INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Jan. 1991, p. 50-58 Vol. 41, No. 1 0020-7713/91/0 10050-09$02.00/0 Copyright 0 1991, International Union of Microbiological Societies

Reclassification of hyodysenteriae and Treponema innocens in a New Genus, Serpula gen. nov., as Serpula hyodysenteriae comb. nov. and Serpula innocens comb. nov.

T. B. STANTON,l* N. S. JENSEN,l T. A. CASEY,l L. A. TORDOFF,2 F. E. DEWHIRST,2 AND B. J. PASTER2 Physiopathology Research Unit, National Animal Disease Center, Agricultural Research Service, U.S.Department of Agriculture, Ames, Iowa 50010,l and Forsyth Dental Center, Boston, Massachusetts 021152

The intestinal anaerobic spirochetes Treponema hyodysenteriae B7ST (T = type strain), B204, B169, and A-1, Treponema innocens B256T and 4/71, Treponema succinifaciens 6091T, and Treponema bryantii RUS-lT were compared by performing DNA-DNA reassociation experiments, sodium dodecyl sulfate-polyacrylamide gel electrophoresis of cell proteins, restriction endonuclease analysis of bNA, and 16s rRNA sequence analysis. DNA-DNA relative reassociation experiments in which the S1 nuclease method was used showed that T. hyodysenteriae B78T and B204 had 93% sequence homology with each other and approximately 40% sequence homology with T. innocens B256T and 4/71. Both T. hyodysenteriae B7ST and T. innocens B256T exhibited negligible levels of DNA homology (55%)with T. succinifaciens 6091T. The results of comparisons of protein electrophoretic profiles corroborated the DNA-DNA reassociation results. We found high levels of similarity (296%) in electrophoretic profiles among T. hyodysenteriae strains, moderate levels of similarity (43 to 49%) between T. hyodysenteriae and T. innocens, and no detectable similarity between the profiles of either T. hyodysenteriae or T. innocens and those of T. succinifaciens, T. bryantii, and Escherichiu coli. Restriction endonuclease analysis of DNA was not useful in assessing genetic relationships since there was heterogeneity even between strains of T. hyodysenteriae. Partial 16s rRNA sequences of the intestinal spirochetes were determined by using a modified Sanger method and were compared in order to evaluate the phylogenetic relationships among these and other spirochetes. The 16s rRNA sequences of T. hyodysenteriae B7ST, B204, and A-1 were nearly identical (99.8 to 99.9% base sequence similarity). T. innocens B256Tand 4/71 were closely related to the T. hyodysenteriae strains (99.4 and 99.0% similarity). Strains of T. hyodysenteriae and T. innocens exhibited low levels of 16s rRNA similarity (average, 76.5 %) with T. pallidum, Borrelia burgdorj'eri, and various other spirochetes. The results of our investigations indicate that T. hyodysenteriae and T. innocens are distinct but related species of spirochetes. T. hyodysenteriae and T. innocens are only distantly related to T.pallidum, the type species of the genus Treponema, and to other spirochetes. Consequently, we propose that the species T. hyodysenteriae and T. innocens be transferred to a new genus, Serpula, gen. nov.

The bacterial agent of swine dysentery was established by T. innocens are genetically distinct from other known spiro- Taylor and Alexander in the United Kingdom (49) and by chetes, including other Treponema species. The guanine- Harris et al. in the United States (11). This organism has a plus-cytosine (G+C) content of DNA from either T. hyod- typical spirochete ultrastructure (protoplasmic cylinder, ysenteriae B204 or T. innocens B256T was estimated to be endoflagella, and outer sheath) and requires anaerobic con- 25.8 mol% (35). This value is significantly lower than the ditions for cultivation (9, 11, 22). Inasmuch as host-associ- value of 53 mol% reported for the DNA of Treponema ated, anaerobic spirochetes are classified as members of the pallidurn (34), the type species of the genus Treponema (42). genus Treponema (42), the agent of swine dysentery was T. hyodysenteriae B204 and A-1 and T. innocens B256T named Treponema hyodysenteriae (11). exhibited negligible levels of DNA sequence homology Initially, both pathogenic and nonpathogenic strains were (4%)with T. pallidum Nichols, Treponema phagedenis classified as T. hyodysenteriae (24). Colonies of nonpatho- biotype Reiter, or Treponema refringens biotype Noguchi genic strains were described as weakly beta-hemolytic, (35). 16s rRNA catalog comparisons have shown that T. whereas those of pathogenic strains were described as hyodysenteriae 94A007 (a subculture of strain B204) has strongly beta-hemolytic (24). More recently, Miao et al. (35) unique 16s rRNA regions that distinguish it from various found a level of relative reassociation of 28% between DNAs other spirochetes, including members of the genera Spiro- from pathogenic strains B204 and A-1 and DNAs from chaeta, Treponema, Leptospira, and Borrelia (38). T. hyod- nonpathogenic strains B256T (T = type strain) and 4/71. ysenteriae has been considered a distinct line of spirochete Strains B204 and A-1 exhibited 80% DNA sequence homol- evolution and, accordingly, a representative of a distinct ogy with each other, and the nonpathogenic strains exhibited spirochete genus (38). Neither the study of levels of DNA 90% sequence homology with each other. These results sequence homology between spirochetes (35) nor the 16s indicated that the pathogenic strains and the nonpathogenic rRNA cataloging study of spirochetes (38) included an strains are genetically distinct species. The nonpathogenic analysis of strain B78, the type strain of T. hyodysenteriae. organisms were reclassified as a new species, Treponema In addition, the 16s rRNA from T. innocens was not innocens, represented by type strain B256 (23). analyzed. There is substantial evidence that T. hyodysenteriae and In this study we used sodium dodecyl sulfate (SDS)- polyacrylamide gel electrophoresis (PAGE) of cell proteins, 16s rRNA sequence analysis, restriction endonuclease anal- * Corresponding author. ysis of DNA, and DNA-DNA reassociation experiments to

