Characterization of the Roles of DNA Polymerases, Clamp, and Clamp Loaders During S-Phase Progression and Cell Cycle Regulation in the Silkworm, Bombyx Mori

Journal of Insect Biotechnology and Sericology 85, 21-29 (2016)

Characterization of the roles of DNA polymerases, clamp, and clamp loaders during S-phase progression and cell cycle regulation in the silkworm, Bombyx mori

Masato Hino, Daisuke Morokuma, Hiroaki Mon, Jae Man Lee and Takahiro Kusakabe＊

Laboratory of Insect Genome Science, Kyushu University Graduate School of Bioresource and Bioenvironmental Sciences, Hakozaki 6-10-1, Higashi-ku, Fukuoka 812-8581, Japan (Received February 17, 2016; Accepted April 4, 2016)

DNA replication is one of key event in cell-cycle progression, yet due to their importance and lethality, the chronological phenotypes of DNA synthesis machineries after the depletion of corresponding genes have proved difficult to study. In the present study, mRNAs for three DNA polymerases, a clamp, and three clamp loaders were gradually depleted from cultured silkworm cells by soaking RNAi. Interestingly, the depletion of these DNA synthesis factors had different effects on the cell growth rate and arrest of cell-cycle progression during time- lapse observation. The depletion of DNA polymerases immediately arrested the cell-cycle progression at the S phase, while that of PCNA, a DNA clamp, required more time to slow cell growth and finally induced apoptosis. Surprisingly, silkworm cells continued to undergo several rounds of cell division when the components of clamp loaders were knocked down. Key words: Cell cycle, Clamp loaders, DNA polymerases, replication factors, Silkworm

In eukaryotes, three DNA polymerases are mainly in- INTRODUCTION volved in replication (Burgers, 1998). Pol α forms a com- Semiconservative DNA replication is an essential bio- plex with primase, and is needed to initiate DNA replication logical phenomenon that enables each daughter cell to at the start of replication and Okazaki fragment synthesis have the same sets of chromosomes. The many proteins (Pellegrini, 2012). Pol δ then synthesizes DNA on the lag- involved in the initiation of replication and DNA synthe- ging strand (Tahirov, 2012), and Pol ε synthesizes DNA sis are highly conserved across eukaryotic species, from on the leading strand (Hogg and Johansson, 2012). These yeast to humans (Singh, 2014). The assembly of an initia- three kinds of Pols are essential to complete the DNA rep- tion complex at the replication origins and their regulation lication. have been extensively studied since the consensus sequence As polymerases synthesize DNA on lagging and leading of the replication origin was found in yeast, but not in hu- strands, torsional stress occurs, and this stress temporarily mans (Marahrens and Stillman, 1992; Leonard and Mechali, leaves the polymerases from DNA (Majka and Burgers, 2013). Also, the firing of each replication origin in a single 2004). At this time, PCNA, a DNA sliding clamp, acts to cell cycle is a highly attractive phenomenon to many re- maintain the connection between the template-primer junc- searchers (Wang et al., 2014; Yeeles et al., 2015). In con- tion and Pol δ or Pol ε (Park et al., 2015). PCNA forms a trast, DNA synthesis step mediation by DNA polymerases, homo-trimer to clamp DNAs in mammals (Scovassi and clamps and clamp loaders has been well studied mainly Prosperi, 2006), and various organisms from bacteriophag- by biochemical methods. However, because the null muta- es to humans have the functionally similar circular sliding tions of DNA synthesis factors cause lethality (Bauer and clamps (Krishna et al., 1994; Majka and Burgers, 2004). Burgers, 1990; Noskov et al., 1998; Kilkenny et al., 2012), Additionally, PCNA interacts with DNA replication pro- the precise roles of these enzymes have been more difficult teins, such as flap structure-specific endonuclease 1 (Fen1) to characterize. or DNA ligase I; in these ways, PCNA is key to recruit- After the activation of the CMG helicase complex con- ment and association in DNA replication (Majka and sisting of Cdc45, Mcm2-7 and GINS, the DNA polymerase Burgers, 2004; Strzalka and Ziemienowicz, 2011). (Pol) α was used to initiate extension on an RNA-primed Rfc1-5 complex (Rfc1-5) is composed of Rfc1, Rfc2, DNA template (Pellegrini, 2012). The short extended DNA Rfc3, Rfc4 and Rfc5, which together form a complex served as a scaffold for replication factor C (Rfc) and the with PCNA, and loads PCNA onto DNA at template- proliferating cell nuclear antigen (PCNA), which then re- primer junctions. A previous study reported that the Rfc1, placed DNA Pol α with Pol δ or Pol ε (Singh, 2014). Rfc3 and Rfc4 interact with PCNA and that human Rfc2- 4 complex binds to PCNA (Pan et al., 1993; Fotedar et al., *To whom correspondence should be addressed. 1996; Mossi et al., 1997; Uhlmann et al., 1997). In addi- Fax & Tel: +81-92-642-2842. tion to Rfc1, the largest subunits of the Rfc1-5 complex, Email: [email protected] Ctf18, Elg1, and Rad24 (hRad17), were identified as part- 22 Hino et al.

