Characterization of the Roles of DNA Polymerases, Clamp, and Clamp Loaders During S-Phase Progression and Cell Cycle Regulation in the Silkworm, Bombyx Mori
Total Page：16
File Type：pdf, Size：1020Kb
Journal of Insect Biotechnology and Sericology 85, 21-29 (2016) Characterization of the roles of DNA polymerases, clamp, and clamp loaders during S-phase progression and cell cycle regulation in the silkworm, Bombyx mori Masato Hino, Daisuke Morokuma, Hiroaki Mon, Jae Man Lee and Takahiro Kusakabe＊ Laboratory of Insect Genome Science, Kyushu University Graduate School of Bioresource and Bioenvironmental Sciences, Hakozaki 6-10-1, Higashi-ku, Fukuoka 812-8581, Japan (Received February 17, 2016; Accepted April 4, 2016) DNA replication is one of key event in cell-cycle progression, yet due to their importance and lethality, the chronological phenotypes of DNA synthesis machineries after the depletion of corresponding genes have proved difficult to study. In the present study, mRNAs for three DNA polymerases, a clamp, and three clamp loaders were gradually depleted from cultured silkworm cells by soaking RNAi. Interestingly, the depletion of these DNA synthesis factors had different effects on the cell growth rate and arrest of cell-cycle progression during time- lapse observation. The depletion of DNA polymerases immediately arrested the cell-cycle progression at the S phase, while that of PCNA, a DNA clamp, required more time to slow cell growth and finally induced apoptosis. Surprisingly, silkworm cells continued to undergo several rounds of cell division when the components of clamp loaders were knocked down. Key words: Cell cycle, Clamp loaders, DNA polymerases, replication factors, Silkworm In eukaryotes, three DNA polymerases are mainly in- INTRODUCTION volved in replication (Burgers, 1998). Pol α forms a com- Semiconservative DNA replication is an essential bio- plex with primase, and is needed to initiate DNA replication logical phenomenon that enables each daughter cell to at the start of replication and Okazaki fragment synthesis have the same sets of chromosomes. The many proteins (Pellegrini, 2012). Pol δ then synthesizes DNA on the lag- involved in the initiation of replication and DNA synthe- ging strand (Tahirov, 2012), and Pol ε synthesizes DNA sis are highly conserved across eukaryotic species, from on the leading strand (Hogg and Johansson, 2012). These yeast to humans (Singh, 2014). The assembly of an initia- three kinds of Pols are essential to complete the DNA rep- tion complex at the replication origins and their regulation lication. have been extensively studied since the consensus sequence As polymerases synthesize DNA on lagging and leading of the replication origin was found in yeast, but not in hu- strands, torsional stress occurs, and this stress temporarily mans (Marahrens and Stillman, 1992; Leonard and Mechali, leaves the polymerases from DNA (Majka and Burgers, 2013). Also, the firing of each replication origin in a single 2004). At this time, PCNA, a DNA sliding clamp, acts to cell cycle is a highly attractive phenomenon to many re- maintain the connection between the template-primer junc- searchers (Wang et al., 2014; Yeeles et al., 2015). In con- tion and Pol δ or Pol ε (Park et al., 2015). PCNA forms a trast, DNA synthesis step mediation by DNA polymerases, homo-trimer to clamp DNAs in mammals (Scovassi and clamps and clamp loaders has been well studied mainly Prosperi, 2006), and various organisms from bacteriophag- by biochemical methods. However, because the null muta- es to humans have the functionally similar circular sliding tions of DNA synthesis factors cause lethality (Bauer and clamps (Krishna et al., 1994; Majka and Burgers, 2004). Burgers, 1990; Noskov et al., 1998; Kilkenny et al., 2012), Additionally, PCNA interacts with DNA replication pro- the precise roles of these enzymes have been more difficult teins, such as flap structure-specific endonuclease 1 (Fen1) to characterize. or DNA ligase I; in these ways, PCNA is key to recruit- After the activation of the CMG helicase complex con- ment and association in DNA replication (Majka and sisting of Cdc45, Mcm2-7 and GINS, the DNA polymerase Burgers, 2004; Strzalka and Ziemienowicz, 2011). (Pol) α was used to initiate extension on an RNA-primed Rfc1-5 complex (Rfc1-5) is composed of Rfc1, Rfc2, DNA template (Pellegrini, 2012). The short extended DNA Rfc3, Rfc4 and Rfc5, which together form a complex served as a scaffold for replication factor C (Rfc) and the with PCNA, and loads PCNA onto DNA at template- proliferating cell nuclear antigen (PCNA), which then re- primer junctions. A previous study reported that the Rfc1, placed DNA Pol α with Pol δ or Pol ε (Singh, 2014). Rfc3 and Rfc4 interact with PCNA and that human Rfc2- 4 complex binds to PCNA (Pan et al., 1993; Fotedar et al., *To whom correspondence should be addressed. 