50 VOL.41, 1991 SERPULA GEN. NOV. 51

TABLE 1. Spirochete species used in this study

G+C content Species Strain (rnol%) Characteristics Reference(s) Serpula hyodysenteriae" B7gT 26 Pathogen, swine intestine 23, 24 B 204 Pathogen, swine intestine 23, 24, 35 B169 Pathogen, swine intestine 23, 24 A- 1 Pathogen, swine intestine 23, 24 Serpula innocens B256T 26 Nonpathogen, swine intestine 23, 24, 35 4/7 1 Nonpathogen, swine intestine 23, 24 T. succinifaciens 6091T 36 Nonpathogen, swine intestine 6 T. bryantii RUS-lT 36 Nonpathogen, bovine rumen 46

a Serpula hyodysenteriue B7gT, B204, B169, and A-1 represent serotypes 1 through 4, respectively (2).

compare strains of spirochetes, focusing on strains isolated resolving gel), using standard electrophoretic techniques from mammalian gastrointestinal tracts. On the basis of our (27). Proteins were stained with Coomassie blue R-250. results and the results of previous investigators, we propose Electrophoretic similarities between were evaluated a revision of the classification of T. hyodysenteriae and T. by visually examining photographs of gels and estimating the innocens and creation of a new genus, Serpula, containing percentages of protein bands with common alignments and the species Serpula hyodysentertae and Serpula innocens. relative staining intensities. Protein standards for molecular We also describe methods which can be used to distinguish weight determinations were purchased from Bio-Rad Labo- these species from each other and from other spirochetes. ratories, Richmond, Calif. Restriction endonuclease analysis. T. succinifaciens 6091T MATERIALS AND METHODS DNA was isolated as described above. Otherwise, bacterial DNAs were obtained by ultracentrifugation (Beckman type Bacterial strains. The spirochete strains used in this study Vti 65 rotor, 4 h, 404,000 x g) of cell lysates in a CsCl are shown in Table 1. In accordance with our proposal to solution as described by Hull et al. (14). DNAs were digested designate a new genus for T. hyodysenteriae and T. inno- with endonucleases BglII (Bethesda Research Laboratories, cens, the names Serpula hyodysenteriae and Serpula inno- Inc. , Gaithersburg, Md.), Hind111 (Bethesda Research Lab- cens are used in Table 1 and below. The conditions used for oratories), and Sau3A (Boehringer Mannheim, Indianapolis, culturing and maintaining bacteria and additional strain Ind.) by using incubation conditions recommended by the characteristics have been described elsewhere (6, 23, 24, 35, manufacturers. DNA fragments were separated in a 0.8% 46,47). Cells were harvested during the exponential phase of agarose gel by horizontal electrophoresis (40). growth. 16s rFWA isolation and sequencing. rRNAs were isolated DNA-DNA reassociation. The levels of DNA sequence and partially purified by using a modification of the proce- homology among the various spirochetes were estimated dure of Pace et al. (36), as previously described (37). The 16s from the results of DNA-DNA reassociation experiments. rRNA sequences of bacteria were determined by using an DNA was extracted from bacterial cells (2 to 3 g, wet weight) adaptation of the Sanger dideoxy chain termination tech- by using the techniques of Marmur (33), except that protein- nique (28). Primers complementary to conserved regions of ase K (total weight, 2 mg) was added after cell lysis by the 16s rRNA sequences were elongated by reverse tran- lysozyme-SDS and cell lysates were incubated for 3 to 4 h at scriptase. Eight primers were used to determine the se- 37°C to ensure protein degradation. The abilities of DNAs quences of 1,375 to 1,443 bases (90 to 95%) of the 16s from various organisms to hybridize with one another were rRNAs. Additional modifications of the procedures used determined by John L. Johnson (Department of Anaerobic have been described previously (8, 38). For the construction Microbiology, Virginia Polytechnic Institute and State Uni- versity), who used the S1 nuclease method (19, 20). of a similarity matrix (see Table 4), the 16s rRNA sequences Electrophoresis of bacterial proteins. The spirochetes were for Spirochaeta halophila , Borrelia burgdorferi, Leptonema compared with one another on the basis of the electropho- illini, and Leptospira b$exa were kindly provided by C. R. retic banding patterns of their soluble and CHC1,-extracted Woese, University of Illinois. The 16s rRNA sequences for proteins. Soluble cell proteins were obtained by sonicating Escherichia coli, Bacteroides fragilis, and Fusobacterium (Branson model 250 Sonifier, three 30-s bursts, setting no. 1) heparinum have been published elsewhere (3, 50). approximately 2 x lo1' cells in 2.5 ml of ice-cold 0.01 M Tris RNA sequence data were entered and aligned by com- hydrochloride buffer (pH 7.4). Unbroken cells and cell puter (37). The program set for 16s rRNA data entry, debris were removed by centrifugation (12,000 x g, 45 min), editing, sequence alignment, secondary structure compari- and the supernatants were used for electrophoresis. Chloro- son, similarity matrix generation, and tree construction was form-extracted proteins in a volume of 0.2 ml were obtained written in Microsoft QuickBASIC for IBM PC-AT and by treating whole cells from 6 ml of culture broth with CHCI, compatible computers. Unique regions of 16s rRNA were (1). Although this technique releases periplasmic proteins determined by computer search. Levels of 16s rRNA simi- from other bacteria (l),the cellular location of proteins larity among organisms were calculated by comparing posi- released by treating spirochetes with CHC1, is unknown. tions at which bases could be unambiguously aligned (ap- Consequently, the term CHC1,-extracted proteins is used proximately 1,200 bases) (28). The similarity matrix was below. Both soluble and CHC1,-extracted proteins were corrected for multiple base changes at single locations by the denatured and separated by electrophoresis in SDS-contain- method of Jukes and Cantor (21). Dendrograms were con- ing polyacrylamide gels (16 by 16 by 0.75 cm, 5% [wt/vol] structed by the modified unweighted pair group method of Li polyacrylamide stacking gel, 12% [wt/vol] polyacrylamide (31). 52 STANTON ET AL. INT.J. SYST.BACTERIOL.

TABLE 2. Levels of reassociation of DNAs from Serpula hyodysenteriae, Serpula innocens, and T. succinifaciens

Level of relative reassociation (%) with unlabeled DNA froma:

['''IlDNA source Serpula hyo- Serpula hyo- Serpula innocens Serpula innocens T. succini- dysenteriae B7gT dysenteriae B204 B256T 417 1 faciens 6091T Serpula hyodysenteriae B78T 100 93 41 40 2 Serpula innocens B256= 37 37 100 87 5 '' Reassociation values determined by using the S1 nuclease technique (19).

