In Hodgkin Lymphoma

ORIGINAL ARTICLE Role of early B-cell factor 1 (EBF1) in Hodgkin lymphoma

V Bohle1,CDo¨ ring2, M-L Hansmann2 and R Ku¨ ppers1

A hallmark of classical Hodgkin lymphoma (cHL) is that the B-cell-derived Hodgkin and Reed–Sternberg (HRS) tumor cells have largely lost the B-cell-typical gene expression program. The factors causing this ‘reprogramming’ of HRS cells are only partly understood. As early B-cell factor 1 (EBF1), a major B-cell transcription factor, is downregulated in HRS cells, we analyzed whether this downregulation contributes to the lost B-cell phenotype and tested the consequences of EBF1 re-expression in cHL cell lines. EBF1 re-expression caused an upregulation of B-cell genes, such as CD19, CD79A and CD79B, although the B-cell genes FOXO1 and PAX5 remained lowly expressed. The re-expression of CD19, CD79A and CD79B occurred largely without demethylation of promoter CpG motifs of these genes. In the cHL cell line L-1236 ﬁtness decreased after EBF1 re-expression. These data show that EBF1 has the ability to reintroduce part of the B-cell signature in cHL cell lines. Loss of EBF1 expression in HRS cells therefore contributes to their lost B-cell phenotype. Notably, in the cHL cell line KM-H2 destructive mutations were found in one allele of EBF1, indicating that genetic lesions may sometimes have a role in impairing EBF1 expression.

Leukemia (2013) 27, 671–679; doi:10.1038/leu.2012.280 Keywords: B-cell phenotype; CD19; CD79; EBF1; Hodgkin lymphoma

INTRODUCTION In cHL, the function of the three central B-cell transcription Classical Hodgkin lymphoma (cHL) is a common malignant factors EBF1, E2A and PAX5 is compromised. E2A is expressed in 11,20 lymphoma in the western world. The Hodgkin and Reed– HRS cells but often at low level, and is functionally inactivated Sternberg (HRS) tumor cells are rare and usually account for only by the E2A inhibitors ID2 and activated B-cell factor 1, which are 9,11,12 a few percent of cells in the tumor tissue, whereas the vast highly expressed in HRS cells. PAX5 is present in most cHL majority of cells in the lymphoma microenvironment represent cases but there is large variation in the number and intensity of 11,20–22 inflammatory cells. Although HRS cells originate in nearly all cases positive HRS cells. EBF1 mRNA is absent or expressed only 11,20 from B cells,1–3 they have a profound lack of B-cell-typical gene at very low level in cHL cell lines and also weak or absent in expression.4 This includes cell surface markers (CD19, CD79A),5 primary cases in comparison with germinal center B cells (see 23 signaling molecules (Syk, Lyn, Blk)4 and transcription factors (Oct2, genechip data from ref. Tiacci et al. ). Beside ID2 and activated BOB.1).6,7 Furthermore, HRS cells express markers of other B-cell factor 1, the T-cell transcription factor Notch1 might further hematopoietic lineages such as CCL17,8 GATA-3,9 Notch1,10 and influence this B-cell transcription factor network. Notch1 is inhibitor of differentiation and DNA-binding 2 (ID2).11,12 cHL is strongly expressed in HRS cells and inhibits the expression of 10,24 unique among lymphoid malignancies in the extent to which the E2A and EBF1. In addition to unbalanced transcription factors, lymphoma cells have lost the gene expression pattern of their epigenetic features are also deregulated in HRS cells and might normal precursor cells and have upregulated expression of non-B- influence the aberrant gene expression in these cells. B-cell genes cell genes.13 It has been speculated that this ‘reprogramming’ is of such as SYK, POU2AF1 (BOB.1, OBF1) and CD79B have methylated pathogenetic relevance for HRS cells.13 promoters in cHL cell lines and primary HRS cells and are therefore 25,26 Early B-cell factor 1 (EBF1) is a central transcription factor in B silenced. A genome-wide DNA methylation analysis of cHL cell cells.14–16 In B cells, it operates as a homodimer in cooperation lines showed that B-cell genes were preferentially found among 27 with two other major B-cell transcription factors, that is, E2A and those with hypermethylated promoters. PAX5.14,16 EBF1 is expressed in all stages of B-cell development In this study, we analyzed the relevance of the low or absent except plasma cells. EBF1 not only induces expression of EBF1 expression for the phenotype of HRS cells. We wondered numerous B-cell genes, but at least in murine B cells it also whether EBF1 silencing has an impact on the aberrant gene represses factors of other hematopoietic lineages. For example, expression of HRS cells or whether its loss influences the EBF1 suppresses the myeloid gene CEBPA, the T-cell transcription deregulated methylation pattern of B-cell genes. factor Notch1 and the natural killer cell factor ID2.15 EBF1 also seems to be involved in epigenetic modifications such as demethylation of the CD79A promoter17 and methylation of MATERIALS AND METHODS 16 histones. Conditional knockout mice have shown that EBF1 is a B Cell culture and B-cell isolation lineage commitment factor and essential for the survival of pro-B Cell lines L-1236, L-428, KM-H2, Raji and SUP-HD1 were cultured in RPMI- cells, marginal zone and B1 B cells, whereas germinal centers were 1640 medium with stable glutamine supplemented with 10% fetal calf formed but not maintained without EBF1.18,19 serum (Biochrom AG, Berlin, Germany). Cell line HDLM-2 was cultured in

