DOCSLIB.ORG

In Hodgkin Lymphoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
In Hodgkin Lymphoma Leukemia (2013) 27, 671–679 & 2013 Macmillan Publishers Limited All rights reserved 0887-6924/13 www.nature.com/leu ORIGINAL ARTICLE Role of early B-cell factor 1 (EBF1) in Hodgkin lymphoma V Bohle1,CDo¨ ring2, M-L Hansmann2 and R Ku¨ ppers1 A hallmark of classical Hodgkin lymphoma (cHL) is that the B-cell-derived Hodgkin and Reed–Sternberg (HRS) tumor cells have largely lost the B-cell-typical gene expression program. The factors causing this ‘reprogramming’ of HRS cells are only partly understood. As early B-cell factor 1 (EBF1), a major B-cell transcription factor, is downregulated in HRS cells, we analyzed whether this downregulation contributes to the lost B-cell phenotype and tested the consequences of EBF1 re-expression in cHL cell lines. EBF1 re-expression caused an upregulation of B-cell genes, such as CD19, CD79A and CD79B, although the B-cell genes FOXO1 and PAX5 remained lowly expressed. The re-expression of CD19, CD79A and CD79B occurred largely without demethylation of promoter CpG motifs of these genes. In the cHL cell line L-1236 fitness decreased after EBF1 re-expression. These data show that EBF1 has the ability to reintroduce part of the B-cell signature in cHL cell lines. Loss of EBF1 expression in HRS cells therefore contributes to their lost B-cell phenotype. Notably, in the cHL cell line KM-H2 destructive mutations were found in one allele of EBF1, indicating that genetic lesions may sometimes have a role in impairing EBF1 expression. Leukemia (2013) 27, 671–679; doi:10.1038/leu.2012.280 Keywords: B-cell phenotype; CD19; CD79; EBF1; Hodgkin lymphoma INTRODUCTION In cHL, the function of the three central B-cell transcription Classical Hodgkin lymphoma (cHL) is a common malignant factors EBF1, E2A and PAX5 is compromised. E2A is expressed in 11,20 lymphoma in the western world. The Hodgkin and Reed– HRS cells but often at low level, and is functionally inactivated Sternberg (HRS) tumor cells are rare and usually account for only by the E2A inhibitors ID2 and activated B-cell factor 1, which are 9,11,12 a few percent of cells in the tumor tissue, whereas the vast highly expressed in HRS cells. PAX5 is present in most cHL majority of cells in the lymphoma microenvironment represent cases but there is large variation in the number and intensity of 11,20–22 inflammatory cells. Although HRS cells originate in nearly all cases positive HRS cells. EBF1 mRNA is absent or expressed only 11,20 from B cells,1–3 they have a profound lack of B-cell-typical gene at very low level in cHL cell lines and also weak or absent in expression.4 This includes cell surface markers (CD19, CD79A),5 primary cases in comparison with germinal center B cells (see 23 signaling molecules (Syk, Lyn, Blk)4 and transcription factors (Oct2, genechip data from ref. Tiacci et al. ). Beside ID2 and activated BOB.1).6,7 Furthermore, HRS cells express markers of other B-cell factor 1, the T-cell transcription factor Notch1 might further hematopoietic lineages such as CCL17,8 GATA-3,9 Notch1,10 and influence this B-cell transcription factor network. Notch1 is inhibitor of differentiation and DNA-binding 2 (ID2).11,12 cHL is strongly expressed in HRS cells and inhibits the expression of 10,24 unique among lymphoid malignancies in the extent to which the E2A and EBF1. In addition to unbalanced transcription factors, lymphoma cells have lost the gene expression pattern of their epigenetic features are also deregulated in HRS cells and might normal precursor cells and have upregulated expression of non-B- influence the aberrant gene expression in these cells. B-cell genes cell genes.13 It has been speculated that this ‘reprogramming’ is of such as SYK, POU2AF1 (BOB.1, OBF1) and CD79B have methylated pathogenetic relevance for HRS cells.13 promoters in cHL cell lines and primary HRS cells and are therefore 25,26 Early B-cell factor 1 (EBF1) is a central transcription factor in B silenced. A genome-wide DNA methylation