Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 2564-2575 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 9 Number 4 (2020) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2020.904.308 Morphological and Molecular Characterization of Gastrointestinal Nematodes in Sheep M. Veena1*, G. C. Puttalakshmamm1, K. J. Ananda2 and P. P. Sengupta3 KVAFSU, Department of Parasitology, Veterinary College, Hassan-573202, Karnataka, India *Corresponding author ABSTRACT A study was set out to investigate the distribution of gastrointestinal nematode parasites in sheep farms of Hassan district, Karnataka and to ascertain which K e yw or ds species are involved in the anthelmintic resistance. In the study 26 farms were treated with fenbendazole and 19 farms were treated with ivermectin. The pre and Haemonchus post treatment faecal cultures were prepared for each farms. The larvae identified contortus , Trichostrongylus in the pre-treatment faecal culture were Haemonchus sp, Trichostrongylus sp, colubriformis , Oesophagostomum sp, Bunostomum sp and Cooperia sp based on the PCR, Anthelmintic morphological keys. During the study 15 farms showed resistance to fenbendazole resistance, ITS-2 whereas 2 farms were resistant to ivermectin. Among 15 farms, 12 farms had Article Info Haemonchus sp as a predominant larvae followed by Trichostrongylus sp in 3 farms. The ivermectin resistant farms had Haemonchus sp as pre dominant larvae. Accepted: The post treatment faecal cultures revealed Haemonchus sp. as the predominant 22 March 2020 gastrointestinal nematode followed by Trichostrongylus sp. The ones mentioned Available Online: 10 April 2020 were identified as Haemonchus contortus and T. colubriformis by PCR. The PCR tool used for epidemiological studies supported the investigations of conventional parasitological techniques. Introduction as well as in sheep reproduction (Levya et al., 1982; Urquhart et al., 1996; Hayat et al., Gastrointestinal parasitism is of considerable 1996; Suarez et al., 2009). Clinical signs and importance to sheep farmers worldwide. sequelae are dependent on the parasite fauna Being the limiting factor of sheep present and the intensity of infection. productivity, gastrointestinal nematodes (GIN) have a highly detrimental effect on the In sheep, these can range from subclinical sheep industry (Coop and Holmes, 1996; weight loss to lethal pathologies such as Jones, 2001), resulting in significant anaemia, diarrhoea and severe protein loss economic losses in meat and wool production, (Pugh and Baird, 2012). 2564 Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 2564-2575 Anthelmintics are commonly used to control district, Karnataka by morphological and gastrointestinal nematodes. The wide spread molecular characterization. use of these drugs and misuse have led to the development of anthelmintic resistance Materials and Methods against GINs (Singh and Yadav, 1997) posing serious limitation on the use of anthelmintics. Per rectal faecal samples or freshly voided The ability to manage both parasitic disease faecal pellets were collected from the and anthelmintic resistance is dependent on naturally infected animals from different an understanding of parasite epidemiology, taluks of Hassan district, Karnataka on day which in turn requires the accurate zero before treatment and then day 10 after identification of the parasite species involved treatment from the animals treated with (Coles et al., 2006; Sweeny et al., 2012). fenbendazole and day 15 from the animals treated with ivermectin. Qualitative faecal To date, identification of nematode parasite sample examination using sedimentation species has been generally based on the method and standard salt floatation technique morphology and morphometry of adult male (Soulsby, 19982) were carried out for the worms (Soulsby 1971). The sacrificing of presence of strongyle eggs. The positive animals to obtain adult worms cannot samples were subjected to quantitative faecal normally be justified, so the most commonly examination by modified McMaster’s used practice is the microscopic technique (Coles et al., 1992). The animals differentiation of infective stage larvae (L3) having eggs per gram (EPG) of faeces more extracted from faecal cultures (Lancaster and than 150 were selected for the study. Hong 1987; Van Wyk et al., 2004; Coles et al., 2006). This is useful in the identification From each farm pre and post treatment faecal of the gastrointestinal nematode genera. culture was prepared. The cultures were Differentiation of the nematodes by larval incubated in moist conditions for stages has limitations. There is overlap of approximately 14 days at 270C. The larvae many of the morphological characters were then harvested and identified using the between the larvae, through which it is morphological keys (Van Wyk and Mayhew, difficult to identify the larvae in mixed 2013). The percentage generic composition of infections. the cultures was determined from a random examination of 100 larvae. Advances in molecular biology have made it possible to rapidly identify the infective