DOCSLIB.ORG

Genomewide Homozygosity Mapping and Molecular Analysis of a Candidate Gene Located on 22Q13 (Fibulin-1) in a Previously Undescribed Vitreoretinal Dystrophy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genomewide Homozygosity Mapping and Molecular Analysis of a Candidate Gene Located on 22Q13 (Fibulin-1) in a Previously Undescribed Vitreoretinal Dystrophy OPHTHALMIC MOLECULAR GENETICS Genomewide Homozygosity Mapping and Molecular Analysis of a Candidate Gene Located on 22q13 (Fibulin-1) in a Previously Undescribed Vitreoretinal Dystrophy Maike Weigell-Weber, MD; Gian-Marco Sarra, MD; Dieter Kotzot, MD; Lodewijk Sandkuijl, PhD†; Elmar Messmer, MD; Martin Hergersberg, PhD Objectives: To localize the gene that causes an autoso- meric) to D22S1170 (telomeric). Lod scores were be- mal recessively inherited vitreoretinal dystrophy that has tween 0.017 and 2.36 (theta=0). A mutation analysis of not been described, to our knowledge, and to analyze a the complete coding region of FBLN1, which encodes in- candidate gene mapped to 22q13 (fibulin-1 [FBLN1]). teracting extracellular matrix proteins, revealed 4 pre- viously undescribed single nucleotide polymorphisms. Methods: Homozygosity mapping with 500 microsat- ellite markers spread over the whole genome (mean dis- Conclusions: A genomewide homozygosity mapping tance, 7.2 centimorgans [cM]) and mutation analysis of analysis supported the hypothesis that the gene respon- the complete coding region of FBLN1. sible for a unique vitreoretinal dystrophy is located on chromosome 22q13. No obviously pathogenic muta- Results: Homozygosity for all analyzed markers was tion was found in the candidate gene, FBLN1. found in the 4 affected siblings in a region on chromo- some 22 encompassing 12 cM from D22S444 (centro- Arch Ophthalmol. 2003;121:1184-1188 EREDITARY vitreoretinal COL11A2 on 6p21.3], Wagner syndrome on dystrophies are poten- 5q13-14, Knobloch syndrome on 21q22.3, tially blinding disorders Goldmann-Favre [enhanced S-cone] syn- characterized by an abnor- drome on 15q23, and multiple vitreoreti- mal vitreous gel, associ- nopathies on 11q13) were excluded by link- Hated retinal changes, and a heterogeneous age analysis. From the Institute of Medical origin. The phenotype is extremely vari- Genetics, University of Zurich able in both syndromic and nonsyndromic See also page 1109 (Drs Weigell-Weber and types. Some of them are associated with axial Hergersberg); Department of myopia of different extents and retinal de- Here, we report on a genomewide ho- Ophthalmology, University tachment. Disease-causing mutations have mozygosity mapping approach that found Hospital Zurich, been identified in various genes that en- a 12-centimorgan (cM) homozygous re- Frauenklinikstr (Drs Sarra and code components of the extracellular ma- gion on chromosome 22q13 containing, Messmer), Zurich, Switzerland; trix (ECM).1 Syndromic types of vitreoreti- among other genes, fibulin-1 (FBLN1). the Institute of Medical Biology nal dystrophies are Knobloch syndrome This attractive candidate gene was fur- and Human Genetics, (Online Mendelian Inheritance in Man University of Innsbruck, ther analyzed for mutations. Innsbruck, Austria (Dr Kotzot); [OMIM] *120328) and the rather heterog- Department of Medical eneous Stickler syndrome (OMIM #108300, METHODS Statistics, Leiden, the OMIM #604841, and OMIM #184840). Netherlands (Dr Sandkuijl). Nonsyndromic types are the Wagner syn- SUBJECTS Dr Sarra is currently affiliated drome (OMIM *143200), Goldmann- with