bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
1
2 FOXS1 is a Master Regulator of Pathological Epithelial to Mesenchymal Transition in Human
3 Epithelia
4
5
6 Timothy A Blenkinsop1, Tomasz Swigut 3, Nathan Boles2, Rajini Srinivasan3, Alvaro Rada-
7 Iglesias.5, Qingjie Wang2, Jeffrey H Stern2, Joanna Wysocka3,4, Sally Temple2#
8
9
10 1Icahn School of Medicine at Mount Sinai, New York, NY, 10029, USA
11 2Neural Stem Cell Institute, Rensselaer NY, 12144, USA
12 3Stanford University, Stanford, CA, 94305, USA
13 4Howard Hughes Medical Institute, Stanford, CA, 94305, USA
14 5University of Cologne, Cologne, 50931, Germany.
15
16
17 # Corresponding Author:
18 Contact info: [email protected], phone: (518) 694 8188, fax: (518) 694 8187
19
20 Running head: Epigenetics of RPE in EMT
21
22 Word count: main text: 2888 abstract: 148 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
23
24 Abstract
25 Epithelial to mesenchymal transition (EMT) is a biological process involved in normal tissue
26 morphogenesis and also in disease pathology. It causes dramatic alterations in cell morphology,
27 migration, proliferation, and phenotype. We captured the global transcriptional and epigenetic
28 programs elicited when polarized, cobblestone human retinal pigment epithelial (RPE) cells
29 were stimulated to undergo EMT, a process associated with several retinal pathologies. The
30 reorganization of chromatin landscapes occurred preferentially at distal enhancers, rather than
31 promoter regions, accompanied by 3136 significantly changing genes. Of the 95 significantly
32 changing transcription factors, FOXS1 was most upregulated. Loss and gain of function
33 experiments demonstrated that FOXS1 is upstream of canonical EMT regulators, and can
34 stimulate EMT in RPE and other epithelia. Inhibition of p38, stimulated by combined action of
35 the EMT-inducing factors, TGFβ1 and TNFα, dampened FOXS1 expression. An increase of FOXS1
36 in several cancers indicates it has a role in several EMT-involved pathologies.
37
38
39
40
41 Introduction
42 During EMT, epithelial cells change phenotype, lose cell polarity and typically become migratory
43 and proliferative 1. Several pathological conditions involve EMT-related processes resulting in
44 cell invasion and metaplasia. In the retina, the retinal pigment epithelium (RPE) forms a single, bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
45 non-proliferative epithelial cell layer that supports neural retinal functions. RPE cells are
46 polarized and are connected by tight junctions that form the blood-retina barrier. In
47 pathological conditions, the RPE can undergo EMT and delaminate, migrating through the
48 retina into the vitreous. There the cells proliferate and acquire mesenchymal characteristics,
49 leading to epiretinal membrane formation, such as seen in proliferative vitreoretinopathy
50 (PVR), the most damaging source of retinal detachment and vision loss in developed countries
51 2. While many factors have been associated with RPE changes in PVR, the critical factors and the
52 changes they elicit in RPE that lead to its contribution in PVR are unknown.
53
54 We found that TGFβ1 and TNFα pathways synergistically activate an EMT program in adult
55 human RPE, producing changes similar to those observed in PVR. To characterize the molecular
56 mechanism underlying this cellular transition, we mapped epigenomic and transcriptional
57 changes and identified a set of transcription factors that are upregulated upon EMT induction in
58 the adult RPE. Among those, we found that FOXS1, while not expressed in normal RPE, is highly
59 induced in response to TGFβ1 and TNFα and, notably, is present in patient PVR biopsy. We
60 found that FOXS1 is upstream of canonical regulators of the EMT program, SNAIL and SLUG, in
61 RPE cells. Furthermore, consistent with a more general role in promoting EMT in various
62 biological contexts, FOXS1 also induced SNAIL expression in human mammary cells and
63 activated SLUG and TWIST expression in hepatic epithelial cells, driving them towards EMT.
64 Finally, increased copy number of the FOXS1 gene locus is found in numerous metastatic cancer
65 studies. These observations identify FOXS1 as a master regulator of EMT that could play a
66 driving role in several pathological contexts. bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
67
68 Results
69 TGFβ1 and TNFα have long been known to be present in the vitreous of patients with PVR 3 and
70 both gene loci have SNP risk associations with PVR 4,5. Hence, we hypothesized that when
71 applied to human RPE, their combination may model the PVR disease state.
72
73 RPE cells were isolated and expanded from adult human cadaver globes, then differentiated
74 into a quiescent polarized cobblestone monolayer 6 (Fig. 1A). The resulting cobblestone RPE
75 cells at passage 0 were treated with RPE with TGFβ1 + TNFα (TNT) for 5 days, and gene
76 expression tested by qPCR on RPE lines from three different donors, with measurements
77 reported as mean ± SEM. TNT treatment led to the synergistic upregulation of EMT master
78 transcription factors SNAIL, SLUG and TWIST (Fig. 1B). SNAIL expression increased 112.23 ±
79 27.91 (fold over control, set at one), P < 0.01 (n=3), after TNT treatment, whereas TGFβ1 alone
80 increased by 7.89 ± 2.21, P < 0.05 (n=3), and the TNFα change was not significant. SLUG
81 expression increased 36.08 ± 6.31, P < 0.01 (n=3), in TNT treatment, while TGFβ1 alone and
82 TNFα alone had little effect. TWIST expression increased 11.26 ± 1.05, P < 0.01 (n=3), in TNT
83 compared to control, while TGFβ1 increased TWIST expression by 6.36 ± 1.91, P <0.05 (n=3),
84 and TNFα had little effect.
85
86 In addition to EMT transcription factor expression, TNT treatment induced a profound change
87 in cell morphology, produced three-dimensional (3D) cell masses (Fig. 1C), and activated
88 expression of αSMA and SNAIL (Fig. 1D,E), markers reported in PVR membranes surgically bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
89 dissected from patients 7,8. To corroborate these findings with PVR disease, we next compared
90 5-day TNT treated versus untreated (vehicle control) RPE cells from 4 different donors to PVR
91 membranes removed from four different patients (Fig. 1F). The PVR membranes expressed
92 MITF at significantly higher levels 0.21 ± 0.79, P < 0.01 (mean +/- S.E.M; n=4) compared to
93 control RPE (normalized to one for each sample), and compared to RPE treated with TNT 0.055
94 ± 0.023, P <0.01 (n=4). BEST1 expression in PVR membranes varied widely 19.48 ± 14.47, P >
95 0.05, (n=4), not significantly different from control RPE or TNT treated RPE 2.63 ± 2.63, P > 0.05,
96 (n=4). SNAIL expression was significantly increased in PVR membranes 12.5 ± 2.13, P < 0.01,
97 (n=4), compared to control RPE normalized to one, consistent with SNAIL expression of RPE
98 treated with TNT 22.51 ± 1.46, P < 0.01, (n=4). Taken together, the in vitro TNT model induces
99 changes in RPE similar to those observed in PVR membranes. We therefore used this model to
100 examine the cellular changes TNT evokes in RPE.
