USOO81291 42B2

(12) United States Patent (10) Patent No.: US 8,129,142 B2 Mulley et al. (45) Date of Patent: Mar. 6, 2012

(54) MUTATIONS IN ION CHANNELS 2004/0214195 A1 10/2004 Rouleau et al. 2004/0229257 A1 11/2004 Petrou et al. 2005/OO74764 A1 4/2005 Mulley et al. (75) Inventors: John Charles Mulley, Firle (AU): 2006.0089306 A1 4/2006 Wallace et al. Louise Anne Harkin, Northgate (AU); 2006/0252121 A1 11/2006 Wallace et al. Leanne Michelle Dibbens, College Park 2010.0088778 A1 4/2010 Mulley et al. (AU); Hilary Anne Phillips, Port Noarlunga (AU); Sarah Elizabeth FOREIGN PATENT DOCUMENTS Heron, Highbury (AU); Samuel Frank AU 65.6247 6, 1996 WO WO84,03564 9, 1984 Berkovic, Caulfield North (AU); Ingrid WO WO97/02048 1, 1997 Eileen Scheffer, Hawthorn East (AU): WO WOO1/38564 5, 2001 Anne Davy, North Adelaide (AU) WO WOO1/88125 11, 2001 WO WOO1/98486 12/2001 (73) Assignee: Bionomics Limited. Thebarton, SA WO WOO2,06521 1, 2002 WO WOO2,06521 A1 1, 2002 (AU) WO WOO2,50096 6, 2002 WO WOO2,50096 A1 6, 2002 (*) Notice: Subject to any disclaimer, the term of this WO WOO3,OO8574 1, 2003 patent is extended or adjusted under 35 WO WOO3,OO8574 A1 1, 2003 U.S.C. 154(b) by 1031 days. WO WO 2004/085674 10, 2004 WO WO 2004/085674. A 10, 2004 (21) Appl. No.: 10/567,424 WO WO 2005/O 14863 2, 2005 (22) PCT Filed: Aug. 6, 2004 OTHER PUBLICATIONS Nabbout et al. Jun. 2003 (Neurology 60: 1961-1967).* (86). PCT No.: PCT/AU2OO4/OO1051 Breaker et al., “A DNA enzyme with MG^2+-dependent RNA S371 (c)(1), phosphoesterase activity”, Chemistry & Biology, 2: 655-660, Oct. (2), (4) Date: Dec. 9, 2008 1995. Cole et al., “Human monoclonal antibodies'. Molecular and Cellular (87) PCT Pub. No.: WO2005/014863 Biochemistry, 62: 109-120, 1984. Cote et al., “Generation of human monoclonal antibodies reactive PCT Pub. Date: Feb. 17, 2005 with cellular antigens'. Proceedings of the National Academy of Sciences USA, 80: 2026-2030, Apr. 1983. (65) Prior Publication Data Gamper et al., "Calmodulin mediates Ca2+ dependent modulation US 2009/008 1724 A1 Mar. 26, 2009 of M-type K^+ channels'. The Journal of General Physiology, 122: 17-31, Jul. 2003. (30) Foreign Application Priority Data Goldman et al., “In vitro and in vivo gene delivery mediated by a Synthetic polycationic amino polymer. Nature Biotechnology, 15: Aug. 7, 2003 (AU) ...... 20039,04154 462-466, May 1997. González et al., "Cell-based assays and instrumentation for screening (51) Int. Cl. ion-channel targets'. DDT, 4(9): 431-439, Sep. 1999. CI2N 15/12 (2006.01) Hamill et al., “Improved patch-clamp techniques for high-resolution CI2N 15/63 (2006.01) current recording from cells and cell-free membrane patches'. Euro CI2N 5/10 (2006.01) pean Journal of Physiology, 391: 85-100, 1981. C7H 2L/00 (2006.01) Haseloffet al., “Simple RNA enzymes with new and highly specific endoribonuclease activities', Nature, 334: 585-591, Aug. 1988. C07K I4/47 (2006.01) Heller et al., “Discovery and analysis of inflammatory disease-related (52) U.S. Cl...... 435/69.1; 435/320.1; 435/252.3: genes using cDNA microarrays'. Proceedings of the National Acad 536/23.5; 530/350 emy of Sciences USA,94: 2150-2155. Mar. 1997. (58) Field of Classification Search ...... None See application file for complete search history. (Continued) (56) References Cited Primary Examiner — Daniel E. Kolker U.S. PATENT DOCUMENTS (74) Attorney, Agent, or Firm — Jenkins, Wilson, Taylor & 4,016,043 A 4, 1977 Schuurs et al. Hunt, PA. 4,172,124 A 10/1979 Koprowski et al. 4.474,893 A 10/1984 Reading 4,971,903. A 1 1/1990 Hyman (57) ABSTRACT 5,331,573 A 7/1994 Balaji et al. 5,579,250 A 1 1/1996 Balaji et al. A method of identifying a subject predisposed to a disorder 6,331,614 B1 12/2001 Wong et al. associated with ion channel dysfunction, comprising ascer 7,078,515 B2 7/2006 Wallace et al. taining whether at least one of the genes encoding ion channel 7.282,336 B2 10/2007 Wallace et al. 7,709,225 B2 5, 2010 Wallace et al. Subunits in said subject has undergone a mutation event as set 7,723,027 B2 5, 2010 Petrou et al. forth in one of SEQID Numbers: 1-72. 2003. O157525 A1 8, 2003 Mintier et al. 2004/0096886 A1 5, 2004 Rouleau et al. 2004/O110706 A1 6, 2004 Wallace et al. 15 Claims, 5 Drawing Sheets US 8,129,142 B2 Page 2

