ORIGINAL RESEARCH

Thyroid Hormone Increases Bulk Expression by Enhancing Translational Efficiency

Alberto Zambrano,* Verónica García-Carpizo,* Raquel Villamuera, and Ana Aranda

Instituto de Investigaciones Biomédicas “Alberto Sols,” Consejo Superior de Investigaciones Científicas and Universidad Autónoma de Madrid, 28029 Madrid, Spain Downloaded from https://academic.oup.com/mend/article/29/1/68/2556825 by guest on 02 October 2021 The expression of canonical histones is normally coupled to DNA synthesis during the of the . Replication-dependent mRNAs do not contain a poly(A) tail at their 3Ј terminus, but instead possess a stem-loop motif, the binding site for the stem-loop binding (SLBP), which regulates mRNA processing, stability, and relocation to polysomes. Here we show that the thyroid hormone can increase the levels of canonical histones independent of DNA replication. Incubation of

mouse embryonic fibroblasts with T3 increases the total levels of histones, and expression of the thyroid hormone receptor ␤ induces a further increase. This is not restricted to mouse embryonic

fibroblasts, because T3 also raises histone expression in other cell lines. T3 does not increase histone

mRNA or SLBP levels, suggesting that T3 regulates histone expression by a posttranscriptional mech-

anism. Indeed, T3 enhanced translational efficiency, inducing relocation of histone mRNA to heavy polysomes. Increased was associated with augmented of the eukaryotic ␥ translation initiation factor 4 2 (EIF4G2). T3 induced EIF4G2 protein and mRNA levels and the thyroid hormone receptor bound to the region of the Eif4g2 . Induction of EIF4G2 was essential

for T3-dependent histone induction, because depletion of this factor abolished histone increase. These results point out the importance of the thyroid hormones on the posttranscriptional regulation of histone biosynthesis in a cell cycle–independent manner and also suggest the potential regulation of eukaryotic translation by the modulation of the initiation factor EIF4G2, which also operates in the translation of canonical mRNAs. (Molecular Endocrinology 29: 68–75, 2015)

ucleosomes, which fold chromosomal DNA, contain Canonical histones, ie, the four core histones as well as N2 molecules each of the core histones H2A, H2B, H3, the linker H1 histone found between nucleosomes, are and H4 (1). Histones are subjected to a great variety of encoded by a family of replication-dependent histone posttranslational modifications, which normally occur . In most cells, the expression of cell cycle–regulated on the amino-terminal and carboxy-terminal histone histone mRNAs is tightly coupled to DNA synthesis oc- “tail” domains, which play an essential role in controlling curring during the S phase. This is achieved by the precise , DNA repair, or condensa- regulation of mRNA synthesis, processing, and stability tion (2). Maintenance of chromosomal integrity requires ac- (5, 6). Replication-dependent histone mRNAs are the curate coordination of DNA replication with histone syn- only known cellular mRNAs that do not contain a thesis (3). Both histone excess and deficiency can have poly(A) tail at their 3Ј terminus, but instead exhibit a deleterious effects, and the cells have developed multiple stem-loop structure that is highly conserved. This stem- regulatory systems to control histone levels. Thus, mamma- loop motif is the binding site for the stem-loop binding lian cells sequester the excess of histones accumulating dur- protein (SLBP), which regulates pre-mRNA processing, ing replication stress, and the histone chaperone Asf1 (anti- mRNA stability, and localization of the mRNA to polyri- silencing function 1) plays a key role in this process (4). bosomes (polysomes) (7, 8). Although histone mRNAs

ISSN Print 0888-8809 ISSN Online 1944-9917 * A.Z. and V.G.-C. contributed equally to the study. Printed in U.S.A. Abbreviations: ChIP, chromatin immunoprecipitation; EIF4G, eukaryotic translation initi- Copyright © 2015 by the Endocrine Society ation factor 4 ␥; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MEFs, mouse Received July 31, 2014. Accepted November 20, 2014. embryo fibroblasts; qRT-PCR, quantitative real-time PCR; siRNA, small-interfering RNA; First Published Online November 25, 2014 SLBP, stem-loop binding protein; SLIP1 (MIF4GD), SLBP-binding protein 1; THR, thyroid hormone receptor; TRE, thyroid hormone response element.

68 mend.endojournals.org Mol Endocrinol, January 2015, 29(1):68–75 doi: 10.1210/me.2014-1235 doi: 10.1210/me.2014-1235 mend.endojournals.org 69

