DOCSLIB.ORG

Morphological and Molecular Characterization of Gastrointestinal Nematodes in Sheep

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Morphological and Molecular Characterization of Gastrointestinal Nematodes in Sheep Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 2564-2575 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 9 Number 4 (2020) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2020.904.308 Morphological and Molecular Characterization of Gastrointestinal Nematodes in Sheep M. Veena1*, G. C. Puttalakshmamm1, K. J. Ananda2 and P. P. Sengupta3 KVAFSU, Department of Parasitology, Veterinary College, Hassan-573202, Karnataka, India *Corresponding author ABSTRACT A study was set out to investigate the distribution of gastrointestinal nematode parasites in sheep farms of Hassan district, Karnataka and to ascertain which K e yw or ds species are involved in the anthelmintic resistance. In the study 26 farms were treated with fenbendazole and 19 farms were treated with ivermectin. The pre and Haemonchus post treatment faecal cultures were prepared for each farms. The larvae identified contortus , Trichostrongylus in the pre-treatment faecal culture were Haemonchus sp, Trichostrongylus sp, colubriformis , Oesophagostomum sp, Bunostomum sp and Cooperia sp based on the PCR, Anthelmintic morphological keys. During the study 15 farms showed resistance to fenbendazole resistance, ITS-2 whereas 2 farms were resistant to ivermectin. Among 15 farms, 12 farms had Article Info Haemonchus sp as a predominant larvae followed by Trichostrongylus sp in 3 farms. The ivermectin resistant farms had Haemonchus sp as pre dominant larvae. Accepted: The post treatment faecal cultures revealed Haemonchus sp. as the predominant 22 March 2020 gastrointestinal nematode followed by Trichostrongylus sp. The ones mentioned Available Online: 10 April 2020 were identified as Haemonchus contortus and T. colubriformis by PCR. The PCR tool used for epidemiological studies supported the investigations of conventional parasitological techniques. Introduction as well as in sheep reproduction (Levya et al., 1982; Urquhart et al., 1996; Hayat et al., Gastrointestinal parasitism is of considerable 1996; Suarez et al., 2009). Clinical signs and importance to sheep farmers worldwide. sequelae are dependent on the parasite fauna Being the limiting factor of sheep present and the intensity of infection. productivity, gastrointestinal nematodes (GIN) have a highly detrimental effect on the In sheep, these can range from subclinical sheep industry (Coop and Holmes, 1996; weight loss to lethal pathologies such as Jones, 2001), resulting in significant anaemia, diarrhoea and severe protein loss economic losses in meat and wool production, (Pugh and Baird, 2012). 2564 Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 2564-2575 Anthelmintics are commonly used to control district, Karnataka by morphological and gastrointestinal nematodes. The wide spread molecular characterization. use of these drugs and misuse have led to the development of anthelmintic resistance Materials and Methods against GINs (Singh and Yadav, 1997) posing serious limitation on the use of anthelmintics. Per rectal faecal samples or freshly voided The ability to manage both parasitic disease faecal pellets were collected from the and anthelmintic resistance is dependent on naturally infected animals from different an understanding of parasite epidemiology, taluks of Hassan district, Karnataka on day which in turn requires the accurate zero before treatment and then day 10 after identification of the parasite species involved treatment from the animals treated with (Coles et al., 2006; Sweeny et al., 2012). fenbendazole and day 15 from the animals treated with ivermectin. Qualitative faecal To date, identification of nematode parasite sample examination using sedimentation species has been generally based on the method and standard salt floatation technique morphology and morphometry of adult male (Soulsby, 19982) were carried out for the worms (Soulsby 1971). The sacrificing of presence of strongyle eggs. The positive animals to obtain adult worms