Nucleotide sequence accession numbers. Nucleotide se- for Serpula hyodysenteriae, Serpula innocens, eight addi- quence data are available from the EMBL, GenBank, and tional species of spirochetes, and E. coli is shown in Table 4. DDJB nucleotide sequence databases under the following A dendrogram representing the phylogenetic relationships accession numbers: Serpula hyodysenteriae B78T, M57743; among these organisms and three additional bacterial species Serpula hyodysenteriae B204, M57741; Serpula hyodysente- is shown in Fig. 3. riae A-1, M57742; Serpula innocens B256T, M57744; Serpula The 16s rRNA sequences of three Serpula hyodysenteriae innocens 4/71, M57745; T. succinifaciens 6091T, M57738; T. strains were almost identical (levels of similarity, 99.8 to bryantii RUS-lT, M57737; Spirochaeta halophila, M34262; 99.9%, indicating one or two base differences in the 16s Leptonema illini, M34118; Leptospira bflexa, M34261; Spi- rRNAs). Serpula innocens B256T and 4/71 were closely rochaeta aurantia, M57740; and T. phagedenis, M57739. related to the three strains of Serpula hyodysenteriae, with average levels of similarity of 99.4 and 99.0%, respectively. RESULTS The two strains of Serpula innocens had a level of 16s rRNA similarity of 99.2%. In contrast, strains of Serpula hyodys- DNA sequence homology. Reassociation studies (Table 2) enteriae and Serpula innocens were only distantly related to showed that there was 93% DNA sequence homology be- other spirochetes (average levels of similarity, about 76.5%). tween strains B78T and B204 of Serpula hyodysenteriae and Serpula hyodysenteriae and Serpula innocens were re- 87% DNA sequence homology between strains B256T and lated to E. coli at an average level of similarity (74.2%) that 4/71 of Serpula innocens. Serpula hyodysenteriae strains had was close to the level (76.5%) obtained in sequence compar- an estimated level of DNA sequence homology with Serpula isons of Serpula hyodysenteriae and Serpula innocens with innocens strains of 37 to 41% (Table 2). In contrast, there other spirochetes. In order to further assess whether Serpula was a very low level of homology (55%) between DNA from hyodysenteriae and Serpula innocens are phylogenetically T. succinifaciens 6091T and DNA from the type strain of related to other spirochetes, a single-base signature analysis either Serpula hyodysenteriae or Serpula innocens. of aligned sequences was performed; that is, bases unique to Protein electrophoresis. SDS-PAGE of proteins from spirochetes were identified (Table 5). Approximately 250 CHC1,-treated cells revealed 30 to 40 bands for each bacte- rial strain (Fig. 1). The banding patterns for four strains of Serpula hyodysenteriae were similar; that is, 96% or more of their proteins had the same alignment (Fig. 1 and Table 3). There was a level of similarity of 79% between the protein band patterns of two strains of Serpula innocens. When the Serpula hyodysenteriae electrophoretic patterns were com- pared with those of Serpula innocens, 38 to 49% of the bands aligned (Table 3). In contrast, 20 to 31% of the protein bands of Serpula hyodysenteriae and Serpula innocens aligned with the protein bands of T. bryantii and T. succinifaciens. These relatively low values can be attributed to random alignment since the same percentage (23 to 28%) was found between E. coli bands and either Serpula hyodysenteriae or Serpula innocens bands (Table 3). Electrophoresis of proteins from sonicated bacteria re- vealed 50 to 60 major bands for each strain (data not shown). For any two strains, the percentage of similarity in the electrophoretic profiles of these soluble proteins was essen- tially the same as the percentage o5served for CHC1,- extracted proteins. Restriction endonuclease analysis. Although there were common bands in the electrophoretic patterns of fragments of BglII-digested DNAs from Serpula hyodysenteriae strains, overall the patterns were heterogeneous (Fig. 2). Heterogeneity was also observed after electrophoresis of FIG. 1. SDS-PAGE of CHC1,-extracted proteins from various bacteria. Lane 1, Molecular weight markers; lanes 2 through 5, DNAs cut with Hind111 and Sau3A (data not shown). There Serpula hyodysenteriae B78T, B204, B169, and A-1, respectively; was no common electrophoretic pattern for BglII-digested lanes 6 and 7, Serpula innocens B256T and 4/71, respectively; lane 8, DNA fragments from Serpula hyodysenteriae , Serpula inno- T. succinifaciens 6091T; lane 9, T. bryantii RUS-lT; lane 10, E. coli cens, T. succinifaciens, and E. coli (Fig. 2). HB101. Each lane contained 40 to 65 pg of protein. Molecular 16s rRNA sequence analysis. A sequence similarity matrix masses (in kilodaltons) are indicated on the left. VOL. 41, 1991 SERPULA GEN. NOV. 53

TABLE 3. Comparisons of the electrophoretic profiles bacterial 16s rRNA sequences were screened for these of CHC1,-extracted proteins single-base signatures. Our findings showed that the Serpula % Of similarity with electrophoretic hyodysenteriae-Serpula innocens cluster represents a dis- Electrophoretic profile of: profile of": tinct, although distantly related branch of spirochetes. These findings agree with the conclusions of 16s rRNA oligonucle- otide cataloging studies (38, 52).

