DOCSLIB.ORG

Platelet-Derived Growth Factor Receptor Activation Promotes The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Platelet-Derived Growth Factor Receptor Activation Promotes The Platelet-Derived Growth Factor Receptor Activation Promotes the Prodestructive Invadosome-Forming Phenotype of Synoviocytes from Patients with Rheumatoid This information is current as Arthritis of October 2, 2021. Martine Charbonneau, Roxane R. Lavoie, Annie Lauzier, Kelly Harper, Patrick P. McDonald and Claire M. Dubois J Immunol 2016; 196:3264-3275; Prepublished online 14 March 2016; Downloaded from doi: 10.4049/jimmunol.1500502 http://www.jimmunol.org/content/196/8/3264 References This article cites 93 articles, 21 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/196/8/3264.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 2, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Platelet-Derived Growth Factor Receptor Activation Promotes the Prodestructive Invadosome-Forming Phenotype of Synoviocytes from Patients with Rheumatoid Arthritis Martine Charbonneau,*,1 Roxane R. Lavoie,*,1 Annie Lauzier,* Kelly Harper,* Patrick P. McDonald,† and Claire M. Dubois* Fibroblast-like synoviocytes (FLS) play a major role in invasive joint destruction in rheumatoid arthritis (RA). This prodestructive phenotype has been shown to involve autocrine TGF-b that triggers formation of matrix-degrading invadosomes through mo- lecular mechanisms that are not fully elucidated. The platelet-derived growth factor (PDGF) receptor (PDGFR) family of receptor tyrosine kinases (RTK) has been shown to cooperate with TGF-b in various pathological conditions. We therefore sought to determine whether RTK activity played a role in invadosome biogenesis. We demonstrated that, among the common RTKs, PDGFR-ab was specifically phosphorylated in FLS from RA patients. Phosphorylation of PDGFR-ab was also elevated in RA Downloaded from synovial tissues. Interference with PDGFR activation or PDGF neutralization inhibited invadosome formation in RA synoviocytes, indicating the presence of an autocrine PDGFR activation loop that involved endogenous PDGF. Among the PDGF-A–D isoforms, only PDGF-B was found both significantly elevated in FLS lines from RA patients, and related to high-invadosome forming cells. Addition of TGF-b upregulated invadosome formation, PDGF-B mRNA expression, and phosphorylation of PDGFR. All of these functions were efficiently suppressed by TGF-b neutralization or interference with the Smad/TbR1or PI3K/Akt pathway. Among the class 1 PI3K family proteins known to be expressed in RA synoviocytes, PI3Ka was selectively involved in PDGF-B expression, http://www.jimmunol.org/ whereas both PI3Ka and PI3Kd participated in invadosome formation. Our findings demonstrate that PDGFR is a critical RTK required for the prodestructive phenotype of RA synovial cells. They also provide evidence for an association between autocrine TGF-b and PDGFR-mediated invadosome formation in RA synoviocytes that involves the production of PDGF-B induced by TGF-b. The Journal of Immunology, 2016, 196: 3264–3275. heumatoid arthritis (RA) is a systemic autoimmune dis- inflammation and joint destruction (2–4). Arthritic FLS resemble ease that mainly affects the joints, leading to joint in- transformed mesenchymal cells that are highly invasive in vitro R flammation and erosive structural damages. Although and in vivo. This property correlates with elevated production of by guest on October 2, 2021 important progress has been made in managing the pain and in- inflammatory cytokines and proteolytic enzymes that sustain in- flammation associated with the disease, strategies to directly in- flammation and joint matrix degradation. We have reported that terfere with the process of erosion are lacking. The onset of RA the ability of arthritic FLS to degrade the extracellular matrix causes important morphological changes in joint lining, including depends on the formation of plasma membrane structures that formation of an aggressive tumor-like synovial tissue that invades resembled invadopodia in tumor cells (5, 6). These structures