analysis of cHL cell cells.14–16 In B cells, it operates as a homodimer in cooperation lines showed that B-cell genes were preferentially found among 27 with two other major B-cell transcription factors, that is, E2A and those with hypermethylated promoters. PAX5.14,16 EBF1 is expressed in all stages of B-cell development In this study, we analyzed the relevance of the low or absent except plasma cells. EBF1 not only induces expression of EBF1 expression for the phenotype of HRS cells. We wondered numerous B-cell genes, but at least in murine B cells it also whether EBF1 silencing has an impact on the aberrant gene represses factors of other hematopoietic lineages. For example, expression of HRS cells or whether its loss influences the EBF1 suppresses the myeloid gene CEBPA, the T-cell transcription deregulated methylation pattern of B-cell genes. factor Notch1 and the natural killer cell factor ID2.15 EBF1 also seems to be involved in epigenetic modifications such as demethylation of the CD79A promoter17 and methylation of MATERIALS AND METHODS 16 histones. Conditional knockout mice have shown that EBF1 is a B Cell culture and B-cell isolation lineage commitment factor and essential for the survival of pro-B Cell lines L-1236, L-428, KM-H2, Raji and SUP-HD1 were cultured in RPMI- cells, marginal zone and B1 B cells, whereas germinal centers were 1640 medium with stable glutamine supplemented with 10% fetal calf formed but not maintained without EBF1.18,19 serum (Biochrom AG, Berlin, Germany). Cell line HDLM-2 was cultured in 1Institute of Cell Biology (Cancer Research), University of Duisburg-Essen, Medical School, Essen, Germany and 2Senckenberg Institute of Pathology, University of Frankfurt, Frankfurt/Main, Germany. Correspondence: Professor R Ku¨ppers, Institute of Cell Biology (Cancer Research), University of Duisburg-Essen, Medical School, Virchowstr. 173, 45122 Essen, Germany. E-mail: [email protected] Received 10 August 2012; revised 17 September 2012; accepted 18 September 2012; accepted article preview online 1 October 2012; advance online publication, 23 November 2012 EBF1 in classical Hodgkin lymphoma V Bohle et al 672 RPMI-1640 medium with 20% fetal calf serum and U-HO1 in Iscove’s exponential phase of the PCR was determined in pretests. The primer modification of Dulbecco’s medium/RPMI-1640 (4:1) with 20% fetal calf sequences are as follows (50–30, each forward and reverse): ACTB serum. All media were supplemented with 1% penicillin–streptomycin (b-actin), AGCCTCGCCTTTGCCGATC, AGCGGGCGATATCATCATCC; GAPDH, (Invitrogen, Darmstadt, Germany). Germinal center B cells were isolated CCACATCGCTCAGACACCATG, TGAAGGGGTCATTGATGGCAAC; EBF1, GTAC- from human tonsils as CD77-positive cells, using the MACS system CATGCTGGTCTGGAGTG, GTGTGACTTCCACAACACCAGG; CD19, CAA (Miltenyi Biotech, Bergisch-Gladbach, Germany). CCTGACCATGTCATTCCACC, CACAGGCAGAAGATCAGATAAGCC; CD79A, ATCTGGTACCCTGGGACTGC, GGACCTTGTGCATCCACAGG; CD79B,AGCCTCG Western blot GACGTTGTCACG, GATTCCGGTACCGGTCCTC; PAX5, GTCCCAGCTTCCAGTCA CAG, CGGAGACTCCTGAATACCTTCG; ID2, CTCGCATCCCACTATTGTCAGC, Western blot analysis to demonstrate the endogenous and exogenous GAACACCGCTTATTCAGCCACAC and NOTCH1, GAATGGCGGGAAGTGTG EBF1 expression was performed using standard conditions and the AAGC, TGCAGGCATAGTCTGCCACG. The cycling program consists of following antibodies: anti-EBF1 (#H00001879-M01, Abnova, Heidelberg, 95 1C for 3 min, followed by 27–45 cycles of 95 1C for 15 s/60 1C for Germany, 1:100–1:10 000; 2nd ab: #115-036-062, Jackson Immuno 15 s/72 1C for 20 s. Research, Hamburg, Germany, 1:2000), anti-glyceraldehyde 3-phosphate dehydrogenase (#sc-31915, Santa Cruz, 1:200; 2nd ab: #sc-2350, Santa Cruz, Heidelberg, Germany, 1:10 000). EBF1 target gene expression was analyzed Real-time RT-PCR of EBF1 target genes in transduced cells using the same conditions as above and the following antibodies: anti- Quantitative real-time PCR analysis was performed on an ABI Prism 7900HT CD79A (#ab-79414, Abcam, Cambridge, UK, 1:500; 2nd ab: #711-036-152; Fast Real-Time