L A region of the 16s rRNA of Serpula hyodysenteriae represents a possible signature sequence for this organism L (Table 6). The sequences of nucleotides in this region were Species Strain identical for three strains of Serpula hyodysenteriae and different from the sequences for other spirochetes, notably s s Setpula innocens (Table 6). & & 4 4 c; DISCUSSION Serpula hyodys- B78= 49 26 29 28 Our studies were aimed at assessing the genetic related- enteriae B204 96 38 31 23 28 ness and determining the phylogenetic relationships of Ser- B169 I 43 30 29 23 pula hyodysenteriae, Serpula innocens, and other spiro- A- 1 96 46 26 24 24 Serpula innocens B256T 45 27 22 26 chetes. The methods which we used were based on 4/71 45 79 23 20 27 comparing either large portions of the genomes (SDS-PAGE ~~ ~~ ~~ ~~ of cell proteins, DNA-DNA reassociation, restriction endo- Percentage of similarity for similarly migrating CHC1,-extracted proteins nuclease analysis) or 16s rRNAs, a ubiquitous and practical (30 to 40 bands). The protein electrophoretic profiles of T. succinifaciens and T. bryantii had a similarity level of 28%. I, Identical. molecular chronometer (51). Each technique has been used extensively for classification or identification of bacteria. As discussed below, our results confirmed that Serpula hyodys- enteriae and Serpula innocens are related but distinct spe- cies of spirochetes and indicated that these two bacteria are incorrectly classified as Treponema species. Information from our studies should be useful for identifying Serpula hyodysenteriae both in pure culture and in clinical samples. Serpula hyodysenteriae and Serpula innocens are properly classified as spirochetes. These bacteria have an ultrastruc- ture that is characteristic of spirochetes (13,23). In addition, both species share with the other spirochetes tested the same nucleotides at certain base positions in their 16s rRNA molecules (Table 5). Previous investigators have identified spirochete signature sequences and single-base signatures in the 16s rRNA of Serpula hyodysenteriae (38, 51, 52). Serpula hyodysenteriae and Serpula innocens are related to one another but are separate species. DNAs from Serpula hyodysenteriae B204 and B7gT had relative reassociation values of 37 to 41% with DNAs from Serpula innocens 4/71 and B256T (Table 3). Miao et al. reported a DNA-DNA relative reassociation value of 28% between strains B7gT and B256T (35). In both the work of Miao et al. and our work the DNA homology values were below the accepted range (60 to 100%) for strains belonging to the same species (12, 20) but indicated that these species should be assigned to the same genus. Protein electrophoresis results were correlated with DNA-DNA reassociation results, as has been found for other bacteria (12, 17). The electrophoretic profiles of cell proteins were 296% similar when Serpula hyodysentenae strains were compared, 79% similar when Serpula innocens strains were compared, 38 to 45% similar when Serpula hyodysentenae and Serpula innocens strains were com- pared, and not detectably similar (23 to 31%) when Serpula hyodysenteriae was compared with T. bryantii, T. succini- faciens, or E. coli (Fig. 1 and Table 2). Joens and Marquez described different electrophoretic patterns for Serpula hy- FIG. 2. Electrophoresis of bacterial DNAs cut with restriction odysenteriae B204 and Serpula innocens B256T, a1 though endonuclease BglII. Each lane contained 1.5 to 1.7 bg of DNA. these two strains had a large number of common antigens Lane 1, Lambda DNA cleaved with Hind111 (fragment size mark- ers); lanes 2 through 5, Serpula hyodysenteriae B204, B78T, B169, (18). Finally, Serpula hyodysenteriae strains were separated and A-1, respectively; lanes 6 and 7, Serpula innocens B256T and from Serpula innocens strains by the results of a computer 4/71, respectively; lane 8, T. succinifaciens 6091T; lane 9, E. coli analysis of 16s rRNA sequence data (Fig. 3). All of these HB101. Fragment sizes (in kilobase pairs [kb]) are indicated on the results indicate that Serpula hyodysenten'ae and Serpula left. innocens are distinct species that belong to the same genus. 54 STANTON ET AL. INT. J. SYST.BACTERIOL.

TABLE 4. Homology matrix

% Similarity to or difference from":