cannot samples were subjected to quantitative faecal normally be justified, so the most commonly examination by modified McMaster’s used practice is the microscopic technique (Coles et al., 1992). The animals differentiation of infective stage larvae (L3) having eggs per gram (EPG) of faeces more extracted from faecal cultures (Lancaster and than 150 were selected for the study. Hong 1987; Van Wyk et al., 2004; Coles et al., 2006). This is useful in the identification From each farm pre and post treatment faecal of the gastrointestinal nematode genera. culture was prepared. The cultures were Differentiation of the nematodes by larval incubated in moist conditions for stages has limitations. There is overlap of approximately 14 days at 270C. The larvae many of the morphological characters were then harvested and identified using the between the larvae, through which it is morphological keys (Van Wyk and Mayhew, difficult to identify the larvae in mixed 2013). The percentage generic composition of infections. the cultures was determined from a random examination of 100 larvae. Advances in molecular biology have made it possible to rapidly identify the infective Morphological characterization larvae to the species level by using PCR. Molecular methods provide a level of parasite Isolation of larvae identification beyond what is possible with morphology alone. They play an important The faecal mixture was made with optimum role in identifying and differentiating consistency and placed on the top of a small parasites when their morphologic features are inverted petri plate which in turn was placed ambiguous or altered. in a larger petri dish covered with a lid. The space between inverted small petri dish and The aim of the current study was to large petri dish is filled with water up to the understand the distribution of the infective level of faeces creating a water pocket larvae involved in the gastrointestinal between two petri dishes. Larvae were nematode infection throughout the Hassan collected after 14 days from the petri dish 2565 Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 2564-2575 without disturbing the mass. The fluid thus extraction. The genomic DNA was extracted obtained was clear, subjected to from the infective larvae using a commercial centrifugation at 1,000 rpm and sediment kit (HiPurATM Multi-Sample DNA obtained was examined for larval purification kit - Himedia) as per the morphology. manufacturer’s instructions. The DNA was stored at -20°C until used as a template for Larva preparation for identification species identification of gastrointestinal nematodes. The shape of the larvae were preserved by adding 2% formalin and tubes containing the Polymerase chain reaction larvae were heated gently with bunsen burner. By this step, larvae were dead but preserved PCR was carried out in a thin wall PCR tubes intact and stained well to ease the in 25 μl reaction volume using a commercial identification of morphological characters. A PCR master mix (Hi-Chrom PCR Master drop of larval su spension was taken on a Mix- MBT089) and genomic DNA. The clean glass microscopic slide and Lugol’s amplification was carried out using the PCR iodine(2%) solution that is pre-diluted was Thermal cycler (MJMiniTM Personal thermal added. The prepared slide was left for few cycler, Bio-Rad Technologies). Samples minutes, then observed under the microscope without genomic DNA were used as negative for detailed internal structures of the larvae controls. and photographed. The amplicons were electrophoresed using Larval identification 1.5% agarose gel and the DNA migration and resolution pattern was examined by UV trans Strongyle larvae (L3) were identified to the illumination technique and the picture was genus level on the basis of morphological documented by photography. characteristics (Van wyk and Mayhew, 2013). In each case 100 randomly selected L3 were Haemonchus contortus identified. The total length of the larvae, tail length and shape, presence or absence of tail The primers targeting unique sequence motifs sheath, type of oesophagus and number of present in the second internal transcribed intestinal