101
102 One of the known signaling pathways downstream of both TGFβ and TNFα, and therefore a
103 candidate for their synergistic effect in RPE is the p38 MAPK pathway. To determine whether
104 this was the case for human RPE, we examined whether TNT treatment induces p38 nuclear
105 localization in RPE cells, testing this on five different donor lines. Indeed, p38 was found to be
106 preferentially localized in RPE nuclei in the TNT conditions 81.69 ± 1.17, P <0.01 (n= 167 cells)),
107 compared to control 65.61 ± 1.02 (n= 144)), TGFβ 62.32 ± .99, (n=161)) or TNFα alone 65.4 ±
108 1.03 (n= 125)) (Fig. 1G). Inhibiting p38 with the small molecule SB202190 (10ng/ml) prevented
109 3D mass formation (Fig. 1H) and suppressed SNAIL 0.04 ± 0.0067, P < 0.01 (n=7) and SLUG 0.34
110 ± 0.09, P < 0.01, (n=7), but not TWIST gene expression compared to the TNT condition (Fig. 1I). bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
111
112 In order to evaluate which additional transcription factors (TFs) may be involved in RPE-EMT,
113 we compared cobblestone RPE and RPE with TGFβ1 alone, TNFα alone or TNT for five days via
114 RNA-sequencing using 2 different donor RPE lines. 3136 genes were found to change
115 significantly between the control and TNT conditions (FDR=0.01), and of those, 95 were known
116 transcription factors. FOXS1 was the most changed TF between these conditions (Fig. 1J).
117
118 We then asked whether p38 activation, induced by TNT was important in inducing FOXS1
119 expression in seven experiments using four different donor lines. When SB202190 (10ng/ml)
120 was added with TNT treatment, FOXS1 expression was suppressed from 60.5 ± 17.19 to 2.57 ±
121 1.29, P < 0.01, (mean+/- S.E.M., n=7) (Fig. 1K), implying FOXS1 is downstream of p38. FOXS1 is
122 expressed in peri-endothelial cells of the testis vasculature 9, in the aorta 10 and during the
123 migration of neural crest derived sensory neurons 11, however it has not previously been linked
124 to EMT. Hence, we have identified key steps along a cascade of changes during RPE
125 transformation from an epithelial to mesenchymal phenotype. To further elucidate the events
126 occurring in RPE EMT, we examined accompanying changes in the epigenome.
127
128 Changes in gene expression patterns during cell fate transitions are associated with changes in
129 the epigenomic status at cis-regulatory elements. In particular, many distal enhancers are
130 activated or decommissioned in a highly cell state-specific manner and this is accompanied by,
131 respectively, gain or loss of certain chromatin marks (reviewed in 12). To systematically
132 characterize epigenomic changes in RPE after EMT, we performed chromatin bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
133 immunoprecipitation and sequencing (ChIP-seq) analysis with antibodies recognizing histone
134 modifications marking active regulatory elements (H3K4me1, H3K4me3, and H3K27ac) using
135 either control cobblestone RPE cells or those treated for 5 days with TNT. First, we examined
136 genome-wide enrichments of H3K27ac, a histone modification associated with active enhancer
137 and promoter states 13,14. Comparisons between untreated or TNT treated RPE revealed a major
138 reorganization of H3K27ac patterns upon EMT, with a large number of sites gaining, and a
139 smaller subset of sites losing H3K27ac in TNT conditions (Fig. 2A). Based on the relative
140 enrichments between the two cellular states, we defined top H3K27ac sites preferentially
141 enriched in TNT conditions (“TNT-specific”, highlighted in red) or untreated RPE (“RPE-specific”,
142 highlighted in blue), and a similar number of sites at which H3K27ac enrichment changed least
143 during treatment (“shared”, shown in orange) (Fig. 2A).
144
145 We then analyzed H3K4me1, a histone mark associated with enhancer elements at the three
146 classes of H3K27ac sites (as defined in Fig. 2D) and observed that changes in H3K4me1
147 generally followed those in H3K27ac: TNT-specific H3K27ac sites had high levels of H3K4me1 in
148 TNT, but not in control RPE and vice versa, whereas shared H3K27ac sites were similarly
149 enriched in both states (Fig. 2B). These observations suggested that major reorganization of
150 H3K27ac patterns might occur at distal enhancer regions rather than proximal promoters. To
151 confirm this, we examined changes in H3K27ac in relation to the H3K4me1/H3K4me3 signal
152 ratio, because relative enrichment of H3K4me1 to H3K4me3 can reliably distinguish putative
153 distal enhancers from promoters (with enhancers having high H3K4me1 and promoters
154 H3K4me3 enrichment) 15. We observed that sites that either gained or lost H3K27ac in TNT RPE bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
155 (highlighted in red or blue, as defined in Fig. 2A) were generally characterized by the high
156 H3K4me1/H3K4me3 ratio, consistent with enhancer identity, whereas unchanged sites (orange)
157 often had low H3K4me1/H3K4me3 ratio, consistent with a large subset of the latter sites having
158 promoter identity (Fig. 2C). In further agreement, dynamically changing H3K27ac sites were
159 preferentially located more than 10 kb from the nearest transcriptional start site (TSS), whereas
160 unchanged sites showed no such preference (and in fact were more enriched in TSS proximity)
161 (Fig. 2D). Functional annotation of these dynamically changing putative enhancer regions
162 revealed association of RPE-specific enhancers with retinal epithelium, visual perception and
163 retinal degeneration categories, whereas enhancers active preferentially in TNT treated cells
164 were enriched for annotations linked to vascular abnormalities (which with the EMT results,
165 may suggest a role in vascular cell migration), cell growth and proliferation (Fig. 2. figure
166 supplements 1-3). Taken together, our data show that EMT in RPE cells is associated with a
167 global reorganization of chromatin landscapes that occurs preferentially at distal enhancer
168 elements.