Table 1. List of the primers used in this study Primer name Sense (5’ to 3’) Antisense (5’ to 3’) GCGTAATACGACTCACTATAGGGTCTAAA GCGTAATACGACTCACTATAGGGGGGCCC dsPOL α ACAGGCTCTACCGCAATATAA TGATAAGTTCCATTGCGGATA GCGTAATACGACTCACTATAGGGGGCACT GCGTAATACGACTCACTATAGGGGGCTGC dsPOL δ TGCTGCTTTCACTAAAAAGAA CCAAACCTTAAAATTGTATTT GCGTAATACGACTCACTATAGGGGCTGGA GCGTAATACGACTCACTATAGGGTTAGGG dsPOL ε GACGGAGACTTACGTCGGGGG TACATAGCGCCGACGTCCAAA GCGTAATACGACTCACTATAGGGATGGGC GCGTAATACGACTCACTATAGGGCGACTG dsPCNA ATGAATCTAGGCAGCATGTCA CCTCTTCCTCTTTGTCAATAG GCGTAATACGACTCACTATAGGGGAAGAT GCGTAATACGACTCACTATAGGGTCTGCG dsRFC1 GAGGTCCCTGGTCAACTACTG GAGAACACTTTCCTTACTGCC GCGTAATACGACTCACTATAGGGATGTTT GCGTAATACGACTCACTATAGGGTTGACT dsRFC2 GCGCAACAAAAGGTTACTTTG GCAGGTTGTTCAGGGCTGATC GCGTAATACGACTCACTATAGGGCCTGGC GCGTAATACGACTCACTATAGGGCTCTCA dsCTF18 ACATTTATTAGCTAAACTAGCCG AAGGCCTCAATGATGTAGCG RTPOL α AGGTCGAGAACGAACAAGAAAAGTACCG CGTTTCGAATGCTGAGACAATCGTTGG RTPOL δ CTCATAGACAGAGACCCAGATGGAG GGTTCTGGTATGTTCACCCTTAAGAAG RTPOL ε TCTACAGCACCTGCTCGACAACAC GAAGATCCCACTTCAGTTAAGCCTTCC RTPCNA TTTGAGGCACGTTTACTCCGAAGCTCTATC GCTGTCTTCTTCCTCGATCTTAGGC RTRFC1 GACATGGTTTCTGCGAGAATCAGAGG CATCACCGTCATCCATTTCGTCATCG RTRFC2 TCAAATGATCGTGGTATAGATGTCGTCC TCATCACACACTTTGAACACATTGTCC RTCTF18 CTAACGTACAGTTGTGCAGCGAGAG CGCTGCATGTGGTTGGGTATAGC RTACTIN AGATGACCCAGATCATGTTCG GAGATCCACATCTGTTGGAAG ners of Rfc2-5. The Ctf18-, Elg1-, and Rad24-containing nlm.nih.gov). The accession numbers of BmPOL α catalytic complexes are known to play roles in the establishment of subunit, BmPOL δ catalytic subunit, BmPOL ε catalytic chromatid cohesion, genomic stability, and DNA damage subunit, BmPCNA, BmRFC1, BmRFC2, and BmCTF18 checkpoint control, respectively (Majka and Burgers, 2004; are XM_012697347, NM_001309551, XM_004923295, Kubota et al., 2013). NM_001043360, XM_004922986, NM_001043452, and Recently, we developed the soaking RNA interference XM_004926234, respectively. (RNAi) system, which enables us to knock down genes of interest efficiently (Mon et al., 2013). In the present study, RT-PCR the three replicases, PCNA, and the clamp loaders in the Semi-quantitative reverse transcription polymerase chain silkworm cells were silenced and their effects on cell via- reaction (RT-PCR) was performed to confirm knockdown bility and cell cycle progression were observed. These re- efficiencies of the genes of interest. Total RNAs (2 μg) sults revealed that depletions of replicases cause severe extracted were reverse transcribed using ReveTra Ace effects on cell growth, and that of PCNA has a moderate (Toyobo, Japan). The resulting cDNAs were used as tem- effect. plates for the PCR using gene-specific primers listed in Table 1. MATERIALS AND METHODS RNA interference Cell culture For dsRNA synthesis, the cDNA fragments of replica- BmN4-SID1 that expresses a C. elegans SID-1 (CeSID-1) tion related genes were amplified using the gene-specific transmembrane protein with the capacity to uptake double- primers including an additional T7 promoter sequence at stranded RNA (dsRNA) (Mon et al., 2013) was maintained both 5′ and 3′ terminus (Table 1). Double-stranded RNAs in IPL41 insect medium (Sigma, St. Louis, MO) with 10% were transcribed from the both ends of PCR fragments by fetal bovine serum (Gibco, Grand Island, NY) at 27°C. T7 RNA polymerase. To induce RNAi of replication related genes in BmN4-SID1 cells, dsRNAs were added to the Sequences of replication related genes cell culture medium at a final concentration of 200 ng/ml. Nucleotide sequences of Bombyx mori replication relat- In this study, the dsRNA for EGFP gene was used as a ed genes were downloaded from NCBI (http://www.ncbi. control. Roles of silkworm DNA replication factors 23