have a different 3Ј end than the polyadenylated mRNAs, Materials and Methods they can be efficiently translated by a similar mechanism and with a similar efficiency. At the 5Ј mRNA, the cap Cell culture, transfections, and chemical reagents Immortal mouse embryonic fibroblasts (MEFs) obtained binding subunit eukaryotic initiation factor 4E interacts from TP53-knockout mice were a gift from M. Serrano (CNIO). with the scaffold protein eukaryotic translation initiation MEFs expressing either the thyroid hormone receptor ␤1 factor 4 ␥ (EIF4G). The 3Ј histone mRNA end is the (THRB) or ␣1 (THRA) isoforms in an stable manner were ob- binding site of SLBP and SLBP-binding protein 1 (SLIP1). tained as described previously by retroviral transduction and SLIP1 interacts with EIF4G, acting as a bridge between posterior selection with puromycin (15). Spontaneously immor- talized MEFs obtained from knockout mice lacking both Thr the 2 mRNA ends mediating the mRNA circularization genes were a gift from J. Samarut (Lyon, France). These cells and thus enhancing translation efficiency (9). In addition, were also transduced with THRB or THRA (15). Parental NIH- histone mRNAs are bound to polysomes through SLBP, 3T3 cells and cells expressing THRB in a stable manner were Downloaded from https://academic.oup.com/mend/article/29/1/68/2556825 by guest on 02 October 2021 also allowing high translational efficiencies (10). described previously (16). The rat pituitary cell line GH4C1 and the colocarcinoma cell line HCT-116 were also used. The thyroid hormones (THs) T3 and its precursor T4, are essential for growth and development. Among other Cells were grown under standard conditions in DMEM supple- mented with 10% fetal bovine serum, 2 mM glutamine, and functions, they increase the basal metabolic rate and af- antibiotics. Before hormone treatment, cells were grown in me- fect almost every aspect of cellular physiology as a result dium containing 10% TH–depleted fetal bovine serum by treat- of their actions on fat, carbohydrate, and protein metab- ment with resin AG-1-X8 (Bio-Rad). Cells were plated at a 2 olism (11). THs largely exert their actions through the density of 16 000/cm and incubated for the times indicated in the presence or absence of T or GC-1 (5 nM). siRNA transfec- binding to nuclear thyroid hormone receptors (THRs), 3 tions were performed by using the TransIT-X2 reagent (Myrus), which normally regulate gene expression by binding to following the manufacturer’s instructions. siRNA duplexes thyroid hormone response elements (TREs) located in SR30004 (control) and SR421103A, B, and C (mouse Eif4g2) regulatory regions of target genes (12, 13). There are 2 were purchased from Origene. genes encoding THRs (THRA and THRB) and 4 THR isoforms designated THRA1, THRB1, THRB2, and Protein extraction, Western blotting, and acidic THRB3 that are able to bind hormone. THRA1 is widely extraction of histones expressed, showing higher levels of expression in brain, Cells were harvested and lysed in triple-detergent lysis buffer (50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.02% sodium cardiac, and skeletal tissue. THRB1 is predominantly ex- azide, 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate, 1 pressed in brain, liver, and kidney. THRB2 expression is mM phenylmethylsulfonylfluoride, 2 ␮g/mL pepstatin, 2 ␮g/mL circumscribed to hypothalamus, pituitary, retina, and in- aprotinin, 2 ␮g/mL leupeptin, and phosphatase inhibitor cock- ner ear, and THRB3 is predominantly expressed in kid- tails 2 and 3 (Sigma-Aldrich). Next, 10 ␮g of protein lysates ney, liver, and lungs (12–14). were mixed with Laemmli sample buffer, boiled, and loaded onto 8% or 12% SDS-PAGE. Western blotting and protein Although the regulation of DNA synthesis and cell detection were performed as described previously (15). Anti- growth by THs has been known for decades, little is bodies used were tubulin (clone DM1A; Sigma-Aldrich T6199), known about their actions on histone expression during H3 and H4, (Abcam ab1791 and ab10158), EIF4G2 (donated or outside the S phase of the cell cycle. Here we describe by C. de Haro (CBM, Madrid, Spain), and anti-SLBP (donated the effects of TH on bulk histone levels in various cell by W.F. Marzluff, University of North Carolina, Chapel Hill, North Carolina). Acid extraction of histones and electrophore- models. TH treatment and the overexpression of THRB1 sis were performed as described previously (17). induced an increase in histone levels not coupled to DNA synthesis. Regulation occurred by a posttranscriptional Polysome separation mechanism. TH treatment did not change the amount of Separation of free and ribosome-bound mRNA was per- histone mRNAs but increased the amount of histone mR- formed by centrifugation in linear sucrose gradients. Cells were NAs bound to polysomes. TH induced the expression of harvested, washed with 1ϫ PBS, and lysed in a mixture contain- ing 1 mL of ice-cold NP-40 buffer (10 mM Tris-HCl [pH 8], 140 EIF4G2 (also known as aging-associated protein 1), 1 of ␮ mM NaCl, 1.5 mM MgCl2, and 0.5% NP-40), 20 Lof1M the 2 isoforms of EIF4G with essential roles in histone dithiothreitol, 10 ␮Lof40U/␮L RNasin (Invitrogen), and 100 biosynthesis. The analysis of the Eif4g2 promoter by ␮L of 5% sodium deoxycholate. Lysates were centrifuged dur- chromatin immunoprecipitation (ChIP) showed the spe- ing 10 seconds at 13 000 rpm, and supernatants were trans- cific binding of THRB to a region upstream to the tran- ferred to a new tube containing 13.3 ␮L of heparin (50 mg/mL), ␮ ␮ scriptional initiation site of the Eif4g2 gene. Moreover, 15 L of 10 mg/mL cycloheximide, and 10 l of 0.1 M phenyl- methylsulfonylfluoride. This mixture was centrifuged for 5 min- the depletion of Eif4g2 by means of small interfering utes at 13 000 rpm, and the supernatant was layered onto a RNA (siRNA) prevented the TH-mediated induction of sucrose gradient (15%–40% [w/v]) supplemented with 10 mM

histone expression. Tris-HCl (pH 7.5), 140 mM NaCl, 1.5 mM Mg2Cl, 10 mM 70 Zambrano et al T3 Increases Histone Expression Mol Endocrinol, January 2015, 29(1):68–75

dithiothreitol, 100 ␮g/mL cycloheximide, and 0.5 mg/mL hep- Results arin. Gradients were centrifuged for 90 minutes at 4°C in an