cells in third stage larvae were spacer region- 2 (ITS-2) of the ribosomal considered for identification. DNA were used. PCR was carried out using species specific forward and universal reverse Molecular characterization primer to strongylide species published by Bottet.al, 2009. The primer sequences used DNA template preparation were: A minimum of 5 pre dominant larvae 1. HAE forward primer: 5’ identified on the basis of morphological keys CAAATGGCATTTGTCTTTTAG 3’ were picked from each culture. The larvae 2. HAE Reverse primer: 5’ were exsheathed by incubating in 3.5% TTAGTTTCTTTTCCTCCGCT 3’ Sodium hypochlorite (aqueous solution, 4% active chlorine) for 5-20minutes. The The reaction was carried out with the exsheathed larvae were washed in distilled following conditions: Initial denaturation at water for 3 – 5 times and then used for DNA 94°C for 5 minutes, followed by 35 cycles of 2566 Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 2564-2575 94°C for 30 s (denaturation), 55°C for 30 s Genus specific primer sequence (annealing) and 72°C for 30 s (extension), followed by a final extension at 72 °C for 7 Oeso forward: 5’ TCG ACT AGC TTC AGC minutes (Bott et al., 2009 and Tan et al., GAT G 3’ 2014). Oeso reverse: 5’CCA AAG CAT TCT TAG TCG CT 3’ Trichostrongylus sp Polymerase chain reaction was performed with the following conditions: Initial A species specific, multiplexed PCR denaturation at 940C for two minutes was technique developed by Waghorn et al., 2013 followed by 36 cycles each at 940C for 30 s, was used for identification of the 530C for 30 s and 720C for 30s. This was Trcihostrongylus sp. larvae. The primers followed by 5 min final extension at 720C. targeting the second internal transcribed The amplicon size was 333bp (Figure 8). spacer region (ITS-2) of the ribosomal DNA were used to identify the larva. The species Species-specific PCR assay specific primers for Trichostrongylus colubriformis and T. axei along with the two The published primer sequence by Bottet.al, generic primers used in the multiplex PCR 2009 was used for amplification of reaction are presented in Table 1.
Load more

Recommended publications
  • Parasites of South African Wildlife. XIX. the Prevalence of Helminths in Some Common Antelopes, Warthogs and a Bushpig in the Limpopo Province, South Africa
    Page 1 of 11 Original Research Parasites of South African wildlife. XIX. The prevalence of helminths in some common antelopes, warthogs and a bushpig in the Limpopo province, South Africa Authors: Little work has been conducted on the helminth parasites of artiodactylids in the northern 1 Ilana C. van Wyk and western parts of the Limpopo province, which is considerably drier than the rest of the Joop Boomker1 province. The aim of this study was to determine the kinds and numbers of helminth that Affiliations: occur in different wildlife hosts in the area as well as whether any zoonotic helminths were 1Department of Veterinary present. Ten impalas (Aepyceros melampus), eight kudus (Tragelaphus strepsiceros), four blue Tropical Diseases, University wildebeest (Connochaetes taurinus), two black wildebeest (Connochaetes gnou), three gemsbok of Pretoria, South Africa (Oryx gazella), one nyala (Tragelaphus angasii), one bushbuck (Tragelaphus scriptus), one Correspondence to: waterbuck (Kobus ellipsiprymnus), six warthogs (Phacochoerus aethiopicus) and a single bushpig Ilana van Wyk (Potamochoerus porcus) were sampled from various localities in the semi-arid northern and western areas of the Limpopo province. Email: [email protected] New host–parasite associations included Trichostrongylus deflexus from blue wildebeest, Postal address: Agriostomum gorgonis from black wildebeest, Stilesia globipunctata from the waterbuck and Private bag X04, Fasciola hepatica in a kudu. The mean helminth burden, including extra-gastrointestinal Onderstepoort 0110, South Africa helminths, was 592 in impalas, 407 in kudus and blue wildebeest, 588 in black wildebeest, 184 in gemsbok, and 2150 in the waterbuck. Excluding Probstmayria vivipara, the mean helminth Dates: burden in warthogs was 2228 and the total nematode burden in the bushpig was 80.