169
170 Next, we associated H3K27ac regions within each class defined in Fig. 2A with nearby genes and
171 investigated the relationship with changes in expression observed during the RPE to TNT
172 transition (Fig. 2E). We observed that genes associated with RPE-specific H3K27ac were
173 commonly downregulated during the transition, whereas genes associated with TNT-specific
174 H3K27ac were commonly upregulated in TNT treated cells as compared to cobblestone RPE
175 (Fig. 2E). Loci encoding TFs that changed expression during the transition (denoted in Fig. 1J),
176 also typically underwent reorganization of enhancer H3K27ac patterns, as exemplified by the bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
177 FOXS1 locus, which gains high levels of H3K27ac and H3K4me1 at nearby putative enhancer
178 regions (Fig. 2F).
179
180 These transcriptomic and epigenomic analyses predict that FOXS1 may be a key TF involved in
181 orchestrating RPE EMT. Consistent with this hypothesis, FOXS1 was expressed much more in
182 the PVR samples, 49.66 ± 20.28 fold, P < 0.01, (mean+/- S.E.M., n=4 donors) compared to
183 cobblestone RPE (Fig. 3A). We then asked whether FOXS1 is upstream or downstream of the
184 canonical master EMT regulators SNAIL, SLUG and TWIST. FOXS1 shRNA inhibited the increase
185 in SNAIL 0.07 ± 0.026, P < 0.01, (n=4) and SLUG 0.24 ± 0.12, P < 0.01 (n=4) during TNT treatment
186 (Fig. 3B) and prevented 3D mass formation (Fig. 3C). Overexpression of FOXS1 for 5 days
187 induced expression of SNAIL 23.88 ± 4.2, P < 0.01 (Mean+/-S.E.M., n=3 donors), SLUG 1.94 ±
188 0.17, P < 0.01 (n=3) and TWIST 2.98 ± 0.96, P < 0.01 (n=3) over RPE control (Fig. 3D), reduced
189 expression of the RPE markers MITF 0.05 ± 0.01, P < 0.01 (n=3) and OTX2 0.26 ± 0.07, P < 0.01
190 (n=3), but increased BEST1 expression to 13.79 ± 4.12, P < 0.01 (n=3) (Fig. 3E), changes
191 consistent with those seen upon TNT treatment and in PVR patient samples. However, FOXS1
192 overexpression alone did not induce 3D mass formation (Fig. 3F). FOXS1 is therefore necessary
193 and sufficient to change SNAIL and SLUG gene expression.
194
195 The observation that FOXS1 regulates canonical EMT transcription factor expression led us to
196 ask whether it plays a role in EMT in other epithelia, including human mammary epithelium
197 (HME) and human hepatic epithelium (HHE). HME cells treated with TNT showed increased
198 expression of both FOXS1 and SNAIL (Fig. 4A), but not SLUG or TWIST (data not shown). p38 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
199 inhibition blocked the expression of both FOXS1 from 8.44 ± 0.61 to 0.23 ± 0.1, P < 0.01
200 (mean+/-S.E.M., n=3 donors) and SNAIL from 16.23 ± 8.59 to 0.91 ±0.29, P < 0.01 (n=5) in HME
201 under TNT conditions (Fig. 4A). Knocking down FOXS1 during TNT treatment in HME cells
202 decreased SNAIL expression to 0.096 ± 0.16, P < 0.01 (n=3) compared to RPE control (Fig. 4A),
203 while overexpression of FOXS1 induced SNAIL expression by 3.35 ± 0.58 fold, P < 0.01 (n=3),
204 which is also seen at the protein level (Fig. 4B). Therefore, TGFβ1 and TNFα signaling synergizes
205 through p38, leading to an increase in FOXS1, which then induces an increase in SNAIL
206 expression in HME. Similar studies in HHE cells (Fig. 4C) indicate that FOXS1 is sufficient but not
207 necessary to induce expression of SLUG, and necessary and sufficient to change TWIST
208 expression.
209
210 Since EMT is hypothesized to play a role in the metastasis in many cancers, we examined the
211 incidence of FOXS1 changes in several cancer studies 16,17. Out of 91 whole genome sequencing
212 tumor studies analyzed, 47 included at least one case of multiple copies of the FOXS1 gene (Fig.
213 4D), 14 had greater than 5% of cases and in one uterine cancer study, 23% of cases had multiple
214 copies of FOXS1. Based on our observations of a central role in EMT, we hypothesize that
215 FOXS1 may be involved in the metastatic invasion of cancer cells.
216
217
218 Discussion
219 EMT is a complex, multifactorial process resulting in profound changes in cell phenotype and
220 behavior. The molecular mechanism underlying EMT is still not completely resolved. In this bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
221 study we defined the global transcriptomic and epigenomic changes associated with EMT in
222 human RPE cells. Subsequent analysis elucidated factors associated with EMT-linked pathology
223 in several cell types, and identified FOXS1 as a key driver of the process, and a novel upstream
224 factor which regulates known master EMT transcription factors.
225
226 Here we show that TGFβ1 or TNFα treatment alone cause slight alterations in RPE morphology,
227 but together they cause a dramatic induction of EMT, during which the RPE cells lose their
228 normal cobblestone configuration and grow into 3D masses that lose key RPE features and gain
229 mesenchymal characteristics. The synergistic action of these factors in stimulating EMT has
230 been reported for non-neural epithelia, including from the lung 18 and colon 19, and in the latter
231 case, they do so via p38-MAPK signaling, implying a common mechanism is shared by neural
232 epithelia. TNT treatment resulted in numerous changes in the RPE epigenome, with a bias
233 towards gene activation. The changes in active chromatin signatures occurred largely at distal
234 enhancers, while promoters were much less affected, consistent with enhancers serving as key
235 mediators of changes in cell states and being utilized in a highly dynamic manner (reviewed in
236 12). GO analysis of the significantly changing enhancers highlighted those associated with
237 extracellular remodeling, vasculature, wound healing, and cell proliferation, which align with
238 the stimulation of cell proliferation and migration apparent in the cultures. The changes
239 occurred within 5 days of treatment, demonstrating that stable cobblestone RPE can rapidly
240 disassemble and form 3D masses in the presence of stimulating environmental factors.