d g4Y42 ?x

L rl U 0\om .N r: Organism 9 9 2 e 8 8 U P P s .N .s U s! 5 & 'Ne & F-; c-; c-; & ad Serpula hyodysenteriae B204 99.9 99.9 99.5 99.1 76.9 73.7 78.0 76.3 78.8 76.0 76.2 76.1 74.2 Serpula hyodysenteriae A-1 0.1 99.8 99.4 99.0 76.7 73.7 77.8 76.1 78.7 76.0 76.2 76.1 74.2 Serpula hyodysenteriae B7gT 0.1 0.2 99.4 99.0 76.8 73.9 77.8 75.9 78.8 76.2 76.3 76.4 74.4 Serpula innocens R256T 0.5 0.6 0.6 99.2 76.7 73.6 77.8 75.9 78.6 75.8 76.3 75.9 74.4 Serpula innocens 4/71 0.9 1.0 1.1 0.8 76.2 73.3 77.9 75.8 78.3 75.4 76.0 75.7 74.0 T. bryantii RUS-lT 27.7 27.9 27.8 27.9 28.7 86.2 86.5 82.9 83.3 80.9 78.5 76.5 75.8 T. succinifaciens 6091T 32.4 32.4 32.1 32.6 33.0 15.2 82.2 80.3 80.4 75.7 77.6 75.7 72.9 T. phagedenis K5 26.1 26.3 26.3 26.3 26.2 14.9 20.4 84.2 84.1 80.4 77.6 76.9 76.5 Spirochaeta aurantia 28.5 28.8 29.0 29.0 29.2 19.4 22.9 17.7 86.9 82.4 78.3 78.7 75.3 Spirochaeta halophila 24.9 25.1 24.9 25.2 25.6 18.9 22.8 17.8 14.4 83.1 78.7 79.2 76.0 B. burgdo$eri 28.9 28.9 28.6 29.3 29.9 22.0 29.4 22.8 20.0 19.2 76.6 77.9 74.4 Leptonema illini 28.6 28.6 28.4 28.5 28.9 25.3 26.7 26.6 25.6 25.1 28.1 83.1 78.1 Leptospira biflaa 28.8 28.8 28.4 29.1 29.4 28.2 29.4 27.6 25.0 24.3 26.2 19.2 76.5 E. coli 31.7 31.6 31.3 31.4 32.0 29.3 33.6 28.1 29.9 28.9 31.3 25.9 28.2

~~~~~~~ ~ ~ ~ The numbers above the diagonal are uncorrected percentages of similarity, and the numbers below the diagonal are percentages of difference corrected for multiple base changes.

Although Serpula hyodysenteriae and Serpula innocens Substantial evidence indicates that Serpula hyodysente- are distinct species, there was an average level of similarity riae and Serpula innocens are not closely related to between their 16s rRNA sequences of 99.3% (Table 4). This treponemes or to other spirochetes for which phylogenetic high level of similarity was unexpected, in view of the information is available. The DNAs of these two species estimated level of DNA homology of 40% (Table 3). Gener- have G+C contents of 26 mol% (Table 1). This base com- ally, different species of a genus have levels of 16s rRNA position is substantially lower than the values for DNAs sequence similarity of 95 to 97% (8, 37). Apparently, for from other treponemes (range, 36 mol% for T. bryantii [46] these species there are constraints on base modifications in to 53 mol% for T. pallidurn [34]). Serpula hyodysenteriae and the 16s rRNA gene that are not imposed on other genes. Serpula innocens strains exhibit no detectable level of DNA

Serpula fnnocens 8256 Serpula innocens 4/71 - Treponema bryant f f Treponema succfnf facfens Treponema phagedenis Sp f rochaeta aurant fa Spirochaeta halophila Rorrel fa burgdor ferf I L ep tonema f I1f nf Leptospfra bf flexa serovar patoc - Escherfchfa colf Proteus vulgaris VOL.41, 1991 SERPULA GEN. NOV. 55

TABLE 5. Unique 16s rRNA bases found in spirochetes sequence of Serpula hyodysenteriae is quite distinct from that of B. burgdorferi (Fig. 3) and that of B. herrnsii (38), an Base Nucleotide in Nucleotide in position" eubacteriab spirochetes' indication that Serpula hyodysenteriae is only distantly related to these Borrelia spp. and is not a species of the 47 C or G genus Borrelia. 52 C, U, or G The species Serpula innocens is not well defined. Knowl- 359 A, G, or C edge of the biochemical, physiological, and cultural charac- 361 G 893 C teristics of nonpathogenic spirochetes of swine is limited. 1415 G Strains considered to be Serpula innocens differ from each other in their protein electrophoretic patterns (4, 30) and in Positions in E. coli 16s rRNA (3). their physiological traits (30) and may actually represent Nucleotides present in bacteria other than spirochetes (approximately 250 species were examined). Exceptions are at positions 359 (one species has U), more than one species (30). As reported here (Tables 2 361 (two species have A), 893 (three species have U), and 1415 (one species through 4 and Fig. 3) and elsewhere (39, type strain B256 has C). and strain 4/71 are closely related and are properly assigned ' Nucleotides present in strains of Serpula hyodysenteriae, Serpula inno- to the same species. To facilitate interpretation of research cens, and all other spirochetes examined (Table 4). results and exchange of information among laboratories, we urge that future investigations of Serpula innocens strains include strain B256T or 4/71. homology with T. succinifaciens, T. phagedenis, T. refrin- A definitive method for identifying an organism as a strain gens, or T. pallidurn (Table 2) (35). T. pallidurn is the type of Serpula hyodysenteriae would be to demonstrate a high species of the genus Treponema (42). 16s rRNA analyses in percentage (>70%) of DNA sequence homology between the which either oligonucleotide cataloging (38) or sequencing organism and a known Serpula hyodysenteriae strain. For has been used (Fig. 3 and Table 4) have shown that Serpula example, a human intestinal spirochete was recently identi- hyodysenteriae and Serpula innocens are distinct from other fied as a strain of Serpula hyodysenteriae on the basis of known spirochetes and represent a unique branch of spiro- DNA-DNA reassociation values of 90 to 95% (7). Although chete evolution. Serpula hyodysenteriae has physiological DNA hybridization methods are considered conclusive, they characteristics (that is, a requirement for cholesterol [29, 471 are also fairly complicated, involving protocols not com- and a pathway for producing H2 from NADH [45]) which monly used. have not been reported for other spirochetes. Finally, on the We found a common electrophoretic banding pattern for basis of ultrastructure comparisons, Hovind-Hougen con- the cell proteins of four strains of Serpula hyodysenteriae cluded that Serpula hyodysenteriae is distinct from T. palli- (Fig. 1 and Table 2). In a previous study, common electro- durn (13a). phoretic patterns were observed for 11 strains of Serpula In view of the genetic, physiological, and morphological hyodysenteriae (4). SDS-PAGE of bacterial proteins is a characteristics distinguishing the species Serpula hyodysen- relatively easy and inexpensive procedure that could prove teriae and Serpula innocens from species of the genus to be useful for identifying Serpula hyodysenteriae in pure Treponerna, we propose that these two organisms be re- culture. moved from the genus Treponema and be assigned to a new Restriction endonuclease analysis could not distinguish genus. For this genus we propose the name Serpula. De- Serpula hyodysenteriae strains from Serpula innocens scriptions of the genus and both species are given below. strains because a restriction endonuclease pattern common Sachse and Blaha (39) believed that the low G+C content to Serpula hyodysenteriae strains was not found. This find- of Serpula hyodysenteriae DNA was primary evidence that ing is consistent with that of Combs et al. (5). Restriction this spirochete is related to Borrelia species, which have endonuclease analysis may be useful for identifying particu- G+C contents of 27 to 30 mol% (16). Schmid and co-workers lar strains of Serpula hyodysenteriae (5). presented evidence from DNA-DNA hybridization studies A promising method for identifying Serpula hyodysente- that B. burgdorferi and Borrelia hermsii are only distantly riae which is both practical and reliable could involve related to Serpula hyodysenteriae (41). The 16s rRNA nucleic acid probes. A nucleotide sequence in the 16s rRNA

TABLE 6. Nucleotide sequences of a specific 16s rRNA region in various bacterian

No. of bases different Organism Nucleotide sequence from Serpula hyodysenteriae sequence Serpula hyodysenteriaeb 5'-CGGAAACGCCUCGGAUACUGUAAGUC-3' Serpula innocens' CGGGAACGCCUCGGAUACUGUGAGUC 2 T. bryantii c G GAA~GCGU~GGAAAc UG c AG A AC 9 T. succinifaciens CGNAACCGCEGGGAACUGCUGGGC 10 Treponema denticola -GUNAACJGCAUEGGCUACUGCUUGAC 11 Spirochaeta aurantia -GGAA&CGCGUEGGAAACUGCAUGAGC 10 Leptonema illini UCAGCCUGCUUUCGAAACUGEAGUC 13 B. burgdorferi --UGGACCUAUGUCGGAAACUAUACGUC 11 E. coli -GGGAAEGCAUCEGAUACUGGCAAGC 9 This region corresponds to base positions 625 to 650 in the E. coli 16s rRNA sequence (3). The positions at which nucleotides differ from those in the Serpula hyodysenteriae sequence are underlined. Strains B78=, B204, and A-1. ' Strains B256= and 4/71. 56 STANTON ET AL. INT.J. SYST.BACTERIOL.

distinguished strains B78T, B204, and A-1 from all of the tol, glycerol, amino acids, and various other compounds do other bacteria examined (Table 6). We are currently testing not support growth (30, 48). radiolabeled oligonucleotide probes complementary to this Growing cells of strains B78T, B204, and B169 consume region for their usefulness both in identifying Serpula hyod- glucose and oxygen and yield (per milliliter of culture broth) ysenteriae strains and in detecting cells of this pathogen in 14 kmol of acetate, 2 pmol of butyrate, 26 pmol of H,, and clinical samples. 12 pmol of CO, (48). Cells possess NADH oxidase, super- Description of Serpula Stanton, Jensen, Casey, Tordoff, oxide dismutase, and NADH peroxidase activities (45). Dewhirst, and Paster gen. nov. Serpula (Ser‘pu.la. L. fem. n. Hydrogen is produced via a clostridial-type phosphoroclas- Serpula, a little serpent [53]). Unless otherwise indicated, tic mechanism and via a pathway that contains NADH: the information below was taken from previous descriptions ferredoxin oxidoreductase (45). of T. hyodysenteriae and T. innocens (11, 23, 42). Helical Classification of strains according to serotypes is based on cells with loose, regular coils, 7 to 9 pm by 0.3 to 0.4 pm. soluble antigens found in the water phase of cells extracted Gram reaction negative. Typical spirochete ultrastructure with hot phenol-water (2, 10, 32). consisting of outer sheath, protoplasmic cylinder bounded Exhibits alkaline phosphatase, C4 esterase, C8 esterase by a cytoplasmic membrane, and endoflagella inserted at lipase, phosphatase acid, P-galactosidase, a-glucosidase, each end of a protoplasmic cylinder and lying between the and p-glucosidase activities (15). outer sheath and the protoplasmic cylinder. Eight or nine Cholesterol in nutrient amounts is required for growth (29, flagella are inserted at each end of a cell. Motile; flexing and 47). Cholesterol is reduced to cholestanol, and both sterols creeping at 22°C; translational movement at 37 to 42°C. are associated with cell membranes (44). Host associated. Isolated from intestinal contents and The Serpula hyodysenteriae strains which have been feces of swine and other mammals. One species, Serpula examined have a common banding pattern of proteins on electrophoretic gels (4; this study). Does not exhibit DNA hyodysenteriae, is enteropathogenic for swine. homology (4%)with T. succinifaciens, T. pallidum, T. Chemoorganotrophic. Uses soluble sugars for growth. phagedenis, or T. refringens (35; this study). Exhibits low Weakly fermentative. Produces acetate, butyrate, H,, and levels of DNA homology (28 and 40%) with Serpula inno- CO, from glucose. Does not reduce nitrate. Negative for cens (35; this paper). Serpula hyodysenteriae can be differ- lipase and lecithinase. Does not grow in media containing 1% entiated from Serpula innocens on the basis of its entero- glycine. Grows anaerobically in Trypticase soy or brain pathogenicity for swine, the type of beta-hemolysis around heart infusion broth containing 10% fetal calf, calf, or rabbit colonies, protein electrophoretic profiles, and DNA homol- serum. Growth occurs at 36 to 42°C. Does not grow at 25 and ogy data. Serpula hyodysenteriae B78T, B204, and A-1 have 30°C. Surface colonies on Trypticase soy blood agar plates a unique 16s rRNA region corresponding to E. coli base are visible after 48 to 96 h of incubation at 38°C. Colonies are positions 625 to 650 (3) and containing the following se- 0.5 to 3 mm in diameter, flat, translucent, and, depending on quence: 5’-CGGAAACGCCUCGGAUACUGUAAGUC-3’ the species, weakly or strongly beta-hemolytic. (this study). Selective culture media for isolating Serpula hyodysente- The type strain is strain ATCC 27168 (= B78). riae and Serpula innocens from intestinal contents contain Description of Serpula innocens comb. nov. Serpula inno- spectinomycin (43) or a combination of spectinomycin, cens (basionym, Treponema innocens Kinyon and Harris colistin, vancomycin, rifampin, and spiramycin (26). 