    [Show full text]
  • Anthelmintic Resistance of Ostertagia Ostertagi and Cooperia Oncophora to Macrocyclic Lactones in Cattle from the Western United States
    Veterinary Parasitology 170 (2010) 224–229 Contents lists available at ScienceDirect Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar Anthelmintic resistance of Ostertagia ostertagi and Cooperia oncophora to macrocyclic lactones in cattle from the western United States M.D. Edmonds, E.G. Johnson, J.D. Edmonds ∗ Johnson Research LLC, 24007 Highway 20-26, Parma, ID, 83660, USA article info abstract Article history: In June 2008, 122 yearling heifers with a history of anthelmintic resistance were obtained Received 15 October 2009 from pastures in northern California and transported to a dry lot facility in southwest- Received in revised form 28 January 2010 ern Idaho, USA. Fifty heifers with the highest fecal egg counts were selected for study Accepted 24 February 2010 enrollment. Candidates were equally randomized to treatment with either injectable iver- mectin (Ivomec®, Merial, 0.2 mg kg−1 BW), injectable moxidectin (Cydectin®, Fort Dodge, Keywords: 0.2 mg kg−1 BW), oral fenbendazole (Safe-Guard®, Intervet, 5.0 mg kg−1 BW), oral oxfenda- Anthelmintic resistance zole (Synanthic®, Fort Dodge, 4.5 mg kg−1 BW), or saline. At 14 days post-treatment, Cattle Bovine nematodes were recovered from the abomasum, small intestine, and large intestine. Par- Nematodes asitism was confirmed in the control group when 10/10 animals were infected with Efficacy adult Ostertagia ostertagi and 9/10 animals with both developing and early L4 stages of Cooperia O. ostertagi. Similarly, 9/10 animals were parasitized with adult Cooperia spp. Fenbenda- Ostertagia zole and oxfendazole efficacy verses controls were >90% against adult Cooperia spp., while moxidectin caused an 88% parasite reduction post-treatment (P < 0.05).
    [Show full text]
  • Ostertagia Ostertagi Excretory-Secretory Products
    Academic Year 2007-2008 Laboratory for Parasitology Department of Virology, Parasitology and Immunology Ghent University – Faculty of Veterinary Medicine Study of Ostertagia ostertagi excretory-secretory products Heidi Saverwyns Proefschrift voorgelegd aan de faculteit Diergeneeskunde tot het behalen van de graad van Doctor in de Diergeneeskundige Wetenschappen Promotoren: Prof. Dr. E. Claerebout en Dr. P. Geldhof Het heeft wel eventjes geduurd, maar nu is het zover. Veel mensen hebben de afgelopen jaren direct of indirect hun medewerking verleend aan het tot stand komen van dit proefschrift. Een aantal van hen wil ik hier persoonlijk bedanken. In eerste instantie wens ik Prof dr. Jozef Vercuysse en mijn promotor Prof. Dr. Edwin Claerebout te bedanken omdat jullie mij de kans boden om op het labo Parasitologie te doctoreren. Jullie deur stond altijd open zowel in goede tijden als in slechte tijden. Bedankt voor alles!! Peter, nog maar pas terug uit Moredun en vervolgens gebombardeerd tot mijn promotor. Jouw hulp was onmisbaar bij het vervolledigen van dit proefschrift. Hopelijk heb je niet te veel fietsuren moeten missen door de ontelbare corrigeersessies. Denk vooral aan die ‘oh zo leuke bureau momenten’ wanneer we samen neurieden op mijn nieuwste ringtone. Dr. Marc Fransen, bedankt voor alle hulp en goede tips wanneer mijn fagen niet deden wat van hen verwacht werd. Natuurlijk wil ik u ook bedanken voor het gedetailleerd en supersnel nalezen van dit proefschrift! Isabel, jouw hersenspinsels (neergepend in een FWO aanvraag) betekenden het startsignaal van een wilde rit op het faagdisplay rad. Je hebt ons reeds enkele jaren geleden verlaten, desalniettemin was je direct bereid om in mijn leescommissie te zetelen.
