DOCSLIB.ORG

Oryctolagus Cuniculus)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Oryctolagus Cuniculus) Genome Gene Expression Profiling Analysis Reveals Fur Development in Rex Rabbits (Oryctolagus cuniculus) Journal: Genome Manuscript ID gen-2017-0003.R2 Manuscript Type: Article Date Submitted by the Author: 31-Jul-2017 Complete List of Authors: Zhao, Bohao; Yangzhou University Chen, Yang; Yangzhou University Yan, Xiaorong ; Yangzhou University Hao, Ye; YangzhouDraft University Zhu, Jie; Yangzhou University Weng, Qiiaoqing; Zhejiang Yuyao Xinnong Rabbit Industry Co., Ltd. Wu, Xinsheng; Yangzhou University, College of Animal Science and Technology Is the invited manuscript for consideration in a Special This submission is not invited Issue? : Keyword: Chinchilla rex rabbit, fur development, key gene, transcriptome https://mc06.manuscriptcentral.com/genome-pubs Page 1 of 138 Genome 1 Gene Expression Profiling Analysis Reveals Fur Development in Rex 2 Rabbits ( Oryctolagus cuniculus ) 3 BoHao Zhao 1, Yang Chen 1, XiaoRong Yan 1, Ye Hao 1, Jie Zhu 1, QiaoQing Weng 2, and 4 XinSheng Wu 1* 5 1 The Key Laboratory of Animal Genetics & Breeding and Molecular Design of Jiangsu Province, 6 College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, P.R. 7 China. ; 8 2 Zhejiang Yuyao Xinnong Rabbit Industry Co., Ltd., Yuyao, Zhejiang 315400, China 9 *Corresponding author E-mail: [email protected] 10 Draft 1 https://mc06.manuscriptcentral.com/genome-pubs Genome Page 2 of 138 11 Abstract 12 Fur is an important economic trait in rabbits. The identification of genes that 13 influence fur development and knowledge regarding the actions of these genes 14 provides useful tools for improving fur quality. However, the mechanism of fur 15 development is unclear. To obtain candidate genes related to fur development, the 16 transcriptomes of tissues from backs and bellies of Chinchilla rex rabbits were 17 compared. Of the genes analyzed, 336 showed altered expression in the two groups 18 (285 upregulated and 51 downregulated), P≤0.05, fold-change≥2 or ≤0.5). Using GO 19 and KEGG to obtain gene classes that were differentially enriched, we found several 20 genes to be involved in manyDraft important biological processes. In addition, we 21 identified several signaling pathways involved in fur development, including the Wnt 22 and MAPK signaling pathways, revealing mechanisms of skin and hair follicle 23 development, and epidermal cell and keratinocytes differentiation. The obtained rabbit 24 transcriptome and differentially expressed gene profiling data provided 25 comprehensive gene expression information for SFRP2, FRZB, CACNG1, SLC25A4 26 and SLC16A3. To validate the RNA-seq data, the expression levels of eight 27 differentially expressed genes involved in fur development were confirmed by 28 qRT-PCR. The results of rabbit transcriptomic profiling provide a basis for 29 understanding the molecular mechanisms of fur development. 30 Keywords 31 Chinchilla rex rabbit, fur development, key gene, transcriptome 32 2 https://mc06.manuscriptcentral.com/genome-pubs Page 3 of 138 Genome 33 Introduction 34 The Chinchilla rex rabbit is an important rabbit breed with varied natural coat 35 colors; consumers highly appreciate the properties of rex furs, such as beauty, softness, 36 color, lightness, and warmth retention (Pan et al. 2015). The characteristics of 37 Chinchilla rex rabbit fur differs between the back and belly, especially the length and 38 diameter of the wools (Tao 2010). 39 In recent years, many studies have revealed the mechanisms of skin and fur 40 development. RNA-seq was used to explore the mechanisms of keratinocyte 41 development in mouse skin, and transcription factor (TF) p63 was found to be highly 42 expressed in stratified epithelia, whichDraft affected the epidermal phenotype (Rizzo et al. 43 2014). Many genes involved in skin development, including those for transcription 44 factors and growth factors, have been identified in rex rabbits with the plaice 45 phenotype (Pan et al. 2015). In cashmere goats, genes related to hair follicle 46 development and cycling were identified