1Institute of Cell Biology (Cancer Research), University of Duisburg-Essen, Medical School, Essen, Germany and 2Senckenberg Institute of Pathology, University of Frankfurt, Frankfurt/Main, Germany. Correspondence: Professor R Ku¨ppers, Institute of Cell Biology (Cancer Research), University of Duisburg-Essen, Medical School, Virchowstr. 173, 45122 Essen, Germany. E-mail: [email protected] Received 10 August 2012; revised 17 September 2012; accepted 18 September 2012; accepted article preview online 1 October 2012; advance online publication, 23 November 2012 EBF1 in classical Hodgkin lymphoma V Bohle et al 672 RPMI-1640 medium with 20% fetal calf serum and U-HO1 in Iscove’s exponential phase of the PCR was determined in pretests. The primer modification of Dulbecco’s medium/RPMI-1640 (4:1) with 20% fetal calf sequences are as follows (50–30, each forward and reverse): ACTB serum. All media were supplemented with 1% penicillin–streptomycin (b-actin), AGCCTCGCCTTTGCCGATC, AGCGGGCGATATCATCATCC; GAPDH, (Invitrogen, Darmstadt, Germany). Germinal center B cells were isolated CCACATCGCTCAGACACCATG, TGAAGGGGTCATTGATGGCAAC; EBF1, GTAC- from human tonsils as CD77-positive cells, using the MACS system CATGCTGGTCTGGAGTG, GTGTGACTTCCACAACACCAGG; CD19, CAA (Miltenyi Biotech, Bergisch-Gladbach, Germany). CCTGACCATGTCATTCCACC, CACAGGCAGAAGATCAGATAAGCC; CD79A, ATCTGGTACCCTGGGACTGC, GGACCTTGTGCATCCACAGG; CD79B,AGCCTCG Western blot GACGTTGTCACG, GATTCCGGTACCGGTCCTC; PAX5, GTCCCAGCTTCCAGTCA CAG, CGGAGACTCCTGAATACCTTCG; ID2, CTCGCATCCCACTATTGTCAGC, Western blot analysis to demonstrate the endogenous and exogenous GAACACCGCTTATTCAGCCACAC and NOTCH1, GAATGGCGGGAAGTGTG EBF1 expression was performed using standard conditions and the AAGC, TGCAGGCATAGTCTGCCACG. The cycling program consists of following antibodies: anti-EBF1 (#H00001879-M01, Abnova, Heidelberg, 95 1C for 3 min, followed by 27–45 cycles of 95 1C for 15 s/60 1C for Germany, 1:100–1:10 000; 2nd ab: #115-036-062, Jackson Immuno 15 s/72 1C for 20 s. Research, Hamburg, Germany, 1:2000), anti-glyceraldehyde 3-phosphate dehydrogenase (#sc-31915, Santa Cruz, 1:200; 2nd ab: #sc-2350, Santa Cruz, Heidelberg, Germany, 1:10 000). EBF1 target gene expression was analyzed Real-time RT-PCR of EBF1 target genes in transduced cells using the same conditions as above and the following antibodies: anti- Quantitative real-time PCR analysis was performed on an ABI Prism 7900HT CD79A (#ab-79414, Abcam, Cambridge, UK, 1:500; 2nd ab: #711-036-152; Fast Real-Time PCR System (Applied Biosystems) using predesigned, Jackson Immuno Research, 1:10 000), anti-b-tubulin (#69126, MP Biomedi- intron-spanning assays (Applied Biosystems): ACTB (Hs99999903_m1), cals, Eschwege, Germany, 1:200; 2nd ab: #115-036-062, Jackson Immuno CD79B (Hs00236881_m1), ID2 (Hs00747379_m1), CD19 (Hs00174333_m1), Research, 1:2000). PAX5 (Hs00277134_m1), NOTCH1 (Hs01062014_m1), FOXO1 (Hs01054576_m1), and TaqMan Universial PCR MasterMix, No AmpErase UNG (Applied Sequence analysis of EBF1 Biosystems). Each cell line was transduced independently two to three times and each gene was measured in duplicates or quadruplicates. Sanger sequencing was performed to analyze the HL cell lines for mutations in EBF1. A 3130 Genetic Analyzer (Applied Biosystems, Darmstadt, Germany) and the BigDye Terminator v3.1 Cycle Sequencing Affymetrix genechips of transduced HL cells Kit (Applied Biosystems) were used. Four PCR products were generated to Cell lines L-428 and L-1236 were transduced three times each with EBF1 or amplify the coding region of EBF1, of which three were sequenced directly control vector constructs and positive cells were sorted 8 days post and one (*) was cloned in pGEM-T easy before sequencing because of four infection for RNA isolation. In all, 150 ng total RNA (RNeasy Micro Kit, different isoforms, which are also present in CD77-positive tonsillar Qiagen) of the transduced cell lines L-428 and L-1236 were amplified by germinal center B cells. The following primers were used for amplifying 0 0 the Ambion WT Expression Kit (Applied Biosystems). Labeling and EBF1 complementary DNA (cDNA) (5 –3 , forward and reverse): hybridization were performed using the GeneChip WT Terminal Labeling TTCAAGGGGGAGGAGATTTTCC, CCGGTAGTGAATTCCGTTATTGG; AATCCAA and Hybridization Kit (Affymetrix, Mu¨nchen, Germany). Washing and CTTCTTCCACTTCGTCC, GGAGTAGCATGTTCCAGATAAGAG; GTCAATGTGG staining was done by the standard Affymetrix GeneChip protocol (Version ATGGCCATGTCC (*), GTTGTCCACTGAACGAATTCACG (*); GGAAATCATTCT 2) in the GeneChip Fluidics Station 450 (Affymetrix), the measurement was GAAGAGAGCGG, CTCTGGGACTTGTATCAGATTACTC. Cell line KM-H2 pro- performed on the GC Scanner 3000 7G (Affymetrix). The genechip data are duced two different reverse transcriptase (RT)-PCR products for the first available through the GEO Omnibus database with accession number amplicon. The following primers were used to analyze exons 1 and 2 GSE41493. of KM-H2 at the DNA level to reveal the reason for these two amplificates (50–30, forward and reverse): TTCAAGGGGGAGGAGATTTTCC, CAGCAGCTG CCGCTGCC; CGGCTGCTTCTCAAAGTGAGC, GCAGACAGCTCCAGGTCC. Bisulfite sequencing of promoter regions of EBF1 target genes in transduced cells Lentivirus production and transduction DNA was isolated from 100 000 tGFP-positive sorted cells with the Gentra Puregene Kit (Qiagen) and eluted in 25 ml elution buffer. The DNA was The constructs used are based on the pGIPZ-plasmid (Thermo Scientific, denatured by adding 2.5 ml3M NaOH and incubation at 42 1C for 30 min. Schwerte, Germany/Open Biosystems, St. Leon-Rot, Germany) in which the Unmethylated cytosines were modified by adding 255 ml 3.9 M sodium puromycin resistance gene and the short hairpin RNA were exchanged by bisulfate (pH 5.0), 15 ml hydroquinone, 2.5 mlHO and incubation at three EBF1 cDNA (kindly provided by Dr Andreas Braüninger). By co-transfection 2 cycles of 3 h for 55 1C and 5 min for 95 1C, followed by 3-h incubation at (GeneJuice, Merck, Darmstadt, Germany/Millipore, Schwalbach, Germany) 55 1C. DNA was cleaned with the DNA Clean and Concentrator Kit (Zymo of the modified pGIPZ, psPAX2 (Addgene plasmid 12260, Didier Trono, Research, Freiburg, Germany) and resuspended in 25 ml Tris (10 mM)/EDTA Lausanne, Switzerland) and pMD2.G (Addgene plasmid 12259, Didier (1 mM). The modified DNA was denatured with 2.5 ml3M NaOH and Trono) viral particles were produced in 293T cells. The viral supernatants incubation for 15 min at 37 1C and subsequently neutralized with 13.8 ml were harvested 3 days post transfection and titered on fresh 293T cells. 9 M ammonium acetate (pH 7.0). The DNA was precipitated with ethanol, B-cell lines were transduced with 8 multiplicity of infection supplemented resuspended in 50 ml Tris/EDTA and stored at –20 1C. with polybrene (final concentration 5 mg/ml). For subsequent experiments, The PCR primer pairs of the promoter regions of CD19, CD79B and PAX5 transduced cells were isolated by fluorescence-activated cell sorting (a and b region) were designed with the help of MethPrimer28 and have (FACSDiva; BD Biosciences, Heidelberg, Germany), gating on turbo green the following sequences (50–30, forward and reverse): CD19-1, fluorescent protein (tGFP)-positive, propidium iodide-negative cells. TATTTTGGTGTTTAGGTTGGAGTGTAGT, CAAAAATATAAACCCCTTAAAATAA Transduced cells were analyzed on a BD FACSCanto (BD Biosciences). AAACC; CD19-2, AAGGGGTTTATATTTTTGTGTAGAAAATAGAA, AAACACC CAACCACAACTCAAAT; CD79B-1, GTTTTGGGTTTTTTTAGATGTTTGATTT, TA RNA isolation and cDNA synthesis CTCCCCTCTATCTATACTTACCC; CD79B-2, AGGATTTTAGTTGTGTTGTTTAA To analyze EBF1 target gene expression in transduced cells, total RNA was GTTGG, CTAAAAATAAAAACAAACCCCACAAAC; PAX5a, TTGGATGGTTG prepared from 10 000 sorted tGFP-positive cells by RNeasy Micro Kit GGAATTTTG, CCCAAACTTTTATAAAAATTAAAAAAAA; PAX5b-1, TTTTGGAG (Qiagen, Hilden, Germany) according to the manufacturer’s protocol using ATTTTTTTTATTTTTATTTTTTAAT, CCCCATTAACTAAACAACCCACA; PAX5b-2, 75 ml RLT buffer, without DNA digestion and elution in 12 ml water. Ten TTTGTGGGTTGTTTAGTTAATGGGG, AAAAAAACAAAAAATCCCAACCACCAA microliters of total RNA were reverse transcribed using the Sensiscript AAC. Standard PCR was performed, and the amplificates were cloned in Reverse Transcription Kit (Qiagen) according to the manufacturer’s pGEM-T easy (Promega Corporation) and sequenced with the PCR primers. 29 protocol using random hexamer primers and the RNase inhibitor RNasin The resulting sequences were analyzed with the help of BIQ Analyzer HT. Plus (Promega Corporation, Mannheim, Germany). Cell proliferation assay Semiquantitative RT-PCR of EBF1 target genes in transduced cells To analyze the fitness of transduced cells, 10 000 or 20 000 sorted cells The primers were chosen to produce amplicons of a length of 100–200 bp, were cultured for 2 days in 100 ml conditioned medium in a well of a to have a highly efficient PCR. Each primer pair spans an intron to prevent 96-well plate. Subsequently, the glycolysis rate was monitored in an amplification of genomic DNA. For each cell line and amplicon, the enzyme-linked immunosorbent assay reader by a colorimetric change of