    [Show full text]
  • Ostertagia Ostertagi: Population Dynamics Under Pasture and Confinement Conditions with Particular Reference to the Inhibition Phenomenon
    Louisiana State University LSU Digital Commons LSU Historical Dissertations and Theses Graduate School 1989 Ostertagia Ostertagi: Population Dynamics Under Pasture and Confinement Conditions With Particular Reference to the Inhibition Phenomenon. Carlos Solomon Eddi Louisiana State University and Agricultural & Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses Recommended Citation Eddi, Carlos Solomon, "Ostertagia Ostertagi: Population Dynamics Under Pasture and Confinement Conditions With Particular Reference to the Inhibition Phenomenon." (1989). LSU Historical Dissertations and Theses. 4712. https://digitalcommons.lsu.edu/gradschool_disstheses/4712 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. INFORMATION TO USERS The most advanced technology has been used to photo­ graph and reproduce this manuscript from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are re­ produced by sectioning the original, beginning at the upper left-hand corner and continuing from left to right in equal sections with small overlaps.
    [Show full text]
  • Molecular Method to Diagnosis of Some Strongylide Nematode of Goats in Nyala Area South Darfur State- Sudan
    IOSR Journal of Agriculture and Veterinary Science (IOSR-JAVS) e-ISSN: 2319-2380, p-ISSN: 2319-2372. Volume 10, Issue 4 Ver. II (April. 2017), PP 54-56 www.iosrjournals.org Molecular Method to Diagnosis of some Strongylide Nematode of goats in Nyala Area South Darfur State- Sudan Salma.A.Hassan1. Abbaker. A. Mohammed2, Fayza.A.Omer3 1 Small ruminants development and research center- Faculty of veterinary science, University of Nyala-Sudan. 2 Departments of preventive medicine and public health Faculty of veterinary science, University of Nyala Sudan. 3 Department of pathology and animal diseases diagnosis-Central veterinary research laboratory (CVRL) Sudan- Soba Abstract: A total of 100 positive faecal samples were examined using floatation technique to detect strongylide eggs, were confirmed by PCR technique, faecal samples were storage by frozen in -20°C and DNA extraction by using phenol/chloroform/isoamylalcohol protocol. PCR leading to amplify the region of the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (r DNA) of strongylide species, amplification by three different primers in separate reactions, in each reaction used species specific primer forward and a universal reverse primer to srongylide species NC2. Haemonchus contortus, Trichostrongylus spp and Oesophagostomum columbianum prevalence rates were recorded as 47(47%), 4(4%) and (0%) respectively, Most commonly, small ruminants are affected by multiple strongylide nematodes, mixed infection between Haemonchus contortus and Trichostrongylus spp was recorded 3(3%) Keyword: Strongylide, PCR, ITS-2, NC2, goats, Sudan. I. Introduction Parasitic worms of livestock cause diseases of major socioeconomic impact worldwide (Roeber et.al 2013), goats play an important role in the economy of rural communities where they are commonly raised by poor families and farmers for livelihood (Bushara, et.al, 2011).
    [Show full text]
  • The Influence of Human Settlements on Gastrointestinal Helminths of Wild Monkey Populations in Their Natural Habitat
    The influence of human settlements on gastrointestinal helminths of wild monkey populations in their natural habitat Zur Erlangung des akademischen Grades eines DOKTORS DER NATURWISSENSCHAFTEN (Dr. rer. nat.) Fakultät für Chemie und Biowissenschaften Karlsruher Institut für Technologie (KIT) – Universitätsbereich genehmigte DISSERTATION von Dipl. Biol. Alexandra Mücke geboren in Germersheim Dekan: Prof. Dr. Martin Bastmeyer Referent: Prof. Dr. Horst F. Taraschewski 1. Korreferent: Prof. Dr. Eckhard W. Heymann 2. Korreferent: Prof. Dr. Doris Wedlich Tag der mündlichen Prüfung: 16.12.2011 To Maya Index of Contents I Index of Contents Index of Tables ..............................................................................................III Index of Figures............................................................................................. IV Abstract .......................................................................................................... VI Zusammenfassung........................................................................................VII Introduction ......................................................................................................1 1.1 Why study primate parasites?...................................................................................2 1.2 Objectives of the study and thesis outline ................................................................4 Literature Review.............................................................................................7 2.1 Parasites