in anagen, catagen and telogen stages by 47 transcriptomic investigation of fur development (Geng et al. 2013). It is generally 48 known that fur development is influenced by many factors, including the proliferation 49 of keratinocytes, development of the epidermis and hair follicle (HF) morphogenesis 50 (Danilenko et al. 1995). Multiple genes involved in HF morphogenesis, regulation of 51 proliferation, differentiation and migration of skin are controlled by members of the 52 Wnt signaling pathway, such as the frizzled and secreted frizzled-related protein 53 (SFRP) families (Ehrlund et al. 2013; Kim and Yoon 2014). Epidermal growth factor 54 is regulated by the MAPK/ERK pathway and plays a vital role in the animal skin 3 https://mc06.manuscriptcentral.com/genome-pubs Genome Page 4 of 138 55 development, enhancing epidermal growth and keratinization, directly stimulating the 56 proliferation of epidermal cells and promoting keratinocyte proliferation and 57 migration. However, fur characteristics are different at different parts of an animal, 58 and the mechanism of fur development regulation is still unclear in rabbits. 59 Rabbit genome sequencing has been used to study the polygene-related phenotypic 60 changes during rabbit domestication (Carneiro et al. 2014) and differential gene 61 expression in animal skin between anagen and telogen was shown by transcriptome 62 sequencing (Xu et al. 2013). In this study, the skin from the backs and bellies of 63 Chinchilla rex rabbits was collected, and gene expression profiling was used to obtain 64 the differentially expressed genesDraft related to the fur development. After functional 65 annotation, enrichment analysis and assessment of biological functions, candidate 66 genes were identified. These key genes were verified by quantitative real-time PCR. 67 The results obtained serve to improve our understanding of fur development and the 68 differential expression profiles of the candidate genes enable us to clarify the 69 mechanisms of fur development, providing a valuable theoretical basis for further 70 research on the hair and fur of animals. 71 72 Materials and methods 73 Ethics statement 74 All animal experiments were reviewed and approved by the Institutional Animal 75 Care and Use Committee of the School of Animal Science and Technology, Yangzhou 76 University, and performed in accordance with the Regulations for the Administration 4 https://mc06.manuscriptcentral.com/genome-pubs Page 5 of 138 Genome 77 of Affairs Concerning Experimental Animals (China, 1988) and the Standards for the 78 administration of experimental practices (Jiangsu, China, 2008). All surgery was 79 performed according to recommendations proposed by the European Commission 80 (1997), and all efforts were made to minimize suffering of the animals. 81 Tissue collection 82 The Chinchilla rex rabbits used in the experiments were obtained from Zhejiang 83 Yuyao Xinnong Rabbit Co., Ltd. During our experiments, rabbits were raised in a 84 controlled environment and had free access to water and food. All rabbits were housed 85 in a suitable, clean and disease free environment, and a secure cage. The health of the 86 rabbits were monitored twice a Draftday (7 am and 6 pm) and recorded. Three healthy, 87 20-day-old rabbits with the same fur traits were evaluated. Fur on the back (B group) 88 and belly (F group) were different. Three biological samples were taken for each of 89 the two groups (one sample of back and belly fur from each rabbit) to ensure the same 90 genetic background and fur phenotype in each group. After transfer to the laboratory, 91 skin tissue samples (1.5 cm 2) were collected from the back and belly of each rabbit. 92 Animals were anesthetized with by injection with 0.7% sodium pentobarbital solution 93 into the ear vein of the rabbits; in order to prevent bacterial infection iodine solution 94 was smeared on the resultant lesion. Fur was removed from the surface, and then the 95 skin was cut into pieces. The pieces were placed in tubes containing RNase, 96 immediately preserved in liquid nitrogen and stored at -70°C until use in subsequent 97 experiments. 