PCR System (Applied Biosystems) using predesigned, Jackson Immuno Research, 1:10 000), anti-b-tubulin (#69126, MP Biomedi- intron-spanning assays (Applied Biosystems): ACTB (Hs99999903_m1), cals, Eschwege, Germany, 1:200; 2nd ab: #115-036-062, Jackson Immuno CD79B (Hs00236881_m1), ID2 (Hs00747379_m1), CD19 (Hs00174333_m1), Research, 1:2000). PAX5 (Hs00277134_m1), NOTCH1 (Hs01062014_m1), FOXO1 (Hs01054576_m1), and TaqMan Universial PCR MasterMix, No AmpErase UNG (Applied Sequence analysis of EBF1 Biosystems). Each cell line was transduced independently two to three times and each gene was measured in duplicates or quadruplicates. Sanger sequencing was performed to analyze the HL cell lines for mutations in EBF1. A 3130 Genetic Analyzer (Applied Biosystems, Darmstadt, Germany) and the BigDye Terminator v3.1 Cycle Sequencing Affymetrix genechips of transduced HL cells Kit (Applied Biosystems) were used. Four PCR products were generated to Cell lines L-428 and L-1236 were transduced three times each with EBF1 or amplify the coding region of EBF1, of which three were sequenced directly control vector constructs and positive cells were sorted 8 days post and one (*) was cloned in pGEM-T easy before sequencing because of four infection for RNA isolation. In all, 150 ng total RNA (RNeasy Micro Kit, different isoforms, which are also present in CD77-positive tonsillar Qiagen) of the transduced cell lines L-428 and L-1236 were amplified by germinal center B cells. The following primers were used for amplifying 0 0 the Ambion WT Expression Kit (Applied Biosystems). Labeling and EBF1 complementary DNA (cDNA) (5 –3 , forward and reverse): hybridization were performed using the GeneChip WT Terminal Labeling TTCAAGGGGGAGGAGATTTTCC, CCGGTAGTGAATTCCGTTATTGG; AATCCAA and Hybridization Kit (Affymetrix, Mu¨nchen, Germany). Washing and CTTCTTCCACTTCGTCC, GGAGTAGCATGTTCCAGATAAGAG; GTCAATGTGG staining was done by the standard Affymetrix GeneChip protocol (Version ATGGCCATGTCC (*), GTTGTCCACTGAACGAATTCACG (*); GGAAATCATTCT 2) in the GeneChip Fluidics Station 450 (Affymetrix), the measurement was GAAGAGAGCGG, CTCTGGGACTTGTATCAGATTACTC.
Load more

Recommended publications
  • PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than Cd79a and Selective Association with T(8;21)-Acute Myelogenous Leukemia
    [CANCER RESEARCH 64, 7399–7404, October 15, 2004] PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than CD79a and Selective Association with t(8;21)-Acute Myelogenous Leukemia Enrico Tiacci,1 Stefano Pileri,2 Annette Orleth,1 Roberta Pacini,1 Alessia Tabarrini,1 Federica Frenguelli,1 Arcangelo Liso,3 Daniela Diverio,4 Francesco Lo-Coco,5 and Brunangelo Falini1 1Institutes of Hematology and Internal Medicine, University of Perugia, Perugia, Italy; 2Unit of Hematopathology, University of Bologne, Bologne, Italy; 3Section of Hematology, University of Foggia, Foggia, Italy; 4Department of Cellular Biotechnologies and Hematology, University La Sapienza of Rome, Rome, Italy; and 5Department of Biopathology, University Tor Vergata of Rome, Rome, Italy ABSTRACT (13, 16). PAX5 expression also occurs in the adult testis and in the mesencephalon and spinal cord during embryogenesis (17), suggesting an The transcription factor PAX5 plays a key role in the commitment of important role in the development of these tissues. hematopoietic precursors to the B-cell lineage, but its expression in acute Rearrangement of the PAX5 gene through reciprocal chromosomal leukemias has not been thoroughly investigated. Hereby, we analyzed routine biopsies from 360 acute leukemias of lymphoid (ALLs) and mye- translocations has been described in different types of B-cell malig- loid (AMLs) origin with a specific anti-PAX5 monoclonal antibody. Blasts nancies (18–23), and, more recently, PAX5 has also been shown to be from 150 B-cell ALLs showed strong PAX5 nuclear expression, paralleling targeted by aberrant hypermutation in Ͼ50% of diffuse large B-cell that of CD79a in the cytoplasm. Conversely, PAX5 was not detected in 50 lymphomas (24).