Fig. 1. (A) Schematic drawing of DNA replication complex, which is modified from the eukaryotic DNA replication website (http://www.dnareplication.net/model/model.html). (B) Knockdown efficiencies of the 6 DNA replication related genes, BmPOL α, BmPOL δ, BmPOL ε, BmPCNA, BmRFC1, and BmRFC2, induced by soaking RNAi were confirmed by RT-PCR. BmACTIN gene was used to normalize the variability in template loading.

Flow cytometry genetic researches are performed on DNA synthesis-relat- BmN4-SID1 cells treated by dsRNAs were fixed with ed genes, DNA polymerases, clamps, and clamp loaders. 70% ethanol and kept at 4°C until used. After RNaseA We thought that the significance of each DNA synthesis- treatment, the cells were stained by propidium iodide, and related factor could be observed if it could be depleted then analyzed immediately using a Guava PCA-96 Flow gradually from cultured silkworm cells, rather than knocked Cytometer (Millipore). The data obtained were analyzed out entirely. Our soaking RNAi method provides us a using FlowJo software (http://www.flowjo.com). powerful tool for such an investigation (Mon et al., 2013). During DNA replication, DNA helicase complex con- Cell cycle arrest assay taining Mcm2-7 separates DNA duplexes, and DNA poly- BmN4-SID1 cells were synchronized at different phases merases start to synthesize DNA strands (Singh, 2014). of the cell cycle by RNAi of the cell cycle regulator genes, Initially, Pol α synthesizes a short DNA strand and then is BmMYC, BmCDT1, BmRNRS, BmCDK1, and BmCDC27 replaced by Pol δ or Pol ε, which continue to synthesize the (Li et al., 2013). The cell cycle-specific expressions of lagging or leading strand, respectively. PCNA, the clamp, replication related genes were analyzed by RT-PCR using loaded to the template-primer junction by the Rfc1-5 gene-specific primers (Table 1) as described above. clamp loader, serves to maintain the connection between DNA and Pol δ or Pol ε (Majka and Burgers, 2004) (Fig. 1A). Similarities between DNA synthesis-related fac- RESULTS AND DISCUSSION tors in silkworms and other organisms are shown in Ta- DNA synthesis-related genes from silkworm ble 2. As expected, fruit fly orthologs are the closest to Due to the severity of knockout phenotypes, very few those of silkworms. Interestingly, silkworm Rfc2 is closer 24 Hino et al.