were and erodes cartilage and bone (1). A large body of evidence from detected in fibroblast-like cells strategically located at the carti- patients and experimental animal models indicated that fibroblast- lage–synovial membrane interface. They were shown to contain like synoviocytes (FLS) are the main cell type that actively drives actin components, signaling molecules, such as Src, and high levels of proteolytic enzymes known to be particularly efficient at *Immunology Division, Department of Pediatrics, Faculty of Medicine, University of inducing cartilage damage. Importantly, interference with the Sherbrooke, Sherbrooke, Quebec J1H 5N4, Canada; and †Pneumology Division, Department of Medicine, Faculty of Medicine, University of Sherbrooke, Sherbrooke formation of invadosomes in arthritic FLS strongly inhibited Quebec J1H 5N4, Canada matrix degradation in vitro and ex vivo as well as cartilage deg- 1M.C. and R.R.L. are cofirst authors. radation in a rat model of arthritis (5, 6). These observations ORCIDs: 0000-0001-6253-8090 (R.R.L.); 0000-0002-0751-2821 (C.M.D.). suggested that invadosomes were directly involved in joint deg- Received for publication March 4, 2015. Accepted for publication February 15, 2016. radation, leading to the conclusion that an in-depth understanding This work was supported by Canadian Institutes for Health Research (CIHR) Grants of the mechanism of invadosome formation is of importance for MOP-86634 and MOP-286621 (to C.M.D.). C.M.D. is a member of the Fonds de la development of joint protection strategies for the clinical man- Recherche en Sante´ du Que´bec–funded Centre de Recherche du Centre Hospitalier agement of RA. Universitaire de Sherbrooke. K.H. is recipient of a scholarship from CIHR. The mechanisms involved in invadosome formation in synovial Address correspondence and reprint requests to Dr. Claire M. Dubois, Immunology Division, Department of Pediatrics, Faculty of Medicine, Universite´ de Sherbrooke, cells are not fully known. Invadosome formation and in vivo 3001 12th Avenue North, Sherbrooke, QC J1H 5N4, Canada. E-mail address: Claire. cartilage degradation capability of synovial cells of collagen- [email protected] induced arthritis rats were shown to depend on an autocrine ac- Abbreviations used in this article: ACR, American College of Rheumatology; tivation loop that involved TGF-b (6). Analysis of the protein and ECM, extracellular matrix; FLS, fibroblast-like synoviocyte; LPA, lysophosphatidic acid; NA, nonarthritis; OA, osteoarthritis; PDGF, platelet-derived growth factor; mRNA in RA synovial tissues revealed that TGF-b was highly PDGFR, PDGF receptor; PLC, phospholipase C; pY, phosphotyrosine; RA, rheumatoid expressed in RA patients (7–9). However, few studies have arthritis; RTK, receptor tyrosine kinase. addressed the role of TGF-b in the functions of synovial fibro- Copyright Ó 2016 by The American Association of Immunologists, Inc. 0022-1767/16/$30.00 blasts derived from these patients. TGF-b was shown to increase www.jimmunol.org/cgi/doi/10.4049/jimmunol.1500502 The Journal of Immunology 3265 the expression of proinflammatory cytokines and metalloproteinases agnosed using the 1986 ACR clinical criteria (34). The protocol was ap- in RA synoviocytes (9), an effect that was found to be dramati- proved by the Centre Hospitalier Universitaire de Sherbrooke Ethics cally potentiated by receptor tyrosine kinase (RTK)–dependent Committee, and written consent was obtained from all participants. Synoviocytes were isolated using standard procedures (35), and the signaling (10). These studies suggested a potential association culture was maintained in DMEM-F12 medium supplemented with 10% between TGF-b and RTK signaling to promote proarthritic FBS and 40 mg/ml gentamicin. Cells were used between passages 3 and 8. functions of synovial fibroblasts. Synoviocyte cultures exhibited a classic spindle-shape fibroblastic mor- RTKs comprise a large family of cell surface receptors that are phology that formed parallel clusters at confluency. The cell surface phenotypic marker analysis showed that they were consistently positive