCGGG … single nucleotide polymorphism (SNP) allele frequencies for C, G, -- 3 Allele Frequency Notations For two alleles Usually labeled p and q = 1 –p e.g. p = frequency of C, q = frequency of G For more than 2 alleles Usually labeled pA, pB, pC ... … subscripts A, B and C indicate allele names 4 2 Genotype The pair of alleles carried by an individual If there are n alternative alleles … … there will be n(n+1)/2 possible genotypes In most cases, there are 3 possible genotypes Homozygotes The two alleles are in the same state (e.g. CC, GG, AA) Heterozygotes The two alleles are different (e.g. CG, AC) 5 Genotype Frequencies Since alleles occur in pairs, these
    [Show full text]
  • Cancer Genomics Terminology
    Cancer Genomics Terminology Acquired Susceptibility Mutation: A mutation in a gene that occurs after birth from a carcinogenic insult. Allele: One of the variant forms of a gene. Different alleles may produce variation in inherited characteristics. Allele Heterogeneity: A phenotype that can be produced by different genetic mechanisms. Amino Acid: The building blocks of protein, for which DNA carries the genetic code. Analytical Sensitivity: The proportion of positive test results correctly reported by the laboratory among samples with a mutation(s) that the laboratory’s test is designed to detect. Analytic Specificity: The proportion of negative test results correctly reported among samples when no detectable mutation is present. Analytic Validity: A test’s ability to accurately and reliably measure the genotype of interest. Apoptosis: Programmed cell death. Ashkenazi: Individuals of Eastern European Jewish ancestry/decent (For example-Germany and Poland). Non-assortative mating occurred in this population. Association: When significant differences in allele frequencies are found between a disease and control population, the disease and allele are said to be in association. Assortative Mating: In population genetics, selective mating in a population between individuals that are genetically related or have similar characteristics. Autosome: Any chromosome other than a sex chromosome. Humans have 22 pairs numbered 1-22. Base Excision Repair Gene: The gene responsible for the removal of a damaged base and replacing it with the correct nucleotide. Base Pair: Two bases, which form a “rung on the DNA ladder”. Bases are the “letters” (Adenine, Thymine, Cytosine, Guanine) that spell out the genetic code. Normally adenine pairs with thymine and cytosine pairs with guanine.
    [Show full text]
  • Transferability of Tag Snps to Capture Common Genetic Variation in DNA Repair Genes Across Multiple Populations Paul I.W. De
    Transferability of Tag SNPs to Capture Common Genetic Variation in DNA Repair Genes Across Multiple Populations Paul I.W. De Bakker, Robert R. Graham, David Altshuler, Brian E. Henderson, and Christopher A. Haiman Pacific Symposium on Biocomputing 11:478-486(2006) TRANSFERABILITY OF TAG SNPS TO CAPTURE COMMON GENETIC VARIATION IN DNA REPAIR GENES ACROSS MULTIPLE POPULATIONS PAUL I.W. DE BAKKER, ROBERT R. GRAHAM, DAVID ALTSHULER Broad Institute of Harvard and Massachusetts Institute of Technology, Cambridge, MA BRIAN E. HENDERSON, CHRISTOPHER A. HAIMAN Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles, CA Genetic association studies can be made more cost-effective by exploiting linkage disequilibrium patterns between nearby single-nucleotide polymorphisms (SNPs). The International HapMap Project now offers a dense SNP map across the human genome in four population samples. One question is how well tag SNPs chosen from a resource like HapMap can capture common variation in independent disease samples. To address the issue of tag SNP transferability, we genotyped 2,783 SNPs across 61 genes (with a total span of 6 Mb) involved in DNA repair in 466 individuals from multiple populations. We picked tag SNPs in samples with European ancestry from the Centre d’Etude du Polymorphisme Humain, and evaluated coverage of common variation in the other samples. Our comparative analysis shows that common variation in non- African samples can be captured robustly with only marginal loss in terms of the maximum r2. We also evaluated the transferability of specified multi-marker haplotypes as predictors for untyped SNPs, and demonstrate that they provide equivalent coverage compared to single-marker tests (pairwise tags) while requiring fewer SNPs for genotyping.
    [Show full text]
  • Glossary/Index
    Glossary 03/08/2004 9:58 AM Page 119 GLOSSARY/INDEX The numbers after each term represent the chapter in which it first appears. additive 2 allele 2 When an allele’s contribution to the variation in a One of two or more alternative forms of a gene; a single phenotype is separately measurable; the independent allele for each gene is inherited separately from each effects of alleles “add up.” Antonym of nonadditive. parent. ADHD/ADD 6 Alzheimer’s disease 5 Attention Deficit Hyperactivity Disorder/Attention A medical disorder causing the loss of memory, rea- Deficit Disorder. Neurobehavioral disorders character- soning, and language abilities. Protein residues called ized by an attention span or ability to concentrate that is plaques and tangles build up and interfere with brain less than expected for a person's age. With ADHD, there function. This disorder usually first appears in persons also is age-inappropriate hyperactivity, impulsive over age sixty-five. Compare to early-onset Alzheimer’s. behavior or lack of inhibition. There are several types of ADHD: a predominantly inattentive subtype, a predomi- amino acids 2 nantly hyperactive-impulsive subtype, and a combined Molecules that are combined to form proteins. subtype. The condition can be cognitive alone or both The sequence of amino acids in a protein, and hence pro- cognitive and behavioral. tein function, is determined by the genetic code. adoption study 4 amnesia 5 A type of research focused on families that include one Loss of memory, temporary or permanent, that can result or more children raised by persons other than their from brain injury, illness, or trauma.
    [Show full text]
  • Efficient Design and Analysis of Genome-Wide
    UNIVERSITY OF CALIFORNIA Los Angeles Efficient Design and Analysis of Genome-wide Association Studies A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Computer Science by Emrah Kostem 2013 c Copyright by Emrah Kostem 2013 ABSTRACT OF THE DISSERTATION Efficient Design and Analysis of Genome-wide Association Studies by Emrah Kostem Doctor of Philosophy in Computer Science University of California, Los Angeles, 2013 Professor Eleazar Eskin, Chair The recent advances in genomic technologies, have made it possible to collect large- scale information on genetic variation across a diverse biological landscape. This has resulted in an exponential influx of genetic information and the field of genetics has be- come data-rich in a relatively short amount of time. These developments have opened new avenues to elucidate the genetic basis of complex diseases, where the traditional disease study approaches had little success. In recent years, the genome-wide association study (GWAS) approach has gained widespread popularity for its ease of use and effectiveness, and is now the standard approach to study complex diseases. In GWAS, information on millions of single- nucleotide polymorphisms (SNPs) is collected from case and control individuals. SNP genotyping is cost-effective and due to their abundance in the genome, SNPs are cor- related to their neighboring genetic variation, which makes them tags for genomic regions. Typically, each SNP is statistically tested for association to disease, and the genomic regions tagged by the significant SNPs are believed to be harboring the func- tional variants contributing to disease. In order to reduce the cost of GWAS and the redundancy in the information col- ii lected, an informative subset of the SNPs, or tag SNPs, are genotyped.
    [Show full text]