98 RNA extraction, cDNA library construction, and Illumina sequencing 5 https://mc06.manuscriptcentral.com/genome-pubs Genome Page 6 of 138 99 Total RNA was extracted following the manufacturer’s instructions using the 100 mirVana™ miRNA isolation kit (Ambion); the integrity of the RNA was determined 101 with an Agilent Bioanalyzer 2100 (Agilent technologies, Santa Clara, CA, US) to 102 obtain a RNA Integrity Number (RIN). An RNeasy micro kit (Cat#74004, QIAGEN, 103 GmBH, Germany) was used to further purify the qualified total RNA, and DNA was 104 removed with the RNase-Free DNase set (QIAGEN, GmBH, Germany). RNA quality 105 was monitored using NanoDrop ND-1000 and Agilent Bioanalyzer 2100. After RNA 106 extraction and purification, 3 µg RNA was used for construction of the back and belly 107 cDNA libraries. Ribosomal RNA (rRNA) was depleted from the total RNA and the 108 remaining RNA was subsequentlyDraft fragmented. These steps were followed by first and 109 second cDNA strand synthesis, end repair, 3'-end adenylation, adapter ligation, and 110 enrichment of the cDNA templates. Finally, the library concentration was determined 111 using a Qubit® 2.0 fluorometer and a Qubit™ dsDNA HS kit (Invitrogen). Cluster 112 generation was completed the sample library, and the first primers hybridized to cBot 113 matched the Illumina HiSeq 2500 platform. After cluster generation, the sequencing 114 reagent was prepared according to the HiSeq 2500 user guide using paired-end 115 technology. Sequencing was controlled by data collection software (Illumina, San 116 Francisco, USA) and the data were analyzed in real time. 117 Transcriptome mapping and analysis of differentially expressed genes 118 The cDNA library was sequenced using an Illumina HiSeq 2500 sequencing 119 platform. Original image files were obtained, and bases were called and filtered, after 120 which the results were stored in fastq format. The original sequencing reads were used 6 https://mc06.manuscriptcentral.com/genome-pubs Page 7 of 138 Genome 121 for transcriptome sequencing analysis.
Load more

Recommended publications
  • Oocyte Aneuploidy—More Tools to Tackle an Old Problem
    COMMENTARY Oocyte aneuploidy—more tools to tackle an old problem COMMENTARY Chris Lodgea and Mary Herberta,1 Meiosis generates a single-copy genome during two centromeric cohesin enables sister centromeres to successive rounds of cell division after a single round biorient on the meiosis II spindle (2, 5). Upon cleavage of DNA replication. Failure to transmit exactly one of centromeric cohesin, dyads are converted to single copy of each chromosome during fertilization gives chromatids, which segregate equationally to opposite rise to aneuploid embryos resulting in infertility and poles of the meiosis II spindle. Protection of a centro- congenital abnormalities such as Down’s syndrome. meric cohesin by Shugoshin proteins (SGOL2 in mam- Aneuploidy attributable to meiotic errors is over- mals) until the onset of anaphase II is essential for whelming due to chromosome segregation errors dur- orderly segregation of chromatids (7, 8). In oocytes, ing female meiosis, and the incidence of these both meiotic divisions are highly asymmetrical, giving increases dramatically as women get older (1, 2). Be- rise to two small nonviable polar bodies (Fig. 1). cause the oocyte is the only viable product of female Consistent with previous studies (9), Tyc et al. (3) meiosis, our understanding of predisposing events in found that only a tiny fraction (<1%) of meiotic errors human oocytes relies largely on inferences from ge- are of paternal origin. Compared with males, the es- netic studies in cases of trisomy and on analysis of tablishment and maintenance of bivalent chromo- oocytes obtained from in vitro fertilization clinics. somes are compromised in female meiosis. In females, Progress toward understanding the underlying mech- there is a greater risk of homologs failing to form cross- anisms has been hampered by a paucity of informa- overs, or of forming them in precarious positions that are tion on the outcome of both meiotic divisions.