the Department of Favre dystrophy (OMIM #268100), and the The family originated from eastern Switzer- Ophthalmology, Inselspital, allelic enhanced S cone syndrome. In ad- land. Informed consent and medical history Berne, Switzerland; dition, similar ophthalmologic findings were obtained from 3 healthy and 4 affected Dr Messmer, with Stadtspital have been described in families with X- siblings aged 68 to 77 years at the time of in- Triemli, Zurich; and chromosomal, autosomal dominant, and au- vestigation. The eighth sibling as well as both Dr Hergersberg, with Zentrum parents were not affected and died prior to this tosomal recessive inheritance. As reported fu¨r Labormedizin, Aarau, 2 investigation. The clinical data have been re- Switzerland. The authors have by Sarra et al, the chromosomal loci of some ported in detail.2 Briefly, in the 4 affected sib- no relevant financial interest of these disorders (high myopia on 18p11, lings, the onset of visual disturbance started in in this article. 12q21-23, and 7q36, Stickler syndrome early childhood, followed by progressive night †Deceased. [COL1A1 on 12q13, COL11A1 on 1q21, blindness and visual field impairment during (REPRINTED) ARCH OPHTHALMOL / VOL 121, AUG 2003 WWW.ARCHOPHTHALMOL.COM 1184 ©2003 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/28/2021 the third to fifth decade of life. Clinical evaluation revealed a peculiar vitreoretinal degeneration characterized by vitreous liq- uefaction and strand formation along with diffuse retinal pig- I-1 I-2 ment epithelium atrophy and pigment clumping of the retina, and high myopia with deep posterior staphyloma. The mean axial length of the eyes was 31.4 mm (range, 28.49-33.41 mm). II-1 II-2 II-3 II-4 II-5 II-6 II-7 II-8 D22S928 2 3 1 31212 12 12 1 3 The depth of the posterior staphylomata was 0.8 mm to 2.7 mm D22S444 2 2 1 21111 11 11 1 2 (mean, 1.75 mm). Visual acuity ranged from no light percep- D22S1153 2 1 2 12222 22 22 2 1 tion to 20/70. Kinetic perimetry revealed severe constrictions D22S532 2 1 1 11111 11 11 1 1 of the isopters, with remaining small central islands. Electro- D22S1141 1 1 1 11111 11 11 1 1 physiologic investigations showed severe retinal damage, sug- D22S1160 21 212222 22 22 21 gestive of a superimposed widespread retinal dystrophy. D22S1149 31 212222 22 22 21 A genealogic analysis of 5 generations revealed no evi- D22S1170 11 212222 22 22 21 dence for parental consanguinity (Manuel Aicher, Genealo- D22S1161 1 2 2 22121 21 21 2 2 gische Forschung, Dietikon, Switzerland). However, the ori- gin of most of the ancestors from a relatively isolated population Figure 1. Pedigree of the family, with solid symbols representing affected individuals. Haplotypes for microsatellite polymorphisms most closely linked and several consanguinities in the different parental pedigrees to fibulin-1 (FBLN1) are depicted below each symbol. The markers showing were indicated. homozygosity in the affected siblings are boxed. GENOTYPING Blood samples were obtained from all 7 living siblings after writ- the Applied Biosystems Dye terminator sequencing kit (Foster ten informed consent was obtained. DNA was extracted using stan- City, Calif), followed by sequence analysis on an ABI 3700 cap- dard salting out procedures. For homozygosity mapping, the DNA- illary sequencer (Microsynth, Balgach, Switzerland). RNA was pooling method was applied (affected vs unaffected).3 The mean isolated from EDTA anticoagulated blood using a QIAamp RNA distance between the 500 highly polymorphic markers