OTHER PUBLICATIONS Escayget al. A novel SCN1A mutation associated with generalized epilepsy with febrile seizures plus—and prevalence of variants in Huse et al., “Generation of a large combinatorial library of the patients with epilepsy. American Journal of Human Genetics, vol. 68, immunoglobulin repertoire in phage lambda”, Science, 246: 1275 (2001), pp. 866-873. 1281, Dec. 1989. Lu et al. Isolation of a human-brain sodium-channel gene encoding Italian League Against Epilepsy Genetic Collaborative Group, "Con two isoforms of the subtype III O-subunit. Journal of Molecular cordance of clinical forms of epilepsy in families with several Neuroscience, vol. 10, (1998), pp. 67-70. affected members”, Epilepsia, 34(5): 819-826, 1993. Noda et al. Existence of distinct sodium channel messenger RNAs in Jentsch Thomas J., “Neuronal KCNQ potassium channels: physiol rat brain. Nature, vol. 320, (1986), pp. 188-192. ogy and role in disease'. Neuroscience, 1:21-30, Oct. 2000. Supplementary European Search Report corresponding to an EP Kasai et al., “Genomic structures of SCN2A and SCN3A- candidate application No. EP 04761088 dated May 18, 2007. genes for deafness at the DFNA16 locus'. Gene, 264: 113-122, 2001. Abstracts of Decisions. Decision of a Delegate of the Commissioner Köhler et al., “Continuous cultures of fused cells secreting antibody of Patents corresponding to an Australian Patent Application No. of predefined specificity”. Nature, 256: 495-497. Aug. 1975. 18465/01 issued Jan. 29, 2007. Kozbor et al., “Specific immunoglobulin production and enhanced Alekov et al., “A Sodium channel mutation causing epilepsy in man tumorigenicity following ascites growth of human hybridomas'. exhibits subtle defects in fast inactivation and activation in vitro.” Journal of Immunological Methods, 81: 31-42, 1985. Journal of Physiology, vol. 529, No. 3, pp. 533-539 (2000). Ohya et al., “Diverse essential functions revealed by complementing Andermann, "Multifactorial Inheritance of Generalized and Focal yeast calmodulin mutants'. Science, 263:963-966, Feb. 1994. Epilepsy.” Genetic Basis of the Epilepsies, pp. 355-374 (1982). Orlandi et al., “Cloning immunoglobulin variable domains for Annegers, “The Epidemiology of Epilepsy.” The Treatment of Epi expression by the polymerase chain reaction'. Proceedings of the lepsy. Principles and Practice. Chpt. 11, pp. 165-172 (1996). National Academy of Sciences USA, 86: 3833-3837, May 1989. Baulac et al., “A Second Locus for Familial Generalized Epilepsy Palfi et al., “Differential calmodulin gene expression in the rodent with Febrile Seizures Plus Maps to Chromosome 2d21-q33.” Am. J. brain', Life Sciences, 70: 2829-2855, 2002. Hum. Genet., vol. 65, pp. 1078-1085 (1999). Phillipset al., “CHRNB2 is the secondacetylcholine receptor subunit Bell and Lathrop, “Multiple loci for multiple sclerosis.” Nature associated with autosomal dominant nocturnal frontal lobe epi Genetics, vol. 13, pp. 377-378 (Aug. 1996). lepsy, American Journal of Human Genetics, 68: 225-231, 2001. Bendahhou et al., “Activation and Inactivation of the Voltage-Gated Rickert et al., “B lymphocyte-specific, Cre-mediated mutagenesis in Sodium Channel: Role of Segment S5 Revealed by a Novel mice”. Nucleic Acids Research, 25(6): 1317-1318, 1997. Hyperkalaemic Periodic Paralysis Mutation.” J. Neurosci., vol. 19. Roger et al., “Epileptic syndromes in infancy, childhood and adoles pp. 4762-4771 (1999). cence”. British Library Cataloguing in Publication Data,2:409-413, Berkovic et al., “Concepts of absence epilepsies: Discrete syndromes 1992. or biological continuum?” Neurology, vol. 37, No. 6, pp. 993-1000 Scharf et al., “6 heat stress promoters and transcription factors'. (Jun. 1987). Results and Problems in Cell Differentiation, 20; 125-162, 1994. Berkovic et al., "Familial Epilepsies in Israel: Clinical Syndromes Schena et al., “Parallel human genome analysis: microarray-based and Modes of Inheritance.” Neurology, vol. 54. Suppl. 