SW41 rotor at 39 000 rpm and fractionated into 20 fractions in T3 increases bulk histone levels tubes containing 10 ␮L of 10 mg/mL Proteinase K, 25 ␮Lof MEFs express THRs (both THRA and THRB) and ␮ 20% SDS, and 12 L of 0.5 M EDTA (pH 8). Fractions were respond to TH (15). We have previously reported the extracted once with phenol-chloroform, and the RNA was pre- cipitated overnight at Ϫ80°C with ethanol, glycogen, and 0.3 M characterization of MEFs in terms of occurrence of DNA damage and cellular senescence upon exposure to T (15). sodium acetate. Precipitated RNAs were dissolved in H2O, 3 quantified, and analyzed by quantitative real-time PCR We have also observed that the overexpression of THRB (qRT-PCR). in MEFs drastically exacerbated those effects. In the course of the molecular characterization of those phe- qRT-PCR nomena, we observed an unexpected and rapid increase in RNA extraction, reverse transcription, and qRT-PCR were the bulk of histones upon T treatment. As shown in Downloaded from https://academic.oup.com/mend/article/29/1/68/2556825 by guest on 02 October 2021 performed as described previously (15). The sequences of the 3 oligonucleotides used in this study were the following: glyceral- Figure 1A, a 48-hour treatment with T3 induced the ex- dehyde-3-phosphate dehydrogenase (GAPDH), 5Ј-ACAGTC- pression of histones H3 and H4 in immortalized MEFs CATGCCATCACTGCC-3Ј (forward) and 5Ј-GCCTGCTT lacking TP53, and the overexpression of THRB signifi- CACCACCTTCTTG-3Ј (reverse); 18S, 5Ј-GTAACCCGTTG cantly magnified this effect. Surprisingly, the T -depen- Ј Ј 3 AACCCCATT-3 (forward) and 5 -CCATCCAATCGGT dent increase in histone levels was not associated with an AGTAGCG-3Ј (reverse); H3, 5Ј-AGTGCTCACCAGCTT elevation in the expression of SLBP, a key regulator of GCTTT-3Ј (forward) and 5Ј-GCTCGGTCGACTTCTG GTAG-3Ј (reverse); and H4, 5Ј-AGGTTCTCCGCGATAA histone biosynthesis (6). The enrichment in histone bulk CATC-3Ј (forward) and 5Ј-GTGCTCCGTGTAGGTGACG-3Ј mediated by the receptor suggested biosynthesis altera- (reverse). tions rather than technical artifacts. This prompted us to purify total histones by acidic extraction and to analyze ChIP assay them by gel electrophoresis. As shown in Figure 1B, when Cells were plated in 150-mm dishes and on the next day were histones from a similar number of cells were applied to the treated with 2.5 ␮M ␣-amanitin (A2263; Sigma-Aldrich) in se- rum-free medium for 2.5 hours. Cells were then washed and gel, the content of all core histones (H2A, H2B, H3, and H4) and that of the linker histone H1 were significantly treated with 5 nM T3 for 2 hours, fixed and lysed following the specifications of the Upstate kit (catalog no. 17–295), and son- higher in THRB-expressing cells than in control cells. icated in a Bioruptor UCD-200TM (Diagenode). In each immu- Therefore, all canonical histones are induced in MEFs by ϫ 6 ␮ noprecipitation, 2 to 3 10 cells and 2 g of the following the receptor. To analyze whether histone induction could were used: normal rabbit IgGs (sc-2027; Santa Cruz also be mediated by THRA, we incubated MEFs with the Biotechnology, Inc), H3 (ab1791; Abcam), and anti-THRB se- rum (described in Ref. 15). DNA was purified and precipitated. THRB-specific ligand GC-1. As illustrated in Figure 1C, Immunoprecipitated DNA was used for qRT-PCR amplifica- GC-1 was as effective as T3 in inducing histone levels in

tion of the regions encompassing the mouse Eif4g2 promoter MEFs. Furthermore, T3 increased histone H3 and histone from Ϫ647 to Ϫ352 and from Ϫ199 to Ϫ41 with respect to the H4 in THR-knockout MEFs transduced with THRB, but Ј transcription initiation site, The primers used were 5 -AAA- not with THRA, indicating that only THRB mediates the CACTTCTCAAGCCAGCC-3Ј (forward) and 5Ј-AAGAAC- CTTTTCCTCGCCTC-3Ј (reverse) for the distal region and 5Ј- ability of T3 to induce histone expression (Figure 1D). GCCTTCGCGAATATGGCTTT-3Ј (forward) and 5Ј- Incubation of NIH-3T3 cells, another murine cell line, Ј CGACCCACTAGAGCCTCC-3 (reverse) for the proximal with T3 for 48 hours did not produce histone induction. region. Results were normalized and are presented as a fraction This is not surprising because these cells express low THR of the input. levels and are unresponsive to T3 unless the receptor is expressed (16). However, the stable expression of THRB Cell cycle analysis also increased H3 and H4 levels very strongly in NIH-3T Cells were fixed and stained with propidium iodide under 3 standard conditions. Acquisition was carried out with a FAC- cells, even in the absence of exogenously added T3, and Scan system and software. Cell cycle analysis was performed by incubation with the hormone induced a further increase using ModFit 3.1 software, and the corresponding plots were (Figure 1E). We then extended the analysis to other non- prepared with FlowJo software. murine cells lines such as the rat pituitary cell line GH4C1, which expresses high endogenous levels of both Statistical analysis THR isoforms and is highly responsive to T3, and the The statistical significance of the data was determined by human colon carcinoma cell line HCT-116. Again, the applying a two-tailed Student t test.Pvalues of Ͻ.05 are con- sidered significant. Statistics were calculated with Prism 5 soft- treatment with T3 gave rise to a significant increase in ware (GraphPad Software). All results are presented in the fig- histone levels (Figure 1F), suggesting a common and con- ures as means Ϯ SD. served phenomenon. Furthermore, GC-1 also increased doi: 10.1210/me.2014-1235 mend.endojournals.org 71