used was Blood Mini Kit (Qiagen). Reverse transcriptase (RT)-PCR analy- 7.2 cM. Microsatellites chosen for maximum informativeness were sis was performed with the Titan RT-PCR kit (Roche Diagnos- obtained from the Genethon human genetic linkage map4 and from tics, Rotkreuz, Switzerland), using the experimental condi- the Marshfield map.5 Polymerase chain reaction (PCR) primers tions provided by the supplier. The primers used for RT-PCR were from Research Genetics (Huntsville, Ala) or were synthe- were A4F, TCTGCCACTGACACCTCAAG, and A4R, sized with the available sequence information. Polymerase chain GGATTTTGGAGGCAACACAT (nucleotides 2141-2160 and 2321-2344, respectively, of the complementary DNA se- reaction was performed using standard conditions. Products were 9 electrophoretically separated on 6% polyacrylamide sequencing quence of variant A of FBLN1 ). The RT reaction was per- gels and visualized by silver staining.6 Linkage was calculated us- formed at 60°C for 30 minutes, followed by 15 minutes at 95°C. ing the LINKAGE (version 5.1) program package (Laboratory of The denaturation, annealing, and extension temperatures were Statistical Genetics at Rockefeller University, New York, NY), as- 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 60 sec- suming autosomal recessive inheritance, 100% penetrance in both onds, respectively, for 40 cycles. sexes, and a gene frequency of 0.001. The same assumptions were used for the lod score calculation for the homozygous region with HAPLOTYPE ANALYSIS OF FBLN1 the MAPMAKER/HOMOZ algorithm.7 For this calculation, each marker allele that showed homozygosity in the 4 patients was as- Assays were developed for the 4 single nucleotide polymor- sumed to be the most frequent allele of the corresponding marker. phisms (SNPs) identified during mutation analysis of FBLN1. The allele frequencies of the different SNPs and the haplo- MUTATION ANALYSIS OF FBLN1 types arising from the different allele combinations were ana- lyzed in the DNA of 30 families (parents and at least 1 child) The PCR primers, annealing temperatures, and PCR product not affected by vitreoretinal dystrophy or severe myopia. These sizes for the amplification of all 20 exons of FBLN1, including families had given written informed consent that their anony- the exon-intron boundaries, were derived from the gene struc- mous DNA samples could be used for research. ture as described by Pan et al,8 and are available on request. Heteroduplex analysis of the PCR products was performed by denaturing high-performance liquid chromatography on a Wave RESULTS system (Transgenomic Inc, Omaha, Neb). The column used was a DNAsep Cartridge (Transgenomic Inc). After heteroduplex HOMOZYGOSITY MAPPING formation, DNA fragments were run, with column tempera- tures between 50°C to 68°C. The column temperature was A homozygous region on chromosome 22q13 was iden- changed in incremental steps of 2°C. An elution time of 14 min- tified, which extends from the proximal marker, D22S444, utes was used: the linear acetonitrile–triethylammonium acetate– to the distal marker, D22S1170 (Figure 1). The calcu- buffer gradient ratio went from 43%/57% to 68%/32% during lated lod score for the polymorphic markers that are ho- 10 minutes, with a buffer flow of 0.9 mL/minute, followed by mozygous in this region was between 0.017 and 2.18 (theta a 100% acetonitrile wash for 30 seconds, and in an equilibra- =0). This region contains FBLN1 (base pairs 29/341/ tion step, was reduced to 43%/57% for the last 4 minutes.