for essential components of signal transduction pathways that medi- the stromal mesenchymal marker fibronectin (.99%) and negative (,1%) ate cell survival, proliferation, differentiation, and motility, and for the macrophage marker CD68. modulate cell metabolism (11). These transmembrane proteins bind polypeptide ligands, mainly growth factors. Among the 58 Plasmids and transfections RTK family members, epidermal growth factor receptor, platelet- pLKO.1-puro short hairpin RNA targeting PI3Ka, PI3Kb, PI3Kd, and derived growth factor (PDGF) receptor (PDGFR), fibroblast control (scrambled) short hairpin RNA plasmids were from Sigma-Aldrich growth factor
Load more

Recommended publications
  • Supplementary Table 1
    Supplementary table 1 List of the 92 proteins analyzed in the multiplex proximity extension assay (PEA) Long name (short name) UniProt No. LOD (pg/mL) Adenosine Deaminase (ADA) P00813 0.48 Artemin (ARTN) Q5T4W7 0.24 Axin-1 (AXIN1) O15169 61,0 Beta-nerve growth factor (Beta-NGF) P01138 0.48 Brain-derived neutrophic factor (BDNF) P23560 Caspase 8 (CASP-8) Q14790 0.48 C-C motif chemokine 4 (CCL4) P13236 1.9 C-C motif chemokine 19 (CCL19) Q99731 15,0 C-C motif chemokine 20 (CCL20) P78556 7.6 C-C motif chemokine 23 (CCL23) P55773 31,0 C-C motif chemokine 25 (CCL25) O15444 3.8 C-C motif chemokine 28 (CCL28) Q9NRJ3 61,0 CD40L receptor (CD40) P25942 0.01 CUB domain-containing protein 1 (CDCP1) Q9H5V8 0.12 C-X-C motif chemokine 1 (CXCL1) P09341 3.8 C-X-C motif chemokine 5 (CXCL5) P42830 0.95 C-X-C motif chemokine 6 (CXCL6) P80162 7.6 C-X-C motif chemokine 9 (CXCL9) Q07325 0.95 C-X-C motif chemokine 10 (CXCL10) P02778 7.6 C-X-C motif chemokine 11 (CXCL11) O14625 7.6 Cystatin D (CST5) P28325 1.9 Delta and Notch-like epidermal growth factor related receptor (DNER) Q8NFT8 0.95 Eotaxin-1 (CCL11) P51671 3.8 Eukaryotic translation initiation factor 4E-binding protein 1 (4EBP1) Q13541 Fibroblast growth factor 5 (FGF-5) Q8NF90 1.9 Fibroblast growth factor 19 (FGF-19) O95750 7.6 Fibroblast growth factor 21 (FGF-21) Q9NSA1 31,0 Fibroblast growth factor 23 (FGF-23) Q9GZV9 122,0 Fms-related tyrosine kinase 3 ligand (FIt3L) P49771 0.01 Fractalkine (CX3CL1) P78423 15.3 Glial cell line-derived neutrophic factor (hGDNF) P39905 0.01 Hepatocyte growth factor (HGF)
    [Show full text]
  • Artificial Liver Support Potential to Retard Regeneration?
    REVIEW ARTICLE Artificial Liver Support Potential to Retard Regeneration? Emma J. Mullin, MBChB; Matthew S. Metcalfe, FRCS; Guy J. Maddern, MD Hypothesis: The concept of an “artificial liver” has been growth-promoting factors from these cultured hepato- in development for over 40 years. Such devices aim to cytes? temporarily assume metabolic and excretory functions of the liver, with removal of potentially hepatotoxic sub- Data Sources, Extraction, and Study Selection: stances, thereby clinically stabilizing patients and pre- Data were obtained using PubMed search for reports in- venting deterioration while awaiting transplantation. If volving liver support, extracorporeal circuits, dialysis, sufficient numbers of viable hepatocytes remain, regen- growth factors, and cytokines. Those reports specifi- eration and subsequent recovery of innate liver func- cally looking at the effect of artificial liver support on cy- tion may occur. However, these devices have not yet be- tokines and growth factors are discussed. come part of routine clinical use. Much less is known regarding the effect such devices have, if any, on circu- Conclusions: There is a paucity of information on the lating cytokines and growth factors and the subsequent key events and substances involved in hepatic regenera- effects on the regenerating liver. If these devices remove tion. In addition, there is a potential impact of liver sup- or reduce factors known to promote regeneration, is the port devices on the regeneration of substances associ- rate of regeneration retarded? Conversely, does the in- ated with hepatic regeneration. Further study is needed. corporation of hepatocytes into bioartificial support sys- tems confer an advantage through the production of Arch Surg.