A B the results obtained after incubation MEFs MEFs vectorTHRB with hydroxyurea, which promotes vector THRB KDa fork stalling and induces DNA rep- H3 15 lication stress arresting cells in the S H4 10 phase, T3-treated and THRB-ex- H1 SLBP H3 pressing cells exhibited significant 50 H2B H2A G0/G1 arrest, dismissing the possi- 50 H4 T3: - + - + bility that the differences in the his- tone bulk were due to S phase arrest C MEFs D (Figure 2). This result was consistent KDa MEFs-THRA MEFs-THRB H3 H3 15 15 with the observed expression of H4 15 H4 15 SLBP, which remained unchanged Downloaded from https://academic.oup.com/mend/article/29/1/68/2556825 by guest on 02 October 2021 α α -TUB 50 -TUB 50 under the different conditions (Fig- - T3 GC1 - T3 - T3 ure 1A), ruling out the possibility NIH-3T3 EFGGH4C1 that the alterations in histone con- vector THRB KDa HCT-116 KDa KDa tent were due to biosynthesis events H3 15 H3 15 H3 15 H4 normally occurring during DNA H4 10 H4 15 10 replication. α α-TUB α -TUB 50 50 -TUB 50 To determine the molecular T3: - + - T3 GC1 T3: - + - + mechanisms behind this effect, we Figure 1. Effects of TH on the expression of histones. A, Western blot analysis of the levels of quantified the mRNA levels of rep- histones H3 and H4 and the SLBP in MEFs. Cells were treated in the presence or absence of 5 nM resentative histones in T3-treated T for 48 hours before protein extraction. Vector, cells stably transfected with an empty vector; 3 and untreated MEFs (Figure 3A). THRB, cells stably transfected with a THRB vector. ␣-Tubulin was used as a loading control. B, Total histones from 7 ϫ 105 control and THRB-expressing MEFs were purified by acidic We found no significant differences extraction. Samples were loaded onto an SDS-PAGE gel and stained subsequently with between the 2 conditions, suggesting Coomassie Blue. C, Western blots of histones H3 and H4 in MEFs treated with equal amounts of a posttranscriptional mechanism for T3 and GC-1 (5 nM). D, Histone levels in control and T3-treated THR-knockout MEFs stably T3 induction of histone protein lev- transfected with THRB or THRA vectors. E, Levels of histone H3 and H4 in control and T3-treated NIH-3T3 cells. F, Histone levels of untreated and T3-treated GH4C1 cells. G, histone levels in HCT- els. The augmented histone protein ␣ ␣ 116 cells treated with T3 or GC-1. -Tubulin ( -TUB) was used as loading control. content without changes in histone mRNA levels could reflect an in- histone levels in HTC-116 cells, reinforcing the idea that creased histone half-life in T -treated cells. However, it is THRB is the receptor isoform responsible (Figure 1G). 3 known that histones can have extremely long half-lives (19, 20), making it very unlikely that a short treatment Effect of T on histone bulk is due to 3 with the hormone could lead to a detectable increase in posttranscriptional mechanisms bulk histone content. Furthermore, after cycloheximide Histone protein synthesis increases during the S phase treatment, we corroborated the observation that histones by transcriptional and posttranscriptional mechanisms to did not decay for an 8-hour period in the absence of new attain fast packing of the newly replicated DNA into protein synthesis and we did not find reduced histone chromatin (18). We then analyzed the possibility that the turnover in T -treated cells (Figure 3B). effect of T on histone abundance could be a consequence 3 3 After dismissing the possibility that T could increase of accumulation of cells in the S phase. However, the 3 histone mRNA levels or the histone protein half-life, the DNA profile of the MEFs showed that, in contrast with most likely explanation for the effect of the hormone was increased mRNA translational effi- A B control T3 THRB HU ciency. To demonstrate that transla- 5000 4000 G0/G1 S G2/M tion of histone mRNA is regulated 3000 control 60 11 28 T3 83 3 14 by T3, we next analyzed the distri-

Counts 2000 THRB 84 3 13 2c 1000 bution of histone H3 and H4 mR- HU 7 10 2 0 10 59 12 4c NAs on polyribosomes by sucrose 0 200 600 1000 0 200 600 1000 0 200 600 1000 0 200 600 1000 FL2-A FL2-A FL2-A FL2-A gradient ultracentrifugation. As Figure 2. T does not induce S phase arrest. A, Cell cycle analysis by flow cytometry of MEFs 3 shown in Figure 4A, the hormone treated for 24 hours with 5 nM T3 or with 0.1 mM hydroxyurea (HU). DNA contents were also measured in cells transfected with THRB. B, Distribution of cells (percentage) throughout the cell altered the distribution of H3 cycle phases. c, haploid number of . mRNA throughout the gradient. T3 72 Zambrano et al T3 Increases Histone Expression Mol Endocrinol, January 2015, 29(1):68–75