241 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
242 Single nucleotide polymorphisms which confer a significantly increased risk of PVR have been
243 located at both TGFβ15 and TNFα4 genetic loci. Moreover, TGFβ1 and TNFα have both been
244 reported at increased levels in the vitreous of patients with epiretinal membranes 3,20 and
245 TGFβ1 in particular is associated with their maturation into contractile masses that lead to
246 retinal detachment and severe vision loss 21, providing the impetus for use of Rho-kinase
247 inhibitors to prevent the myosin-based contractions. While inhibition of contraction of already
248 formed epiretinal membranes is a valuable therapeutic approach, by determining the causes of
249 RPE EMT, our goal is to identify targets that inhibit the production of these membranes at an
250 earlier stage of the disease.
251
252 Within 5 days of EMT induction, RPE cells increase expression of 95 transcription factors that
253 may play roles in activating the pleiotropic phenotypic changes. Of these, the most dramatic
254 increase occurs in FOXS1, which is not detectable in the control cobblestone RPE. Changes in
255 histone marks surrounding the FOXS1 gene locus were consistent with its activation. We have
256 corroborated expression of FOXS1 in patient PVR samples. Most importantly, knockdown of
257 FOXS1 inhibited production of 3D masses, and was found to be both necessary and sufficient to
258 drive the canonical EMT master regulators SNAIL and SLUG in human RPE cells. These
259 observations implicate FOXS1 induction as an early, causal factor in pathological RPE EMT
260 (modeled in Figure 5), and raise questions about the specific targets of FOXS1, which will be the
261 focus of future studies. Our finding that p38 inhibition can prevent the increase in FOXS1 raises
262 the possibility of an early intervention in this pathological process.
263 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
264 In addition to its action in RPE cells, we demonstrated that FOXS1 can act as a master
265 transcription factor in EMT in other cells, as it is upstream of the canonical EMT transcription
266 factors SNAIL, SLUG and TWIST in two non-neural epithelial cell types tested. The FOXS1 gene
267 can be hypomethylated in adrenocortical neoplasms 22 and demonstrates increased copy
268 number across a variety of cancers. Given that FOXS1 is not expressed in normal RPE nor in
269 other adult epithelia, its expression and involvement in pathological EMT indicate it may be a
270 valuable therapeutic target across several tissue types.
271
272 Acknowledgements
273 We thank Dr. Barbara Corneo for manuscript review, Carol Charniga and Dr. Marie Fernandes
274 for their invaluable help with eye dissection and cell culture, and the eye donors and their
275 families for the generous donation of retinal tissue. This study was supported by a National Eye
276 Institute (NEI; Bethesda, MD, USA) extramural grant (1R01EY022079; ST) and by NYSTEM
277 through a retinal stem cell consortium grant (N11C012) and by the Icahn School of Medicine at
278 Mount Sinai (TAB) and by a gift from Dr. Heinrich Medicus to the Regenerative Research
279 Foundation (S.T. and J.H.S).
280
281 Author contributions
282 TAB, ST, JHS and JW conceived the experiments, and helped with data analysis, interpretation
283 and manuscript writing. TAB performed the experiments, analyzed data, made figures, and
284 wrote the manuscript. TAB and QW produced shRNA and overexpression FOXS1 lentiviruses, RS
285 prepared RNA and DNA for sequencing, TS and NB analyzed sequencing data and made figures. bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
286 ARI performed 1 ChIP-seq and data analysis. TAB wrote the initial manuscript draft, which was
287 edited primarily by ST and JW and additionally by TS, NB, RS, QW, JHS.
288
289 Author Information
290 Data deposition with URL and accession database numbers
291
292 Competing financial interests
293 TAB, JHS, ST have filed a provisional patent on the method by which FOXS1 is expressed in RPE
294 and RPE related diseases.
295 Correspondence
296 Correspondence and requests for materials should be addressed to
297 [email protected] for questions regarding experimentation,
298 [email protected] for conceptual questions, and [email protected] for
299 bioinformatic analytical questions.
300
301 Black Family Stem Cell Institute, Icahn School of Medicine at Mount Sinai, New York, NY,
302 10029, USA
303 Timothy A Blenkinsop
304
305 Macular Degeneration Program, Neural Stem Cell Institute, Rensselaer NY, 12144, USA
306 Nathan Boles, Qingjie Wang, Jeffrey H Stern, Sally Temple
307 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
308 Institute for Stem Cell Biology and Regenerative Medicine, Stanford University, Stanford, CA,
309 94305, USA
310 Tomasz Swigut, Rajini Srinivasan, Joanna Wysocka
311
312 Howard Hughes Medical Institute, Stanford, CA, 94305, USA
313 Joanna Wysocka
314
315 University of Cologne, Cologne, 50931, Germany
316 Alvaro Rada-Iglesias
317
318
319 References cited
320 1 Grisanti, S. & Guidry, C. Transdifferentiation of retinal pigment epithelial cells from epithelial to 321 mesenchymal phenotype. Invest Ophthalmol Vis Sci 36, 391-405 (1995). 322 2 Ho, P. C., Yoshida, A., Schepens, C. L., McMeel, J. W. & Duncan, J. E. Severe proliferative 323 vitreoretinopathy and retinal detachment. I. Initial clinical findings. Ophthalmology 91, 1531- 324 1537 (1984). 325 3 Limb, G. A. et al. Cytokines in proliferative vitreoretinopathy. Eye (Lond) 5 ( Pt 6), 686-693, 326 doi:10.1038/eye.1991.126 (1991). 327 4 Rojas, J. et al. A strong genetic association between the tumor necrosis factor locus and 328 proliferative vitreoretinopathy: the retina 4 project. Ophthalmology 117, 2417-2423 e2411- 329 2412, doi:S0161-6420(10)00378-7 [pii] 330 10.1016/j.ophtha.2010.03.059 (2010). 331 5 Sanabria Ruiz-Colmenares, M. R., Pastor Jimeno, J. C., Garrote Adrados, J. A., Telleria Orriols, J. J. 332 & Yugueros Fernandez, M. I. Cytokine gene polymorphisms in retinal detachment patients with 333 and without proliferative vitreoretinopathy: a preliminary study. Acta Ophthalmol Scand 84, 334 309-313, doi:10.1111/j.1600-0420.2005.00600.x (2006). 335 6 Blenkinsop, T. A. et al. Human Adult Retinal Pigment Epithelial Stem Cell-Derived RPE 336 Monolayers Exhibit Key Physiological Characteristics of Native Tissue. Invest Ophthalmol Vis Sci 337 56, 7085-7099, doi:10.1167/iovs.14-16246 (2015). 338 7 Tomasek, J. J., Gabbiani, G., Hinz, B., Chaponnier, C. & Brown, R. A. Myofibroblasts and 339 mechano-regulation of connective tissue remodelling. Nature reviews. Molecular cell biology 3, 340 349-363, doi:10.1038/nrm809 (2002). bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