3, A356, No. expression monitoring of 1000 genes”. Proceedings of the National P05,063 (Apr. 2000). Academy of Sciences USA, 93: 10614-10619, Oct. 1996. Berkovic et al., “The epilepsies: specific syndromes or a Schmitt et al., “A recessive C-terminal Jervell and Lange-Nielsen neurobiological continuum?' Epileptic Seizures and Syndromes, mutation of the KCNQ1 channel impairs subunit assembly'. The Chpt. 5, pp. 25-37 (1994). EMBOJournal, 19(3): 332-340, 2000. Bertrand et al., “Properties of neuronal nicotinic acetylcholine recep Schwake et al., "Surface expression and single channel properties of tor mutants from humans Suffering from autosomal dominant noc KCNQ2/KCNQ3, M-type K^+ channels involved in epilepsy”. The turnal frontal lobe epilepsy.” British J. of Pharmacology, vol. 124, pp. Journal of Biological Chemistry, 275(18): 13343-13348, 2000. 1-10 (1998). Schwenk et al., “A cre-transgenic mouse strain for the ubiquitous Bievert et al., “A Potassium Channel Mutation in Neonatal Human deletion of loXP-flanked gene segments including deletion in germ Epilepsy.” Science, vol. 279, pp. 403-406 (Jan. 16, 1998). cells”, Nucleic Acids Research, 23(24): 5080-5081, 1995. Bourgeois, "Chronic Management of Seizures in the Syndromes of Toutenhoofd et al., “The calmodulin multigene family as a unique Idiopathic Generalized Epilepsy.” Epilepsia, 44 (Suppl. 2), pp. 27-32 case of genetic redundancy: multiple levels of regulation to provide (2003). spatial and temporal control of calmodulin pools?”. Cell Calcium, Cannon, “Sodium Channel Gating: No Margin for Error.” Neuron, 28(2): 83-96, 2000. vol. 34, pp. 853-858 (Jun. 13, 2002). Wallace et al., “Neuronal sodium-channel O. 1-subunit mutations in CavaZZuti et al., “Longitudinal Study of Epileptiform EEG Patterns generalized epilepsy with febrile seizures plus”. American Journal of in Normal Children.” Epilepsia, vol. 21, pp. 43-55 (1980). Human Genetics, 68: 859-865, 2001. Charlier et al., “A pore mutation in a novel KQT-like potassium Wen et al., "Calmodulin is an auxiliary subunit of KCNQ2/3 potas channel gene in an idiopathic epilepsy family.” Nature Genetics, vol. sium channels'. The Journal of Neuroscience, 22(18): 7991-8001, 18, pp. 53-55 (Jan. 1998). Sep. 2002. Chou et al., “The lack of association between febrile convulsions and Winter et al., “Man-made antibodies', Nature, 349: 293-299, Jan. polymorphisms in SCNIA.” Epilepsy Research, vol. 54, pp. 53-57 1991. (2003). Wyman et al., “A highly polymorphic locus in human DNA'. Pro Claes et al., “De Novo Mutations in the Sodium-Channel Gene ceedings of the National Academy of Sciences USA, 77(11): 6754 SCN1A Cause Severe Myoclonic Epilepsy of Infancy.” American 6758, Nov. 1980. Journal of Human Genetics, vol. 68, pp. 1327-1332 (2001). Yus-Néjera et al., “The identification and characterization of a Collins, “Positional cloning moves from perditional to traditional.” noncontinuous calmodulin-binding site in noninactivating voltage Nature Genetics, vol. 9, pp. 347-349 (Apr. 1995). dependent KCNQ potassium channels'. The Journal of Biological Commission on Classification and Terminology of the International Chemistry, 277(32): 28545-28553, 2002. League Against Epilepsy, “Proposal for Revised Classification of International Preliminary Report on Patentability, corresponding to Epilepsies and Epileptic Syndromes.” Epilepsia, vol. 30, No. 4, pp. PCT application No. PCT/AU2004/00151 dated Feb. 23, 2006. 389-399 (1989). Abou-Khalil et al. Partial and generalized epilepsy with febrile sei Communication pursuant to Rule 46(1) EPC corresponding to Euro Zures plus and a novel SCN1A mutation. Neurology, vol. 57. (2001), pean Application No. 04718885.9-2402 PCT/AU2004.000295 dated pp. 2265-2272. Jul. 14, 2006. Claes et al. DeNovo SCN1A mutations are a major cause of severe Database UniProt, “Sodium channel protein type I alpha subunit.” myoclonic epilepsy of infancy. Human Mutation, vol. 21, (2003), pp. XP002313393, retrieved from EBI accession No. UNIPROT: CIN1 615-621. HUMAN, Database accession No. P35498. (Abstract). US 8,129,142 B2 Page 3