AB HTC-116 cells treated with GC-1 -T3 - T3 (Figure 5D). This finding indicates KDa +T3 that EIF4G2 induction by the hor- 1,5 H3 15 mone is not restricted to fibroblasts and that THRB is the receptor iso- 1,2 α-TUB 50 form that mediates the increased ex- 0,9 CHX (hours) 0 2 4 8 pression of the initiating factor. To confirm the relevance of + T3 0,6 EIF4G2 induction in the effects ex- H3 15 erted by the hormone on histone lev-

mRNA fold induction mRNA fold 0,3 els, we used siRNA-mediated silenc-

α Downloaded from https://academic.oup.com/mend/article/29/1/68/2556825 by guest on 02 October 2021 -TUB 50 ing. MEFs transfected with control siRNAs and treated with T showed H3 H4 CHX (hours) 0 2 4 8 3 the expected increase in the levels of Figure 3. T does not alter histone mRNA levels or histone turnover. A, Histone mRNA levels 3 EIF4G2 and of histone H3 after 48 were determined by qRT-PCR in control MEFs and in cells treated with T3 for 48 hours. B, Cells ␮ were treated with or without T3 for 24 hours before addition of 50 g/mL cycloheximide (CHX). hours. However, cells transfected H3 levels were analyzed by Western blotting at the times indicated for CHX treatment. ␣-Tubulin with Eif4g2-specific siRNA exhib- ␣ ( -TUB) was used as a loading control. ited a reduction in the levels of EIF4G2 with a concomitant reduc- increased mRNA levels in 3 high-density fractions, corre- tion in histone H3 levels (Figure 4E),

sponding with heavy polyribosomes, both expressed rel- indicating that EIF4G2 induction is required for the T3- ative to 18S RNA (Figure 4A) and to GAPDH mRNA, mediated increase in bulk histones. In the search for a used as a negative control (Figure 4C). GAPDH mRNA transcriptional mechanism responsible for this action of

showed a rather homogeneous distribution throughout T3, we explored the Eif4g2 promoter and performed the gradient that was not significantly altered in the pres- ChIP assays. Sequence analysis revealed the presence of 2

ence of T3 (Figure 4B). Similar results were obtained with putative half-sites of the TRE upstream from the tran- H4 mRNA translation, because T3 also increased the scription initiation site (Figure 5F). ChIP assays showed amount of mRNA associated with heavy polysomes (Fig- constitutive recruitment of THRB, which was further in- Ϫ Ϫ ure 4D). In contrast with the effect of T3, which caused a duced by T3, to the region 647/ 352 encompassing shift to the high-density fractions, after incubation with those elements, whereas H3 abundance was not altered hydroxyurea, H3 mRNA sedimented predominantly in by the hormone. The promoter region Ϫ199/Ϫ41 that low-density fractions, where no polysomal mRNA is does not contain putative elements was used as a negative present (Figure 4E). These results show conclusively that control, and, as illustrated in Figure 5G, THRB did not

histone mRNA translation is facilitated by T3. bind to this proximal region. This finding suggests tran- scriptional control of EIF4G2 expression by the THR by EIF4G2 is up-regulated by T3 binding of the receptor to the identified elements. Efficient translation of cell-cycle regulated histones with 3Ј stem-loop mRNAs requires specific factors such as SLBP and SLIP1 and the scaffold initiation factor Discussion EIF4G, also used for translation of polyadenylated mR- NAs. Two isoforms of EIF4G, EIF4G1 and EIF4G2, are Our results provide a mechanism of regulation of histone found in mammalian cells. We analyzed by qRT-PCR the mRNA translation by THs. Previous results from our lab-

effect of T3 on transcript levels of the key eukaryotic oratory described the effect of THs on DNA damage and translation initiation factors Eif4g1 and Eif4g2, and of cellular senescence in MEFs (15). The characterization of

Mif4gd (Slip1). The results shown in Figure 5A indicate the effect of T3 in these cells showed an unexpected in-

that T3 induced specifically the levels of Eif4g2 mRNA crease in the total amount of canonical histones. This after 24 hours of treatment. The expression of EIF4G2 phenomenon seems to be well conserved, as it was ob- protein was also analyzed by Western blotting, finding a served in cell lines from different species under the same

correlation with its mRNA levels (Figure 5B). T3 in- experimental conditions. The effect is mediated by THRB creased the Eif4g2 levels in THR-knockout MEFs trans- and not by THRA. duced with THRB, but not with THRA (Figure 5C). Chronic DNA damage due to telomere shortening dur- Moreover, this induction was also found in MEFs and in ing replicative senescence decreases histone H3 and H4 doi: 10.1210/me.2014-1235 mend.endojournals.org 73

A B GH4C1 cells, in which the hormone 4,0 4,0 promotes proliferation (24). There- 3,5 -T3 H3/18S mRNA 3,5 -T3 +T3 +T3 GAPDH/18S mRNA fore, cells must possess a mechanism 3,0 3,0 2,5 2,5 to buffer the pool of soluble histones 2,0 2,0 not incorporated into chromatin to 1,5 1,5 avoid the deleterious consequences Rel. mRNA levels Rel. 1,0 mRNA levels Rel. 1,0 of histone excess when TH signaling 0,5 0,5 is stimulated. Histone chaperones Fr: 1234567891011121314151617181920 Fr: 1 2 3 4 5 6 7 8 9 10 1112 13 14 15 16 17 18 19 20 such as Asf1, which provide a buff- Polysomal Polysomal 4,0 ering system for the histone excess C 4,0 D 3,5 generated in response replication 3,5 -T3 -T3 H4/GAPDH mRNA H3/GAPDH mRNA +T3 Downloaded from https://academic.oup.com/mend/article/29/1/68/2556825 by guest on 02 October 2021 +T3 3,0 3,0 stress (4), might also operate in this 2,5 2,5 process. 2,0 2,0 The expression of canonical his- 1,5 1,5