Table 2. The similarity of the 6 DNA replication related genes, BmPOL α, BmPOL δ, BmPOL ε, BmPCNA, BmRFC1, and BmRFC2 among organisms. Gene name Yeast Fruit fly Human BmPOL α 60.9% 72.8% 72.4% catalytic subunit XP_012552801 NP_014297 NP_536736 NP_058633

BmPOL δ 76.4% 89.3% 81.8% catalytic subunit NP_001296480 NP_010181 NP_524099 NP_002682

BmPOL ε 66.7% 81.3% 79.1% catalytic subunit XP_004923352 NP_014137 NP_524462 NP_006222

BmPCNA 78.4% 95.0% 93.8% NP_001036825 NP_009645 NP_476905 NP_002583 Fig. 2. Cell cycle dependent expression analysis of 6 DNA replication related genes by RT-PCR. Lane 1, 2: cDNA from BmRFC1 63.8% 75.4% 68.7% the cells arrested at G1 phase by knockdown of BmMYC or XP_004923043 NP_014860 NP_524229 NP_002904 BmCDT1 was used as a template. Lane 3: cDNA from the cells arrested at S phase by knockdown of BmRNRS was used as a template. Lane 4,5: cDNA from the cells arrested 67.0% 67.5% 91.5% BmRFC2 at G2/M phase by knockdown of BmCDK1 or BmCDC27 was 85.3% (RFC4) 91.5% (RFC4) 66.5% (RFC4) used as a template. CDNA from BmN4-SID1 cells without cell NP_012602 NP_573245 NP_852136 NP_001036917 cycle arrest was used as a control template. NP_014547 NP_523915 NP_002907 Sequences of replication related proteins were downloaded from BmPOL δ, BmPOL ε, BmPCNA, BmRFC1, and BmRFC2, NCBI (http://www.ncbi.nlm.nih.gov). measured by Image J software, were 8.6, 22.8, 1.8, 17.2, 2.1, and 9.1%, respectively, as compared with the control. to the Rfc4 of yeast and fruit fly than to their respective Using these RNAi-treated cells, the effects of gene knock- Rfc2s. down on cell cycle progression were analyzed using a Flow Cytometer (Fig. 3A). The cell cycles of BmPOL α- and Cell cycle-dependent expression analysis of rep- BmPOL δ-depleted cells were arrested mainly at the early lication-related genes or middle S phase, whereas that of BmPOL ε was arrested Several replication-related genes have been reported to at the late S phase. The cell-cycle-specific expression of show S-phase-specific expression. To synchronize the cell BmPOL ε may account for the different gene knockdown population at different cell cycle phases, knockdowns of phenotypes between BmPOL α and δ and BmPOL ε. In cell cycle-specific genes, BmMYC, BmCDT1, BmRNRS, contrast, the depletion of BmPCNA, BmRFC1, and BmRFC2 BmCDK1, and BmCDC27, were performed (Li et al., demonstrated almost no effect on cell cycle progressions. 2013). The expression of BmPOL ε decreased in the cells Consistent with this observation, the growth of DNA poly- arrested at the S/G2/M phase, consistent with the previous merase-depleted cells was inhibited, but not those of cells study (Tuusa et al., 1995), while the expression levels of depleted of BmPCNA, BmRFC1, or BmRFC2 (Fig. 3B). the other genes were constant throughout the cell cycle These results suggest that DNA polymerases are essential (Fig. 2). for the first-round DNA synthesis.