DePalma, A., “Capturing Proteins Using Antibody Arrays.” from Hirschhorn et al., “A comprehensive review of genetic association Genomics and Proteomics; available online from author at www. studies.” Genetics in Medicine, vol. 4. No. 2, pp. 45-61 (2002). adeplama.com, pp. 1-5. International Search Report for International Application No. PCT/ Doose and Baier, “Genetic Aspects of Childhood Epilepsy.” Cleve AU2004/000295 dated May 14, 2004. land Clinic Journal of Medicine, vol. 56, Suppl. Part 1, S101-S110 Interview Summary corresponding to U.S. Appl. No. 1 1/262,647 (1989). dated Dec. 5, 2008. Doose and Baier, “Genetic Factors in Epilepsies with Primarily Gen Interview Summary corresponding to U.S. Appl. No. 10/806,899 eralized Minor Seizures.” Neuropediatrics, vol. 18, Suppl. I, pp. 1-64 dated Nov. 23, 2009. (Feb. 1987). Interview Summary corresponding to U.S. Appl. No. 10/806,899 Dworakowska and Dolowy, “Ion channels-related diseases.” ACTA dated Oct. 8, 2009. Biochimica Polonica, vol. 47, No. 3, pp. 685-703 (2000). Interview Summary corresponding to U.S. Appl. No. 10/806,899 Escayget al., “Mutations of SCN1A, encoding a neuronal Sodium dated Nov. 1, 2007. channel, in two families with GEFS+2.” Nature Genetics, vol. 24, pp. Janz et al., “Do idiopathic generalized epilepsies share a common 343-345 (Apr. 2000). Susceptibility gene?” Neurology, vol. 42, Suppl 5, pp. 48-55 (Apr. European Patent Office Search Report corresponding to European 1992). Patent Application No. 07075566.5-2401 dated Oct. 4, 2007. Kanai et al., “Effect of localization of missense mutations in SCN1A Examiner's First Report for Australian Patent Application No. on epilepsy phenotype severity.” Neurology, vol. 63, pp. 329-334 2004200978 dated May 6, 2004. (2004). Finkelstein et al., “Use of denaturing gradient gel electrophoresis for Kimura K., “A missense mutation in SCN1A in brothers with severe detection of mutation and prospective diagnosis in late onset myoclonic epilepsy in infancy (SMEI) inherited from a father with ornithine transcarbamylase deficiency.’ Genomics, vol. 7, pp. 167 febrile seizures.” Brain Dev., vol.27, No. 6, pp. 424-430 (Sep. 2005). 172 (1990). Kinzler et al., “Identification of a gene located at chromosome 5q21 Fong et al., “Childhood Absence Epilepsy with Tonic-Clonic Sei that is mutated in colorectal cancers.” Science, vol. 251, pp. 1366 Zures and Electroencephalogram 3-4-HZ Spike and Multispike— 1370 (1991). Slow Wave Complexes: Linkage to Chromosome 8q24.” Am. J. Hum. Kuhn et al., “Movement of voltage sensor S4 in domain 4 is tightly Genet., vol. 63, pp. 1117-1129 (1998). coupled to Sodium channel fast inactivation and gating charge immo Fujiwara et al., “Long-Term Course of Childhood Epilepsy with bilization.” J. Gen. Physiol, vol. 114, pp. 167-183 (1999). Intractable Grand Mal Seizures,” Jpn. J. Psychiatry Neurol., vol. 46, Lason W., “Neurochemical and pharmacological aspects of cocaine pp. 297-302 (1992). induced seizures.” Polish Journal of Pharmacology, vol.53, pp. 57-60 Fukuma G., “Mutations of neuronal voltage-gated Na+ channel alpha (2001). 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy Lerche et al., “Ion Channels and Epilepsy.” Am. J. of Med. Genetics, (SMEI) and in borderline SMEI (SMEB).” Epilepsia, vol. 45, No. 2, vol. 106, pp. 146-159 (2001). pp. 140-148 (Feb. 2004). Lernmark and Ott, “Sometimes it's hot, sometimes it's not.” Nature Gardiner, "Impact of our understanding of the genetic aetiology of Genetics, vol. 19, pp. 213-214 (Jul 1998). epilepsy.” J. Neurol., vol. 247, pp. 327-334 (2000). Lo et al., “High Level Expression and Secretion of Fc-X Fusion Genbank accession No. AB093548, Oct. 16, 2002. Proteins in Mammalian Cells.” Protein Engineering, vol. 11, pp. Genbank accession No. M22253, Oct. 26, 1995. 495-500 (1998). Genbank accession No. NM 012647, Mar. 21, 2010. Lopes-Cendes et al., “A New Locus for Generalized Epilepsy with Genbank Accession No. NM 172107. Aug. 5, 2010. Febrile Seizures Plus Maps to Chromosome 2,” Am. J. Hum. Genet. GenBank Locus AF225985. “Homo sapiens voltage-gated sodium vol. 66, pp. 698-701 (2000). channel alpha subunit SCN1A (SCN1A) mRNA, complete cols.” pp. Lucentini, J., “Gene Asscoiation Studies Typically Wrong.” The Sci 1-4 (Feb. 1, 2001). entist, p. 20 (Dec. 20, 2004). GenBank Locus NM 006920, “Homo sapiens sodium channel, volt Madia et al., “No evidence of GABRG2 mutations in severe age-gated, type I, alpha (SCN1A), mRNA. pp. 1-11 (Nov. 13, 2006). myoclonic epilepsy of infancy.” Epilepsy Research, vol.53, pp. 196 Gene Card for SCNA1 available via uri: genecards.org, pp. 1-20, Jul. 23, 2007. Maxam et al., “A new method for sequencing DNA” Proceedings of Gennaro et al., “Familial severe myoclonic epilepsy of infancy: trun the National Academy of Sciences of the USA, vol. 74, No. 2, pp. cation of Nal. 1 and genetic heterogeneity.” Epileptic Disord... vol. 5, 560-564 (1977). pp. 21-25 (2003). Mazumder et al., “Translations control by the 3'UTR: the ends Geysen H.M. et al., "Cognitive features of continuous antigenic specify the means.” Trends in Biochemical Sciences, vol. 28, pp. determinants.” Journal of Molecular Recognition, vol. 1, pp. 32-41 91-98 (2004). (1988). Modrich, Paul. “Mechanisms and biological effects of mismatch Goldsby et al., “Immunology.” Fifth Edition, section “Cross-Reac repair.” Annual Review of Genetics, vol. 25, pp. 229-253 (1991). tivity.” p. 141 (2003). Moran et al., “Skeletal Muscle Sodium Channel Is Affected by an Greenberg et al., “Evidence for multiple geneloci in the expression of Epileptogenic B1 Subunit Mutation.” Biochem. Biophys. Res. the common generalized epilepsies. Neurology, vol. 42. Suppl. 5, Comm., vol. 282, pp.55-59 (2001). pp. 56-62 (Apr. 1992). Moulard et al., “Identification of a New Locus for Generalized Epi Greenberg et al., “Juvenile Myoclonic Epilepsy (JME) May be lepsy with Febrile Seizures Plus (GEFS+) on Chromosome 2d24 Linked to the BF and HLA Loci on Human Chromosome 6, Am. J. q33.” Am. J. Hum. Genet., vol. 65, pp. 1396-1400 (1999). of Medical Genetics, vol. 31, pp. 185-192 (1988). Mulley et al., “SCN1A Mutations and Epilepsy.” Human Mutation, Greenberg et al., “Segregation Analysis of Juvenile Myoclonic Epi vol. 25, pp. 535-542 (2005). lepsy.” Genetic Epidemiology, vol. 5, pp. 81-94 (1988). Mulley et al., “Channelopathies as a Genetic Cause of Epilepsy.” Guerrini et al., Lamotrigine and seizure aggravation in severe Current Opinion in Neurology, vol. 16, pp. 171-176 (2003). myoclonic epilepsy, Epilepsia, vol. 39s, pp. 508-512 (1998). Notice of Allowance corresponding to U.S. Appl. No. 10/451,126 Harkin et al., “The Spectrum of SCN1A-Related Infantile Epileptic (Patent No. 7,078.515) dated Aug. 30, 2005. Encephalopathies.” Brain, vol. 130, pp. 843-852 (2007). Notice of Allowance corresponding to U.S. Appl. No. 1 1/263.326 Hauser et al., “Incidence of Epilespy and Unprovoked Seizures in (Patent No. 7.282,336) dated Jun. 18, 2007. Rochester, Minnesota: 1935-1984.” Epilepsia, vol. 34, No. 3, pp. Notice of Allowance corresponding to U.S. Appl. No. 1 1/262,647 453-468 (1993). dated Dec. 18, 2009. Hille, “Ionic Channels of Exciteable Membranes,* 2" Edition, pp. Notice of Allowance corresponding to U.S. Appl. No. 10/806,899 423 and 434-444 (1992). dated Jan. 4, 2010. US 8,129,142 B2 Page 4