Leukemia (2013) 671 – 679 & 2013 Macmillan Publishers Limited EBF1 in classical Hodgkin lymphoma V Bohle et al 673 the CellTiter96 AQueous One Solution Cell Proliferation Assay (Promega EBF1 re-expression in cHL cell lines Corporation). The measurement was performed in triplicates, and the To re-express EBF1 in cHL cell lines, a lentiviral expression system experiment was repeated once. was used. The EBF1 construct contains genetic information of tGFP and EBF1, whereas the control construct expresses only tGFP (Figure 3a). Semiquantitative RT-PCRs (Figure 3b) and protein immunoblots in the time frame of 3 to 10 days post transduction RESULTS (Figure 3c) show expression of EBF1 mRNA and protein in all EBF1 expression in cHL cell lines transduced cHL cell lines. To examine EBF1 expression levels in HRS cells, we performed a protein immunoblot for the HL cell lines HDLM-2, SUP-HD1, KM- H2, L-428, L-1236 and U-HO1 in comparison with their proposed Expression of EBF1 target genes in transduced HL cell lines natural counterpart, that is, germinal center B cells. No EBF1 To test whether the low or absent expression of EBF1 in HRS cells expression is seen for KM-H2, L-428 and L-1236 cells (Figure 1). contributes to their lost B-cell phenotype, we analyzed the HDLM-2 and SUP-HD1 have as much EBF1 as germinal center B consequences of EBF1 re-expression in these cells on the cells if compared with the absolute amount of protein loaded on expression of known EBF1 target genes. By semiquantitative RT- the blot, but a much lower EBF1 expression if normalized to the PCR, we studied the positively regulated target genes CD19, loading control glyceraldehyde 3-phosphate dehydrogenase. Cell CD79A, CD79B and PAX5 and the potentially negatively regulated line U-HO1 expresses high amounts of EBF1. Thus, in general EBF1 genes NOTCH1 and ID2 in sorted tGFP-positive cells between days expression in cHL cell lines is much lower than in germinal center 3 and 10 post transduction in comparison with the negative B cells. Owing to the lack of an antibody suitable for control (Figure 4a and data not shown). A clear upregulation of immunohistochemistry, we could not analyze EBF1 protein CD19, CD79A and CD79B in the EBF1-transduced cell lines L-1236, expression in primary cHL. L-428 and KM-H2 is seen. Notch1 showed either no change To clarify whether mutations in EBF1 cause the lack of its (L-428), or a minor (KM-H2) or more pronounced upregulation expression, we sequenced the coding region of EBF1 from (L-1236), although a downregulation was expected based on amplified cDNA of the cell lines L-1236, L-428, KM-H2, HDLM-2, studies in the mouse.15 PAX5 and ID2 did not change their U-HO1 and SUP-HD1. No peculiarities were seen except in KM-H2. expression level on EBF1 re-expression (data not shown). Although Here the first cDNA amplicon showed two bands of different CD79A mRNA is strongly upregulated on EBF1 re-expression, length. By analyzing this region in KM-H2 DNA, we detected two CD79A protein was not detectable by immunoblot in transduced mutations affecting the donor splice site at the exon 1/intron 1 L-1236, L-428 and U-HO1 cells (data not shown). junction of one allele causing usage of an alternative donor splice We aimed to validate and quantify these findings by real-time site within exon 1 and a frameshift because of shortening of exon RT-PCR analysis of the EBF1 or control vector-transduced cell lines 1 by 56 bp (Figure 2). All other cell lines are wild type for EBF1 L-1236, L-428, KM-H2 and U-HO1. We again clearly detected (data not shown). Therefore, mutations in EBF1 do not seem to be upregulation of the transcripts for CD19 and CD79B, in a range the cause for the reduced or absent EBF1 protein expression in from 2- to 4000-fold (Figure 4b). Again, PAX5, and ID2 did not general, although the destructive mutation of one allele of EBF1 in show a regulation, and Notch1 was upregulated only in L-1236 KM-H2 likely contributes to absent EBF1 protein in this line. cells. In this analysis, we also included Foxo1, as this transcription factor was described as a further EBF1 target gene.30 However, no regulation of Foxo1 was seen (Figure 4b). Thus, the quantitative RT-PCR analysis validates the semiquantitative RT-PCR results and extend them to the cHL line U-HO1. These results encouraged us to investigate the influence of EBF1 re-expression on gene expression in the cHL cell lines in a global way. We transduced cell lines L-1236 and L-428 with the EBF1 and the negative control constructs, sorted tGFP-positive Figure 1. Western blot analysis of endogenous EBF1 levels of cells 8 days post infection and used their RNA for analysis on the untransduced cHL cell lines. Fifteen micrograms of protein are Human Gene 1.0 ST array. The unsupervised hierarchical clustering loaded per lane. GCB, germinal center B cells. of 464 genes with a minimum standard deviation of one