Morphological characterization larvae to the species level by using PCR. Molecular methods provide a level of parasite Isolation of larvae identification beyond what is possible with morphology alone. They play an important The faecal mixture was made with optimum role in identifying and differentiating consistency and placed on the top of a small parasites when their morphologic features are inverted petri plate which in turn was placed ambiguous or altered. in a larger petri dish covered with a lid. The space between inverted small petri dish and The aim of the current study was to large petri dish is filled with water up to the understand the distribution of the infective level of faeces creating a water pocket larvae involved in the gastrointestinal between two petri dishes. Larvae were nematode infection throughout the Hassan collected after 14 days from the petri dish 2565 Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 2564-2575 without disturbing the mass. The fluid thus extraction. The genomic DNA was extracted obtained was clear, subjected to from the infective larvae using a commercial centrifugation at 1,000 rpm and sediment kit (HiPurATM Multi-Sample DNA obtained was examined for larval purification kit - Himedia) as per the morphology. manufacturer’s instructions. The DNA was stored at -20°C until used as a template for Larva preparation for identification species identification of gastrointestinal nematodes. The shape of the larvae were preserved by adding 2% formalin and tubes containing the Polymerase chain reaction larvae were heated gently with bunsen burner. By this step, larvae were dead but preserved PCR was carried out in a thin wall PCR tubes intact and stained well to ease the in 25 μl reaction volume using a commercial identification of morphological characters. A PCR master mix (Hi-Chrom PCR Master drop of larval su spension was taken on a Mix- MBT089) and genomic DNA. The clean glass microscopic slide and Lugol’s amplification was carried out using the PCR iodine(2%) solution that is pre-diluted was Thermal cycler (MJMiniTM Personal thermal added. The prepared slide was left for few cycler, Bio-Rad Technologies). Samples minutes, then observed under the microscope without genomic DNA were used as negative for detailed internal structures of the larvae controls. and photographed. The amplicons were electrophoresed using Larval identification 1.5% agarose gel and the DNA migration and resolution pattern was examined by UV trans Strongyle larvae (L3) were identified to the illumination technique and the picture was genus level on the basis of morphological documented by photography. characteristics (Van wyk and Mayhew, 2013). In each case 100 randomly selected L3 were Haemonchus contortus identified. The total length of the larvae, tail length and shape, presence or absence of tail The primers targeting unique sequence motifs sheath, type of oesophagus and number of present in the second internal transcribed intestinal cells in third stage larvae were spacer region- 2 (ITS-2) of the ribosomal considered for identification. DNA were used. PCR was carried out using species specific forward and universal reverse Molecular characterization primer to strongylide species published by Bottet.al, 2009. The primer sequences used DNA template preparation were: A minimum of 5 pre dominant larvae 1. HAE forward primer: 5’ identified on the basis of morphological keys CAAATGGCATTTGTCTTTTAG 3’ were picked from each culture. The larvae 2. HAE Reverse primer: 5’ were exsheathed by incubating in 3.5% TTAGTTTCTTTTCCTCCGCT 3’ Sodium hypochlorite (aqueous solution, 4% active chlorine) for 5-20minutes. The The reaction was carried out with the exsheathed larvae were washed in distilled following conditions: Initial denaturation at water for 3 – 5 times and then used for DNA 94°C for 5 minutes, followed by 35 cycles of 2566 Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 2564-2575 94°C for 30 s (denaturation), 55°C for 30 s Genus specific primer sequence (annealing) and 72°C for 30 s (extension), followed by a final extension at 72 °C for 7 Oeso forward: 5’ TCG ACT AGC TTC AGC minutes (Bott et al., 2009 and Tan et al., GAT G 3’ 2014). Oeso reverse: 5’CCA AAG CAT TCT TAG TCG CT 3’ Trichostrongylus sp Polymerase chain reaction was performed with the following conditions: Initial A species specific, multiplexed PCR denaturation at 940C for two minutes was technique developed by Waghorn et al., 2013 followed by 36 cycles each at 940C for 30 s, was used for identification of the 530C for 30 s and 720C for 30s. This was Trcihostrongylus sp. larvae. The primers followed by 5 min final extension at 720C. targeting the second internal transcribed The amplicon size was 333bp (Figure 8). spacer region (ITS-2) of the ribosomal DNA were used to identify the larva. The species Species-specific PCR assay specific primers for Trichostrongylus colubriformis and T. axei along with the two The published primer sequence by Bottet.al, generic primers used in the multiplex PCR 2009 was used for amplification of reaction are presented in Table 1.