Short-term knockdown phenotypes of replication Long-term knockdown phenotypes of BmPCNA, related genes BmRFC1, or BmRFC2 In order to analyze the functions in silkworm cells of Growth and cell cycle progression were not affected by the 6 DNA replication-related genes, BmPOL α, BmPOL δ, 5-day depletion of BmPCNA, BmRFC1 or BmRFC2. There- BmPOL ε, BmPCNA, BmRFC1, and BmRFC2, we induced fore, the effects of long-term knockdowns of these genes RNAi for these genes using BmN4-SID1 cells as de- were investigated (Fig. 4A). Compared with controls, ten scribed in the Materials and Methods section. Five days days’ depletion of all three genes caused significant altera- after dsRNA treatment, the cells were collected, and the tions of cell-cycle progression, although the BmPCNA de- efficiencies of RNAi induction were evaluated. As shown pletion shows the most severe effect and stimulates the in Figure 1B, the knockdown efficiencies of BmPOL α, sub-G1 population, suggesting the induction of apoptosis. Roles of silkworm DNA replication factors 25

Fig . 3. (A) Flow cytometric analysis of cell cycle in the BmN4-SID1 cells inducing RNAi of the 6 DNA replication related genes for 5 days. (B) Micrographs of the cells inducing RNAi for 5 days. Scale bar, 50 μm.

Cell cycle progressions were arrested at G2/M phase by 10 (Fig. 4B). Depletion of BmPCNA or BmRFC2 significant- days’ depletion of BmRFC1 or BmRFC2. Compared with ly decreased the cell growth rate at 10 or 20 days after BmRFC1, the BmRFC2 depletion strongly arrested cell cy- RNAi induction. The growth of cells depleted of BmRFC1 cle progression at the G2/M phase. was slightly slowed after 20 days’ incubation. Furthermore, In order to confirm these results, the growth of cells the depletion of BmRFC1 or BmRFC2 increased cell vol- was observed at 10, 15, and 20 days after RNAi induction ume, indicating that these cells entered the endomitotic 26 Hino et al.

Fig . 4. (A) Flow cytometric analysis of the cells inducing RNAi of BmPCNA, BmRFC1, or BmRFC2 for 10, 15, or 20 days. (B) Micrographs of the cells inducing RNAi for 10, 15, 20 days. Scale bar, 50 μm. The cells inducing RNAi for 10 or 15 days were passaged once, and the cells inducing RNAi for 20 days were passaged twice. cell-division cycle without apoptosis being induced. Elg1-Rfc2-5 (Kubota et al., 2013). Shiomi et al. reported There are two possible explanations for the different that the PCNA loaded by Ctf18-Rfc2-5 complex stimulat- knockdown phenotypes observed between BmPCNA and ed the DNA synthesis activity of Pol δ like the PCNA BmRFC1/2: 1) PCNA is known to have other roles besides loaded by Rfc1-5 under a certain condition (Shiomi et al., DNA replication (Park et al., 2015) or 2) PCNA can be 2004), which may explain the difference observed be- loaded by another clamp loader, such as Ctf18-Rfc2-5 and tween BmRFC1 and BmRFC2 depletion. Roles of silkworm DNA replication factors 27

Fig . 5. (A) Knockdown efficiency of BmCTF18 was analyzed by RT-PCR. BmACTIN was used to normalize the variability in template loading. (B) Flow cytometric analysis of the cells inducing single BmCTF18, BmRFC1, BmRFC2 RNAi or BmRFC1-BmCTF18 double knockdown for 10, 15, 20 days. (C) Micrographs of the cells inducing RNAi for 10, 15, 20 days. Scale bar, 50 μm. The cells inducing RNAi for 10 or 15 days were passaged once, and the cells inducing RNAi for 20 days were passaged twice.