Notification Concerning Transmittal of International Preliminary Sanger et al., “DNA sequencing with chain-terminating inhibitors.” Report on Patentability for International Application No. PCT/ Proceedings of the National Academy of Sciences of the USA. vol. AU2006/000841 dated Jan. 3, 2008. 74, No. 12, pp. 5463-5467 (1977). Official Communication of U.S. Patent and Trademark Office corre Scheffer and Berkovic, “Generalized epilepsy with febrile seizures sponding to U.S. Appl. No. 10/482,834 dated Aug. 7, 2009. plus A genetic disorder with heterogeneous clinical phenotypes.” Official Communication of U.S. Patent and Trademark Office corre Brain, vol. 120, pp. 479-490 (1997). sponding to U.S. Appl. No. 10/482,834 dated Dec. 30, 2008. Scheffer et al., “Locus for Febrile Seizures.” Annals of Neurology, Official Communication of U.S. Patent and Trademark Office corre vol. 47, No. 6, pp. 840-841 (Jun. 2000). sponding to U.S. Appl. No. 10/482,834 dated Apr. 4, 2008. Scheffer et al., “The Genetics of Human Epilepsy.” TRENDS in Official Communication of U.S. Patent and Trademark Office corre Pharmacological Science, vol. 24. No. 8, pp. 428-433 (Aug. 2003). sponding to U.S. Appl. No. 10/482,834 dated Aug. 2, 2007. Sheffield et al., “Attachment of a 40-base-pair G+C-rich sequence Official Communication of U.S. Patent and Trademark Office corre (GC-clamp) to genomic DNA fragments by the polymerase chain sponding to U.S. Appl. No. 10/806,899 dated Oct. 28, 2009. reaction results.” Proceedings of the National Academy of Sciences Official Communication of U.S. Patent and Trademark Office corre of the USA, vol. 86, pp. 232-236 (1989). sponding to U.S. Appl. No. 10/806,899 dated May 13, 2009. Singh et al., “A novel potassium channel gene, KCNO2, is mutated in Official Communication of U.S. Patent and Trademark Office corre an inherited epilepsy of newborns.” Nature Genetics, vol. 18, pp. sponding to U.S. Appl. No. 10/806,899 dated Aug. 19, 2008. 25-29 (Jan. 1998). Official Communication of U.S. Patent and Trademark Office corre Singh et al., “Generalized Epilepsy with Febrile Seizures Plus: a sponding to U.S. Appl. No. 10/806,899 dated Jun. 26, 2007. Common Childhood-Onset Onset Genetic Epilepsy Syndrome.” Official Communication of U.S. Patent and Trademark Office corre Ann. Neurol., vol. 45, pp. 75-81 (1999). sponding to U.S. Appl. No. 10/806,899 dated Nov. 29, 2006. Singhet al., “Severe Myoclonic Epilepsy of Infancy: Extended Spec Official Communication of U.S. Patent and Trademark Office corre trum of GEFS?” Epilepsia, vol. 42, No. 7, pp. 837-844 (2001). sponding to U.S. Appl. No. 1 1/263.326 (Patent No. 7.282,336) dated Spampanato et al., “Generalized Epilepsy with Febrile Seizures Plus Oct. 6, 2006. Type 2 Mutation W1204R Alters voltage-Dependent Gating of Official Communication of U.S. Patent and Trademark Office corre Na, 1.1 Sodium Channels.” Neuroscience, vol. 116, pp. 37-48 (2003). sponding to U.S. Appl. No. 1 1/262,647 dated Apr. 22, 2009. Stafstrom et al., “Epilepsy Genes: The link between molecular dys Official Communication of U.S. Patent and Trademark Office corre function and pathophysiology. Mental Retardation and Develop sponding to U.S. Appl. No. 1 1/262,647 dated Dec. 5, 2008. Official Communication of U.S. Patent and Trademark Office corre mental Disabilities Research Reviews, vol. 6, pp. 281-292 (2000). sponding to U.S. Appl. No. 1 1/262,647 dated Feb. 15, 2008. Steinlein et al., “A missense mutation in the neuronal nicotinic ace Official Communication of U.S. Patent and Trademark Office corre tylcholine receptor C4 subunit is associated with autosomal dominant sponding to U.S. Appl. No. 10/451,126 (Patent No. 7,078,515) dated nocturnal frontal lobe epilepsy.” Nature Genetics, vol. 11, pp. 201 Jan. 24, 2005. 203 (Oct. 1995). Ohmori et al., “Significant correlation of the SCN1A mutations and Sugawara et al., “Frequent mutations of SCN1A in severe myoclonic severe myoclonic epilepsy in infancy.” Biochemical and Biophysical epilepsy in infancy.” Neurology, vol. 58, pp. 1122-1124 (2002). Research Communications, vol. 295, pp. 17-23 (2002). Sugawara, T., "Nav1.1 channels with mutations of severe myoclonic Ohtahara et al., “Lennox-Gastaut syndrome: a new vista.” Psychiatry epilepsy in infancy display attenuated currents. Epilepsy Res., vol. Clin. Neurosci., vol. 49, pp. S179-S183 (1995). 