    [Show full text]
  • Mutational Inactivation of STAG2 Causes Aneuploidy in Human Cancer
    REPORTS mean difference for all rubric score elements was ing becomes a more commonly supported facet 18. C. L. Townsend, E. Heit, Mem. Cognit. 39, 204 (2011). rejected. Univariate statistical tests of the observed of STEM graduate education then students’ in- 19. D. F. Feldon, M. Maher, B. Timmerman, Science 329, 282 (2010). mean differences between the teaching-and- structional training and experiences would alle- 20. B. Timmerman et al., Assess. Eval. High. Educ. 36,509 research and research-only conditions indicated viate persistent concerns that current programs (2011). significant results for the rubric score elements underprepare future STEM faculty to perform 21. No outcome differences were detected as a function of “testability of hypotheses” [mean difference = their teaching responsibilities (28, 29). the type of teaching experience (TA or GK-12) within the P sample population participating in both research and 0.272, = 0.006; CI = (.106, 0.526)] with the null teaching. hypothesis rejected in 99.3% of generated data References and Notes 22. Materials and methods are available as supporting samples (Fig. 1) and “research/experimental de- 1. W. A. Anderson et al., Science 331, 152 (2011). material on Science Online. ” P 2. J. A. Bianchini, D. J. Whitney, T. D. Breton, B. A. Hilton-Brown, 23. R. L. Johnson, J. Penny, B. Gordon, Appl. Meas. Educ. 13, sign [mean difference = 0.317, = 0.002; CI = Sci. Educ. 86, 42 (2001). (.106, 0.522)] with the null hypothesis rejected in 121 (2000). 3. C. E. Brawner, R. M. Felder, R. Allen, R. Brent, 24. R. J. A. Little, J.
    [Show full text]
  • Genome-Wide Analysis Reveals Selection Signatures Involved in Meat Traits and Local Adaptation in Semi-Feral Maremmana Cattle
    Genome-Wide Analysis Reveals Selection Signatures Involved in Meat Traits and Local Adaptation in Semi-Feral Maremmana Cattle Slim Ben-Jemaa, Gabriele Senczuk, Elena Ciani, Roberta Ciampolini, Gennaro Catillo, Mekki Boussaha, Fabio Pilla, Baldassare Portolano, Salvatore Mastrangelo To cite this version: Slim Ben-Jemaa, Gabriele Senczuk, Elena Ciani, Roberta Ciampolini, Gennaro Catillo, et al.. Genome-Wide Analysis Reveals Selection Signatures Involved in Meat Traits and Local Adaptation in Semi-Feral Maremmana Cattle. Frontiers in Genetics, Frontiers, 2021, 10.3389/fgene.2021.675569. hal-03210766 HAL Id: hal-03210766 https://hal.inrae.fr/hal-03210766 Submitted on 28 Apr 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License ORIGINAL RESEARCH published: 28 April 2021 doi: 10.3389/fgene.2021.675569 Genome-Wide Analysis Reveals Selection Signatures Involved in Meat Traits and Local Adaptation in Semi-Feral Maremmana Cattle Slim Ben-Jemaa 1, Gabriele Senczuk 2, Elena Ciani 3, Roberta
    [Show full text]
  • A Gene Expression Resource Generated by Genome-Wide Lacz