Long-term knockdown phenotypes of BmCTF18 differences. The knockdown efficiency of BmCTF18, mea- Ctf18 is found as a subunit of the Ctf18-Rfc2-5 clamp sured by Image J software, was 25.6% as compared with loader complex and functions in sister chromatid cohesion. the control (Fig. 5A). Unexpectedly, depletion of BmCTF18 Therefore, we were interested in the role of BmCTF18 in showed almost no effect on the cell cycle progression and DNA replication and induced single BmCTF18 knockdown growth while the double knockdown caused the same ef- and BmRFC1-BmCTF18 double knockdown to explore the fect as BmRFC1 single RNAi (Fig. 5B and 5C). Taken 28 Hino et al. together, these results suggest that assembly of BmRfc2-5 Leonard, A.C. and Mechali, M. (2013) DNA replication ori- with other proteins may play redundant roles in replica- gins. Cold Spring Harb. Perspect. Biol., 5, a010116. tion, although one possible candidate, Elg1, was reported Li, Z., Cheng, D., Mon, H., Zhu, L., Xu, J., Tatsuke, T., Lee, J.M., Xia, Q. and Kusakabe, T. (2013) Cell cycle-dependent to remove the PCNA clamp from DNA. recruitment of polycomb proteins to the ASNS promoter Silkworms are important insects for basic modeling and counteracts C/ebp-mediated transcriptional activation in Bom- for applied research. Especially for industrial use, the ge- byx mori. PLoS One, 8, e52320. netic modification of silkworm requires the introduction Majka, J. and Burgers, P.M.J. (2004) The PCNA-RFC families of multiple genes and tight relation of foreign gene ex- of DNA clamps and clamp loaders. Prog. Nucleic Acid Res. Mol. Biol., 78, 227-260. pression. In general, these manipulations have been very Marahrens, Y. and Stillman, B. (1992) A yeast chromosomal complex and time-consuming. To address these problems, origin of DNA replication defined by multiple functional el- artificial silkworm chromosomes are expected to be use- ements. Science, 255, 817-823. ful. Artificial chromosomes have been established in hu- Mon, H., Li, Z., Kobayashi, I., Tomita, S., Lee, J., Sezutsu, H., mans, yeast, and bacteria (Burke et al., 1987; Shizuya et Tamura, T. and Kusakabe, T. (2013) Soaking RNAi in Bom- byx mori BmN4-SID1 cells arrests cell cycle progression. J. al., 1992; Harrington et al., 1997), but not in silkworms. Insect Sci., 13, 155. The results obtained in this research will provide funda- Mossi, R., Jonsson, Z.O., Allen, B.L., Hardin, S.H. and Hubscher, mental information about DNA synthesis and for the con- U. (1997) Replication factor C interacts with the C-terminal struction of an artificial silkworm chromosome. side of proliferating cell nuclear antigen. J. Biol. Chem., 272, 1769-1776. Noskov, V.N., Araki, H. and Sugino, A. (1998) The RFC2 ACKNOWLEDGEMENTS gene, encoding the third-largest subunit of the replication factor C complex, is required for an S-phase checkpoint in This work was supported in part by a grant KAKENHI Saccharomyces cerevisiae. Mol. Cell. Biol., 18, 4914-4923. No. 26252057 from the Japan Society for the Promotion Pan, Z.Q., Chen, M. and Hurwitz, J. (1993) The subunits of of Science. The authors declare no conflict of interest. activator 1 (replication factor C) carry out multiple functions essential for proliferating-cell nuclear antigen-dependent DNA synthesis. Proc. Natl. Acad. Sci. U. S. A., 90, 6-10. REFERENCES Park, S.Y., Jeong, M.S., Han, C.W., Yu, H.S. and Jang, S.B. (2015) Structural and functional insight into proliferating Bauer, G.A. and Burgers, P.M. (1990) Molecular cloning, cell nuclear antigen. J. Microbiol. Biotechnol., In press. doi: structure and expression of the yeast proliferating cell nu- 10.4014/jmb.1509.09051 clear antigen gene. Nucleic Acids Res., 18, 261-265. Pellegrini, L. (2012) The Pol alpha-primase complex. In The Burgers, P.M. (1998) Eukaryotic DNA polymerases in DNA Eukaryotic Replisome: a Guide to