54, Nos. 2-3, pp. 201-207 (May 2003). Ohtsuka et al., "Long-term prognosis of the Lennox-Gastaut Syn Supplementary European Search Report corresponding to Australian drome.” Jpn. J. Psychiatry Neurol., vol. 44, pp. 257-264 (1990). Patent No. AUO200910 dated Feb. 17, 2005. Ohtsuka et al., "Refractory Childhood Epilepsy and Factors Related Supplementary Partial European Search Report for Application No. to Refractoriness.” Epilepsia, vol. 41. Suppl. 9, pp. 14-17 (2000). O1271383.0-2406 dated Mar. 12, 2004. Okubo et al., “Epileptiform EEG Discharges in Healthy Children: Taylor et al., “Enzymatic methods for mutation scanning. Genetic Prevalence, Emotional and Behavioral Correlates, and Genetic Influ Analysis: Biomolecular Engineering, vol. 14, pp. 181-186 (1999). ences.” Epilepsia, vol. 35. No. 4, pp. 832-841 (1994). Thisted, “What is a P-value?” available online from www.stat. Orita et al., “Detection of polymorphisms of human DNA by gel electrophoresis as single-strand confirmation polymorphisms.” Pro uchicago.edu, pp. 1-6 (May 25, 1998). ceedings of the National Academy of Sciences of the USA. vol. 86. Todd, “Interpretation of results from genetic studies of multifactorial pp. 2766-2770 (1989). disease.” Molecular Medicine, vol. 354, pp. 15-16 (Jul. 1999). Panayiotopoulos and Obeid, “Juvenile Myoclonic Epilepsy: An Veggiottietal., “Generalized Epilepsy with Febrile Seizures plus and Autosomal Recessive Disease.” Ann Neurol, vol. 25, pp. 440-443 Severe Myoclonic Epilepsy in Infancy: a case report of two Italian (1989). families.” Epileptic Discord, vol. 3, pp. 29-32 (2001). Peiffer et al., “A Locus for Febrile Seizures (FEB3) Maps to Chro Wallace et al., “Febrile seizures and generalized epilepsy associated mosome 2c23-24.” Annals of Neurology, vol. 46, No. 4, pp. 671-678 with a mutation in the Na-channel B1 subunit gene SCN1B,” Nature (Oct. 1999). Genetics, vol. 19, pp. 366-370 (Aug. 1998). Phillips et al., “Autosomal Dominant Nocturnal Frontal-Lobe Epi Wallace et al., “Mutant GABA receptor Y2-subunit in childhood lepsy: Genetic Heterogeneity and Evidence for a Second Locus at absence epilepsy and febrile seizures.” Nature Genetics, vol. 28, pp. 15q24.” Am. J. Hum. Genet, vol. 63, pp. 1108-1116 (1998). 49-52 (May 2001). Phillips et al., “Localization of a gene for autosomal dominant noc Wallace et al., “Sodium Channel E L-Subunit Mutations in Severe turnal frontal lobe epilepsy to chromosome 20q13.2.” Nature Genet Myoclonic Epilepsy of Infancy and Infantile Spasms.” Neurology, ics, vol. 10, pp. 117-118 (May 1995). vol. 61, pp. 765-769 (Sep. 2003). Plummer et al., “Evolution and Diversity of Mammalian Sodium Wallace R. “A Plethora of SCN1A Mutations: What Can They Tell Channel Genes.” Genomics, vol. 57, pp. 323-331 (1999). Us?” Epilepsy Curro., vol. 5, No. 1, pp. 17-20 (Jan. 2005). Plummer et al., “Exon Organization, Coding Sequence, Physical Wartellet al., “Detecting base pair substitutions in DNA fragments by Mapping, and Polymorphic Intragenic Markers for the Human temperature-gradient gel electrophoresis. Nucleic Acids Research, Neuronal Sodium Channel Gene SCN8A.” Genomics, vol. 54, pp. vol. 18, No. 9, pp. 2699-2705 (1990). 287-296 (1998). Zara et al., “Mapping of genes predisposing to idiopathic generalized Reutens and Berkovic, "Idiopathic generalized epilepsy of adoles epilepsy.” Human Molecular Genetics, vol. 4. No. 7, pp. 1201-1207 cence: Are the syndromes clinically distinct? Neurology, vol. 45, pp. (1995). 1469-1476 (Aug. 1995). Zara et al., “Mapping of Locus for a Familial Autosomal Recessive Risch and Botstein, "A manic depressive history.” Nature Genetics, Idiopathic Myoclonic Epilepsy of Infancy to Chromosome 16p13.” vol. 12, pp. 351-353 (Apr. 1996). Am. J. Hum. Genet., vol. 66, pp. 1552-1557. US 8,129,142 B2 Page 5

