Leukemia (2013) 27, 671–679 & 2013 Macmillan Publishers Limited All rights reserved 0887-6924/13 www.nature.com/leu ORIGINAL ARTICLE Role of early B-cell factor 1 (EBF1) in Hodgkin lymphoma V Bohle1,CDo¨ ring2, M-L Hansmann2 and R Ku¨ ppers1 A hallmark of classical Hodgkin lymphoma (cHL) is that the B-cell-derived Hodgkin and Reed–Sternberg (HRS) tumor cells have largely lost the B-cell-typical gene expression program. The factors causing this ‘reprogramming’ of HRS cells are only partly understood. As early B-cell factor 1 (EBF1), a major B-cell transcription factor, is downregulated in HRS cells, we analyzed whether this downregulation contributes to the lost B-cell phenotype and tested the consequences of EBF1 re-expression in cHL cell lines. EBF1 re-expression caused an upregulation of B-cell genes, such as CD19, CD79A and CD79B, although the B-cell genes FOXO1 and PAX5 remained lowly expressed. The re-expression of CD19, CD79A and CD79B occurred largely without demethylation of promoter CpG motifs of these genes. In the cHL cell line L-1236 fitness decreased after EBF1 re-expression. These data show that EBF1 has the ability to reintroduce part of the B-cell signature in cHL cell lines. Loss of EBF1 expression in HRS cells therefore contributes to their lost B-cell phenotype. Notably, in the cHL cell line KM-H2 destructive mutations were found in one allele of EBF1, indicating that genetic lesions may sometimes have a role in impairing EBF1 expression. Leukemia (2013) 27, 671–679; doi:10.1038/leu.2012.280 Keywords: B-cell phenotype; CD19; CD79; EBF1; Hodgkin lymphoma INTRODUCTION In cHL, the function of the three central B-cell transcription Classical Hodgkin lymphoma (cHL) is a common malignant factors EBF1, E2A and PAX5 is compromised. E2A is expressed in 11,20 lymphoma in the western world. The Hodgkin and Reed– HRS cells but often at low level, and is functionally inactivated Sternberg (HRS) tumor cells are rare and usually account for only by the E2A inhibitors ID2 and activated B-cell factor 1, which are 9,11,12 a few percent of cells in the tumor tissue, whereas the vast highly expressed in HRS cells. PAX5 is present in most cHL majority of cells in the lymphoma microenvironment represent cases but there is large variation in the number and intensity of 11,20–22 inflammatory cells. Although HRS cells originate in nearly all cases positive HRS cells. EBF1 mRNA is absent or expressed only 11,20 from B cells,1–3 they have a profound lack of B-cell-typical gene at very low level in cHL cell lines and also weak or absent in expression.4 This includes cell surface markers (CD19, CD79A),5 primary cases in comparison with germinal center B cells (see 23 signaling molecules (Syk, Lyn, Blk)4 and transcription factors (Oct2, genechip data from ref. Tiacci et al. ). Beside ID2 and activated BOB.1).6,7 Furthermore, HRS cells express markers of other B-cell factor 1, the T-cell transcription factor Notch1 might further hematopoietic lineages such as CCL17,8 GATA-3,9 Notch1,10 and influence this B-cell transcription factor network. Notch1 is inhibitor of differentiation and DNA-binding 2 (ID2).11,12 cHL is strongly expressed in HRS cells and inhibits the expression of 10,24 unique among lymphoid malignancies in the extent to which the E2A and EBF1. In addition to unbalanced transcription factors, lymphoma cells have lost the gene expression pattern of their epigenetic features are also deregulated in HRS cells and might normal precursor cells and have upregulated expression of non-B- influence the aberrant gene expression in these cells. B-cell genes cell genes.13 It has been speculated that this ‘reprogramming’ is of such as SYK, POU2AF1 (BOB.1, OBF1) and CD79B have methylated pathogenetic relevance for HRS cells.13 promoters in cHL cell lines and primary HRS cells and are therefore 25,26 Early B-cell factor 1 (EBF1) is a central transcription factor in B silenced. A genome-wide DNA methylation analysis of cHL cell cells.14–16 In B cells, it operates as a homodimer in cooperation lines showed that B-cell genes were preferentially found among 27 with two other major B-cell transcription factors, that is, E2A and those with hypermethylated promoters. PAX5.14,16 EBF1 is expressed in all stages of B-cell development In this study, we analyzed the relevance of the low or absent except plasma cells. EBF1 not only induces expression of EBF1 expression for the phenotype of HRS cells. We wondered numerous B-cell genes, but at least in murine B cells it also whether EBF1 silencing has an impact on the aberrant gene represses factors of other hematopoietic lineages. For example, expression of HRS cells or whether its loss influences the EBF1 suppresses the myeloid gene CEBPA, the T-cell transcription deregulated methylation pattern of B-cell genes. factor Notch1 and the natural killer cell factor ID2.15 EBF1 also seems to be involved in epigenetic modifications such as demethylation of the CD79A promoter17 and methylation of MATERIALS AND METHODS 16 histones. Conditional knockout mice have shown that EBF1 is a B Cell culture and B-cell isolation lineage commitment factor and essential for the survival of pro-B Cell lines L-1236, L-428, KM-H2, Raji and SUP-HD1 were cultured in RPMI- cells, marginal zone and B1 B cells, whereas germinal centers were 1640 medium with stable glutamine supplemented with 10% fetal calf formed but not maintained without EBF1.18,19 serum (Biochrom AG, Berlin, Germany). Cell line HDLM-2 was cultured in 1Institute of Cell Biology (Cancer Research), University of Duisburg-Essen, Medical School, Essen, Germany and 2Senckenberg Institute of Pathology, University of Frankfurt, Frankfurt/Main, Germany. Correspondence: Professor R Ku¨ppers, Institute of Cell Biology (Cancer Research), University of Duisburg-Essen, Medical School, Virchowstr. 