341 8 Abu El-Asrar, A. M., Missotten, L. & Geboes, K. Expression of myofibroblast activation molecules 342 in proliferative vitreoretinopathy epiretinal membranes. Acta Ophthalmol 89, e115-121, 343 doi:10.1111/j.1755-3768.2010.01916.x (2011). 344 9 Sato, Y. et al. Importance of forkhead transcription factor Fkhl18 for development of testicular 345 vasculature. Molecular reproduction and development 75, 1361-1371, doi:10.1002/mrd.20888 346 (2008). 347 10 Cederberg, A. et al. Chromosome localization, sequence analysis, and expression pattern 348 identify FKHL 18 as a novel human forkhead gene. Genomics 44, 344-346, 349 doi:10.1006/geno.1997.4864 (1997). 350 11 Montelius, A. et al. Emergence of the sensory nervous system as defined by Foxs1 expression. 351 Differentiation 75, 404-417, doi:10.1111/j.1432-0436.2006.00154.x (2007). 352 12 Calo, E. & Wysocka, J. Modification of enhancer chromatin: what, how, and why? Mol Cell 49, 353 825-837, doi:10.1016/j.molcel.2013.01.038 (2013). 354 13 Creyghton, M. P. et al. Histone H3K27ac separates active from poised enhancers and predicts 355 developmental state. Proc Natl Acad Sci U S A, doi:1016071107 [pii] 356 10.1073/pnas.1016071107 (2012). 357 14 Rada-Iglesias, A. et al. A unique chromatin signature uncovers early developmental enhancers in 358 humans. Nature, doi:nature09692 [pii] 359 10.1038/nature09692 (2010). 360 15 Heintzman, N. D. et al. Distinct and predictive chromatin signatures of transcriptional promoters 361 and enhancers in the human genome. Nat Genet 39, 311-318, doi:ng1966 [pii] 362 10.1038/ng1966 (2007). 363 16 Cerami, E. et al. The cBio cancer genomics portal: an open platform for exploring 364 multidimensional cancer genomics data. Cancer discovery 2, 401-404, doi:10.1158/2159- 365 8290.CD-12-0095 (2012). 366 17 Gao, J. et al. Integrative analysis of complex cancer genomics and clinical profiles using the 367 cBioPortal. Science signaling 6, pl1, doi:10.1126/scisignal.2004088 (2013). 368 18 Yamauchi, Y. et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal 369 transition and cell contraction induced in A549 human alveolar epithelial cells by transforming 370 growth factor-beta1. Experimental lung research 36, 12-24, doi:10.3109/01902140903042589 371 (2010). 372 19 Bates, R. C. & Mercurio, A. M. Tumor necrosis factor-alpha stimulates the epithelial-to- 373 mesenchymal transition of human colonic organoids. Molecular biology of the cell 14, 1790- 374 1800, doi:10.1091/mbc.E02-09-0583 (2003). 375 20 Bochaton-Piallat, M. L. et al. TGF-beta1, TGF-beta receptor II and ED-A fibronectin expression in 376 myofibroblast of vitreoretinopathy. Invest Ophthalmol Vis Sci 41, 2336-2342 (2000). 377 21 Kita, T. et al. Role of TGF-beta in proliferative vitreoretinal diseases and ROCK as a therapeutic 378 target. Proc Natl Acad Sci U S A 105, 17504-17509, doi:10.1073/pnas.0804054105 (2008). 379 22 Schillebeeckx, M. et al. Novel markers of gonadectomy-induced adrenocortical neoplasia in the 380 mouse and ferret. Molecular and cellular endocrinology 399, 122-130, 381 doi:10.1016/j.mce.2014.09.029 (2015). 382 23 Blenkinsop, T. A., Salero, E., Stern, J. H. & Temple, S. The culture and maintenance of functional 383 retinal pigment epithelial monolayers from adult human eye. Methods Mol Biol 945, 45-65, 384 doi:10.1007/978-1-62703-125-7_4 (2013). 385 24 Phoenix, T. N. & Temple, S. Spred1, a negative regulator of Ras-MAPK-ERK, is enriched in CNS 386 germinal zones, dampens NSC proliferation, and maintains ventricular zone structure. Genes Dev 387 24, 45-56, doi:10.1101/gad.1839510 (2010). bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
388 25 Wang, Q., Yang, L., Alexander, C. & Temple, S. The niche factor syndecan-1 regulates the 389 maintenance and proliferation of neural progenitor cells during mammalian cortical 390 development. PLoS One 7, e42883, doi:10.1371/journal.pone.0042883 (2012). 391 26 Rada-Iglesias, A. et al. A unique chromatin signature uncovers early developmental enhancers in 392 humans. Nature 470, 279-283, doi:nature09692 [pii] 393 10.1038/nature09692 (2011). 394 27 Buecker, C. et al. Reorganization of enhancer patterns in transition from naive to primed 395 pluripotency. Cell Stem Cell 14, 838-853, doi:10.1016/j.stem.2014.04.003 (2014). 396 397 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
398 Figures
399 Figure 1
A B LOG SNAIL LOG SLUG TWIST Dissect Scrape 10 10 15 100 ** 100 Control Control Control ** ** TGFβ TGFβ ** TGFβ ) A
N 10 R 10 TNFα 10 TNFα TNFα m
Vitreous (
. TNT TNT TNT Plate t uan Q . e 5 R 1 1 Culture 4 months
0 0 0 0 1 3 5 0 1 3 5 0 1 3 5 0 1 3 5 0 1 3 5 0 1 3 5 0 1 3 5 0 1 3 5 0 1 3 5 0 1 3 5 0 1 3 5 0 1 3 5 Day Day Day C D αSMA E SNAIL Control TGFβ
Control TGFβ Control TGFβ Control TGFβ TNFα TNT
TNFα TNT TNFα TNT TNFα TNT
G Control TGFβ TNFα TNT F 9 0 1.5 )
A MITF N ** R 8 0 m (
. 1.0 t NLB
uan 7 0 Q .
e 0.5 R ** ** 6 0 0.0 TGFβ + + + R T TNFα + PE R PV TN H 60 30 BEST1 SNAIL ) ) A A ** N N R R m m ( ( 40 20
. . t t
uan uan ** Q Q . 20 . 10 e e R R
0 0 E R T R T P V PE V R P TN R P TN Control TGFβ TNFα TNT TNT + SB202190
I J K 10 FOXS1 SNAIL SLUG TWIST FOXS1 ) FOXL1 HIC1
500 5 A 600 4 MT3 POU2F2 CREB3L1 ) A N 100 e SOX17 R g 400 POU3F2 TCF4 VDR N R m ** ** 80 ( 3
m . ( t 400 0 ** 300 .