Fujiwara, T. et al., Mutations of sodium channel O. Submit type 1 International Preliminary Report for Patentability and Written Opin (SCN1A) in intractable childhood epilepsies with frequent general- ion corresponding PCT Appl. No. PCT/AU2004/001051 dated Aug. ized tonic-clonic seizures, Brain (2003), 126: 531-546. 6, 2004. Apr. 25, 2006. Nabbout, R. et al., Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy, Neurology, Jun. (2 of 2) 2003, 60:1961-1967. * cited by examiner U.S. Patent Mar. 6, 2012 Sheet 1 of 5 US 8,129,142 B2

A

Normal

B

GE: Outbred Population C go

IGE: Inbred Population

GE Autosomal Dominant FIG. 1 U.S. Patent Mar. 6, 2012 Sheet 2 of 5 US 8,129,142 B2

"GS GM)

FIG. 2 U.S. Patent Mar. 6, 2012 Sheet 3 of 5 US 8,129,142 B2

A

I

II

C

IV

Febrile Seizures 2 Febrile Seizures Plus A A1067T SCN1A Myoclonic Astatic Epilepsy k N43 del SCN3A Absences -- G1050S SCN8A Severe Myoclonic Epilepsy of Infancy Y Q35lX GABRG2 FIG. 3 U.S. Patent Mar. 6, 2012 Sheet 4 of 5 US 8,129,142 B2

--Q2L619R-> 5. Controls

F.G. 4

U.S. Patent Mar. 6, 2012 Sheet 5 of 5 US 8,129,142 B2

0.3000 rvestors assosaur ---arrowsnessessen awurrussesserravel-huesasassrs sent mutan.