    [Show full text]
  • Human TGF Alpha ELISA Kit Basic Information: Catalog No.: UE1330 Size: 96T for Research Use Only
    Efficient Professional Protein and Antibody Platforms Human TGF alpha ELISA Kit Basic information: Catalog No.: UE1330 Size: 96T For research use only. Not for diagnostic or therapeutic procedures. I. INTRODUCTION Transforming growth factor alpha (TGF-α) is upregulated in some human cancers. It is produced in macrophages, brain cells, and keratinocytes, and induces epithelial development. It is closely related to EGF, and can also bind to the EGF receptor with similar effects . TGFα stimulates neural cell proliferation in the adult injured brain. Transforming growth factor alpha gene (TGFA) maps to human chromosome 2 close to the breakpoint of the t (2;8) variant translocation in Burkitt lymphoma. Synthetic TGF-alpha was as active as murine epidermal growth factor in binding to the epidermal growth factor receptor and in stimulation of anchorage-dependent and of anchorage-independent growth of normal indicator cells in culture. Synthetic TGF-alpha stimulated plasminogen activator production in A 431 and HeLa cells; the stimulation was similar to that induced by epidermal growth factor. Furthermore, synthetic human TGF-alpha showed similar immunoreactivity when compared with rat TGF-alpha. Thus, the 50-amino acid TGF-alpha is likely to be the bioactive principle produced and secreted by tumor cell lines. II. ASSAY PRINCIPLES The Gene Universal Human TGF alpha ELISA (Enzyme-Linked Immunosorbent Assay) kit is an in vitro enzyme-linked immunosorbent assay for the quantitative measurement of Human TGF alpha in Cell Culture Supernatants, Serum, Plasma. This assay employs an antibody specific for Human TGF alpha coated on a 96-well plate. Standards and samples are pipetted into the wells and TGF alpha present in a sample is bound to the wells by the immobilized antibody.
    [Show full text]
  • Proseek Multiplex Oncology I V296×96
    Proseek Multiplex Oncology I v296×96 Adrenomedullin (AM) P35318 Fms-related tyrosine kinase 3 ligand (Flt3L) P49771 Amphiregulin (AR) P15514 Folate receptor alpha (FR-alpha) P15328 Angiopoietin-1 receptor (TIE2) Q02763 Follistatin (FS) P19883 B-cell activating factor (BAFF) Q9Y275 Furin (FUR) P09958 Cadherin-3 (CDH3) P22223 Growth hormone (GH) P01241 Carbonic anhydrase IX (CAIX) Q16790 Growth/differentiation factor 15 (GDF-15) Q99988 Carcinoembryonic antigen (CEA) P06731 Heparin-binding EGF-like growth factor (HB-EGF) Q99075 Caspase-3 (CASP-3) P42574 Hepatocyte growth factor (HGF) P14210 C-C motif chemokine 19 (CCL19) Q99731 ICOS ligand (ICOSLG) O75144 CD40 ligand (CD40-L) P29965 Immunoglobulin-like transcript 3 (ILT-3) Q8NHJ6 C-X-C motif chemokine 5 (CXCL5 ) P42830 Integrin alpha-1 (ITGA1) P56199 C-X-C motif chemokine 9 (CXCL9 ) Q07325 Interferon gamma (IFN-gamma) P01579 C-X-C motif chemokine 10 (CXCL10 ) P02778 Interleukin-1 receptor antagonist protein (IL-1ra) P18510 C-X-C motif chemokine 11 (CXCL11 ) O14625 Interleukin-2 (IL-2) P60568 C-X-C motif chemokine 13 (CXCL13 ) O43927 Interleukin-6 (IL-6) P05231 Cyclin-dependent kinase inhibitor 1 (CDKN1A) P38936 Interleukin-6 receptor subunit alpha (IL-6RA) P08887 Cystatin-B (CSTB) P04080 Interleukin-7 (IL-7) P13232 Early activation antigen CD69 (CD69 ) Q07108 Interleukin-8 (IL-8) P10145 Epidermal growth factor receptor (EGFR ) P00533 Interleukin-12 (IL-12) P29460; P29459 Epididymal secretory protein E4 (HE4 ) Q14508 Interleukin-17 receptor B (IL-17RB ) Q9NRM6 Epithelial cell adhesion molecule