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Bispecific CAR-T Cells Targeting Both CD19 and CD22 for Therapy Of
    Dai et al. Journal of Hematology & Oncology (2020) 13:30 https://doi.org/10.1186/s13045-020-00856-8 RAPID COMMUNICATION Open Access Bispecific CAR-T cells targeting both CD19 and CD22 for therapy of adults with relapsed or refractory B cell acute lymphoblastic leukemia Hanren Dai1,2,3†, Zhiqiang Wu1†, Hejin Jia2†, Chuan Tong1, Yelei Guo1, Dongdong Ti1, Xiao Han1, Yang Liu4, Wenying Zhang2, Chunmeng Wang2, Yajing Zhang2, Meixia Chen2, Qingming Yang2, Yao Wang1* and Weidong Han1,2* Abstract Background: Despite the impressive complete remission (CR) induced by CD19 CAR-T cell therapy in B-ALL, the high rate of complete responses is sometimes limited by the emergence of CD19-negative leukemia. Bispecific CAR-modified T cells targeting both CD19 and CD22 may overcome the limitation of CD19-negative relapse. Methods: We here report the design of a bispecific CAR simultaneous targeting of CD19 and CD22. We performed a phase 1 trial of bispecific CAR T cell therapy in patients with relapsed/refractory precursor B-ALL at a dose that ranged from 1.7 × 106 to 3 × 106 CAR T cells per kilogram of body weight. Results: We demonstrate bispecific CD19/CD22 CAR T cells could trigger robust cytolytic activity against target cells. MRD-negative CR was achieved in 6 out of 6 enrolled patients. Autologous CD19/CD22 CAR T cells proliferated in vivo and were detected in the blood, bone marrow, and cerebrospinal fluid. No neurotoxicity occurred in any of the 6 patients treated. Of note, one patient had a relapse with blast cells that no longer expressed CD19 and exhibited diminished CD22 site density approximately 5 months after treatment.
    [Show full text]
  • CD81 Is Required for CD19-Complex Formation and Terminal Human B
    Supplemental Table 1. Primer sequences for PCR amplification and sequencing of CD81 coding regions from genomic DNA. Exon Forward primer Forward primer sequence Reverse primer Reverse primer sequence 1 CD81exon1F GGGGCGGGGCCTATGGAG CD81exon1R GGACCTGCCCAACGTGGA 2 CD81exon2F TGTGGGGTGGGCGCACTC CD81exon2R CACGCCATGCCCGACTGT 3 CD81exon3F ATCCCTGGCAGTCAGCAACC CD81exon3R TCCGCCCTGAGCACCAGC 4 CD81exon4F GTCAGGTCGTGGGCTGGT CD81exon4R CTGGAGATCCTCCTGGCAAGT 5 CD81exon5F TCTGGGGTCTAGCCTCGAAGC CD81exon5R CTGGGCGTAGGCAGGATT 6 CD81exon6F GGCCCCTGGATGCATTCT CD81exon6R AGTGTGGTCGCTCCCTGTGG 7+8 CD81exon7+8F CTGCGTGACAACGGGAAG CD81exon7+8R TATACACAGGCGGTGATGG Supplemental Table 2. Primer sequences for PCR amplification and sequencing of CD81 and CD225 transcripts. Gene Forward primer Forward primer sequence Reverse primer Reverse primer sequence CD81 CD81_mRNA_F1 GACCCCACCGCGCATCCT CD81_mRNA_R1 GGATGGCCCCGTAGCAGC CD81_mRNA_F2 CGCCCAACACCTTCTATGTA CD81_mRNA_R2 TGCCCGAGGGACACAAAT CD81_mRNA_F3 TTCCACGAGACGCTTGACTGCT CD81_mRNA_R3 AGGCCCGTCTCCACTCAT IFITM1 IFITM1_mRNA_F1 TCATTGGTCCCTGGCTAATTCAC IFITM1_mRNA_R1 GGTCACGTCGCCAACCAT IFITM1_mRNA_F2 ACAGCGAGACCTCCGTGC IFITM1_mRNA_R2 TCTAGGGGCAGGACCAAG Supplemental Table 3. PCR primers and TaqMan probes for CD81 transcript level quantification. Target Forward primer Forward primer sequence Reverse primer Reverse primer sequence TaqMan probe TaqMan probe Sequence total CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA CD81_RQ_R AGAGGTTGCTGATGATGTTGCTG T-CD81 ACTGACTGCTTTGACCACCTCAGTGCTCA wild type CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA
    [Show full text]
  • The REST/NRSF Pathway As a Central Mechanism in CNS Dysfunction