Figure 2. Sequence analysis of EBF1 in KM-H2. (a) The wild-type (wt) sequence of the 30 end of exon 1 and the 50 end of intron 1 is shown in the upper diagram. The lower diagram shows the corresponding sequence of KM-H2. This cell line has a G substitution in the GT donor splice site and a G insertion 4 bp further 30 in intron 1. (b) A comparison of the protein and mRNA sequences of wt EBF1 and the sequence of the mutated EBF1 allele of KM-H2 is shown. Both sequences start with the same 26 codons. Owing to the mutated splice site at the exon 1/intron 1 junction in one allele of EBF1 in KM-H2 an internal cryptic splice site in exon 1 is used, causing a deletion of 56 bp of exon 1 (underlined) in the mRNA. This also leads to a frameshift, which causes a premature stop codon (gray TGA). Hence, a heavily truncated protein is made from this mRNA.

& 2013 Macmillan Publishers Limited Leukemia (2013) 671 – 679 EBF1 in classical Hodgkin lymphoma V Bohle et al 674

Figure 3. EBF1 re-expression in cHL cell lines. (a) Lentiviral constructs on the basis of pGIPZ. (b) Semiquantitative RT-PCR of EBF1 re-expression in transduced HL cell lines. (c) Western blot analysis of EBF1 re-expression in transduced HL cell lines. Control, positive/negative PCR control; dx, days post transduction; ev, empty vector control; GCB, germinal center B cells; ut, untreated cells.

(Supplementary Figure 1) shows that the differences between the post transduction by bisulfite sequencing of cloned PCR products. two cell lines were larger than between EBF1-expressing and For comparison, we also determined the methylation pattern of EBF1-negative cells. However, the three replicates for each line the promoters of the three genes in CD77-positive germinal center and condition clustered together, indicating that consistent B cells. As expected, the normal B cells showed unmethylated CpG effects of EBF1 expression occurred in both lines. The regulation promoter motifs for the three genes (Figure 5). In contrast, the of genes in each cell line is mostly smaller than twofold (false CD19 and CD79B promoters of the cHL cell lines transduced with discovery rate p5%). In L-1236, 34 of 298 differentially expressed the control vector are highly methylated (Figure 5). The PAX5a genes have a regulation larger than twofold (including EBF1) and promoter is in L-1236 strongly methylated but shows a hetero- in L-428 this is true for 21 of 113 differentially expressed genes genous pattern in L-428 and KM-H2 cells. The PAX5b promoter is (Supplementary Table 1). The EBF1-induced genes in L-428 unmethylated in all cell lines. On EBF1 re-expression some CpGs include, for example, CXCL9, CD40 and FOS, and in L-1236, we change the trend of their methylation status, but overall, there is see upregulation of IL7, MAPKBP1 and PLXNA1 (plexin A1) little effect (Figure 5). The exception is the PAX5a promoter of (Supplementary Table 1). Several genes were also downregulated L-1236, which becomes strongly demethylated when EBF1 is on re-expression of EBF1 (Supplementary Table 1). When focusing re-expressed. In other promoters and cell lines, only single CpGs on genes induced by EBF1 in both cHL cell lines with at least a are demethylated, for example, CpG1 (second amplicon) in the twofold upregulation, we identified only four genes, namely CD19 promoter of KM-H2, CpG 5 and 6 in the CD79B promoter CCL22, SEMA7A, FCER2 (CD23) and CRLF2, besides EBF1 itself (second amplicon) of L-1236 and CpG 4 and 5 (first amplicon) in (Table 1). Thus, EBF1 re-expression influenced the expression level the CD79B promoter of KM-H2. There are also some CpGs that of more than a hundred genes in L-428 and L-1236 cells, including show increased methylation because of EBF1 expression. Hence, several B-cell markers. Notably, the two lines are quite hetero- re-expression of EBF1 in cHL cell lines has relatively little impact on genous in their behavior. the methylation status of EBF1 target genes.