    [Show full text]
  • Leaf-Swallowing by Chimpanzees: a Behavioral Adaptation for the Control of Strongyle Nematode Infections
    International Journal of Primatology, Vol. 17, No. 4, 1996 Leaf-Swallowing by Chimpanzees: A Behavioral Adaptation for the Control of Strongyle Nematode Infections Michael A. Huffman, 1,2,7 Jonathan E. Page, 3 Michael V. K. Sukhdeo, 4 Shunji Gotoh, 5 Mohamedi S. Kalunde, 6 Thushara Chandrasiri, 4 and G. H. Neil Towers 3 Received April 26, 1995; revised September 5, 1995; accepted November 29, 1995 Swallowing whole leaves by chimpanzees and other African apes has been hypothesized to have an antiparasitic or medicinal function, but detailed studies demonstrating this were lacking. We correlate for the first time quantifiable measures of the health of chimpanzees with observations of leaf-swallowing in Mahale Mountains National Park, Tanzania. We obtained a total of 27 cases involving the use of Aspilia mossambicensis (63%), Lippia plicata (7%), Hibiscus sp. (15%), Trema orientalis (4%), and Aneilema aequinoctiale (11%), 15 cases by direct observation of 12 individuals of the Mahale M group. At the time of use, we noted behavioral symptoms of illness in the 8 closely observed cases, and detected single or multiple parasitic infections (Strongyloides fulleborni, Trichuris trichiura, Oesophagostomum stephanostomum) in 10 of the 12 individuals. There is a significant relationship between the presence of whole leaves (range, 1-51) and worms of adult O. stephanostomum (range, 2-21) in the dung. HPLC analysis of leaf ZSection of Ecology, Kyoto University, Primate Research Institute, 41 Kanrin, Inuyama 484 Aichi, Japan. 2Department of Anthropology, University of Colorado at Denver, Denver, Colorado 80217-3364. 3Botany Department, University of British Columbia, Vancouver, B.C., Canada. 4Department of Animal Sciences, Cook College, Rutgers University, New Brunswick, New Jersey 08903.
    [Show full text]
  • Early Developmental Stages of Nematodes Occurring in Swine
    EARLY DEVELOPMENTAL STAGES OF NEMATODES OCCURRING IN SWINE By JOSEPH E. ALICATA Junior Zoolofllst Zoological Division Bureau of Animal Industry UNITED STATES DEPARTMENT OF AGRICULTURE, WASHINGTON, D. C. Technical Bulletin No. 489 December 1935 UNITED STATES DEPARTMENT OF AGRICULTURE WASHINGTON, D. C. EARLY DEVELOPMENTAL STAGES OF NEMATODES OCCURRING IN SWINE By JOSEPH E. ALICATA Junior zoologist, Zoological Division, Bureau of Animal Industry CONTENTS Page Morphological and experimental data—Con. Page Introduction 1 Ascaridae. _ 44 Historical résumé 2 Ascaris suum Goeze, 1782 44 General remarks on life histories of groups Trichuridae 47 studied _. 4 Trichuris suis (Schrank, 1788) A. J. Abbreviations and symbols used in illus- Smith, 1908 47 trations __ 5 Trichostrongylidae 51 Morphological and experimental data 5 HyostrongylîLS rubidus (Hassall and Spiruridae 5 Stiles, 1892) HaU,.1921 51 Gongylonema pulchrum Molin, 1857.. 5 Strongylidae. _— — .-. 68 Oesophagostomum dentatum (Ru- Ascarops strongylina (Rudolphi, 1819) dolphi, 1803) Molin, 1861 68 Alicata and Mclntosh, 1933 21 Stephanurus dentatus Diesing, 1839..- 73 Physocephalus sexalatus (Molin, 1860) Strongyloididae 79 Diesing, 1861 27 Strongyloides ransomi Schwartz and Metastrongyhdae 33 AUcata, 1930. 79 Metastrongylus salmi Gedoelst, 1923— 33 Comparative morphology of eggs and third- Metastrongylus elongattbs (Dujardin, stage larvae of some nematodes occurring 1845) Railliet and Henry, 1911 37 in swine 85 Choerostrongylus pudendotectus (Wos- Summary 87 tokow, 1905) Skrjabin, 1924 41 Literature cited 89 INTRODUCTION The object of this bulletin is to present the result^ of an investiga- tion on the early developmental stages of nematodes of common occur- rence in domestic swine. Observations on the stages in the definitive host of two of the nematodes, Gongylonema pulchrum and Hyostrongy- lus rubidus, are only briefly given, however, since little is known of these stages in these nematodes.