    © 2015. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2015) 8, 1467-1478 doi:10.1242/dmm.021238 RESOURCE ARTICLE A gene expression resource generated by genome-wide lacZ profiling in the mouse Elizabeth Tuck1,**, Jeanne Estabel1,*,**, Anika Oellrich1, Anna Karin Maguire1, Hibret A. Adissu2, Luke Souter1, Emma Siragher1, Charlotte Lillistone1, Angela L. Green1, Hannah Wardle-Jones1, Damian M. Carragher1,‡, Natasha A. Karp1, Damian Smedley1, Niels C. Adams1,§, Sanger Institute Mouse Genetics Project1,‡‡, James N. Bussell1, David J. Adams1, Ramiro Ramırez-Soliś 1, Karen P. Steel1,¶, Antonella Galli1 and Jacqueline K. White1,§§ ABSTRACT composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Knowledge of the expression profile of a gene is a critical piece of Furthermore, there were 1207 observations of expression of a information required to build an understanding of the normal and particular gene in an anatomical structure where Bgee had no essential functions of that gene and any role it may play in the data, indicating a large amount of novelty in our data set. development or progression of disease. High-throughput, large- Examples of expression data corroborating and extending scale efforts are on-going internationally to characterise reporter- genotype-phenotype associations and supporting disease gene tagged knockout mouse lines. As part of that effort, we report an candidacy are presented to demonstrate the potential of this open access adult mouse expression resource, in which the powerful resource. expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter KEY WORDS: Gene expression, lacZ reporter, Mouse, Resource gene.
    [Show full text]
  • DCAF1 Ubiquitin E3 Ligase Directs Protein Phosphatase 2A Degradation to Control Oocyte Meiotic Maturation
    ARTICLE Received 28 Jan 2015 | Accepted 7 Jul 2015 | Published 18 Aug 2015 DOI: 10.1038/ncomms9017 OPEN CRL4–DCAF1 ubiquitin E3 ligase directs protein phosphatase 2A degradation to control oocyte meiotic maturation Chao Yu1, Shu-Yan Ji1,*, Qian-Qian Sha1,*, Qing-Yuan Sun2 & Heng-Yu Fan1 Oocyte meiosis is a specialized cell cycle that gives rise to fertilizable haploid gametes and is precisely controlled in various dimensions. We recently found that E3 ubiquitin ligase CRL4 is required for female fertility by regulating DNA hydroxymethylation to maintain oocyte survival and to promote zygotic genome reprogramming. However, not all phenotypes of CRL4-deleted oocytes could be explained by this mechanism. Here we show that CRL4 controls oocyte meiotic maturation by proteasomal degradation of protein phosphatase 2A scaffold subunit, PP2A-A. Oocyte-specific deletion of DDB1 or DCAF1 (also called VPRBP) results in delayed meiotic resumption and failure to complete meiosis I along with PP2A-A accumulation. DCAF1 directly binds to and results in the poly-ubiquitination of PP2A-A. Moreover, combined deletion of Ppp2r1a rescues the meiotic defects caused by DDB1/DCAF1 deficiency. These results provide in vivo evidence that CRL4-directed PP2A-A degradation is physiologically essential for regulating oocyte meiosis and female fertility. 1 Life Sciences Institute and Innovation Center for Cell Signaling Network, Zhejiang University, Hangzhou 310058, China. 2 State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China. * These authors contributed equally to this work. Correspondence and requests for materials should be addressed to H.-Y.F. (email: [email protected]).