    The REST/NRSF Pathway as a Central Mechanism in CNS Dysfunction Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Alix Warburton April 2015 Disclaimer The data in this thesis is a result of my own work. The material collected for this thesis has not been presented, nor is currently being presented, either wholly or in part for any other degree or other qualification. All of the research, unless otherwise stated, was performed in the Department of Physiology and Department of Pharmacology, Institute of Translational Medicine, University of Liverpool. All other parties involved in the research presented here, and the nature of their contribution, are listed in the Acknowledgements section of this thesis. i Acknowledgements First and foremost, I would like to express my upmost gratitude to my primary and secondary supervisors Professor John Quinn (a.k.a Prof. Quinny) and Dr Jill Bubb for all of their support, guidance, wisdom (thank you Jill) and encouragement throughout my PhD; I could not have wished for a better pair. I am also extremely grateful to the BBSRC for funding my PhD project. I would also like to extend my thanks to Dr Graeme Sills for providing samples and assistance with my work on the SANAD epilepsy project, Dr Fabio Miyajima for offering his knowledge and knowhow on many occasions, Dr Gerome Breen for being a bioinformatics wizard and providing support on several projects, Dr Minyan Wang’s lab for their help and hospitality during my 3 month visit to Xi'an Jiaotong-Liverpool University, Dr Roshan Koron for assisting with the breast cancer study, Dr Chris Murgatroyd for his invaluable advice on ChIP and Professor Dan Rujescu’s lab for providing clinical samples and support with statistical analyses on the schizophrenia project.
    [Show full text]
  • CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-Lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity
    cancers Article CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity Shabirul Haque 1,2,* and Sarah R. Vaiselbuh 1,2,3 1 Feinstein Institute for Medical Research, Northwell Health, 350 Community Drive, Manhasset, NY 11030, USA; [email protected] 2 Department of Pediatrics, Staten Island University Hospital, Northwell Health, 475 Seaview Ave, Staten Island, NY 10305, USA 3 Monsey Health Center, 40 Robert Pitt Drive, Monsey, NY 10952, USA * Correspondence: [email protected] Simple Summary: Our research describes our designer exosomes express CD19 Chimeric Antigen Receptor (Exo-CD19 CAR). This novel Exo-CD19 CAR is cytotoxic for CD19-positive leukemia B-cells without interfering with cytotoxicity in CD19-negative cells. This innovation can be translated into broader clinical applications as CD19 CAR exosome-based nano-immunotherapy for B-cell leukemia instead of whole CD19 CAR T-cell immunotherapy. Abstract: CAR-T cell therapy is not without some clinical adverse effects, namely cytokine storms, due to a massive release of cytokines when CAR-T cells multiply in the body. Our goal was to develop exosomes expressing CD19 CAR to treat CD19-positive B-cell malignancies, instead of using whole CD19 CAR-T cells, thereby reducing the clinical risk of uncontrolled cytokine storms. Exosomes are Citation: Haque, S.; Vaiselbuh, S.R. extracellular nanovesicles (30–150 nm), composed of lipids, proteins, and nucleic acids, that carry the CD19 Chimeric Antigen fingerprint of their parent cells. Exosomes are a preferred delivery system in nano-immunotherapy. Receptor-Exosome Targets CD19 Here, HEK293T parent cells were transduced with CD19 CAR plasmids and cellular CD19 CAR Positive B-lineage Acute Lymphocytic expression was confirmed.