Rel. mRNA levels Rel. 1,0 tones is normally associated with Rel. mRNA levels Rel. 1,0 0,5 DNA synthesis occurring during the 0,5

Fr: 1234567891011121314151617181920 S phase of the cell cycle (6) and relies Fr: 1234567891011121314151617181920 Polysomal Polysomal on the binding of SLBP to the stem- loop structure of the 3Ј end of non- E 4,0 polyadenylated histones mRNAs. 3,5 -HU H3/GAPDH mRNA +HU 3,0 SLBP and histone mRNA levels are 2,5 rapidly increased as cells approach 2,0 the S phase and are reduced at its 1,5 conclusion (18, 25). Our results

Rel. mRNA levels Rel. 1,0 show that no significant changes in 0,5 SLBP levels occur upon T3 treatment Fr: 1234567891011121314151617181920 Polysomal and that the hormone induces cell cycle arrest in G /G , excluding the Figure 4. T3 increases translational efficiency of histone H3 and H4 mRNA. A, Distribution of 0 1 histone H3 mRNA relative to 18S RNA throughout a sucrose gradient was analyzed in control possibility that the alterations on hi- MEFs and in MEFs treated with T for 48 hours. After the cell lysis, the cytoplasmic fraction was 3 stone expression were associated loaded onto a sucrose gradient and fractionated by centrifugation, the RNA of each fraction was purified and analyzed for H3 mRNA and 18S RNA levels by qRT-PCR. The figure shows 20 with S phase arrest. In addition, we fractions (Fr) collected from the top of the gradient. The bottom fractions correspond to heavy observed no differences in histone polysomes. B, GAPDH mRNA relative to 18S RNA values in the same fractions, C, Relative histone degradation. These data and the fact H3 mRNA values with respect to the GAPDH mRNA levels shown in B. D, Histone H4 mRNA relative to GAPDH mRNA values. E, Distribution of histone H3 mRNA in cells treated with 0.1 mM that the half-lives of histones can be hydroxyurea (HU) for 48 hours. extremely long (3, 26), led us to ex- clude differences in protein degrada- biosynthesis in cultured human fibroblasts (21). This ef- tion as the origin of the increased histone levels after fect in late passage cells is opposite to the increase ob- hormone treatment. served by us in T3-treated fibroblasts that undergo senes- The amounts of representative H3 and H4 mRNAs cence as a consequence of oxidative DNA damage after a also remained unaltered in the presence of T3, suggesting short time of hormone exposure (15). The mechanism is a posttranscriptional mechanism behind the observed ef- also different, because telomeric shortening coincides fects. Efficient translation of histone mRNAs is achieved with a reduction in the levels of the SLBP and histone by mRNA circularization mediated by protein-protein in- chaperones, whereas no changes in SLBP levels are found teractions between SLIP1, bound to the 3Ј end through in T -treated fibroblasts. 3 SLBP, and EIF4G, which interacts with the cap-binding The biological significance of the cell cycle–indepen- dent enhanced synthesis of histones is still unclear. protein (27). In addition, SLBP directs histone mRNAs to Changes in histone-DNA equilibrium can induce DNA polysomes (8), thus further increasing translation effi- damage and impair DNA replication (22, 23). Therefore, ciency. Our results support the observation that T3 in- it could participate in the DNA damage and reduced pro- duces the relocation or distribution of histone mRNAs to liferation observed in T3-treated MEFs (15). However, a heavy polysomes, thus increasing their translation effi- T3-dependent histone increase also occurs in pituitary ciency in a cell cycle–independent manner. The mecha- 74 Zambrano et al T3 Increases Histone Expression Mol Endocrinol, January 2015, 29(1):68–75

A B C might enhance and sustain T3-de- * 2,5 MEFs-THRA pendent stimulation of the transla- KDa 2,0 -T3 EIF4G2 150 tional capacity of histone mRNAs. +T3 KDa α-TUB 50 1,5 EIF4G2 150 - T3 Because of the global role of EIF4G 1,0 α -TUB 50 MEFs-THRB in the initiation of translation, T3 0,5 KDa T3: - + EIF4G2 150 might have a more general role in the mRNA fold induction mRNA fold 0,0 α-TUB Mif4gd Eif4g1 Eif4g2 50 translational control. However, T - T3 3 does not induce a generalized in- DEMEFs KDa siControl siEif4g2 crease in protein synthesis in MEFs, EIF4G2 150 because the translational efficiency α-TUB 50 EIF4G2 KDa - T3 GC1 150 of GAPDH was not significantly al- H3 Downloaded from https://academic.oup.com/mend/article/29/1/68/2556825 by guest on 02 October 2021 HCT-116 KDa 15 tered by the hormone, SLBP was not EIF4G2 150 α-TUB altered, and the levels of α-TUB 50 50 - T3 GC1 T3: - + - + used as a loading control were not affected. How specificity is obtained F Eif4g2 promoter (-650 to -350) despite the increased levels of the TGCAAACACTTCTCAAGCCAGCCTAGTATACTGTCTGGGTCAAGCTCGGT-601 GACAGCAGGCCGAGCATTTGAGTTAAAGCTGCCTCTAGCCTGGGATACAA-551 general translation factor EIF4G re- AGCCCTTCCTTTGATCCTTTTCTCGTTACTCTGCAGATGGAGGACCAACA-501 quires further investigation. AACAGAACGCATTCCTATCGATGGGCACACGTCCCTCTCTTCAGCAAAGC-451 TCCCAGACGCTAAACCGAGGCCAGGCCGCAAGGCCACGCCGAGCCCTCAG-401 To maintain normal cell growth, GACGCCAGGCCCGGGCGGGTCAGGGAGGAGAGGCGAGGAAAAGGTTCTTC-351 the control of protein synthesis and