Analysis of methylation pattern in EBF1-transduced HL cell lines Analysis of fitness of EBF1-transduced HL cell lines As HRS cells and cHL cell lines are known to have highly It has been speculated that the loss of the B-cell gene expression methylated promoters of many B-cell genes,25–27,31 and EBF1 program may be a survival strategy of HRS cells with a non- seems to be involved in DNA demethylation,17 we studied functional B-cell receptor.3 As some B-cell genes are re-expressed whether enforced expression of EBF1 in the cHL cell lines on enforced EBF1 expression in HL cell lines, we wondered L-1236, L-428 and KM-H2 by lentiviral transduction influences whether these changes would be sufficient to cause a reduced the DNA methylation status of the EBF1 target genes CD19, CD79B survival of the cells. Therefore, the fitness of the EBF1 re- and PAX5 (a and b promoter). The cell lines were analyzed 9 days expressing L-1236, L-428, KM-H2, U-HO1 was tested. We sorted

Leukemia (2013) 671 – 679 & 2013 Macmillan Publishers Limited EBF1 in classical Hodgkin lymphoma V Bohle et al 675

Figure 4. Expression of EBF1 target genes after EBF1 transduction. (a) Semiquantitative RT-PCR of positively and negatively regulated EBF1 target genes. b-Actin is used for normalization. For the cell lines L-1236 and KM-H2, two independent semiquantitative RT-PCRs are shown. (b) Real-time RT-PCR of positively and negatively regulated EBF1 target genes. Typical results of different transductions are summarized in this ﬁgure. Corresponding b-actin and empty vector controls are used for DDCt calculation. Control, positive/negative PCR control; ev, empty vector control; ut, untreated cells.

Table 1. Common differentially expressed genes among the EBF1-transduced cell lines L-1236 and L-428

Gene symbol FC (L-1236) FC (L-428) Transcript ID Gene name

CCL22 2.9 2.0 7996022 Chemokine (C-C motif) ligand 22 SEMA7A 2.6 2.5 7990345 Semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) FCER2 2.5 5.1 8033420 Fc fragment of IgE, low-afﬁnity II, receptor for (CD23) CRLF2 À 2.3 À 2.5 8171105 Cytokine receptor-like factor 2

Abbreviations: EBF1, early B-cell factor 1; FC, fold change; IgE, immunoglobulin E. All genes are significant with a false discovery rate of p5% and both have a minimum regulation of twofold. tGFP-positive cells 3 or 5 days post transduction, let them recover pathogenetic relevance, for example, by promoting the survival of for 2 days and performed a cell proliferation assay in comparison HRS precursor cells with crippled B-cell receptor.4 Hence, it is with control-transduced cells. The fitness (glycolysis rate) of EBF1- important to understand the factors that have essential roles transduced L-1236 cells is weaker than of control-transduced cells in the loss of the B-cell gene expression program of HRS cells. (Figure 6). We did not detect this effect in L-428, KM-H2 and A number of factors have been identified that contribute to this U-HO1 cells (data not shown). The approach used may, however, downregulation of B-cell genes in HRS cells. These include underestimate the effect of EBF1 on survival, because it has been inhibition of E2A by ID2 and activated B-cell factor 1, described that apoptotic cells lose green fluorescent protein downregulation of transcription factors Oct2, PU.1 and BOB1, fluorescence.32 aberrant expression of the T-cell transcription factor Notch1, constitutive activity of STAT5a and epigenetic silencing of many B-cell genes.33 In this study, we addressed the issue whether also DISCUSSION the low or undetectable level of EBF1 contributes to the lost B-cell One of the most peculiar features of HRS cells in cHL is that these phenotype of HRS cells. mature B-cell-derived tumor cells have largely lost their B-cell- The enforced expression of EBF1 in cHL cell lines indeed typical gene expression pattern. It has been speculated that this partially reconstituted the B-cell status of these cells, which was consistent and dramatic ‘reprogramming’ of the HRS cells is of shown by semiquantitative RT-PCR and real-time RT-PCR.

& 2013 Macmillan Publishers Limited Leukemia (2013) 671 – 679 EBF1 in classical Hodgkin lymphoma V Bohle et al 676

Figure 5. Methylation pattern of EBF1-transduced cells in comparison with control cells. Methylation status of each sequenced CpG is shown. Each block represents one PCR amplicon and each row one single clone. Red boxes symbolize methylated CpGs, blue ones unmethylated CpGs and white ones could not be evaluated by the program BiQ Analyzer HT. All CpGs of the first CD19 amplicon belong to the promoter region, whereas CpG 1 to 6 of the second CD19 amplicon are part of the promoter and CpGs 7 to 11 are part of exon 1. In case of CD79B, all CpGs of the first amplicon and CpG 1 to 5 of the second amplicon are of the promoter. CpGs 6 to 14 are part of exon 1 and CpGs 15 and 16 (which could not be evaluated) are part of intron 1. The PAX5a amplicon lies completely in the promoter region. The first amplicon of PAX5b and CpG 1 to 12 of the second amplicon are part of the promoter, whereas CpGs 13 to 36 are in exon 1.