    [Show full text]
  • Reconstructing Cell Cycle Pseudo Time-Series Via Single-Cell Transcriptome Data—Supplement
    School of Natural Sciences and Mathematics Reconstructing Cell Cycle Pseudo Time-Series Via Single-Cell Transcriptome Data—Supplement UT Dallas Author(s): Michael Q. Zhang Rights: CC BY 4.0 (Attribution) ©2017 The Authors Citation: Liu, Zehua, Huazhe Lou, Kaikun Xie, Hao Wang, et al. 2017. "Reconstructing cell cycle pseudo time-series via single-cell transcriptome data." Nature Communications 8, doi:10.1038/s41467-017-00039-z This document is being made freely available by the Eugene McDermott Library of the University of Texas at Dallas with permission of the copyright owner. All rights are reserved under United States copyright law unless specified otherwise. File name: Supplementary Information Description: Supplementary figures, supplementary tables, supplementary notes, supplementary methods and supplementary references. CCNE1 CCNE1 CCNE1 CCNE1 36 40 32 34 32 35 30 32 28 30 30 28 28 26 24 25 Normalized Expression Normalized Expression Normalized Expression Normalized Expression 26 G1 S G2/M G1 S G2/M G1 S G2/M G1 S G2/M Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage CCNE1 CCNE1 CCNE1 CCNE1 40 32 40 40 35 30 38 30 30 28 36 25 26 20 20 34 Normalized Expression Normalized Expression Normalized Expression 24 Normalized Expression G1 S G2/M G1 S G2/M G1 S G2/M G1 S G2/M Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage Supplementary Figure 1 | High stochasticity of single-cell gene expression means, as demonstrated by relative expression levels of gene Ccne1 using the mESC-SMARTer data. For every panel, 20 sample cells were randomly selected for each of the three stages, followed by plotting the mean expression levels at each stage.
    [Show full text]
  • Multivariate Analysis Reveals Genetic Associations of the Resting Default
    Multivariate analysis reveals genetic associations of PNAS PLUS the resting default mode network in psychotic bipolar disorder and schizophrenia Shashwath A. Medaa,1, Gualberto Ruañob,c, Andreas Windemuthb, Kasey O’Neila, Clifton Berwisea, Sabra M. Dunna, Leah E. Boccaccioa, Balaji Narayanana, Mohan Kocherlab, Emma Sprootena, Matcheri S. Keshavand, Carol A. Tammingae, John A. Sweeneye, Brett A. Clementzf, Vince D. Calhoung,h,i, and Godfrey D. Pearlsona,h,j aOlin Neuropsychiatry Research Center, Institute of Living at Hartford Hospital, Hartford, CT 06102; bGenomas Inc., Hartford, CT 06102; cGenetics Research Center, Hartford Hospital, Hartford, CT 06102; dDepartment of Psychiatry, Beth Israel Deaconess Hospital, Harvard Medical School, Boston, MA 02215; eDepartment of Psychiatry, University of Texas Southwestern Medical Center, Dallas, TX 75390; fDepartment of Psychology, University of Georgia, Athens, GA 30602; gThe Mind Research Network, Albuquerque, NM 87106; Departments of hPsychiatry and jNeurobiology, Yale University, New Haven, CT 06520; and iDepartment of Electrical and Computer Engineering, The University of New Mexico, Albuquerque, NM 87106 Edited by Robert Desimone, Massachusetts Institute of Technology, Cambridge, MA, and approved April 4, 2014 (received for review July 15, 2013) The brain’s default mode network (DMN) is highly heritable and is Although risk for psychotic illnesses is driven in small part by compromised in a variety of psychiatric disorders. However, ge- highly penetrant, often private mutations such as copy number netic control over the DMN in schizophrenia (SZ) and psychotic variants, substantial risk also is likely conferred by multiple genes bipolar disorder (PBP) is largely unknown. Study subjects (n = of small effect sizes interacting together (7). According to the 1,305) underwent a resting-state functional MRI scan and were “common disease common variant” (CDCV) model, one would analyzed by a two-stage approach.