    [Show full text]
  • Canine TGF-Alpha ELISA Kit
    Canine TGF-alpha ELISA Kit Catalog #: AYQ-E10339 (96 wells) User Manual This kit is designed to quantitatively detect the levels of Canine TGF-alpha in cell lysates, serum/ plasma and other suitable sample solution. Manufactured and Distributed by: AssaySolution 310 W Cummings Park, Woburn, MA, 01801, USA Phone: (617) 238-1396, Fax: (617) 380-0053 Email: [email protected] FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC PURPOSES Important notes Before using this product, please read this manual carefully; after reading the subsequent contents of this manual, please note the following specially: • The operation should be carried out in strict accordance with the provided instructions. • Store the unused strips in a sealed foil bag at 2-8°C. • Always avoid foaming when mixing or reconstituting protein solutions. • Pipette reagents and samples into the center of each well, avoid bubbles. • The samples should be transferred into the assay wells within 15 minutes of dilution. • We recommend that all standards, testing samples are tested in duplicate. • Using serial diluted sample is recommended for first test to get the best dilution factor. • If the blue color develops too light after 15 minutes incubation with the substrate, it may be appropriate to extend the incubation time (Do not over-develop). • Avoid cross-contamination by changing tips, using separate reservoirs for each reagent. • Avoid using the suction head without extensive wash. • Do not mix the reagents from different batches. • Stop Solution should be added in the same order of the Substrate Solution. • TMB developing agent is light-sensitive. Avoid prolonged exposure to the light.
    [Show full text]
  • Table S1. List of All Proteins Included in the Proseek® Multiplex Oncology I V2 96X96 Cancer Panel
    Table S1. List of all proteins included in the Proseek® Multiplex Oncology I v2 96x96 Cancer Panel. Adrenomedullin (AM) Ezrin (EZR) Latency-associated peptide transforming growth factor beta-1 (LAP TGF-beta-1) Amphiregulin (AR) Fas antigen ligand (FasL) Angiopoietin-1 receptor (TIE2) FAS-associated death domain protein (FADD) Lipopolysaccharide-induced tumor necrosis factor- alpha factor (LITAF) B-cell activating factor (BAFF) Fms-related tyrosine kinase 3 ligand (Flt3L) Cadherin-3 (CDH3) Folate receptor alpha (FR-alpha) Macrophage colony-stimulating factor 1 (CSF-1) Carbonic anhydrase IX (CAIX) Follistatin (FS) Matrix metalloproteinase-1 (MMP-1) Carcinoembryonic antigen (CEA) Furin (FUR) Melanoma-derived growth regulatory protein (MIA) Caspase-3 (CASP-3) Growth hormone (GH) MHC class I polypeptide-related sequence A (MIC-A) C-C motif chemokine 19 (CCL19) Growth/differentiation factor 15 (GDF-15) Midkine (MK) CD40 ligand (CD40-L) Heparin-binding EGF-like growth factor (HB-EGF) Monocyte chemotactic protein 1 (MCP-1) C-X-C motif chemokine 5 (CXCL5) Hepatocyte growth factor (HGF) Myeloid differentiation primary response protein MyD88 (MYD88) C-X-C motif chemokine 9 (CXCL9) ICOS ligand (ICOSLG) C-X-C motif chemokine 10 (CXCL10) Immunoglobulin-like transcript 3 (ILT-3) NF-kappa-B essential modulator (NEMO) C-X-C motif chemokine 11 (CXCL11) Integrin alpha-1 (ITGA1) NT-3 growth factor receptor (NTRK3) C-X-C motif chemokine 13 (CXCL13) Interferon gamma (IFN-gamma) Ovarian cancer-related tumor marker CA 125 (CA-125) Cyclin-dependent kinase inhibitor
    [Show full text]
  • TGF-Α Antisense Gene Therapy Inhibits Head and Neck Squamous Cell