1979) (in‘no-cens. L. adj. innocens, doing no harm). In At specific base locations in the 16s rRNA, Serpula addition to the characteristics described above for the genus, species contain spirochete signature nucleotides (38,52; this colonies on Trypticase blood agar plates are weakly beta- study). The genus Serpula is differentiated from other spiro- hemolytic. Not enteropathogenic for swine. chete genera on the basis of DNA homology or 16s rRNA . Isolated from intestinal contents and feces of swine and sequence similarity data. A 16s rRNA signature region for dogs. three strains of Serpula hyodysenteriae and two strains of Exhibits no (55%) DNA homology with T. pallidum, T. Serpula innocens has the following sequence: 5’-CG phagedenis, T. refringens, or T. succinifaciens and low GRAACGCCUCGGAUACUGURAGUC-3’, where R is A levels of DNA homology (28 to 41%) with Serpula hyodys- or G (this study). This sequence corresponds to E. coli 16s enteriae (35; this paper). Exhibits extensive (99 to 99.4%) rRNA base positions 625 to 650 (3). 16s rRNA sequence similarity with Serpula hyodysenteriae The G+C contents of the DNAs of the strains tested are 25 (this paper). Serpula innocens B256T and 4/71 have a unique to 26 mol%. The type species is Serpula hyodysenteriae. 16s rRNA region corresponding to E. coli base positions 625 Description of Serpula hyodysenteriae comb. nov. Serpula to 650 (3) and containing the following sequence: 5’-CGG hyodysenteriae (basionym, Treponema hyodysenteriae Har- GAACGCCUCGGAUACUGUGAGUC-3’ (this study). ris, Glock, Christensen, and Kinyon 1972) (hy.o.dys.en. The type strain is strain ATCC 29796 (= B256). te’ri.ae M. L. gen. n. hyodysenteriae, of hog dysentery). In addition to the characteristics described above for the genus, Serpula hyodysenteriae grows at 38°C in a variety of anaer- ACKNOWLEDGMENTS obically prepared culture broth media (22, 25, 48). Although We thank John G. Holt, Ercole Canale-Parola, and Joann Kinyon considered anaerobic, growing cells under certain conditions for their advice and comments in matters of bacterial and require low (1%) oxygen tensions and consume substrate nomenclature. We appreciate John L. Johnson’s contributions in amounts of oxygen (48). Population doubling times are 3 to 5 performing and interpreting DNA-DNA reassociation studies. h in broth media at 38°C. Growth substrates include D-fruc- tose, D-glucose, sucrose, ~-galactose,~-trehalose, N-acetyl- REFERENCES D-glucosamine, D-glucosamine, D-mannose, maltose, pyru- 1. Ames, G. F.-L., C. Prody, and S. Kustu. 1984. Simple, rapid, vate, and lactose (30, 48). D-Fucose, L-fucose, D-ribose, and quantitative release of periplasmic proteins by chloroform. D-raffinose, D-melibiose, D-cellobiose, L-arabinose, D-xy- J. Bacteriol. 160:1181-1183. lose, N-acetyl-D-galactosamine, D-galactosamine, D-manni- 2. Baum, D. H., and L. A. Joens. 1979. Serotypes of beta- VOL. 41, 1991 SERPULA GEN. NOV. 57

hemolytic Treponema hyodysenteriae. Infect. Immun. 25792- the type strain of Treponema hyodysenteriae Harris et al. Int. J. 796. Syst. Bacteriol. 29:102-109. 3. Brosius, J., M. L. Palmer, P. J. Kennedy, and H. F. Noller. 1978. 24. Kinyon, J. M., D. L. Harris, and R. D. Glock. 1977. Entero- Complete nucleotide sequence of a 16s ribosomal RNA gene pathogenicity of various isolates of Treponema hyodysenteriae. from Escherichia cofi. Proc. Natl. Acad. Sci. USA 754801- Infect. lmmun. 156384346. 4805. 25. Kunkle, R. A., D. L. Harris, and J. M. Kinyon. 1986. Auto- 4. Chatfield, S. N., D. S. Fernie, C. Penn, and G. Dougan. 1988. claved liquid medium for propagation of Treponema hyodysen- Identification of the major antigens of Treponema hyodysente- teriae. J. Clin. Microbiol. 24:6694371. riae and comparison with those of Treponema innocens. Infect. 26. Kunkte, R. A., and J. M. Kinyon. 1988. Improved selective Immun. 56:1070-1075. medium for the isolation of Treponema hyodysenteriae. J. Clin. 5. Combs, B., D. J. Hampson, J. R. L. Mhoma, and J. R. Buddle. Microbiol. 26:2357-2360. 1989. Typing of Treponema hyodysenteriae by restriction endo- 27. Laemmli, U. K. 1970. Cleavage of structural proteins during the nuclease analysis. Vet. Microbiol. 19:351-359. assembly of the head of bacteriophage T4. Nature (London) 6. Cwyk, W. M., and E. Canale-Parola. 1979. Treponema succin- 227:68M85. ifaciens sp. nov., an anaerobic spirochete from the swine 28. Lane, D. J., B. Pace, G. J. Olsen, D. A. Stahl, M. L. Sogin, and intestine. Arch. Microbiol. 122:231-239. N. R. Pace. 1985. Rapid determination of 16s ribosomal RNA 7. de Wergifosse, P., and M. M. Coene. 1989. Comparison of the sequences for phylogenetic analyses. Proc. Natl. Acad. Sci. genomes of pathogenic treponemes of human and animal origin. USA 82: 6955-6959. Infect. Immun. 57:1629-1631. 29. Lemcke, R. M., and M. R. Burrows. 1980. Sterol requirement 8. Dewhirst, F. E., B. J. Paster, and P. L. Bright. 1989. Chromo- for the growth of Treponema hyodysenteriae. J. Gen. Microbiol. bacterium, Eikenella, Kingella, Neisseria , Simonsiella, and 116~539-543. Vitreoscifla species comprise a major branch of the beta group 30. Lemcke, R. M., and M. R. Burrows. 1981. A comparative study Proteobacteria by 16s ribosomal ribonucleic acid sequence of from the porcine alimentary tract. J. Hyg. comparison: transfer of Eikenella and Simonsielfa to the family 86:173-182. Neisseriaceae (emend.). Int. J. Syst. Bacteriol. 39:258-266. 31. Li, W.-H. 1981. Simple method for constructing phylogenetic 9. Glock, R. D., and D. L. Harris. 1972. Swine dysentery. 