** t 60 2 uan
** old Chan uan 200 F Q HLF FOXQ1SOX8 40 2 . 200 TEF OTX2 Q e . 1 -5 PGR CSRNP3 R
e 20 100 OG DRGX GSX2 MITF R ** L KLF15 HNF4A ** 0 0 0 NR2E1 0 TGFβ + + + + + + + + + -10 TGFβ + + + + + + TNFα + + + + + + + + + TNFα + SB202190 + + + 1e+01 1e+02 1e+03 1e+04 1e+05 SB202190 400 Mean expression bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
401 Figure 1. TGFβ1+TNFα co-treatment of cobblestone RPE induces PVR-like EMT 3D masses. A)
402 Schematic of the method to obtain pure cultures of RPE. B) Time course of SNAIL, SLUG and
403 TWIST expression in control (cobblestone RPE, vehicle treated) and when treated with 10ng/ml
404 of TGFβ1 and/or TNFα. (C-E) Comparison of RPE cells in control conditions or 5 days after
405 treatment with 10ng/ml of TGFβ1 and/or TNFα. C) Phase images D) Immunostaining with anti-
406 SNAIL antibody. E) Immunostaining with anti-αSMA antibody. F) Fundus images of patient with
407 PVR membranes (indicated by dotted line) and gene expression comparison between TNT RPE
408 and PVR samples from two patients. G) Immunofluorescence of p38 localization Inset:
409 DAPI:blue, p38: green (NL=nuclear luminescence. H) Phase contrast images of RPE at day 5 of
410 treatment indicated. I) qPCR of SNAIL, SLUG and TWIST from RPE after 5 days of treatment
411 indicated. J) Scatterplot of RNA-seq data from cobblestone RPE versus TNT RPE with
412 transcription factors highlighted; blue= increased and red= decreased expression. K) qPCR of
413 FOXS1 transcript after treatment indicated. Graph bars indicate SEM. Image scale Bars = 50μm.
414 ** = P-value ≤ 0.01.
415 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
416 Figure 2 TNT [ChIP signal] TNT [ChIP signal] TNT [ChIP
TNT [ChIP signal] TNT [ChIP signal] H3K4me3 H3K4me1 TNT:log
H3K4me1 RPE:log distance from TSS [bp] log2 fold expression changes of the closest gene H3K4me3
5 kb
417 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
418 Figure 2. TGFβ1+TNFα co-treatment of cobblestone RPE induces massive epigenetic changes
419 at enhancer elements. A) TGFβ1+TNFα co-treatment induced changes in H3K27 acetylation:
420 ordinate - normalized read density of H3K27ac ChIP-seq at chromatin features (putative
421 enhancers and promoters) in cobblestone RPE cells, abscissa - normalized read density of
422 H3K27ac ChIP-seq in TGFβ1+TNFα treated cells. Regions indicated in red have significantly
423 upregulated ChIP signal upon TGFβ1+TNFα treatment (FDR<0.01), in blue downregulated
424 (FDR<0.01), in orange with no change (FDR<0.1). B) Changes in the H3K4me1 ChIP signal are
425 correlated with H3K27ac changes, regions are color coded according to the H3K27ac classes
426 defined in the previous panel C) TGFβ1+TNFα co-treatment results in relatively few changes in
427 promoter signatures. Plotted is the log ratio of H3K4me1 versus H3K4me3 ChIP density; RPE on
428 the ordinate, treated cells on the abscissa. Negative values are indicative of a promoter-like
429 chromatin signature at interrogated sites. Color-coding as in previous panels. D) Most changes
430 in H3K27 acetylation occur at sites distal from annotated transcription start sites. Plotted is the
431 absolute distance to the closest annotated TSS versus the log2 fold change in the H3K27ac ChIP
432 signal. E) Changes in H3K27ac are correlated with changes in gene expression. Plotted are the
433 distribution of log2 fold expression changes for genes associated with distal elements that have
434 upregulated H3K27ac (red), downregulated H3K27ac (blue) or were unchanged (orange). The
435 differences are significant (Mann-Whitney-Wilcoxon test). F) Visualization of the histone
436 modification changes at the FOXS1 locus after TGFβ1+TNFα treatment in the UCSC browser;
437 H3K27ac density in green, H3K4me1 in blue. Location of two major FOXS1 enhancers is
438 indicated by black bars.
439 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
440 Figure 3 n A n FOXS1 B 2.0 FOXS1 SNAIL SLUG TWIST o o 2.0 2.0 2.0 t t a a 10000 c c fi fi 1.5 1.5 t t 1.5 1.5 1000 ** quan quan 100 1.0
** 1.0 1.0 1.0 e e v v
t 10 t a a l l 0.5 0.5 0.5 0.5 e e r r 1 **
A A ** 0.1 0.0 ** 0.0 0.0 0.0 RN RN
E D D D m m D + V + V + V + V K K K K RP PVR TNT T T T T 1 +S 1 +S 1 +S 1 +S N N N N T T T T T T T T XS XS XS XS N N N N T T T T FO FO FO FO C D
n FOXS1 SNAIL SLUG TWIST o 30 2.5 5 t ** a c 10000 ** 2.0 ** 4 fi t 1000 20 1.5 3 ** 100 quan 2 e 1.0
v 10 10 t a
l 0.5 1
e 1 r
A 0.1 0 0.0 0
TNT +SV TNT + FOXS1 KD RN SV FOXS1 OE SV FOXS1 OE SV FOXS1 OE SV FOXS1 OE m E F n o MITF OTX2 BEST t 2.0 20 a 2.0 c fi t 1.5 1.5 15 ** quan 1.0 1.0 10 e v t a
l 0.5 0.5 5 e ** r
A ** 0.0 0.0 0 RN SV FOXS1 OE SV FOXS1 OE SV FOXS1 OE m SV FOXS1 OE 441
442 Figure 3. FOXS1 is necessary and sufficient to drive SNAIL and SLUG expression in RPE. A)
443 qPCR gene expression comparison between TNT-RPE and PVR samples from two patients. B)
444 qPCR of RPE after 5 days of TNT and either a scrambled, or FOXS1 shRNA lentivirus treatment
445 and C) corresponding color images. qPCR gene expression comparison of RPE with either a
446 scrambled or FOXS1 overexpression lentivirus of EMT (D) and RPE (E) genes. F) Color images of
447 RPE at day 5 after treatment with either a scrambled or FOXS1 overexpression lentivirus. Image
448 Scale bars= 100mm. ** indicates P-value ≤0.01. Graph bars = SEM. SV=scrambled control
449 vector.