    Gene Therapy (2000) 7, 1906–1914 2000 Macmillan Publishers Ltd All rights reserved 0969-7128/00 $15.00 www.nature.com/gt ACQUIRED DISEASES RESEARCH ARTICLE TGF-␣ antisense gene therapy inhibits head and neck squamous cell carcinoma growth in vivo S Endo1, Q Zeng1, NA Burke2,YHe3, MF Melhem4, SF Watkins2, MN Lango1, SD Drenning1, L Huang3 and J Rubin Grandis1,2 Departments of 1Otolaryngology, 2Cell Biology and Physiology, 3Pharmacology, 4Pathology, University of Pittsburgh School of Medicine, and University of Pittsburgh Cancer Institute, Pittsburgh, PA, USA Unlike normal mucosal squamous epithelial cells, head and remained localized to the nucleus for up to 3 days. Direct neck squamous cell carcinomas (HNSCCs) overexpress inoculation of the TGF-␣ antisense (but not the correspond- TGF-␣ mRNA and protein which is required to sustain the ing sense) construct into established HNSCC tumors proliferation of HNSCC cells in vitro. To determine whether resulted in inhibition of tumor growth. Sustained antitumor TGF-␣ expression contributes to tumor growth in vivo, cat- effects were observed for up to 1 year after the treatments ionic liposome-mediated gene transfer was used to deliver were discontinued. Down-modulation of TGF-␣ was an antisense expression construct targeting the human TGF- accompanied by increased apoptosis in vivo. These experi- ␣ gene into human head and neck tumor cells, grown as ments indicate that interference with the TGF-␣/EGFR subcutaneous xenografts in nude mice. The TGF-␣ anti- autocrine signaling pathway may be an effective therapeutic sense gene was immediately detected in the cytoplasm of strategy for cancers which overexpress this ligand/receptor the tumor cells, translocated to the nucleus by 12 h and pair.
    [Show full text]
  • A Novel Leptin Receptor Antagonist Uncouples Leptin's Metabolic And
    Cellular and Molecular Life Sciences https://doi.org/10.1007/s00018-019-03004-9 Cellular andMolecular Life Sciences ORIGINAL ARTICLE A novel leptin receptor antagonist uncouples leptin’s metabolic and immune functions Lennart Zabeau1 · Joris Wauman1 · Julie Dam2 · Sandra Van Lint1 · Elianne Burg1 · Jennifer De Geest1 · Elke Rogge1 · Anisia Silva2 · Ralf Jockers2 · Jan Tavernier1 Received: 29 June 2018 / Revised: 28 December 2018 / Accepted: 2 January 2019 © The Author(s) 2019 Abstract Leptin links body energy stores to high energy demanding processes like reproduction and immunity. Based on leptin’s role in autoimmune diseases and cancer, several leptin and leptin receptor (LR) antagonists have been developed, but these intrinsically lead to unwanted weight gain. Here, we report on the uncoupling of leptin’s metabolic and immune functions based on the cross talk with the epidermal growth factor receptor (EGFR). We show that both receptors spontaneously interact and, remarkably, that this complex can partially overrule the lack of LR activation by a leptin antagonistic mutein. Moreover, this leptin mutant induces EGFR phosphorylation comparable to wild-type leptin. Exploiting this non-canonical leptin signalling pathway, we identifed a camelid single-domain antibody that selectively inhibits this LR-EGFR cross talk without interfering with homotypic LR signalling. Administration in vivo showed that this single-domain antibody did not interfere with leptin’s metabolic functions, but could reverse the leptin-driven protection against starvation-induced
    [Show full text]
  • Supplementary Tables Bhandage Birnir