Load more

Recommended publications
  • Supplemental Table 3 - Male Genes Differentially Expressed > 1.5-Fold Among Strains in E11.5 XY Gonads
    Supplemental Table 3 - Male genes differentially expressed > 1.5-fold among strains in E11.5 XY gonads. Male genes differentially expressed between C57BL/6J and 129S1/SvImJ. Note: Positive fold values reflect male genes that are up regulated in C57BL/6J relative to 129S1/SvImJ. Fold Diff Gene symbol Genbank acc Description 10.77 Gcnt1 NM_173442 Mus musculus glucosaminyl (N-acetyl) transferase 1, core 2 (Gcnt1), mRNA [NM_173442] 5.50 Afp NM_007423 Mus musculus alpha fetoprotein (Afp), mRNA [NM_007423] 4.95 Hnf4a NM_008261 Mus musculus hepatic nuclear factor 4, alpha (Hnf4a), mRNA [NM_008261] 4.71 Ppp1r14c AK082372 Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230042N14 product:hypothetical protein, full insert sequence. [AK082372] 4.41 Gorasp2 AK020521 Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430094F20 product:inferred: golgi reassembly stacking protein 2, full insert sequence. [AK020521] 3.69 Tmc7 NM_172476 Mus musculus transmembrane channel-like gene family 7 (Tmc7), mRNA [NM_172476] 2.97 Mt2 NM_008630 Mus musculus metallothionein 2 (Mt2), mRNA [NM_008630] 2.62 Gstm6 NM_008184 Mus musculus glutathione S-transferase, mu 6 (Gstm6), mRNA [NM_008184] 2.43 Adhfe1 NM_175236 Mus musculus alcohol dehydrogenase, iron containing, 1 (Adhfe1), mRNA [NM_175236] 2.38 Txndc2 NM_153519 Mus musculus thioredoxin domain containing 2 (spermatozoa) (Txndc2), mRNA [NM_153519] 2.30 C030038J10Rik AK173336 Mus musculus mRNA for mKIAA2027
    [Show full text]
  • Characterization of Glomerular Extracellular Matrix in Iga Nephropathy by Proteomic Analysis of Laser-Captured Microdissected Gl
    Paunas et al. BMC Nephrology (2019) 20:410 https://doi.org/10.1186/s12882-019-1598-1 RESEARCH ARTICLE Open Access Characterization of glomerular extracellular matrix in IgA nephropathy by proteomic analysis of laser-captured microdissected glomeruli Flavia Teodora Ioana Paunas1,2* , Kenneth Finne2, Sabine Leh2,3, Tarig Al-Hadi Osman2, Hans-Peter Marti2,4, Frode Berven5 and Bjørn Egil Vikse1,2 Abstract Background: IgA nephropathy (IgAN) involves mesangial matrix expansion, but the proteomic composition of this matrix is unknown. The present study aimed to characterize changes in extracellular matrix in IgAN. Methods: In the present study we used mass spectrometry-based proteomics in order to quantitatively compare protein abundance between glomeruli of patients with IgAN (n = 25) and controls with normal biopsy findings (n = 15). Results: Using a previously published paper by Lennon et al. and cross-referencing with the Matrisome database we identified 179 extracellular matrix proteins. In the comparison between IgAN and controls, IgAN glomeruli showed significantly higher abundance of extracellular matrix structural proteins (e.g periostin, vitronectin, and extracellular matrix protein 1) and extracellular matrix associated proteins (e.g. azurocidin, myeloperoxidase, neutrophil elastase, matrix metalloproteinase-9 and matrix metalloproteinase 2). Periostin (fold change 3.3) and azurocidin (3.0) had the strongest fold change between IgAN and controls; periostin was also higher in IgAN patients who progressed to ESRD as compared to patients who did not. Conclusion: IgAN is associated with widespread changes of the glomerular extracellular matrix proteome. Proteins important in glomerular sclerosis or inflammation seem to be most strongly increased and periostin might be an important marker of glomerular damage in IgAN.