450 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
451 Figure 4
A B FOXS1 FOXS1 5 FOXS1 Control TGFβ 15 1.5 1.5x10 ** 5 10 ** 1.0 1.0x10 ** 5 5 0.5 .5x10 ** ** 0 0.0 0 l T V V 0 TNT + D S Contro TGFβ TNFα TN TNT + T + S TN FOXS1 OE SB20219 FOXS1 K TNFα TNT 30 SNAIL 1.5 SNAIL 5 SNAIL 4 ** 20 ** 1.0 3 0.5 2 10 ** 1 ** ** 0 0.0 0 l V T 0 TNT + D SV TGFβ TNFα TN TNT + T + S Contro TN FOXS1 OE SB20219 FOXS1 K
C FOXS1 FOXS1 FOXS1 SLUG 1.5 80000 150 10000 ** 60000 8000 1.0 100 ** 6000 * 40000 0.5 50 4000 ** 20000 2000 0.0 0 0 0 l l T 0 V D T 0 SV TGFβ TNFα TN Contro TGFβ TNFα TN TNT + Contro TNT + NT + S SB20219 T FOXS1 K FOXS1 OE SB20219 SLUG SLUG TWIST TWIST TWIST 1.5 15 10 1.5 20 8 15 1.0 10 ** 1.0 6 ** 10 0.5 5 4 0.5 ** 5 2 0.0 0 0 0.0 0 l V D V T 0 V D SV S TN TGFβ TNFα TNT + T + S NT + S Contro N T FOXS1 K FOXS1 OE SB20219 T FOXS1 K FOXS1 OE
D 25 64
FOXS1 NU
32 M
C ASES
N 20 16 IO T
W A
R 8 IT E H T FO L 15 A
4 XS 1 1 XS
A O 2 F L
T H E
T 10 I R
1 A W
TIO N ASES C 5 %
0 l l a a a l r r r e e e t t t r r L L s n n h h h g g g g g g d d 0 T C C e e M E ia ia v v r r rea AM AM AC Li Li Lun Lun Lun Lun Lun Lun a a GB Hea Hea c DLB CCL ladde ladde ladde Breas Breas Breas NCI-6 Uterin Uterin Uterin B B B MPNS Ov Ov Cervica an Prostate Prostate Stomac Stomac Stomac Sarcoma Sarcoma P Colorecta Colorecta Melanom Melanom Melanom Esophagus Esophagus STUDY ABBREVIATION 452 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
453 Figure 4. FOXS1 in EMT in other epithelia and cancer. A) qPCR of HME cells treated with TGFβ1
454 and/or TNFα with and without p38 inhibitor SB202190; Lentivirus treatment including a
455 scrambled, or FOXS1 shRNA in HME cells with TNT; lentivirus treatment of HME cells with either
456 a scrambled or FOXS1 overexpression construct. B) Immunofluorescence of HME cells treated
457 with TGFβ1 and TNFα stained with anti-SNAIL antibody. C) qPCR of HHE cells treated with
458 TGFβ1 and/or TNFα with and without p38 inhibitor SB202190; Lentivirus treatment including a
459 scrambled, or FOXS1 shRNA in HHE cells with TNT; lentivirus treatment of HHE cells with either
460 a scrambled, or FOXS1 overexpression construct. D) Cross cancer analysis shows FOXS1
461 alterations are present in 47 of 92 studies examined (See Sup Table 1). Graph scale bars = SEM.
462 Image scale Bars = 200μm. * = P-value ≤ 0.05. ** = P-value ≤ 0.01.
463 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
464 Figure 5
Extracellular space TGFβ
R TNF β α TGF
TNFαR plasma membrane
p38 Cytoplasm
nuclear pore nuclear membrane Epithelial cell
FOXS1 p38
Nucleus FOXS1
SNAIL SLUG TWIST
RPE PVR SNAIL αSMA Collagen
465
466 Figure 5. Model of the pathway of synergistic action of TGFβ and TNFα in transforming RPE
467 into 3D contractile tissue. TGFβ and TNFα bind to their respective receptors leading to a co-
468 activation of p38, which leads to p38 translocation into the nucleus and transcriptional
469 activation of FOXS1. FOXS1 expression leads to SNAIL, SLUG, and TWIST expression, driving an
470 epithelial to mesenchymal transition in RPE.
471 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
472 Methods
473 Human adult RPESC culture
474 Human globes from donors aged between 51 and 89 yrs were obtained from the National
475 Disease Research Interchange, Philadelphia, PA., the Eye-Bank for Sight Restoration, Inc., New
476 York, NY, and the Lions Eye Bank, Albany, NY. A detailed eye dissection protocol was previously
477 published 23. Globes were obtained within 40 hours of death, RPE sheets were isolated and
478 plated on tissue culture plates coated with 10μg/ml placental ECM (Corning) or Synthemax II
479 (Corning) in RPE medium 23, supplemented with 10% FBS and 10mM Nicotinamide, which was
480 changed 3 times a week. After the first week, FBS was reduced to 2%.
481
482 EMT model
483 Passage 0 adult human RPE cultures (ahRPE) were trypsinized using 0.25% Trypsin for 15
484 minutes, washed and replated at 3 x104 cells per 1.9mm2 per well of a 24-well plate in
485 DMEM/F12 with 5%FBS, L-Glutamine, Na-Pyruvate, NEAA, Pen/Strep. After 24 hours, 10ng/ml
486 TGFβ1 or TNFα, or both (TNT) were added to induce EMT versus vehicle as control, and the
487 cultures were maintained in this medium (with feeding every other day) for 5 days.