    [Show full text]
  • Classification and Nomenclature of Human Parasites Lynne S
    C H A P T E R 2 0 8 Classification and Nomenclature of Human Parasites Lynne S. Garcia Although common names frequently are used to describe morphologic forms according to age, host, or nutrition, parasitic organisms, these names may represent different which often results in several names being given to the parasites in different parts of the world. To eliminate same organism. An additional problem involves alterna- these problems, a binomial system of nomenclature in tion of parasitic and free-living phases in the life cycle. which the scientific name consists of the genus and These organisms may be very different and difficult to species is used.1-3,8,12,14,17 These names generally are of recognize as belonging to the same species. Despite these Greek or Latin origin. In certain publications, the scien- difficulties, newer, more sophisticated molecular methods tific name often is followed by the name of the individual of grouping organisms often have confirmed taxonomic who originally named the parasite. The date of naming conclusions reached hundreds of years earlier by experi- also may be provided. If the name of the individual is in enced taxonomists. parentheses, it means that the person used a generic name As investigations continue in parasitic genetics, immu- no longer considered to be correct. nology, and biochemistry, the species designation will be On the basis of life histories and morphologic charac- defined more clearly. Originally, these species designa- teristics, systems of classification have been developed to tions were determined primarily by morphologic dif- indicate the relationship among the various parasite ferences, resulting in a phenotypic approach.
    [Show full text]
  • Overview of the Order Strongylida
    Overview of the Order Strongylida Objectives: 1) Describe the general structure and function of the copulatory bursa of adult males of the Order Strongylida (“the bursate worms”). 2) Compare buccal area morphology of (a) Trichostrongyloidea, (b) Strongyloidea, (c) Ancylostomatoidea, and (d) Metastrongyloidea. 3) Describe the life cycle stages outside of the host for the four superfamilies listed below: (a) Trichostrongyloidea (includes the following eight genera: Trichostrongylus, Ostertagia, Haemonchus, Cooperia, Nematodirus [variation in life cycle], Dictyocaulus, Hyostrongylus, Ollulanus [variation in life cycle]); (b) Strongyloidea (includes the following five genera: Strongylus, Triodontophorus, cyathostomes [many different small strongyles], Oesophagostomum, Stephanurus [variation in life cycle]). (c) Ancylostomatoidea (includes the following three genera: Ancylostoma, Uncinaria, Bunostomum); (d) Metastrongyloidea (includes the following seven genera: Metastrongylus, Protostrongylus, Muellerius, Parelaphostrongylus, Crenosoma, Aelurostrongylus and Filaroides [variation in life cycle]). 4) Describe the pathogenesis and etiology of disease associated with Ostertagia in cattle, Haemonchus in sheep. 5) Outline the general control measures for trichostrongyles (Trichostrongylus, Ostertagia, Haemonchus and Cooperia) in cattle. 6) Outline the general control measures for trichostrongyles in sheep. 7) Describe the pathogenesis and etiology of pneumonia caused by Dictyocaulus. Outline: I. General morphology of the Order Strongylidea (bursate worms): distinctive copulatory bursa on adult males. A. Structure 1. Well-developed dorsal, ventral and lateral expansions of the surface cuticle at the posterior end, referred to as lobes. 2. Lobes supported by muscular rays. 3. Exception in the superfamily Metastrongyloidea where copulatory bursa is less well- developed. B. Function 1. To grasp the female worm at the vulvar site. 2. To facilitate male spicule insertion and movement of sperm from the male cloaca to the female vulva.