Leukemia (2013) 671 – 679 & 2013 Macmillan Publishers Limited EBF1 in classical Hodgkin lymphoma V Bohle et al 677 microarray, some of the analyzed genes disappear in the background of the chip or cannot be considered as significant such as CD79A in L-428 and CD79B in L-1236 (data not shown). Interestingly, over 100 and 200 genes in L-428 and L-1236, respectively, showed a significant regulation (false discovery rate p5%), albeit mostly at a low fold-change. Nevertheless, 34 genes in L-1236 and 21 genes in L-428 showed a more than twofold change in transcript levels on EBF1 re-expression. The overlap of the regulated genes was rather small in the two cell lines, likely Figure 6. Cell proliferation assay of EBF1- and control-transduced reflecting the already known heterogeneity of HRS cells and cHL cells. Sorted EBF1- and control vector-transduced tGFP-positive cell lines.40,41 Focusing on commonly regulated genes, we L-1236 cells were cultured for 2 days. Subsequently, the glycolysis identified CCL22 (MDC, chemokine (C-C motif) ligand 22/ rate was monitored in an enzyme-linked immunosorbent assay macrophage-derived chemokine), SEMA7A (CD108, semaphorin (ELISA) reader by a colorimetric change of the CellTiter96 AQueous 7A, GPI membrane anchor), FCER2 (CD23, low-affinity One Solution Cell Proliferation Assay (Promega Corporation), which immunoglobulin epsilon Fc receptor) and CRLF2 (cytokine contains a tetrazolium compound [3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; receptor-like factor 2) as direct or indirect EBF1 target genes in MTS]. The difference is significant with a P-value of 5.4 Â 10 À 6 HRS cells. calculated with the paired two-sample t-test. One of two repetitions CCL22 attracts activated T cells and is normally expressed by 42 with similar results are shown. activated B lymphocytes and dendritic cells. It is also expressed and secreted by HRS cells and might have an influence on the typical cHL microenvironment.43,44 The upregulation of CCL22 in Increased transcription of the B-cell genes CD19, CD79A and HRS cells on EBF1 re-expression indicates that this chemokine is a CD79B was observed in all cell lines analyzed. For CD79A, we target of EBF1. Sema7a has a critical role in inflammatory immune tested also for protein expression by immunoblot analysis, but no responses.45 EBF1 positively regulates expression of Sema7a in protein was detectable. This may on the one hand be due to murine B cells.16,18 Its function in B cells is still unknown. The FCeR instability of the protein in the absence of immunoglobulin CD23 is expressed by naive B cells and other hematopoietic cells. expression to allow assembly of a stable B-cell receptor. On the Whether primary HRS cells express CD23 is controversial,46–49 but other hand, the re-expression of CD79A mRNA may be restricted we observed in our analysis a medium to strong expression in the to only a fraction of the HRS cells, so that not sufficient protein is HL cell lines, which is further increased by EBF1. Thus, CD23 is a made to enable detection by immunoblot. Absence of EBF1 target further B-cell molecule that is influenced in its expression by the gene protein expression after short-term expression of transfected low EBF1 levels in HRS cells. Finally, CRLF2, the expression of which EBF1 gene was also seen by Hertel et al.,20 who showed activity of is downregulated by EBF1, builds together with the IL7Ra chain a co-transfected CD19 reporter gene but no expression of the receptor for thymic stromal lymphopoietin, which has a role in endogenous CD19 by flow cytometric analysis.20 early B-cell development.50 PAX5, a direct EBF1 target, and FOXO1, which is at least in Studies in the mouse indicated that EBF1 influences the murine B cells positively regulated by EBF1, were not re-expressed methylation status of target genes. However, in the studies on EBF1 expression in the HL cell lines. That EBF1 does not cause a presented here, there was hardly any demethylation of the full reappearance of the B-cell program in the HL cell lines is promoters of the EBF1 target genes CD19, CD79B and PAX5 certainly not surprising, because most B-cell genes are positively detectable, with exception of the PAX5a promoter in L-1236 cells, regulated by numerous transcription factors, so that enforced which showed a strong demethylation on EBF1 re-expression. expression of EBF1 alone is likely not sufficient to reactivate all Perhaps, the epigenetic structure of these gene promoters is too these genes. For example, CD79A expression is presumably stable to be affected in HRS cells by several days of re-expression coregulated by Ets, EBF1, IKAROS and Sp1,34 CD79B by Sp1, Ets, of EBF1. The fact that we nevertheless observed increased OCT, IKAROS and EBF1,35,36 and PAX5 by EBF1, STAT5, SPI1, IRF4, transcription of the CD19, CD79B and PAX5 genes could mean IRF8 and NF-kB.37,38 that low level transcription of these genes is possible even in the We also studied the influence of EBF1 re-expression on the presence of methylated CpGs in their promoter regions. transcript levels of ID2 and NOTCH1, because these suppressive Alternatively, but not mutually exclusively, the increased expres- factors for B-cell genes were expected to be downregulated by sion of the three genes may stem from only a small fraction of HRS EBF1, based on studies in the mouse.15 However, no cells that opened the gene loci on EBF1 expression, whereas most downregulation was observed. For Notch1, there was even an cells keep a methylated and silent structure of the promoters. upregulation of transcript levels seen in L-1236 cells. However, We also tested whether enforced re-expression of EBF1 affected Notch1 expression might not be completely aberrant in human B the fitness of HL cell lines. However, three of the lines analyzed did cells, as its expression has recently been described in human not show any effect, and only L-1236 cells showed a moderate, germinal center B cells.39 The retained expression of Notch1 and but significant reduced fitness (Figure 6). The experimental setup ID2 in HL cell lines with enforced expression of EBF1 is likely a may underestimate the effect of EBF1 on cell survival, because we further factor why only a moderate re-expression of typical EBF1 had to sort the transduced cells as tGFP-positive cells before the target genes was observed. Notch1 functions as an inhibitor of cell proliferation assay, and it is known that dead cells lose green E2A, EBF1 and their target genes in cHL cell lines,24 and ID2 fluorescent protein expression. Hence, cells that died early after prevents DNA binding of E2A.11,12 As E2A is hence repressed in EBF1 re-expression before sorting were excluded from the HRS cells and as two-thirds of the EBF1 target genes are measurement. Nevertheless, as we did not observe massive cell coregulated by E2A,14 the retained ID2 expression presumably death specifically in the EBF1-transduced cells before sorting, and impaired a strong upregulation of many EBF1 target genes in the as only one of four cHL lines tested showed any effect of EBF1 EBF1-expressing HL cell lines. silencing on survival, it seems that EBF1 re-expression is not By gene chip analysis, we searched for further genes showing sufficient to compromise the viability of the HRS cells. changes in gene expression on re-expression of EBF1. The In summary, EBF1 has the ability to reconstitute part of the microarray studies generally confirmed the quantitative RT-PCR B-cell status of HRS cells but is not capable to repress aberrantly results, especially for CD79A and NOTCH1 in L-1236 (data not expressed factors of other hematopoietic lineages such as Notch1 shown). As the quantitative RT-PCR is more sensitive than the and ID2. EBF1 has little influence on the methylation pattern of its