G 4.0 degradation by TH could be crucial. At physiological concentrations, -T3 THs can stimulate the synthesis as 3.0 +T3 well as the degradation of proteins. Early studies demonstrated the ef-

0,50 fect of THs on protein synthesis both in vivo and in vitro cell-free sys- Percent of input Percent tems (28–31). From these studies it 0,25 appears that the increase in protein synthesis upon hormone stimulation 0,0 was due to a primary effect on poly- IgGs H3 THRB IgGs H3 THRB peptide assembly at the level of trans- (-647 /-352) (-199 /-41) lation followed by a stimulation of transcription of the protein-synthesiz- Figure 5. EIF4G2 induction is involved in TH-induced expression of histones. A, Relative mRNA ing machinery. Taken together, our levels of Slip1, Eif4g1, and Eif4g2 between T3-treated (24 hours) and untreated MEFs. B, Protein levels of EIF4G2 in treated (24 hours) and untreated cells. C, EIF4G2 levels in control and T3- results fit into the picture of transla- treated THR-knockout MEFs expressing either THRA or THRB. D, EIF4G2 levels in MEFs and HTC- tional control outlined in these initial 116 cells treated with T or GC-1, as indicated. E, Effect of EIF4G2 depletion by means of siRNA 3 studies. A number of later studies have on histone H3 expression. MEFs were transfected with the siRNA and treated with T3 for 48 hours. F, Eif4g2 promoter sequence (Ϫ650 to Ϫ350) showing the 2 putative TRE hemisites found described the effects on polypeptide (in red) and in bold the sequence of the primers used in the ChIP experiments. Cells were treated assembly mediated by nongenomic for 2 hours with T3 and analyzed by ChIP with normal IgGs, histone H3, and THRB antibodies. Ϫ Ϫ actions of THs at the level of the phos- The amplified DNA corresponds to the 647/ 352 promoter region and to a proximal promoter Ϫ region (Ϫ199/Ϫ41) used as a negative control. phoinositide 3 kinase Akt (protein kinase B)Ϫmammalian target of rapa- nism responsible might imply T3-induced repositioning of mycin pathway (32–36). Among other functions, this path- SLBP to polysomes. way promotes cell growth and protein synthesis through In addition to this, the hormone induced the expres- regulation of mammalian target of rapamycin. These ac- sion of EIF4G2 by a transcriptional mechanism involving tions induce G1 cell cycle progression through signaling via the recruitment of THRB to the Eif4g2 promoter. We p70 S6 kinase and inhibition of eukaryotic translation initi- found 2 potential half-sites in a region upstream of the ation factor 4E–binding protein 1. However, it is very un- transcription initiation site that could be used by the re- likely that these nongenomic actions operate in the effects ceptor to activate transcription. The relocation of the mR- presented here because of the kinetics and the cell cycle con- NAs to polysomes together with the increase in EIF4G2 text in which they take place. doi: 10.1210/me.2014-1235 mend.endojournals.org 75