1996; Mossi et al., 1997; Uhlmann et al., 1997). In addi- Fax & Tel: +81-92-642-2842. tion to Rfc1, the largest subunits of the Rfc1-5 complex, Email: [email protected] Ctf18, Elg1, and Rad24 (hRad17), were identified as part- 22 Hino et al. Table 1. List of the primers used in this study Primer name Sense (5’ to 3’) Antisense (5’ to 3’) GCGTAATACGACTCACTATAGGGTCTAAA GCGTAATACGACTCACTATAGGGGGGCCC dsPOL α ACAGGCTCTACCGCAATATAA TGATAAGTTCCATTGCGGATA GCGTAATACGACTCACTATAGGGGGCACT GCGTAATACGACTCACTATAGGGGGCTGC dsPOL δ TGCTGCTTTCACTAAAAAGAA CCAAACCTTAAAATTGTATTT GCGTAATACGACTCACTATAGGGGCTGGA GCGTAATACGACTCACTATAGGGTTAGGG dsPOL ε GACGGAGACTTACGTCGGGGG TACATAGCGCCGACGTCCAAA GCGTAATACGACTCACTATAGGGATGGGC GCGTAATACGACTCACTATAGGGCGACTG dsPCNA ATGAATCTAGGCAGCATGTCA CCTCTTCCTCTTTGTCAATAG GCGTAATACGACTCACTATAGGGGAAGAT GCGTAATACGACTCACTATAGGGTCTGCG dsRFC1 GAGGTCCCTGGTCAACTACTG GAGAACACTTTCCTTACTGCC GCGTAATACGACTCACTATAGGGATGTTT GCGTAATACGACTCACTATAGGGTTGACT dsRFC2 GCGCAACAAAAGGTTACTTTG GCAGGTTGTTCAGGGCTGATC GCGTAATACGACTCACTATAGGGCCTGGC GCGTAATACGACTCACTATAGGGCTCTCA dsCTF18 ACATTTATTAGCTAAACTAGCCG AAGGCCTCAATGATGTAGCG RTPOL α AGGTCGAGAACGAACAAGAAAAGTACCG CGTTTCGAATGCTGAGACAATCGTTGG RTPOL δ CTCATAGACAGAGACCCAGATGGAG GGTTCTGGTATGTTCACCCTTAAGAAG RTPOL ε TCTACAGCACCTGCTCGACAACAC GAAGATCCCACTTCAGTTAAGCCTTCC RTPCNA TTTGAGGCACGTTTACTCCGAAGCTCTATC GCTGTCTTCTTCCTCGATCTTAGGC RTRFC1 GACATGGTTTCTGCGAGAATCAGAGG CATCACCGTCATCCATTTCGTCATCG RTRFC2 TCAAATGATCGTGGTATAGATGTCGTCC TCATCACACACTTTGAACACATTGTCC RTCTF18 CTAACGTACAGTTGTGCAGCGAGAG CGCTGCATGTGGTTGGGTATAGC RTACTIN AGATGACCCAGATCATGTTCG GAGATCCACATCTGTTGGAAG ners of Rfc2-5. The Ctf18-, Elg1-, and Rad24-containing nlm.nih.gov). The accession numbers of BmPOL α catalytic complexes are known to play roles in the establishment of subunit, BmPOL δ catalytic subunit, BmPOL ε catalytic chromatid cohesion, genomic stability, and DNA damage subunit, BmPCNA, BmRFC1, BmRFC2, and BmCTF18 checkpoint control, respectively (Majka and Burgers, 2004; are XM_012697347, NM_001309551, XM_004923295, Kubota et al., 2013). NM_001043360, XM_004922986, NM_001043452, and Recently, we developed the soaking RNA interference XM_004926234, respectively. (RNAi) system, which enables us to knock down genes of interest efficiently (Mon et al., 2013). In the present study, RT-PCR the three replicases, PCNA, and the clamp loaders in the Semi-quantitative reverse transcription polymerase chain silkworm cells were silenced and their effects on cell via- reaction (RT-PCR) was performed to confirm knockdown bility and cell cycle progression were observed. These re- efficiencies of the genes of interest. Total RNAs (2 μg) sults revealed that depletions of replicases cause severe extracted were reverse transcribed using ReveTra Ace effects on cell growth, and that of PCNA has a moderate (Toyobo, Japan). The resulting cDNAs were used as tem- effect. plates for the PCR using gene-specific primers listed in Table 1. MATERIALS AND METHODS RNA interference Cell culture For dsRNA synthesis, the cDNA fragments of replica- BmN4-SID1 that expresses a C. elegans SID-1 (CeSID-1) tion related genes were amplified using the gene-specific transmembrane protein with the capacity to uptake double- primers including an additional T7 promoter sequence at stranded RNA (dsRNA) (Mon et al., 2013) was maintained both 5′ and 3′ terminus (Table 1). Double-stranded RNAs in IPL41 insect medium (Sigma, St. Louis, MO) with 10% were transcribed from the both ends of PCR fragments by fetal bovine serum (Gibco, Grand Island, NY) at 27°C. T7 RNA polymerase. To induce RNAi of replication relat- ed genes in BmN4-SID1 cells, dsRNAs were added to the Sequences of replication related genes cell culture medium at a final concentration of 200 ng/ml. Nucleotide sequences of Bombyx mori replication relat- In this study, the dsRNA for EGFP gene was used as a ed genes were downloaded from NCBI (http://www.ncbi. control. Roles of silkworm DNA replication factors 23 Fig. 1. (A) Schematic drawing of DNA replication complex, which is modified from the eukaryotic DNA replication website (http://www.dnareplication.net/model/model.html). (B) Knockdown efficiencies of the 6 DNA replication related genes, BmPOL α, BmPOL δ, BmPOL ε, BmPCNA, BmRFC1, and BmRFC2, induced by soaking RNAi were confirmed by RT-PCR. BmACTIN gene was used to normalize the variability in template loading. Flow cytometry genetic researches are performed on DNA synthesis-relat- BmN4-SID1 cells treated by dsRNAs were fixed with ed genes, DNA polymerases, clamps, and clamp loaders. 70% ethanol and kept at 4°C until used. After RNaseA We thought that the significance of each DNA synthesis- treatment, the cells were stained by propidium iodide, and related factor could be observed if it could be depleted then analyzed immediately using a Guava PCA-96 Flow gradually from cultured silkworm cells,