    Table S1: Primers for RT-qPCR Genes Forward Primer Sequence Reverse Primer Sequence Amplicon Size (bp) Endogenous control TBP GAGCTGTGATGTGAAGTTTCC TCTGGGTTTGATCATTCTGTAG 117 IPO8 GCAAAGGAAGGGGAATTGAT CGAAGCTCACTAGTTTTGACCC 91 19 GABAA receptor subunit genes GABRA1 (α1) GTCACCAGTTTCGGACCCG AACCGGAGGACTGTCATAGGT 119 GABRA2 (α2) GTTCAAGCTGAATGCCCAAT ACCTAGAGCCATCAGGAGCA 160 GABRA3 (α3) CAACTTGTTTCAGTTCATTCATCCTT CTTGTTTGTGTGATTATCATCTTCTTAGG 102 GABRA4 (α4) TTGGGGGTCCTGTTACAGAAG TCTGCCTGAAGAACACATCCA 105 GABRA5 (α5) TTGGATGGCTACGACAACAGA GTCCTCACCTGAGTGATGCG 62 GABRA6 (α6) ACCCACAGTGACAATATCAAAAGC GGAGTCAGGATGCAAAACAATCT 67 GABRB1 (β1) TGCATGTATGATGGATCTTCG GTGGTATAGCCATAACTTTCGA 80 GABRB1 (β1) ATTACAATTCTGTCCTGGGTG CACTGTCGTGATTCCTAGTG 81 GABRB2 (β2) GCAGAGTGTCAATGACCCTAGT TGGCAATGTCAATGTTCATCCC 137 GABRB3 (β3) CAAGCTGTTGAAAGGCTACGA ACTTCGGAAACCATGTCGATG 108 GABRG1 (γ1) CCTTTTCTTCTGCGGAGTCAA CATCTGCCTTATCAACACAGTTTCC 91 GABRG2 (γ2) CACAGAAAATGACGGTGTGG TCACCCTCAGGAACTTTTGG 136 GABRG3 (γ3) AACCAACCACCACGAAGAAGA CCTCATGTCCAGGAGGGAAT 113 GABRD (δ) CTTTGCTCATTTCAACGCC TTCCTCACGTCCATCTCTG 86 GABRE (ε) ACAGGAGTGAGCAACAAAACTG TGAAAGGCAACATAGCCAAA 107 GABRQ (θ) CCAGGGTGACAATTGGCTTAA CCCGCAGATGTGAGTCGAT 63 GABRP (π) CAATTTTGGTGGAGAACCCG GCTGTCGGAGGTATATGGTG 110 GABRR1 (ρ1) AAAGGCAGGCCCCAAAGA TCAGAATTGGGCTGACTTGCT 70 GABRR2 (ρ2) TACAGCATGAGGATTACGGT CAAAGAACAGGTCTGGGAG 81 GABRR3 (ρ3) TGATGCTTTCATGGGTTTCA CGCTCACAGCAGTGATGATT 111 2 GABAB receptor subunit genes GABBR1 (GABA-B1) TGGCATGGACGCTTATCGA GATCATCCTTGGTGCTGTCATAGT 78 GABBR2 (GABA-B2) GAGTCCACGCCATCTTCAAAAAT
    [Show full text]
  • Growth Factor Superfamilies and Mammalian Embryogenesis
    Development 102. 451-460 (1988) Review Article 451 Printed in Great Britain © The Company of Biologists Limited 1988 Growth factor superfamilies and mammalian embryogenesis MARK MERCOLA and CHARLES D. STILES Department of Microbiology and Molecular Genetics, Harvard Medical School and the Dana-Farber Cancer Institute, Boston, MA 02115, USA Summary With the availability of amino acid and nucleotide unpredicted from the cell biology of most of the sequence information has come the realization that growth factors. Moreover, these actions are reflected growth factors can be clustered into superfamilies. in nonmammalian species where homologues of the Several of these superfamilies contain molecules that mammalian growth factors control crucial steps in the were not initially identified because of growth-promot- choice of developmental fate. This review describes ing activities; rather they were discovered through five growth factor superfamilies and the role these their ability to regulate other processes. Certain molecules may have in controlling proliferation, dif- members of these superfamilies are present during ferentiation, and morphogenesis during mammalian early mammalian embryogenesis. However, until re- development. cently, it has been difficult to manipulate the develop- ing mammalian embryo to observe directly the effects Key words: growth factor, mammal, epidermal growth of inappropriate, excessive, or reduced expression of factor, EGF, insulin-like growth factor, IGF-I, IGF-II, these molecules. Despite this limitation, at least some transforming growth factor-beta, TGF, heparin-binding of these molecules have been implicated in the control growth factor, HBGF, platelet-derived growth factor, of differentiation and morphogenesis, two actions PDGF. Introduction fibroblast growth factor can induce mesoderm differ- entiation from ectoderm tissue.