488
489 Immunohistochemistry
490 ahRPE on 24 well-size transwell inserts (Corning) were fixed with 4% paraformaldehyde for 10
491 minutes, rinsed 3 times with phosphate buffered saline (PBS), permeabilized with 0.01%
492 saponin and blocked with normal goat serum (5%) in 1% BSA in PBS for 1 hour. Primary
493 antibody (Table 1) was added overnight at 4oC, then incubated with the corresponding Alexa bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
494 Fluor conjugated secondary antibodies (1:1000) (Life Technologies Alexa Fluor 647 goat anti-
495 mouse IgG (H+L) (Cat#: A-21237), Alexa Fluor 647 goat anti-rabbit IgG (H+L) (Cat#: A-21244), at
496 room temperature for 45 minutes. Cells on transwell inserts were then mounted on glass slides
497 with Prolong gold (Life Technologies) and imaged by confocal microscopy (Leica). DAPI
498 fluorescence was used to demarcate the nucleus in experiments measuring nuclear p38. P38
499 fluorescence intensity was then measured exclusively in the DAPI demarcated region based on
500 a 0-256 scale using ImageJ analysis software. The fluorescence intensity of all nuclei was
501 averaged across experiments and compared between conditions using a student’s t-test.
502
503 qPCR
504 RNA was extracted (Qiagen) and reverse-transcribed (Superscript III Reverse Transcriptase kit)
505 then qPCR was performed according to manufacturer instructions (Power SybrGreen PCR
506 Master Mix) using primers in Table 2. Data was recorded as the cycle by which sybr
507 fluorescence detection threshold is reached during the exponential increase phase. All cycles
508 for queried genes were normalized to the housekeeping gene cyclophilin to control for cDNA
509 quantity variation.
Table 2 List of primers used for Real Time PCR on adult human RPE
Product Human Tann Gene Bank Forward 5'-3' Reverse 3'-5' Size Gene (oC) ID (bp)
RPE65 TACAGAAAGCACTGAGTTGAGC CCATTTAGTAAGTCCACATTCATTTCC 153 55 NM_000329 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
OTX2 CCATGACCTATACTCAGGCTTCAGG GAAGCTCCATATCCCTGGGTGGAAAG 211 60 NM_000326
MITF TTGTCCATCTGCCTCTGAGTAG CCTATGTATGACCAGGTTGCTTG 87 65 NM_004183
BESTROPHIN CCTTTATGGGCTCCACCTTCAACATC CAGTAGTTTGGTCCTTGAGTTTGCCC 166 65 NM_004183
SNAIL TGTCAGATGAGGACAGTGGGAAAGG CTGAAGTAGAGGAGAAGGACGAAGG 611 53 NM_005985
SLUG AGCGAACTGGACACACATAC TCTAGACTGGGCATCGCAG 410 55 NM_003068
TWIST GTCCGCAGTCTTAGCAGGAG GCTTGAGGGTCTGAATCTTGCT 156 60 NM_000474
FOXS1 AGTGGCATCTACCGCTACATC CACCTTGACAAAGCACTCGT 114 63 NM_004118
CYCLOPHILIN CTTGTCAATGGCCAACAGAGG GCCCATCTAAATGAGGAGTTGGT 82 60 NM_004792 G
510
511 Lentiviral vector production and viral packaging
512 shRNA plasmids: the hairpin oligonucleotides (Scrambled control: TTCTCCGAACGTGTCACGT;
513 FOXS1 3’ UTR: GCCAATAAAGCCATGTGAT) were inserted into the FUGW-H1 lentiviral construct
514 as previously described 24,25. To package the lentivirus, the constructs were co-transfected with
515 pCMV-VSVG and pCMV-dvpr into 293FT cells. Supernatant was harvested 2 and 3 days later and
516 concentrated by ultra-centrifugation. For overexpression constructs, the open reading frame
517 (ORF) of each gene was PCR-amplified, sequence-verified, and cloned into a modified version of
518 FUGW. An IRES-eGFP was included for visualization. Lentiviruses were used at 10 MOI for cell
519 transduction.
520 bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
521 ChIP-seq
522 ChIP assays were performed from 107 RPE cells per experiment, according to a previously
523 described protocol with slight modification 26. Briefly, RPE cells at passage 0 cultures were
524 treated with TGFβ1, TNFα or TNT conditions for 5 days. The cells were then with 1%
525 formaldehyde for 10 minutes at room temperature to crosslink, and the reaction was then
526 quenched by adding glycine at a final concentration of 0.125 M. Cells were dissolved in lysis
527 buffer and chromatin was sonicated to an average size of 0.5–2 kb, using Bioruptor
528 (Diagenode). 5–7.5 μg of antibody was added to the sonicated chromatin and incubated
529 overnight at 4°C. Subsequently, 50μl of protein G Dynal magnetic beads were added to the ChIP
530 reactions and incubated for 4–6 hr at 4°C. Magnetic beads were washed and chromatin eluted,
531 followed by reversal of crosslinks and DNA purification. ChIP-seq and input libraries were
532 prepared according to Illumina protocols and sequenced using the Illumina HiSeq. To identify
533 the approximate positions of regulatory elements from histone modification ChIP-seq profiles
534 alone, we calculated kernel density estimate tracks with bi-modal kernels 27 and identified
535 peaks in the product of the combined H3K27 and H3K4 signals. To analyze changes in histone
536 modifications, we calculated the read coverage for each sample over a combined set of
537 detected peaks and performed a differential analysis with DESeq2.
538
539 RNA-seq
540 RPE cells from two different donors were treated with TGFβ1, TNFα or TNT or vehicle control as
541 described above for 5 days, then the RNA was extracted with Trizol (Invitrogen), following the
542 manufacturer’s recommendations. 10ug of total RNA was subjected to two rounds of bioRxiv preprint doi: https://doi.org/10.1101/154369; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
543 purification using Dynaloligo-dT beads (Invitrogen) then fragmented with 10× fragmentation
544 buffer (Ambion) and used for first-strand cDNA synthesis, using random hexamer primers
545 (Invitrogen) and SuperScript II enzyme (Invitrogen). Second strand cDNA was obtained by
546 adding RNaseH (Invitrogen) and DNA Pol I (New England BioLabs). The resulting double-
547 stranded cDNA was used for Illumina library preparation and sequenced with the Illumina
548 HiSeq. Reads were mapped with tophat v2.0.14 to the gencode 23 transcriptome model and
549 the read coverage was calculated with htseq. Differential analysis was performed with DESeq2.
550