Protein Structure and replication and DNA repair. Chromosoma, 107, 218-227. Function (MacNeill, S. ed.), pp. 157-169, Springer Nether- Burke, D.T., Carle, G.F. and Olson, M.V. (1987) Cloning of lands, Dordrecht. large segments of exogenous DNA into yeast by means of Scovassi, A.I. and Prosperi, E. (2006) Analysis of proliferating artificial chromosome vectors. Science, 236, 806-812. cell nuclear antigen (PCNA) associated with DNA excision Fotedar, R., Mossi, R., Fitzgerald, P., Rousselle, T., Maga, G., repair sites in mammalian cells. In DNA repair protocols : Brickner, H., Messier, H., Kasibhatla, S., Hubscher, U. and mammalian systems, second edition (Henderson, D.S. ed.), Fotedar, A. (1996) A conserved domain of the large subunit pp. 457-475, Humana Press, Totowa, N.J. of replication factor C binds PCNA and acts like a domi- Shiomi, Y., Shinozaki, A., Sugimoto, K., Usukura, J., Obuse, C. nant negative inhibitor of DNA replication in mammalian and Tsurimoto, T. (2004) The reconstituted human Chl12- cells. EMBO J., 15, 4423-4433. RFC complex functions as a second PCNA loader. Genes Harrington, J.J., Van Bokkelen, G., Mays, R.W., Gustashaw, K. Cells, 9, 279-290. and Willard, H.F. (1997) Formation of de novo centromeres Shizuya, H., Birren, B., Kim, U.J., Mancino, V., Slepak, T., and construction of first-generation human artificial micro- Tachiiri, Y. and Simon, M. (1992) Cloning and stable main- chromosomes. Nat. Genet., 15, 345-355. tenance of 300-kilobase-pair fragments of human DNA in Hogg, M. and Johansson, E. (2012) DNA polymerase epsilon. Escherichia coli using an F-factor-based vector. Proc. Natl. In The Eukaryotic Replisome: a Guide to Protein Structure Acad. Sci. U. S. A., 89, 8794-8797. and Function (MacNeill, S. ed.), pp. 237-257, Springer Neth- Singh, J. (2014) Role of DNA replication in establishment and erlands, Dordrecht. propagation of epigenetic states of chromatin. Semin. Cell Kilkenny, M.L., De Piccoli, G., Perera, R.L., Labib, K. and Dev. Biol., 30, 131-143. Pellegrini, L. (2012) A conserved motif in the C-terminal Strzalka, W. and Ziemienowicz, A. (2011) Proliferating cell tail of DNA polymerase α tethers primase to the eukaryotic nuclear antigen (PCNA): a key factor in DNA replication replisome. J. Biol. Chem., 287, 23740-23747. and cell cycle regulation. Ann. Bot., 107, 1127-1140. Krishna, T.S., Kong, X.P., Gary, S., Burgers, P.M. and Kuriyan, Tahirov, T.H. (2012) Structure and function of eukaryotic DNA J. (1994) Crystal structure of the eukaryotic DNA poly- polymerase delta. In The Eukaryotic Replisome: a Guide to merase processivity factor PCNA. Cell, 79, 1233-1243. Protein Structure and Function (MacNeill, S. ed.), pp. 217- Kubota, T., Myung, K. and Donaldson, A.D. (2013) Is PCNA 236, Springer Netherlands, Dordrecht. unloading the central function of the Elg1/ATAD5 replica- Tuusa, J., Uitto, L. and Syväoja, J.E. (1995) Human DNA tion factor C-like complex? Cell Cycle, 12, 2570-2579. polymerase epsilon is expressed during cell proliferation in Roles of silkworm DNA replication factors 29

a manner characteristic of replicative DNA polymerases. Leo, E., Fu, H., Aladjem, M., Pommier, Y., Appella, E. and Nucleic Acids Res. 23, 2178-2183. Deng, C.-X. (2014) SIRT1 deacetylates TopBP1 and modu- Uhlmann, F., Cai, J., Gibbs, E., O’Donnell, M. and Hurwitz, J. lates intra-S-phase checkpoint and DNA replication origin (1997) Deletion analysis of the large subunit p140 in human firing. Int. J. Biol. Sci., 10, 1193-1202. replication factor C reveals regions required for complex Yeeles, J.T.P., Deegan, T.D., Janska, A., Early, A. and Diffley, formation and replication activities. J. Biol. Chem., 272, J.F.X. (2015) Regulated eukaryotic DNA replication origin 10058-10064. firing with purified proteins. Nature, 519, 431-435. Wang, R.-H., Lahusen, T.J., Chen, Q., Xu, X., Jenkins, L.M.M.,