& 2013 Macmillan Publishers Limited Leukemia (2013) 671 – 679 EBF1 in classical Hodgkin lymphoma V Bohle et al 678 target genes. Overall, the downregulation of EBF1 expression in 19 Gyo¨ry I, Boller S, Nechanitzky R, Mandel E, Pott S, Liu E et al. Transcription factor HRS cell contributes to the lost B-cell phenotype and hence Ebf1 regulates differentiation stage-specific signaling, proliferation, and survival participates in the ‘reprogramming’ of these tumor cells. In rare of B cells. Genes Dev 2012; 26: 668–682. instances, as seen here for KM-H2, genetic lesions in the EBF1 20 Hertel CB, Zhou XG, Hamilton-Dutoit SJ, Junker S. Loss of B cell identity correlates gene may contribute to loss of EBF1 expression. with loss of B cell-specific transcription factors in Hodgkin/Reed-Sternberg cells of classical Hodgkin lymphoma. Oncogene 2002; 21: 4908–4920. 21 Krenacs L, Himmelmann AW, Quintanilla-Martinez L, Fest T, Riva A, Wellmann A CONFLICT OF INTEREST et al. Transcription factor B-cell-specific activator protein (BSAP) is differentially expressed in B cells and in subsets of B-cell lymphomas. Blood 1998; 92: The authors declare no conflict of interest. 1308–1316. 22 Foss HD, Reusch R, Demel G, Lenz G, Anagnostopoulos I, Hummel M et al. Frequent expression of the B-cell-specific activator protein in Reed-Sternberg cells ACKNOWLEDGEMENTS of classical Hodgkin’s disease provides further evidence for its B-cell origin. Blood We thank Gwen Lorenz for expert technical assistance, Klaus Lennartz for cell sorting 1999; 94: 3108–3113. and Jens Stanelle for helpful discussions. This work was supported by the Deutsche 23 Tiacci E, Do¨ring C, Brune V, van Noesel CJ, Klapper W, Mechtersheimer G et al. Krebshilfe (108687). Analyzing primary Hodgkin and Reed-Sternberg cells to capture the molecular and cellular pathogenesis of classical Hodgkin lymphoma. Blood 2012, ealy online Sept. 5. PMID: 22955914. REFERENCES 24 Jundt F, Acikgoz O, Kwon SH, Schwarzer R, Anagnostopoulos I, Wiesner B et al. 1Ku¨ppers R, Rajewsky K, Zhao M, Simons G, Laumann R, Fischer R et al. Hodgkin Aberrant expression of Notch1 interferes with the B-lymphoid phenotype of disease: Hodgkin and Reed-Sternberg cells picked from histological sections show neoplastic B cells in classical Hodgkin lymphoma. Leukemia 2008; 22: 1587–1594. clonal immunoglobulin gene rearrangements and appear to be derived from 25 Doerr JR, Malone CS, Fike FM, Gordon MS, Soghomonian SV, Thomas RK et al. B cells at various stages of development. Proc Natl Acad Sci USA 1994; 91: Patterned CpG methylation of silenced B cell gene promoters in classical Hodgkin 10962–10966. lymphoma-derived and primary effusion lymphoma cell lines. J Mol Biol 2005; 2Mu¨schen M, Rajewsky K, Braüninger A, Baur AS, Oudejans JJ, Roers A et al. Rare 350: 631–640. occurrence of classical Hodgkin’s disease as a T cell lymphoma. J Exp Med 2000; 26 Ushmorov A, Leithauser F, Sakk O, Weinhausel A, Popov SW, Moller P et al. 191: 387–394. Epigenetic processes play a major role in B-cell-specific gene silencing in classical 3 Kanzler H, Ku¨ppers R, Hansmann ML, Rajewsky K. Hodgkin and Reed-Sternberg Hodgkin lymphoma. Blood 2006; 107: 2493–2500. cells in Hodgkin’s disease represent the outgrowth of a dominant tumor clone 27 Ammerpohl O, Haake A, Pellissery S, Giefing M, Richter J, Balint B et al. Array- derived from (crippled) germinal center B cells. J Exp Med 1996; 184: 1495–1505. based DNA methylation analysis in classical Hodgkin lymphoma reveals new 4 Schwering I, Braüninger A, Klein U, Jungnickel B, Tinguely M, Diehl V et al. Loss of insights into the mechanisms underlying silencing of B cell-specific genes. the B-lineage-specific gene expression program in Hodgkin and Reed-Sternberg Leukemia 2012; 26: 185–188. cells of Hodgkin lymphoma. Blood 2003; 101: 1505–1512. 28 Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinfor- 5 Watanabe K, Yamashita Y, Nakayama A, Hasegawa Y, Kojima H, Nagasawa T et al. matics 2002; 18: 1427–1431. Varied B-cell immunophenotypes of Hodgkin/Reed-Sternberg cells in classic 29 Lutsik P, Feuerbach L, Arand J, Lengauer T, Walter J, Bock C. BiQ Analyzer HT: Hodgkin’s disease. Histopathology 2000; 36: 353–361. locus-specific analysis of DNA methylation by high-throughput bisulfite sequen- 6 Stein H, Marafioti T, Foss HD, Laumen H, Hummel M, Anagnostopoulos I et al. cing. Nucleic Acids Res 2011; 39(Web Server issue): W551–W556. Down-regulation of BOB.1/OBF.1 and Oct2 in classical Hodgkin disease but not in 30 Zandi S, Mansson R, Tsapogas P, Zetterblad J, Bryder D, Sigvardsson M. lymphocyte predominant Hodgkin disease correlates with immunoglobulin EBF1 is essential for B-lineage priming and establishment of a transcription transcription. Blood 2001; 97: 496–501. factor network in common lymphoid progenitors. J Immunol 2008; 181: 7 Re D, Muschen M, Ahmadi T, Wickenhauser C, Staratschek-Jox A, Holtick U et al. 3364–3372. Oct-2 and Bob-1 deficiency in Hodgkin and Reed Sternberg cells. Cancer Res 2001; 31 Ushmorov A, Ritz O, Hummel M, Leithauser F, Moller P, Stein H et al. Epigenetic 61: 2080–2084. silencing of the immunoglobulin heavy-chain gene in classical Hodgkin lym- 8 van den Berg A, Visser L, Poppema S. High expression of the CC chemokine TARC phoma-derived cell lines contributes to the loss of immunoglobulin expression. in Reed-Sternberg cells. A possible explanation for the characteristic T-cell infil- Blood 2004; 104: 3326–3334. tratein Hodgkin’s lymphoma. Am J Pathol 1999; 154: 1685–1691. 32 Lowder M, Unge A, Maraha N, Jansson JK, Swiggett J, Oliver JD. Effect of star- 9Ku¨ppers R, Klein U, Schwering I, Distler V, Braüninger A, Cattoretti G et al. Iden- vation and the viable-but-nonculturable state on green fluorescent protein (GFP) tification of Hodgkin and Reed-Sternberg cell-specific genes by gene expression fluorescence in GFP-tagged Pseudomonas fluorescens A506. Appl Environ Micro- profiling. J Clin Invest 2003; 111: 529–537. biol 2000; 66: 3160–3165. 10 Jundt F, Anagnostopoulos I, Forster R, Mathas S, Stein H, Dorken B. Activated 33 Ku¨ppers R, Braüninger A. Reprogramming of the tumour B-cell phenotype in Notch1 signaling promotes tumor cell proliferation and survival in Hodgkin and Hodgkin lymphoma. Trends Immunol 2006; 27: 203–205. anaplastic large cell lymphoma. Blood 2002; 99: 3398–3403. 34 Leduc I, Cogne M. Regulatory elements of the mb-1 gene encoding the Ig-alpha 11 Mathas S, Janz M, Hummel F, Hummel M, Wollert-Wulf B, Lusatis S et al. Intrinsic component of the human B-cell antigen receptor. Mol Immunol 1996; 33: inhibition of transcription factor E2A by HLH proteins ABF-1 and Id2 mediates 1277–12786. reprogramming of neoplastic B cells in Hodgkin lymphoma. Nat Immunol 2006; 7: 35 Akerblad P, Rosberg M, Leanderson T, Sigvardsson M. The B29 (immunoglobulin 207–215. beta-chain) gene is a genetic target for early B-cell factor. Mol Cell Biol 1999; 19: 12 Renne C, Martin-Subero JI, Eickernjager M, Hansmann ML, Ku¨ ppers R, Siebert R et 392–401. al. Aberrant expression of ID2, a suppressor of B-cell-specific gene expression, in 36 Thompson AA, Wood Jr. WJ, Gilly MJ, Damore MA, Omori SA, Wall R. The promoter Hodgkin’s lymphoma. Am J Pathol 2006; 169: 655–664. and 50 flanking sequences controlling human B29 gene expression. Blood 1996; 13 Ku¨ppers R. The biology of Hodgkin’s lymphoma. Nat Rev Cancer 2009; 9: 15–27. 87: 666–673. 14 Lin YC, Jhunjhunwala S, Benner C, Heinz S, Welinder E, Mansson R et al. A global 37 Decker T, Pasca di Magliano M, McManus S, Sun Q, Bonifer C, Tagoh H et al. network of transcription factors, involving E2A, EBF1 and Foxo1, that orchestrates Stepwise activation of enhancer and promoter regions of the B cell commitment B cell fate. Nat Immunol 2010; 11: 635–643. gene Pax5 in early lymphopoiesis. Immunity 2009; 30: 508–520. 15 Pongubala JM, Northrup DL, Lancki DW, Medina KL, Treiber T, Bertolino E et al. 38 Hirokawa S, Sato H, Kato I, Kudo A. EBF-regulating Pax5 transcription is enhanced Transcription factor EBF restricts alternative lineage options and promotes B cell by STAT5 in the early stage of B cells. Eur J Immunol 2003; 33: 1824–1829. fate commitment independently of Pax5. Nat Immunol 2008; 9: 203–215. 39 Yoon SO, Zhang X, Berner P, Blom B, Choi YS. Notch ligands expressed by folli- 16 Treiber T, Mandel EM, Pott S, Gyory I, Firner S, Liu ET et al. Early B cell factor 1 cular dendritic cells protect germinal center B cells from apoptosis. J Immunol regulates B cell gene networks by activation, repression, and transcription- 2009; 183: 352–358. independent poising of chromatin. Immunity 2010; 32: 714–725. 40 Drexler HG. Recent results on the biology of Hodgkin and Reed-Sternberg cells. I. 17 Maier H, Ostraat R, Gao H, Fields S, Shinton SA, Medina KL et al. Early B cell factor Biopsy material. Leuk Lymphoma 1992; 8: 283–313. cooperates with Runx1 and mediates epigenetic changes associated with mb-1 41 Drexler HG. Recent results on the biology of Hodgkin and Reed-Sternberg cells. II. transcription. Nat Immunol 2004; 5: 1069–1077. Continuous cell lines. Leuk Lymphoma 1993; 9: 1–25. 18 Vilagos B, Hoffmann M, Souabni A, Sun Q, Werner B, Medvedovic J et al. Essential 42 Schaniel C, Pardali E, Sallusto F, Speletas M, Ruedl C, Shimizu T et al. Activated role of EBF1 in the generation and function of distinct mature B cell types. J Exp murine B lymphocytes and dendritic cells produce a novel CC chemokine which Med 2012; 209: 775–792. acts selectively on activated T cells. J Exp Med 1998; 188: 451–463.