Acknowledgments hormone receptor ␤ induces DNA damage and premature senes- cence. J Cell Biol. 2014;204:129–146. Address all correspondence to: Ana Aranda, Instituto de Inves- 16. García-Silva S, Aranda A. The thyroid hormone receptor is a sup- tigaciones Biomédicas Arturo Duperier 4, 28029 Madrid, Spain. pressor of ras-mediated transcription, proliferation, and transfor- mation. Mol Cell Biol. 2004;24:7514–7523. E-mail: [email protected]; or Alberto Zambrano, Instituto de 17. Shechter D, Dormann HL, Allis CD, Hake SB. Extraction, purifi- Investigaciones Biomédicas Arturo Duperier 4, 28029 Madrid, cation and analysis of histones. Nat Protoc. 2007;2:1445–1457. Spain. E-mail: [email protected]. 18. Marzluff WF. Metazoan replication-dependent histone mRNAs: a This work was supported by the Ministerio de Economía y distinct set of RNA polymerase II transcripts. Curr Opin Cell Biol. Competitividad (Grant BFU2011–28058), the Instituto de Sa- 2005;17:274–280. lud Carlos III (Grant RD12/0036/0030), and the Comunidad de 19. Toyama BH, Hetzer MW. Protein homeostasis: live long, won’t prosper. Nat Rev Mol Cell Biol. 2013;14:55–61. Madrid (Grant S2011/BMD-2328 to A.A), and by the Instituto 20. Commerford SL, Carsten AL, Cronkite EP. Histone turnover de Salud Carlos III (Grant MPY-1038/14 to A.Z.). within nonproliferating cells. Proc Natl Acad Sci USA. 1982;79: Author contributions: A.Z. and A.A. conceived the project 1163–1165. Downloaded from https://academic.oup.com/mend/article/29/1/68/2556825 by guest on 02 October 2021 and designed experiments; A.Z., V.G.-C. and R.V. performed 21. O’Sullivan RJ, Kubicek S, Schreiber SL, Karlseder J. Reduced his- the experiments; A.Z., V.G.-C., and A.A. analyzed the data; and tone biosynthesis and chromatin changes arising from a damage signal at telomeres. Nat Struct Mol Biol. 2010;17:1218–1225. A.Z. and A.A. wrote the article. 22. Meeks-Wagner D, Hartwell LH. Normal stoichiometry of histone Disclosure Summary: The authors have nothing to disclose. dimer sets is necessary for high fidelity of mitotic chromosome transmission. Cell. 1986;44:43–52. 23. Groth A, Corpet A, Cook AJ, et al. Regulation of replication fork progression through histone supply and demand. Science. 2007; References 318:1928–1931. 24. Hinkle PM, Kinsella PA. Thyroid hormone induction of an auto- 1. Kornberg RD, Lorch Y. Twenty-five years of the nucleosome, fun- crine growth factor secreted by pituitary tumor cells. Science. 1986; damental particle of the eukaryote chromosome. Cell. 1999;98: 234:1549–1552. 285–294. 25. Mullen TE, Kaygun H, Marzluff WF. Chapter 2. Cell-cycle regula- 2. Jenuwein T, Allis CD. Translating the histone code. Science. 2001; tion of histone mRNA degradation in Mammalian cells: role of 293:1074–1080. translation and oligouridylation. Methods Enzymol. 2008;449:23– 3. Bonner WM, Wu RS, Panusz HT, Muneses C. Kinetics of accumu- 45. lation and depletion of soluble newly synthesized histone in the 26. Tsvetkov S, Ivanova E, Djondjurov L. Metabolic behaviors of the reciprocal regulation of histone and DNA synthesis. Biochemistry. core histones in proliferating Friend cells. Exp Cell Res. 1989;180: 1988;27:6542–6550. 94–105. 4. Groth A, Ray-Gallet D, Quivy JP, Lukas J, Bartek J, Almouzni G. 27. Wells SE, Hillner PE, Vale RD, Sachs AB. Circularization of mRNA Human Asf1 regulates the flow of S phase histones during replica- tional stress. Mol Cell. 2005;17:301–311. by eukaryotic translation initiation factors. Mol Cell. 1998;2:135– 5. Jaeger S, Barends S, Giegé R, Eriani G, Martin F. Expression of 140. metazoan replication-dependent histone genes. Biochimie. 2005; 28. Sokoloff L, Kaufman S. Effects of thyroxin on amino acid incorpo- 87:827–834. ration into protein. Science. 1959;129:569–570. 6. Marzluff WF, Wagner EJ, Duronio RJ. Metabolism and regulation 29. Sokoloff L, Kaufman S. Thyroxine stimulation of amino acid incor- of canonical histone mRNAs: life without a poly(A) tail. Nat Rev poration into protein. J Biol Chem. 1961;236:795–803. Genet. 2008;9:843–854. 30. Sokoloff L, Kaufman S, Gelboin HV. Thyroxine stimulation of 7. Marzluff WF, Duronio RJ. Histone mRNA expression: multiple soluble ribonucleic acid bound amino acid transfer to microsomal levels of cell cycle regulation and important developmental conse- protein. Biochim Biophys Acta. 1961;52:410–412. quences. Curr Opin Cell Biol. 2002;14:692–699. 31. Sokoloff L, Roberts PA, Januska MM, Kline JE. Mechanisms of 8. Whitfield ML, Kaygun H, Erkmann JA, Townley-Tilson WH, stimulation of protein synthesis by thyroid hormones in vivo. Proc Dominski Z, Marzluff WF. SLBP is associated with histone mRNA Natl Acad Sci USA. 1968;60:652–659. on polyribosomes as a component of the histone mRNP. Nucleic 32. Cao X, Kambe F, Moeller LC, Refetoff S, Seo H. Thyroid hormone Acids Res. 2004;32:4833–4842. induces rapid activation of Akt/protein kinase B-mammalian target 9. Cakmakci NG, Lerner RS, Wagner EJ, Zheng L, Marzluff WF. of rapamycin-p70S6K cascade through phosphatidylinositol 3-ki- SLIP1, a factor required for activation of histone mRNA translation nase in human fibroblasts. Mol Endocrinol. 2005;19:102–112. by the stem-loop binding protein. Mol Cell Biol. 2008;28:1182– 33. Furuya F, Hanover JA, Cheng SY. Activation of phosphatidylino- 1194. sitol 3-kinase signaling by a mutant thyroid hormone beta receptor. 10. Gorgoni B, Andrews S, Schaller A, Schümperli D, Gray NK, Müller Proc Natl Acad Sci USA. 2006;103:1780–1785. B. The stem-loop binding protein stimulates histone translation at 34. Kenessey A, Ojamaa K. Thyroid hormone stimulates protein syn- an early step in the initiation pathway. RNA. 2005;11:1030–1042. thesis in the cardiomyocyte by activating the Akt-mTOR and 11. Lazar MA. Thyroid hormone action: a binding contract. J Clin p70S6K pathways. J Biol Chem. 2006;281:20666–20672. Invest. 2003;112:497–499. 35. Moeller LC, Cao X, Dumitrescu AM, Seo H, Refetoff S. Thyroid 12. Aranda A, Pascual A. Nuclear hormone receptors and gene expres- hormone mediated changes in gene expression can be initiated by sion. Physiol Rev. 2001;81:1269–1304. cytosolic action of the thyroid hormone receptor beta through the 13. Cheng SY, Leonard JL, Davis PJ. Molecular aspects of thyroid phosphatidylinositol 3-kinase pathway. Nucl Recept Signal. 2006; hormone actions. Endocr Rev. 2010;31:139–170. 4:e020. 14. Aranda A, Alonso-Merino E, Zambrano A. Receptors of thyroid 36. Hiroi Y, Kim HH, Ying H, et al. Rapid nongenomic actions of hormones. Pediatr Endocrinol Rev. 2013;11:2–13. thyroid hormone. Proc Natl Acad Sci USA. 2006;103:14104– 15. Zambrano A, García-Carpizo V, Gallardo ME, et al. The thyroid 14109.