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]
  • The Correlation of Keratin Expression with In-Vitro Epithelial Cell Line Differentiation
    The correlation of keratin expression with in-vitro epithelial cell line differentiation Deeqo Aden Thesis submitted to the University of London for Degree of Master of Philosophy (MPhil) Supervisors: Professor Ian. C. Mackenzie Professor Farida Fortune Centre for Clinical and Diagnostic Oral Science Barts and The London School of Medicine and Dentistry Queen Mary, University of London 2009 Contents Content pages ……………………………………………………………………......2 Abstract………………………………………………………………………….........6 Acknowledgements and Declaration……………………………………………...…7 List of Figures…………………………………………………………………………8 List of Tables………………………………………………………………………...12 Abbreviations….………………………………………………………………..…...14 Chapter 1: Literature review 16 1.1 Structure and function of the Oral Mucosa……………..…………….…..............17 1.2 Maintenance of the oral cavity...……………………………………….................20 1.2.1 Environmental Factors which damage the Oral Mucosa………. ….…………..21 1.3 Structure and function of the Oral Mucosa ………………...….……….………...21 1.3.1 Skin Barrier Formation………………………………………………….……...22 1.4 Comparison of Oral Mucosa and Skin…………………………………….……...24 1.5 Developmental and Experimental Models used in Oral mucosa and Skin...……..28 1.6 Keratinocytes…………………………………………………….….....................29 1.6.1 Desmosomes…………………………………………….…...............................29 1.6.2 Hemidesmosomes……………………………………….…...............................30 1.6.3 Tight Junctions………………………….……………….…...............................32 1.6.4 Gap Junctions………………………….……………….….................................32
    [Show full text]
  • MALE Protein Name Accession Number Molecular Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean H Mean PDAC Mean T-Test PDAC Vs. H T-Test
    MALE t-test t-test Accession Molecular H PDAC PDAC vs. PDAC vs. Protein Name Number Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean Mean Mean H CP PDAC/H PDAC/CP - 22 kDa protein IPI00219910 22 kDa 7 5 4 8 1 0 6 6 1 0.1126 0.0456 0.1 0.1 - Cold agglutinin FS-1 L-chain (Fragment) IPI00827773 12 kDa 32 39 34 26 53 57 36 30 55 0.0309 0.0388 1.8 1.5 - HRV Fab 027-VL (Fragment) IPI00827643 12 kDa 4 6 0 0 0 0 5 0 0 - 0.0574 - 0.0 - REV25-2 (Fragment) IPI00816794 15 kDa 8 12 5 7 8 9 10 6 8 0.2225 0.3844 1.3 0.8 A1BG Alpha-1B-glycoprotein precursor IPI00022895 54 kDa 115 109 106 112 111 100 112 109 105 0.6497 0.4138 1.0 0.9 A2M Alpha-2-macroglobulin precursor IPI00478003 163 kDa 62 63 86 72 14 18 63 79 16 0.0120 0.0019 0.2 0.3 ABCB1 Multidrug resistance protein 1 IPI00027481 141 kDa 41 46 23 26 52 64 43 25 58 0.0355 0.1660 2.4 1.3 ABHD14B Isoform 1 of Abhydrolase domain-containing proteinIPI00063827 14B 22 kDa 19 15 19 17 15 9 17 18 12 0.2502 0.3306 0.7 0.7 ABP1 Isoform 1 of Amiloride-sensitive amine oxidase [copper-containing]IPI00020982 precursor85 kDa 1 5 8 8 0 0 3 8 0 0.0001 0.2445 0.0 0.0 ACAN aggrecan isoform 2 precursor IPI00027377 250 kDa 38 30 17 28 34 24 34 22 29 0.4877 0.5109 1.3 0.8 ACE Isoform Somatic-1 of Angiotensin-converting enzyme, somaticIPI00437751 isoform precursor150 kDa 48 34 67 56 28 38 41 61 33 0.0600 0.4301 0.5 0.8 ACE2 Isoform 1 of Angiotensin-converting enzyme 2 precursorIPI00465187 92 kDa 11 16 20 30 4 5 13 25 5 0.0557 0.0847 0.2 0.4 ACO1 Cytoplasmic aconitate hydratase IPI00008485 98 kDa 2 2 0 0 0 0 2 0 0 - 0.0081 - 0.0
    [Show full text]
  • Experimental Eye Research 129 (2014) 93E106