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Proteomics of Serum Extracellular Vesicles Identifies a Novel COPD Biomarker, Fibulin-3 from Elastic Fibres
    ORIGINAL ARTICLE COPD Proteomics of serum extracellular vesicles identifies a novel COPD biomarker, fibulin-3 from elastic fibres Taro Koba 1, Yoshito Takeda1, Ryohei Narumi2, Takashi Shiromizu2, Yosui Nojima 3, Mari Ito3, Muneyoshi Kuroyama1, Yu Futami1, Takayuki Takimoto4, Takanori Matsuki1, Ryuya Edahiro1, Satoshi Nojima5, Yoshitomo Hayama1, Kiyoharu Fukushima1, Haruhiko Hirata1, Shohei Koyama1, Kota Iwahori1, Izumi Nagatomo1, Mayumi Suzuki1, Yuya Shirai1, Teruaki Murakami1, Kaori Nakanishi 1, Takeshi Nakatani1, Yasuhiko Suga1, Kotaro Miyake1, Takayuki Shiroyama1, Hiroshi Kida 1, Takako Sasaki6, Koji Ueda7, Kenji Mizuguchi3, Jun Adachi2, Takeshi Tomonaga2 and Atsushi Kumanogoh1 ABSTRACT There is an unmet need for novel biomarkers in the diagnosis of multifactorial COPD. We applied next-generation proteomics to serum extracellular vesicles (EVs) to discover novel COPD biomarkers. EVs from 10 patients with COPD and six healthy controls were analysed by tandem mass tag-based non-targeted proteomics, and those from elastase-treated mouse models of emphysema were also analysed by non-targeted proteomics. For validation, EVs from 23 patients with COPD and 20 healthy controls were validated by targeted proteomics. Using non-targeted proteomics, we identified 406 proteins, 34 of which were significantly upregulated in patients with COPD. Of note, the EV protein signature from patients with COPD reflected inflammation and remodelling. We also identified 63 upregulated candidates from 1956 proteins by analysing EVs isolated from mouse models. Combining human and mouse biomarker candidates, we validated 45 proteins by targeted proteomics, selected reaction monitoring. Notably, levels of fibulin-3, tripeptidyl- peptidase 2, fibulin-1, and soluble scavenger receptor cysteine-rich domain-containing protein were significantly higher in patients with COPD.
    [Show full text]
  • Clonally Expanding Smooth Muscle Cells Promote Atherosclerosis by Escaping Efferocytosis and Activating the Complement Cascade
    Clonally expanding smooth muscle cells promote atherosclerosis by escaping efferocytosis and activating the complement cascade Ying Wanga,b, Vivek Nandaa,b,c, Daniel Direnzoa, Jianqin Yea, Sophia Xiaoa, Yoko Kojimaa, Kathryn L. Howea, Kai-Uwe Jarra, Alyssa M. Floresa, Pavlos Tsantilasa, Noah Tsaoa, Abhiram Raob,d, Alexandra A. C. Newmane, Anne V. Eberharda, James R. Priestf, Arno Ruusaleppg, Gerard Pasterkamph,i, Lars Maegdefesselj,k, Clint L. Millerl,m,n, Lars Lindo, Simon Koplevp, Johan L. M. Björkegrenp, Gary K. Owense, Erik Ingelssonb,o,q, Irving L. Weissmanr,1, and Nicholas J. Leepera,b,1 aDivision of Vascular Surgery, Department of Surgery, Stanford University School of Medicine, Stanford, CA 94305; bStanford Cardiovascular Institute, Stanford University, Stanford, CA 94305; cDepartment of Molecular and Cellular Pathology, University of Alabama at Birmingham, Birmingham, AL 35294; dDepartment of Bioengineering, Stanford University, Stanford, CA 94305; eRobert M. Berne Cardiovascular Research Center, University of Virginia, Charlottesville, VA 22904; fDivision of Pediatric Cardiology, Department of Pediatrics, Stanford University School of Medicine, Stanford, CA 94305; gDepartment of Cardiac Surgery, Tartu University Hospital, Tartu, Estonia 50406; hDepartment of Cardiology, University Medical Center Utrecht, 3584CX Utrecht, the Netherlands; iLaboratory of Clinical Chemistry, University Medical Center Utrecht, 3584CX Utrecht, the Netherlands; jDepartment for Vascular and Endovascular Surgery, Klinikum Rechts der Isar, Technical University
    [Show full text]