173, 45122 Essen, Germany. E-mail: [email protected] Received 10 August 2012; revised 17 September 2012; accepted 18 September 2012; accepted article preview online 1 October 2012; advance online publication, 23 November 2012 EBF1 in classical Hodgkin lymphoma V Bohle et al 672 RPMI-1640 medium with 20% fetal calf serum and U-HO1 in Iscove’s exponential phase of the PCR was determined in pretests. The primer modification of Dulbecco’s medium/RPMI-1640 (4:1) with 20% fetal calf sequences are as follows (50–30, each forward and reverse): ACTB serum. All media were supplemented with 1% penicillin–streptomycin (b-actin), AGCCTCGCCTTTGCCGATC, AGCGGGCGATATCATCATCC; GAPDH, (Invitrogen, Darmstadt, Germany). Germinal center B cells were isolated CCACATCGCTCAGACACCATG, TGAAGGGGTCATTGATGGCAAC; EBF1, GTAC- from human tonsils as CD77-positive cells, using the MACS system CATGCTGGTCTGGAGTG, GTGTGACTTCCACAACACCAGG; CD19, CAA (Miltenyi Biotech, Bergisch-Gladbach, Germany). CCTGACCATGTCATTCCACC, CACAGGCAGAAGATCAGATAAGCC; CD79A, ATCTGGTACCCTGGGACTGC, GGACCTTGTGCATCCACAGG; CD79B,AGCCTCG Western blot GACGTTGTCACG, GATTCCGGTACCGGTCCTC; PAX5, GTCCCAGCTTCCAGTCA CAG, CGGAGACTCCTGAATACCTTCG; ID2, CTCGCATCCCACTATTGTCAGC, Western blot analysis to demonstrate the endogenous and exogenous GAACACCGCTTATTCAGCCACAC and NOTCH1, GAATGGCGGGAAGTGTG EBF1 expression was performed using standard conditions and the AAGC, TGCAGGCATAGTCTGCCACG. The cycling program consists of following antibodies: anti-EBF1 (#H00001879-M01, Abnova, Heidelberg, 95 1C for 3 min, followed by 27–45 cycles of 95 1C for 15 s/60 1C for Germany, 1:100–1:10 000; 2nd ab: #115-036-062, Jackson Immuno 15 s/72 1C for 20 s. Research, Hamburg, Germany, 1:2000), anti-glyceraldehyde 3-phosphate dehydrogenase (#sc-31915, Santa Cruz, 1:200; 2nd ab: #sc-2350, Santa Cruz, Heidelberg, Germany, 1:10 000). EBF1 target gene expression was analyzed Real-time RT-PCR of EBF1 target genes in transduced cells using the same conditions as above and the following antibodies: anti- Quantitative real-time PCR analysis was performed on an ABI Prism 7900HT CD79A (#ab-79414, Abcam, Cambridge, UK, 1:500; 2nd ab: #711-036-152; Fast Real-Time PCR System (Applied Biosystems) using predesigned, Jackson Immuno Research, 1:10 000), anti-b-tubulin (#69126, MP Biomedi- intron-spanning assays (Applied Biosystems): ACTB (Hs99999903_m1), cals, Eschwege, Germany, 1:200; 2nd ab: #115-036-062, Jackson Immuno CD79B (Hs00236881_m1), ID2 (Hs00747379_m1), CD19 (Hs00174333_m1), Research, 1:2000). PAX5 (Hs00277134_m1), NOTCH1 (Hs01062014_m1), FOXO1 (Hs01054576_m1), and TaqMan Universial PCR MasterMix, No AmpErase UNG (Applied Sequence analysis of EBF1 Biosystems). Each cell line was transduced independently two to three times and each gene was measured in duplicates or quadruplicates. Sanger sequencing was performed to analyze the HL cell lines for mutations in EBF1. A 3130 Genetic Analyzer (Applied Biosystems, Darmstadt, Germany) and the BigDye Terminator v3.1 Cycle Sequencing Affymetrix genechips of transduced HL cells Kit (Applied Biosystems) were used. Four PCR products were generated to Cell lines L-428 and L-1236 were transduced three times each with EBF1 or amplify the coding region of EBF1, of which three were sequenced directly control vector constructs and positive cells were sorted 8 days post and one (*) was cloned in pGEM-T easy before sequencing because of four infection for RNA isolation. In all, 150 ng total RNA (RNeasy Micro Kit, different isoforms, which are also present in CD77-positive tonsillar Qiagen) of the transduced cell lines L-428 and L-1236 were amplified by germinal center B cells. The following primers were used for amplifying 0 0 the Ambion WT Expression Kit (Applied Biosystems). Labeling and EBF1 complementary DNA (cDNA) (5 –3 , forward and reverse): hybridization were performed using the GeneChip WT Terminal Labeling TTCAAGGGGGAGGAGATTTTCC, CCGGTAGTGAATTCCGTTATTGG; AATCCAA and Hybridization Kit (Affymetrix, Mu¨nchen, Germany). Washing and CTTCTTCCACTTCGTCC, GGAGTAGCATGTTCCAGATAAGAG; GTCAATGTGG staining was done by the standard Affymetrix GeneChip protocol (Version ATGGCCATGTCC (*), GTTGTCCACTGAACGAATTCACG (*); GGAAATCATTCT 2) in the GeneChip Fluidics Station 450 (Affymetrix), the measurement was GAAGAGAGCGG, CTCTGGGACTTGTATCAGATTACTC.