    [Show full text]
  • (HGF/SF) on Fibroblast Growth Factor-2 (FGF-2) Levels in External Auditory Canal Cholesteatoma (EACC) Cell Culture
    in vivo 19: 599-604 (2005) Influence of Hepatocyte Growth Factor/Scatter Factor (HGF/SF) on Fibroblast Growth Factor-2 (FGF-2) Levels in External Auditory Canal Cholesteatoma (EACC) Cell Culture RAMIN NAIM1, RAY C. CHANG2, HANEEN SADICK1 and KARL HORMANN1 1Department of Otolaryngology, Head and Neck Surgery, University Hospital Mannheim, D-68135 Mannheim, Germany; 2Department of Otolaryngology, University of Miami/Jackson Memorial Hospital, Miami, Florida, U.S.A. Abstract. Background: In previous studies, we cited angiogenesis have been identified, including fibroblast circulatory disorders and hypoxia as etiological factors for the growth factor-a (aFGF), transforming growth factor-alpha formation of external auditory canal cholesteatoma (EACC) (TGF-alpha), TGF-beta, hepatocyte growth factor/scatter resulting in angiogenesis. Here, we investigate how the factor (HGF/SF), tumor necrosis factor-alpha (TNF-alpha), angiogenic factor hepatocyte growth factor/scatter factor angiogenin and interleukin-8 (IL-8) (3, 4). (HGF/SF) influences the level of another angiogenic factor Fibroblast growth factors (FGFs) are also considered FGF-2. Materials and Methods: After 16 to 72 hours of angiogenic factors, yet the exact relationship between FGF incubation with 20ng/ml HGF/SF, levels of VEGF in the and vascular development in normal and pathological tissue HGF/SF-treated and untreated culture was analyzed. We also has long remained elusive (5). FGF-2 is a member of the investigated the influence of HGF/SF (20-80ng/ml) on the FGF family, that comprises about nine members. FGF-2 concentration of FGF-2. Results: After 16 hours of incubation stimulates smooth muscle cell growth, wound healing, tissue with HGF/SF at 20ng/ml, FGF-2 was measured at 44.19pg/ml repair, and is increased in chronic inflammation (5).
    [Show full text]
  • Role of Angiogenesis-Related Genes in Cleft Lip/Palate: Review of the Literature
    International Journal of Pediatric Otorhinolaryngology 78 (2014) 1579–1585 Contents lists available at ScienceDirect International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl Review Article Role of angiogenesis-related genes in cleft lip/palate: Review of the literature C. Franc¸ois-Fiquet a,b,c,*, M.L. Poli-Merol a, P. Nguyen b, E. Landais d, D. Gaillard d, M. Doco-Fenzy b,d a Department of Pediatric Surgery, American Memorial Hospital, CHU Reims, France b EA 3801 Laboratory Champagne Ardenne University, SFR CAP sante´ Reims-Amiens, Reims, France c Department of Plastic and Reconstructive Surgery, Hopital Maison Blanche, CHU Reims, France d Genetics Department, Hoˆpital Maison Blanche, CHU Reims, France ARTICLE INFO ABSTRACT Article history: Objectives: Cleft lip and cleft palate (CLP) are the most common congenital craniofacial anomalies. They Received 24 May 2014 have a multifactorial etiology and result from an incomplete fusion of the facial buds. Two main Received in revised form 30 July 2014 mechanisms,acting alone orinteracting with each other, were evidenced inthisfusion defect responsible for Accepted 1 August 2014 CLP: defective tissue development and/or defective apoptosis in normal or defective tissues. The objective of Available online 12 August 2014 this work was to study the implication and role of angiogenesis-related genes in the etiology of CL/P. Methods: Our methodological approach included a systematic and thorough analysis of the genes Keywords: involved in CL/P (syndromic and non-syndromic forms) including previously identified genes but also Cleft lip genes that could potentially be angiogenesis-related (OMIM, Pub Med).We studied the interactions of Cleft palate Gene these different genes and their relationships with potential environmental factors.
    [Show full text]