    [Show full text]
  • ORIGINAL ARTICLE Flow Cytometric Protein Expression Profiling As a Systematic Approach for Developing Disease-Specific Assays
    Leukemia (2006) 20, 2102–2110 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE Flow cytometric protein expression profiling as a systematic approach for developing disease-specific assays: identification of a chronic lymphocytic leukaemia-specific assay for use in rituximab-containing regimens AC Rawstron, R de Tute, AS Jack and P Hillmen Haematological Malignancy Diagnostic Service (HMDS), Leeds Teaching Hospitals, Leeds, UK Depletion of disease below the levels detected by sensitive sustained remissions only occur in patients achieving an MRD- minimal residual disease (MRD) assays is associated with negative complete response.12 Therefore MRD is increasingly prolonged survival in chronic lymphocytic leukaemia (CLL). being used as an end point for therapeutic trials, and several Flow cytometric MRD assays are now sufficiently sensitive and rapid to guide the duration of therapy in CLL, but generally rely studies are now using the assessment of MRD to define the on assessment of CD20 expression, which cannot be accurately duration of therapy. measured during and after therapeutic approaches containing Approaches using allele-specific oligonucleotide polymerase rituximab. The aim of this study was to use analytical software chain reaction (ASO-PCR) to the immunoglobulin gene of the developed for microarray analysis to provide a systematic B-CLL cell are generally accepted to show the highest sensitivity approach for MRD flow assay development. Samples from CLL for MRD detection. However, more recent four-colour ap- patients (n ¼ 49), normal controls (n ¼ 21) and other B-lympho- proaches show sensitivities nearing that of ASO-PCR6,11,13 with proliferative disorders (n ¼ 12) were assessed with a panel of 66 antibodies.
    [Show full text]
  • Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn K
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423142; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Running Title: MDC1 co-regulates ER in ILC 2 3 Research article 4 5 Mediator of DNA damage checkpoint 1 (MDC1) is a novel estrogen receptor co-regulator in invasive 6 lobular carcinoma of the breast 7 8 Evelyn K. Bordeaux1+, Joseph L. Sottnik1+, Sanjana Mehrotra1, Sarah E. Ferrara2, Andrew E. Goodspeed2,3, James 9 C. Costello2,3, Matthew J. Sikora1 10 11 +EKB and JLS contributed equally to this project. 12 13 Affiliations 14 1Dept. of Pathology, University of Colorado Anschutz Medical Campus 15 2Biostatistics and Bioinformatics Shared Resource, University of Colorado Comprehensive Cancer Center 16 3Dept. of Pharmacology, University of Colorado Anschutz Medical Campus 17 18 Corresponding author 19 Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, 20 CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: 21 @mjsikora 22 23 Authors' contributions 24 MJS conceived of the project. MJS, EKB, and JLS designed and performed experiments. JLS developed models 25 for the project. EKB, JLS, SM, and AEG contributed to data analysis and interpretation. SEF, AEG, and JCC 26 developed and performed informatics analyses. MJS wrote the draft manuscript; all authors read and revised the 27 manuscript and have read and approved of this version of the manuscript.
    [Show full text]
  • Point Mutation in CD19 Facilitates Immune Escape of B Cell Lymphoma from CAR-­T Cell Therapy
    Open access Original research J Immunother Cancer: first published as 10.1136/jitc-2020-001150 on 6 October 2020. Downloaded from Point mutation in CD19 facilitates immune escape of B cell lymphoma from CAR- T cell therapy 1 1 1 1 1 1 Zhen Zhang, Xinfeng Chen, Yonggui Tian, Feng Li , Xuan Zhao, Jinyan Liu, 1 1,2,3,4 Chang Yao, Yi Zhang To cite: Zhang Z, Chen X, ABSTRACT relapses after CD19 CAR-T cell therapy are Tian Y, et al. Point mutation Background Tumor relapse due to mutation in CD19 can attributed to the antigen loss, indicating an in CD19 facilitates immune hinder the efficacy of chimeric antigen receptor (CAR)- T urgent need for investigating the mechanisms escape of B cell lymphoma from cell therapy. Herein, we focused on lymphoma patients CAR- T cell therapy. Journal underlying recurrence and for improving whose B cells exhibited a point mutation in CD19 of B cells 4 5 for ImmunoTherapy of Cancer the efficacy of CAR- T cell therapy. Inter- 2020; :e001150. doi:10.1136/ after CAR-T cell infusion. 8 + estingly, one of the specific mechanisms jitc-2020-001150 Methods The CAR- T and CD19 B cells from peripheral blood or bone marrow were assessed using flow of tumor escape that has been reported cytometry. Genome sequencing was conducted to identify suggests that exon mutations affecting the ► Additional material is + published online only. To view, the molecular characteristics of CAR- T and CD19 B cells CD19 gene and its splicing isoforms, leading please visit the journal online from pre-rela pse and postrelapse samples.