Leukemia (2013) 671 – 679 & 2013 Macmillan Publishers Limited EBF1 in classical Hodgkin lymphoma V Bohle et al 679 43 Maggio EM, Van Den Berg A, Visser L, Diepstra A, Kluiver J, Emmens R et al. 47 Jarrett RF, Armstrong A, Wilkins BS, Jones DB. Immunohistochemical determina- Common and differential chemokine expression patterns in rs cells of NLP, tion of CD23 expression in Hodgkin’s disease using paraffin sections. J Pathol EBV positive and negative classical Hodgkin lymphomas. Int J Cancer 2002; 99: 1991; 164: 345–346. 665–672. 48 Salama ME, Rajan Mariappan M, Inamdar K, Tripp SR, Perkins SL. The value of 44 Poppema S. Immunobiology and pathophysiology of Hodgkin lymphomas. CD23 expression as an additional marker in distinguishing mediastinal Hematology Am Soc Hematol Educ Program 2005 231–238. (thymic) large B-cell lymphoma from Hodgkin lymphoma. Int J Surg Pathol 2010; 45 Suzuki K, Okuno T, Yamamoto M, Pasterkamp RJ, Takegahara N, Takamatsu H et 18: 121–128. al. Semaphorin 7A initiates T-cell-mediated inflammatory responses through 49 Rowlands DC, Hansel TT, Crocker J. Immunohistochemical determination of CD23 alpha1beta1 integrin. Nature 2007; 446: 680–684. expression in Hodgkin’s disease using paraffin sections. JPathol1990; 160:239–243. 46 Angel CA, Warford A, Campbell AC, Pringle JH, Lauder I. The immunohistology of 50 Pandey A, Ozaki K, Baumann H, Levin SD, Puel A, Farr AG et al. Cloning Hodgkin’s disease--Reed-Sternberg cells and their variants. J Pathol 1987; 153: of a receptor subunit required for signaling by thymic stromal lymphopoietin. 21–30. Nat Immunol 2000; 1: 59–64.

Supplementary Information accompanies the paper on the Leukemia website (http://www.nature.com/leu)

& 2013 Macmillan Publishers Limited Leukemia (2013) 671 – 679