  • Download Author Version (PDF)
    Biomaterials Science Cell -derived matrices for tissue engineering and regenerative medicine applications Journal: Biomaterials Science Manuscript ID: BM-REV-07-2014-000246.R1 Article Type: Review Article Date Submitted by the Author: 19-Aug-2014 Complete List of Authors: Fitzpatrick, Lindsay; Queen's University, Department of Chemical Engineering McDevitt, Todd; Georgia Institute of Technology, Wallace H. Coulter Department of Biomedical Engineering Page 1 of 33 Biomaterials Science Cell-derived matrices for tissue engineering and regenerative medicine applications 1 Lindsay E. Fitzpatrick a*, Todd C. McDevitt b,c aDepartment of Chemical Engineering, Queen's University, Kingston, Canada; bThe Wallace H. Coulter Department of Biomedical Engineering, Georgia Institute of Technology/Emory University, Atlanta, Georgia, USA; cThe Parker H. Petit Institute for Bioengineering and Bioscience, Georgia Institute of Technology, Atlanta, Georgia, USA. Corresponding Author (*): Dr. Lindsay E. Fitzpatrick Assistant Professor Department of Chemical Engineering Queen’s University 19 Division St, Room 302 Kingston, Ontario, Canada, K7K 3N6 E-mail: [email protected] Biomaterials Science Page 2 of 33 Abstract The development and application of decellularized extracellular matrices (ECM) has grown rapidly in the fields of cell biology, tissue engineering and regenerative medicine in recent years. Similar to decellularized tissues and whole organs, cell-derived matrices (CDMs) represent bioactive, biocompatible materials consisting of a complex assembly of fibrillar proteins, matrix macromolecules and associated growth factors that often recapitulate, at least to some extent, the composition and organization of native ECM microenvironments. The unique ability to engineer CDMs de novo based on cell source and culture methods makes them an attractive alternative to conventional allogeneic and xenogeneic tissue-derived matrices that are currently harvested from cadaveric sources, suffer from inherent heterogeneity, and have limited ability for customization.
    [Show full text]
  • Investigating Developmental and Functional Deficits in Neurodegenerative
    UNIVERSITY OF CALIFORNIA, IRVINE Investigating developmental and functional deficits in neurodegenerative disease using transcriptomic analyses DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biomedical Sciences by Ryan Gar-Lok Lim Dissertation Committee: Professor Leslie M. Thompson, Chair Assistant Professor Dritan Agalliu Professor Peter Donovan Professor Suzanne Sandmeyer 2016 Introduction, Figure 1.1 © 2014 Macmillan Publishers Limited. Appendix 1 © 2016 Elsevier Ltd. All other materials © 2016 Ryan Gar-Lok Lim DEDICATION This dissertation is dedicated to my parents, sister, and my wife. I love you all very much and could not have accomplished any of this without your love and support. Please take the time to reflect back on all of the moments we’ve shared, and know, that it is because of those moments I have been able to succeed. This accomplishment is as much yours as it is mine. ii TABLE OF CONTENTS Page LIST OF FIGURES vi LIST OF TABLES ix ACKNOWLEDGMENTS x CURRICULUM VITAE xiii ABSTRACT OF THE DISSERTATION xv Introduction Huntington’s disease, the neurovascular unit and the blood-brain barrier 1 1.1 Huntington’s Disease 1.2 HTT structure and function 1.2.1 Normal HTT function and possible loss-of-function contributions to HD 1.3 mHTT pathogenesis 1.3.1 The dominant pathological features of mHTT - a gain-of- toxic function? 1.3.2 Cellular pathologies and non-neuronal contributions to HD 1.4 The neurovascular unit and the blood-brain barrier 1.4.1 Structure and function
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Fibulin-1 Regulates the Pathogenesis of Tissue Remodeling in Respiratory Diseases