    [Show full text]
  • ROR1/CD19 Receptor Complex Promotes Growth of Mantle Cell Lymphoma Cells Independently of the B Cell Receptor–BTK Signaling Pathway † Qian Zhang,* Hong Y
    Published September 18, 2019, doi:10.4049/jimmunol.1801327 Cutting Edge: ROR1/CD19 Receptor Complex Promotes Growth of Mantle Cell Lymphoma Cells Independently of the B Cell Receptor–BTK Signaling Pathway † Qian Zhang,* Hong Y. Wang,* Xiaobin Liu,* Selene Nunez-Cruz,* Mowafaqx Jillab, Olga Melnikov,† Kavindra Nath,‡ Jerry Glickson,‡ and Mariusz A. Wasik*,†, Inhibitors of Bruton tyrosine kinase (BTK), a kinase these mechanisms is of uttermost importance in design- downstream of BCR, display remarkable activity in a ing an appropriate therapeutic strategy to counteract the subset of mantle cell lymphoma (MCL) patients, but reprogramming. the drug resistance remains a considerable challenge. In ROR1 belongs to the receptor tyrosine kinase-like orphan this study, we demonstrate that aberrant expression of receptor (ROR) family and displays very restricted expression ROR1 (receptor tyrosine kinase-like orphan receptor 1), in normal tissues (11, 12). ROR1 is aberrantly expressed in seen in a large subset of MCL, results in BCR/BTK– various malignancies, including small lymphocytic lymphoma/ independent signaling and growth of MCL cells. ROR1 chronic lymphocytic leukemia (SLL/CLL) and MCL. ROR1 forms a functional complex with CD19 to persistently activates signaling molecules, such as RAC-1 and contractin activate the key cell signaling pathways PI3K–AKT and (13, 14), to promote cell proliferation, survival, and migration MEK–ERK in the BCR/BTK–independent manner. (13–15). CD19 is a B cell–specific receptor capable of stimu- lating the growth of malignant B cells (16). In normal This study demonstrates that ROR1/CD19 complex B lymphocytes, it is activated by SRC family kinases and effectively substitutes for BCR–BTK signaling to SYK, both downstream of BCR (17).
    [Show full text]
  • Intrinsic Specificity of DNA Binding and Function of Class II Bhlh
    INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS APPROVED BY SUPERVISORY COMMITTEE Jane E. Johnson Ph.D. Helmut Kramer Ph.D. Genevieve Konopka Ph.D. Raymond MacDonald Ph.D. INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS by BRADFORD HARRIS CASEY DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas December, 2016 DEDICATION This work is dedicated to my family, who have taught me pursue truth in all forms. To my grandparents for inspiring my curiosity, my parents for teaching me the value of a life in the service of others, my sisters for reminding me of the importance of patience, and to Rachel, who is both “the beautiful one”, and “the smart one”, and insists that I am clever and beautiful, too. Copyright by Bradford Harris Casey, 2016 All Rights Reserved INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS Publication No. Bradford Harris Casey The University of Texas Southwestern Medical Center at Dallas, 2016 Jane E. Johnson, Ph.D. PREFACE Embryonic development begins with a single cell, and gives rise to the many diverse cells which comprise the complex structures of the adult animal. Distinct cell fates require precise regulation to develop and maintain their functional characteristics. Transcription factors provide a mechanism to select tissue-specific programs of gene expression from the shared genome.
    [Show full text]
  • Accompanies CD8 T Cell Effector Function Global DNA Methylation
    Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M.
    [Show full text]