    [Show full text]
  • Downloaded From
    Oesophagostomum bifurcum infection in man. A study on the taxonomy, diagnosis, epidemiology Krepel, H.P. Citation Krepel, H. P. (1994, June 28). Oesophagostomum bifurcum infection in man. A study on the taxonomy, diagnosis, epidemiology. Retrieved from https://hdl.handle.net/1887/13885 Version: Corrected Publisher’s Version Licence agreement concerning inclusion of License: doctoral thesis in the Institutional Repository of the University of Leiden Downloaded from: https://hdl.handle.net/1887/13885 Note: To cite this publication please use the final published version (if applicable). Chapter 1 GENERAL INTRODUCTION Introduction 1 Introduction Representatives of the genus Oesopnagostomum are small nematodes that occur in a wide range of animals. The first Oesopnagostomum species were discovered in 1803 in cattle (O.radiatum) and pigs (O.dentatum). Later on, several other species were described, e.g. O.quadrispinulatum (pigs), O.columbianum and O.venulosum (sheep and goats) [1]. O.aculeatum, O.stephanostomum and O.bifurcum are species that have been recognized in monkeys [2-7]. The name of this nematode has its origin in the typical shape of the head, with an excretory pore clearly visible in the cephalic groove of the head (fig. 1). The life cycle of O. columbianum, a common parasite of sheep causing serious disease and economic damage [8-10] has been studied extensively [11-13], and serves as an example for the life cycles of other Oesopnagostomum sp.. Adult worms, living in the intestinal lumen of the sheep, produce eggs that leave the host with the faeces. Outside the host, the eggs develop into first-, second- and finally third-stage larvae (L-I, L-II and L-III larvae resp.).
    [Show full text]
  • Evaluation of Some Vulval Appendages in Nematode Taxonomy
    Comp. Parasitol. 76(2), 2009, pp. 191–209 Evaluation of Some Vulval Appendages in Nematode Taxonomy 1,5 1 2 3 4 LYNN K. CARTA, ZAFAR A. HANDOO, ERIC P. HOBERG, ERIC F. ERBE, AND WILLIAM P. WERGIN 1 Nematology Laboratory, United States Department of Agriculture–Agricultural Research Service, Beltsville, Maryland 20705, U.S.A. (e-mail: [email protected], [email protected]) and 2 United States National Parasite Collection, and Animal Parasitic Diseases Laboratory, United States Department of Agriculture–Agricultural Research Service, Beltsville, Maryland 20705, U.S.A. (e-mail: [email protected]) ABSTRACT: A survey of the nature and phylogenetic distribution of nematode vulval appendages revealed 3 major classes based on composition, position, and orientation that included membranes, flaps, and epiptygmata. Minor classes included cuticular inflations, protruding vulvar appendages of extruded gonadal tissues, vulval ridges, and peri-vulval pits. Vulval membranes were found in Mermithida, Triplonchida, Chromadorida, Rhabditidae, Panagrolaimidae, Tylenchida, and Trichostrongylidae. Vulval flaps were found in Desmodoroidea, Mermithida, Oxyuroidea, Tylenchida, Rhabditida, and Trichostrongyloidea. Epiptygmata were present within Aphelenchida, Tylenchida, Rhabditida, including the diverged Steinernematidae, and Enoplida. Within the Rhabditida, vulval ridges occurred in Cervidellus, peri-vulval pits in Strongyloides, cuticular inflations in Trichostrongylidae, and vulval cuticular sacs in Myolaimus and Deleyia. Vulval membranes have been confused with persistent copulatory sacs deposited by males, and some putative appendages may be artifactual. Vulval appendages occurred almost exclusively in commensal or parasitic nematode taxa. Appendages were discussed based on their relative taxonomic reliability, ecological associations, and distribution in the context of recent 18S ribosomal DNA molecular phylogenetic trees for the nematodes.
    [Show full text]