    Fibulin-1 regulates the pathogenesis of tissue remodeling in respiratory diseases Gang Liu, … , Janette K. Burgess, Philip M. Hansbro JCI Insight. 2016;1(9):e86380. https://doi.org/10.1172/jci.insight.86380. Research Article Cell biology Immunology Airway and/or lung remodeling, involving exaggerated extracellular matrix (ECM) protein deposition, is a critical feature common to pulmonary diseases including chronic obstructive pulmonary disease (COPD), asthma, and idiopathic pulmonary fibrosis (IPF). Fibulin-1 (Fbln1), an important ECM protein involved in matrix organization, may be involved in the pathogenesis of these diseases. We found that Fbln1 was increased in COPD patients and in cigarette smoke– induced (CS-induced) experimental COPD in mice. Genetic or therapeutic inhibition of Fbln1c protected against CS- induced airway fibrosis and emphysema-like alveolar enlargement. In experimental COPD, this occurred through disrupted collagen organization and interactions with fibronectin, periostin, and tenascin-c. Genetic inhibition of Fbln1c also reduced levels of pulmonary inflammatory cells and proinflammatory cytokines/chemokines (TNF-α, IL-33, and CXCL1) in experimental COPD. Fbln1c–/– mice also had reduced airway remodeling in experimental chronic asthma and pulmonary fibrosis. Our data show that Fbln1c may be a therapeutic target in chronic respiratory diseases. Find the latest version: https://jci.me/86380/pdf RESEARCH ARTICLE Fibulin-1 regulates the pathogenesis of tissue remodeling in respiratory diseases Gang Liu,1 Marion A. Cooley,2 Andrew G. Jarnicki,1 Alan C-Y. Hsu,1 Prema M. Nair,1 Tatt Jhong Haw,1 Michael Fricker,1 Shaan L. Gellatly,1 Richard Y. Kim,1 Mark D. Inman,3 Gavin Tjin,4 Peter A.B.
    [Show full text]
  • Single-Cell Transcriptomes Reveal a Complex Cellular Landscape in the Middle Ear and Differential Capacities for Acute Response to Infection
    fgene-11-00358 April 9, 2020 Time: 15:55 # 1 ORIGINAL RESEARCH published: 15 April 2020 doi: 10.3389/fgene.2020.00358 Single-Cell Transcriptomes Reveal a Complex Cellular Landscape in the Middle Ear and Differential Capacities for Acute Response to Infection Allen F. Ryan1*, Chanond A. Nasamran2, Kwang Pak1, Clara Draf1, Kathleen M. Fisch2, Nicholas Webster3 and Arwa Kurabi1 1 Departments of Surgery/Otolaryngology, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States, 2 Medicine/Center for Computational Biology & Bioinformatics, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States, 3 Medicine/Endocrinology, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States Single-cell transcriptomics was used to profile cells of the normal murine middle ear. Clustering analysis of 6770 transcriptomes identified 17 cell clusters corresponding to distinct cell types: five epithelial, three stromal, three lymphocyte, two monocyte, Edited by: two endothelial, one pericyte and one melanocyte cluster. Within some clusters, Amélie Bonnefond, Institut National de la Santé et de la cell subtypes were identified. While many corresponded to those cell types known Recherche Médicale (INSERM), from prior studies, several novel types or subtypes were noted. The results indicate France unexpected cellular diversity within the resting middle ear mucosa. The resolution of Reviewed by: Fabien Delahaye, uncomplicated, acute, otitis media is too rapid for cognate immunity to play a major Institut Pasteur de Lille, France role. Thus innate immunity is likely responsible for normal recovery from middle ear Nelson L. S. Tang, infection. The need for rapid response to pathogens suggests that innate immune The Chinese University of Hong Kong, China genes may be constitutively expressed by middle ear cells.