    Experimental Eye Research 129 (2014) 93e106 Contents lists available at ScienceDirect Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer Transcriptomic analysis across nasal, temporal, and macular regions of human neural retina and RPE/choroid by RNA-Seq S. Scott Whitmore a, b, Alex H. Wagner a, c, Adam P. DeLuca a, b, Arlene V. Drack a, b, Edwin M. Stone a, b, Budd A. Tucker a, b, Shemin Zeng a, b, Terry A. Braun a, b, c, * Robert F. Mullins a, b, Todd E. Scheetz a, b, c, a Stephen A. Wynn Institute for Vision Research, The University of Iowa, Iowa City, IA, USA b Department of Ophthalmology and Visual Sciences, Carver College of Medicine, The University of Iowa, Iowa City, IA, USA c Department of Biomedical Engineering, College of Engineering, The University of Iowa, Iowa City, IA, USA article info abstract Article history: Proper spatial differentiation of retinal cell types is necessary for normal human vision. Many retinal Received 14 September 2014 diseases, such as Best disease and male germ cell associated kinase (MAK)-associated retinitis pigmen- Received in revised form tosa, preferentially affect distinct topographic regions of the retina. While much is known about the 31 October 2014 distribution of cell types in the retina, the distribution of molecular components across the posterior pole Accepted in revised form 4 November 2014 of the eye has not been well-studied. To investigate regional difference in molecular composition of Available online 5 November 2014 ocular tissues, we assessed differential gene expression across the temporal, macular, and nasal retina and retinal pigment epithelium (RPE)/choroid of human eyes using RNA-Seq.
    [Show full text]
  • Supplementary Data ASXL2 Regulates Hematopoiesis in Mice and Its
    Supplementary data ASXL2 regulates hematopoiesis in mice and its deficiency promotes myeloid expansion Supplementary Methods Genomic DNA extraction Genomic DNA was extracted from BM mononuclear cells using a DNA extraction kit (Puregene Gentra System, Minneapolis, MN, USA) according to the manufacturer’s instructions. Genomic DNA was quantified using Qubit Fluorometer (Life Technologies) and DNA integrity was assessed by agarose gel electrophoresis. For samples with low quantity, DNA was amplified using REPLI-g Ultrafast mini kit (Qiagen). Peripheral blood analysis Complete peripheral blood counts were analysed using Abbott Cell-Dyn 3700 hematology analyzer (Abbott Laboratories). Expression analysis of Asxl2 and Asxl1 Transcript levels of Asxl2 and Asxl1 were estimated using quantitative RT-PCR with following primers: Asxl2 primer set 1, ATTCGACAAGAGATTGAGAAGGAG (forward) and TTTCTGTGAATCTTCAAGGCTTAG (reverse); Asxl2 primer set 2, GCCCTTAACAATGAGTTCTTCACT (forward) and TCCACAGCTCTACTTTCTTCTCCT (reverse); Asxl1 primers, GGTGGAACAATGGAAGGAAA (forward) and CTGGCCGAGAACGTTTCTTA (reverse). Asxl2 protein was detected in immunoblot using anti-ASXL2 antibody (Bethyl). In vitro differentiation of bone marrow cells Bone marrow (BM) cells were cultured in IMDM containing 20% FBS and 10 ng/ml IL3, 10 ng/ml IL6, 20 ng/ml SCF and 20 ng/ml GMCSF for two weeks. For FACS analysis, cells were washed, stained with fluorochrome-conjugated antibodies and analysed on FACS LSR II flow cytometer (BD Biosciences) using FACSDIVA software (BD Biosciences). Colony re-plating assay Bone marrow cells were plated in methylcellulose medium containing mouse stem cell factor (SCF), mouse interleukin 3 (IL-3), human interleukin 6 (IL-6) and human erythropoietin (MethoCult GF M3434; StemCell Technologies). Colonies were enumerated after 9-12 days and cells were harvested for re-plating.
    [Show full text]