11. trees from distance matrices. Proc. Natl. Acad. Sci. USA Characterization of lesions in pigs inoculated with Treponema 78:1085-1089. hyodysenteriae in pure and mixed culture. Vet. Med. Small 32. Mapother, M. E., and L. A. Joens. 1985. New serotypes of Anim. Clin. 67:65-68. Treponema hyodysenteriae. J . Clin. Microbiol. 22:161-164. 10. Hampson, D. J., J. R. L. Mhoma, B. Combs, and J. R. Buddle. 33. Marmur, J. 1961. A procedure for the isolation of deoxyribo- 1989. Proposed revisions to the serological typing system for nucleic acid from micro-organisms. J. Mol. Biol. 3:208-218. Treponema hyodysenteriae. Epidem. Infect. 102:75-84. 34. Miao, R., and A. H. Fieldsteel. 1978. Genetics of Treponema: 11. Harris, D. L., R. D. Glock, C. R. Christensen, and J. M. Kinyon. relationship between Treponema pullidum and five cultivable 1972. Swine dysentery. I. Inoculation of pigs with Treponema treponemes. J. Bacteriol. 133:lOl-107. hyodysenteriae (new species) and reproduction of the disease. 35. Miao, R. M., A. H. Fieldsteel, and D. L. Harris. 1978. Genetics Vet. Med. Small Anim. Clin. 67:61-64. of Treponema: characterization of Treponema hyodysenteriae 12. Holdeman, L. V., E. P. Cato, and W. E. C. Moore. 1984. and its relationship to Treponema paflidum. Infect. Immun. Taxonomy of anaerobes: present state of the art. Rev. Infect. 22: 73 6-739. Dis. 6:S3-S10. 36. Pace, B., E. A. Matthews, K. D. Johnson, C. R. Cantor, and 13. Holt, S. C. 1978. Anatomy and chemistry of spirochetes. Micro- N. R. Pace. 1982. Conserved 5s rRNA complement to tRNA is biol. Rev. 42:114-160. not required for protein synthesis. Proc. Natl. Acad. Sci. USA 13a.Hovind-Hougen, K. (National Veterinary Laboratory, Copen- 79: 36-40. hagen). 1989. Personal communication. 37. Paster, B. J., and F. E. Dewhirst. 1988. Phylogeny of campylo- 14. Hull, R. A., R. E. Gill, P. Hsu, B. H. Minshew, and S. Falkow. bacters, wolinellas, Bacteroides gracilis, and Bacteroides ure- 1981. Construction and expression of recombinant plasmids olyticus by 16s ribosomal ribonucleic acid sequencing. Int. J. encoding type 1 or D-mannose-resistant pili from a urinary tract Syst. Bacteriol. 38:5&62. infection Escherichia cofi isolate. Infect. lmmun. 33:933-938. 38. Paster, B. J., E. Stackebrandt, R. B. Hespell, C. M. Hahn, and 15. Hunter, D., and T. Wood. 1979. An evaluation of the API ZYM C. R. Woese. 1984. The phylogeny of the spirochetes. Syst. system as a means of classifying spirochaetes associated with Appl. Microbiol. 5337-351. swine dysentery. Vet. Rec. 104:383-384. 39. Sachse, K., and T. Blaha. 1988. Characterization of the agent of 16. Hyde, F. W., and R. C. Johnson. 1984. Genetic relationship of swine dysentery based on deoxyribonucleic acid homology. lyme disease spirochetes to Borrefia, Treponema, and Lep- Zentralbl. Bakteriol. Parasitenkd. Infektionskr. Hyg. Abt. 1 tospira spp. J. Clin. Microbio!. 20:151-154. Reihe A 268:8-14. 17. Jackman, P. J. H. 1985. Bacterial taxonomy based on electro- 40. Sambrook, J., E. R. Fritsch, and T. Maniatis. 1989. Molecular phoretic whole cell protein patterns. SOC. Appl. Bacteriol. cloning, a laboratory manual, 2nd ed., vol. 1. Cold Spring Tech. Ser. 20:115-129. Harbor Laboratory, Cold Spring Harbor, N.Y. 18. Joens, L. A., and R. B. Marquez. 1986. Molecular characteriza- 41. Schmid, G. P., A. G. Steigerwalt, S. E. Johnson, A. G. Barbour, tion of proteins from porcine spirochetes. Infect. Immun. 54: A. C. Steer, I. M. Robinson, and D. J. Brenner. 1984. DNA 893-896. characterization of the spirochete that causes Lyme disease. J. 19. Johnson, J. L. 1985. DNA reassociation and RNA hybridization Clin. Microbiol. 20:155-158. of bacterial nucleic acids, p. 33-74. In G. Gottschalk (ed.), 42. Smibert, R. M. 1984. Genus 111. Treponema, p. 49-57. In N. R. Methods in microbiology, vol. 18. Academic Press, Inc., New Krieg and J. G. Holt (ed.), Bergey’s manual of systematic York. bacteriology, vol. 1. The William & Wilkins Co., Baltimore. 20. Johnson, J. L., C. F. Phelps, C. S. Cummins, J. London, and F. 43. Songer, J. G., J. M. Kinyon, and D. L. Harris. 1976. Selective Gasser. 1980. Taxonomy of the Lactobacillus acidophilus medium for isolation of Treponema hyodysenteriae. J. Clin. group. Int. .J. Syst. Bacteriol. 3053-68. Microbiol. 457-60. 21. Jukes, T. H., and C. R. Cantor. 1969. Evolution of protein 44. Stanton, T. B. 1987. Cholesterol metabolism by Treponema molecules, p. 21-132. In H. N. Munro (ed.), Mammalian protein hyodysenteriue. Infect. Immun. 55:309-313. metabolism, vol. 3. Academic Press, Inc., New York. 45. Stanton, T. B. 1989. Glucose metabolism and NADH recycling 22. Kinyon, J. M., and D. L. Harris. 1974. Growth of Treponemu by Treponema hyodysenteriae, the agent of swine dysentery. hyodysenteriae in liquid medium. Vet. Rec. 95219-220. Appl. Environ. Microbiol. 5523562371. 23. Kinyon, J. M., and D. L. Harris. 1979. Treponema innocens, a 46. Stanton, T. B., and E. Canale-Parola. 1980. Treponema bryantii, new species of intestinal bacteria, and emended description of sp. nov., a rumen spirochete that interacts with cellulolytic 58 STANTON ET AL. INT. J. SYST.BACTERIOL.

bacteria. Arch. Microbiol. 127:145-156. 50. Weisburg, W. G., Y. Oyaizu, H. Oyaizu, and C. R. Woese. 1985. 47. Stanton, T. B., and C. P. Cornell. 1987. Erythrocytes as a source Natural relationship between bacteroides and flavobacteria. J. of essential lipids for Treponema hyodysenteriae. Infect. Im- Bacteriol. 164:23&236. mun. 55304308. 51. Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51:221- 48. Stanton, T. B., and D. F. Lebo. 1988. Treponema hyodysente- 271. riae growth under various culture conditions. Vet. Microbiol. 52. Woese, C. R., E. Stackebrandt, T. J. Macke, and G. E. Fox. 18: 177-190. 1985. A phylogenetic definition of the major eubacterial taxa. 49. Taylor, D. J., and T. J. L. Alexander. 1971. The production of Syst. Appl. Microbiol. 6:143-151. dysentery in swine by feeding cultures containing a . 53. Woods, R. S. 1966. An English-classical dictionary for the use of Br. Vet. J. 127:lviii-lxi. taxonomists. Pomona College Press, Pomona, Calif.