    [Show full text]
  • Original Article Potential Targets and Clinical Value of Mir-490-5P in Hepatocellular Carcinoma: a Study Based on TCGA, Qrt-PCR and Bioinformatics Analyses
    Int J Clin Exp Pathol 2018;11(3):1123-1134 www.ijcep.com /ISSN:1936-2625/IJCEP0070742 Original Article Potential targets and clinical value of miR-490-5p in hepatocellular carcinoma: a study based on TCGA, qRT-PCR and bioinformatics analyses Hong Yang1*, Lu Zhang2*, Xiao-Dong Wang1, Meng-Lan Huang2, Peng Lin1, Yu-Yan Pang2, Zhen-Bo Feng2, Gang Chen2 Departments of 1Medical Ultrasonics, 2Pathology, The First Affiliated Hospital of Guangxi Medical University, Nanning, People’s Republic of China. *Equal contributors. Received December 11, 2017; Accepted January 7, 2018; Epub March 1, 2018; Published March 15, 2018 Abstract: Objective: To explore potential targets and clinical value of miR-490-5p in the oncogenesis and progres- sion of hepatocellular carcinoma (HCC). Methods: Clinical value of miR-490-5p was accessed through The Cancer Genome Atlas (TCGA) and qRT-PCR analyses. Potential target mRNAs of miR-490-5p were predicted by bioinfor- matics methods and were annotated as Gene Ontology (GO) function analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) signaling pathway analysis, and Protein-Protein Interaction (PPI) network analysis. Results: miR- 490 expression in HCC tissues was lower compared with normal control tissues based on TCGA and down regula- tion of miR-490-5p was verified by qRT-PCR (P<0.0001). Both miR-490 and miR-490-5p had moderate ability to diagnose HCC tissues from noncancerous tissues. Moreover, lower miR-490 level predicted poorer overall survival in patients with HCC (P=0.0063). One hundred and eighty-four mRNAs were selected as potential targets of miR- 490-5p by overlap with 4,090 prediction genes and 1,478 differentially expressed genes (DEGs).
    [Show full text]
  • Fibroblasts from the Human Skin Dermo-Hypodermal Junction Are
    cells Article Fibroblasts from the Human Skin Dermo-Hypodermal Junction are Distinct from Dermal Papillary and Reticular Fibroblasts and from Mesenchymal Stem Cells and Exhibit a Specific Molecular Profile Related to Extracellular Matrix Organization and Modeling Valérie Haydont 1,*, Véronique Neiveyans 1, Philippe Perez 1, Élodie Busson 2, 2 1, 3,4,5,6, , Jean-Jacques Lataillade , Daniel Asselineau y and Nicolas O. Fortunel y * 1 Advanced Research, L’Oréal Research and Innovation, 93600 Aulnay-sous-Bois, France; [email protected] (V.N.); [email protected] (P.P.); [email protected] (D.A.) 2 Department of Medical and Surgical Assistance to the Armed Forces, French Forces Biomedical Research Institute (IRBA), 91223 CEDEX Brétigny sur Orge, France; [email protected] (É.B.); [email protected] (J.-J.L.) 3 Laboratoire de Génomique et Radiobiologie de la Kératinopoïèse, Institut de Biologie François Jacob, CEA/DRF/IRCM, 91000 Evry, France 4 INSERM U967, 92260 Fontenay-aux-Roses, France 5 Université Paris-Diderot, 75013 Paris 7, France 6 Université Paris-Saclay, 78140 Paris 11, France * Correspondence: [email protected] (V.H.); [email protected] (N.O.F.); Tel.: +33-1-48-68-96-00 (V.H.); +33-1-60-87-34-92 or +33-1-60-87-34-98 (N.O.F.) These authors contributed equally to the work. y Received: 15 December 2019; Accepted: 24 January 2020; Published: 5 February 2020 Abstract: Human skin dermis contains fibroblast subpopulations in which characterization is crucial due to their roles in extracellular matrix (ECM) biology.
    [Show full text]