DBLeu OB-Q2 WT DB-Q2 R353G DB-Q2L619R KCNO2 BAT

FIG. 5 US 8,129,142 B2 1. 2 MUTATIONS IN ON CHANNELS genes sometimes interacting with environmental influences. Molecular genetic advances in disorders with complex inher TECHNICAL FIELD itance have been far more modest to date (Todd, 1999). Most of the molecular genetic advances have occurred by a The present invention is concerned with mutations in pro sequential three stage process. First a clinically homogeneous teins having biological functions as ion channels and, more disorder is identified and its mode of inheritance determined. particularly, with Such mutations where they are associated Second, linkage analysis is performed on carefully character with diseases Such as epilepsy and disorders associated with ized clinical populations with the disorder. Linkage analysis ion channel dysfunction including, but not restricted to, is a process where the chromosomal localization of a particu hyper- or hypo-kalemic periodic paralysis, myotonias, malig 10 lar disorder is narrowed down to approximately 0.5% of the nant hyperthermia, myasthenia, cardiac arrhythmias, epi total genome. Knowledge of linkage imparts no intrinsic bio sodic ataxia, migraine, Alzheimer's disease, Parkinson's dis ease, Schizophrenia, hyperekplexia, anxiety, depression, logical insights other than the important clue as to where to phobic obsessive symptoms, neuropathic pain, inflammatory look in the genome for the abnormal gene. Third, strategies pain, chronic/acute pain, Bartter's syndrome, polycystic kid 15 Such as positional cloning or the positional candidate ney disease, Dent's disease, hyperinsulinemic hypoglycemia approach are used to identify the aberrant gene and its specific of infancy, cystic fibrosis, congenital stationary night blind mutations within the linked region (Collins, 1995). ness and total colour-blindness. Linkage studies in disorders with complex inheritance have been bedevilled by negative results and by failure to BACKGROUND ART replicate positive findings. A sense of frustration permeates current literature in the genetics of complex disorders. Care Epilepsies constitute a diverse collection of brain disorders fully performed, large scale studies involving hundreds of that affect about 3% of the population at some time in their sibpairs in disorders including multiple Sclerosis and diabetes lives (Annegers, 1996). An epileptic seizure can be defined as have been essentially negative (Bell and Lathrop, 1996; Lern an episodic change in behaviour caused by the disordered 25 mark and Ott, 1998). An emerging view is that such disorders firing of populations of neurons in the central nervous system. are due to the Summation of many genes of Small effect and This results in varying degrees of involuntary muscle contrac that identification of these genes may only be possible with tion and often a loss of consciousness. Epilepsy syndromes very large-scale association studies. Such studies on a have been classified into more than 40 distinct types based genome-wide basis are currently impossible due to incom upon characteristic symptoms, types of seizure, cause, age of 30 plete marker sets and computational limitations. onset and EEG patterns (Commission on Classification and The idiopathic generalized epilepsies (IGE) are the most Terminology of the International League Against Epilepsy, common group of inherited human epilepsy and do not have 1989). However the single feature that is common to all simple inheritance. Like other complex disorders, linkage syndromes is the persistent increase in neuronal excitability studies in IGE have generated controversial and conflicting that is both occasionally and unpredictably expressed as a 35 claims. Previous authors have suggested the possibility of seizure. multifactorial, polygenic, oligogenic or two locus models for A genetic contribution to the aetiology of epilepsy has been the disease (Andermann, 1982: Doose and Baier, 1989; estimated to be present in approximately 40% of affected Greenberg et al., 1988a; 1992; Janz et al., 1992). individuals (Gardiner, 2000). As epileptic seizures may be the Two broad groups of IGE are now known the classical end-point of a number of molecular aberrations that ulti 40 idiopathic generalized epilepsies (Commission on Classifica mately disturb neuronal synchrony, the genetic basis for epi tion and Terminology of the International League Against lepsy is likely to be heterogeneous. There are over 200 Men Epilepsy, 1989) and the newly recognized genetic syndrome delian diseases which include epilepsy as part of the of generalized epilepsy with febrile seizures plus (GEFS) phenotype. In these diseases, seizures are symptomatic of (Scheffer and Berkovic, 1997: Singh et al., 1999). underlying neurological involvement such as disturbances, in 45 The classical IGEs are divided into a number of clinically brain structure or function. In contrast, there are also a num recognizable but overlapping Sub-syndromes including ber of "pure' epilepsy syndromes in which epilepsy is the sole childhood absence epilepsy, juvenile absence epilepsy, juve manifestation in the affected individuals. These are termed nile myoclonic epilepsy etc (Commission on Classification idiopathic and account for over 60% of all epilepsy cases. and Terminology of the International League Against Epi Idiopathic epilepsies have been further divided into partial 50 lepsy, 1989; Roger et al., 1992). The sub-syndromes are iden and generalized sub-types. Partial (focal or local) epileptic tified by age of onset and the pattern of seizure types (absence, fits arise from localized cortical discharges, so that only cer myoclonus and tonic-clonic) Some patients, particularly tain groups of muscles are involved and consciousness may those with tonic-clonic seizures alone do not fit a specifically be retained. However, in generalized epilepsy, EEG discharge recognized sub-syndrome. Arguments for regarding these as shows no focus such that all Subcortical regions of the brain 55 separate syndromes, yet recognizing that they are part of a are involved. Although the observation that generalized epi neurobiological continuum, have been presented previously lepsies are frequently inherited is understandable, the mecha (Berkovic et al. 1987: 1994; Reutens and Berkovic, 1995). nism by which genetic defects, presumably expressed consti GEFS was originally recognized through large multi-gen tutively in the brain, give rise to partial seizures is less clear. eration families and comprises a variety of Sub-syndromes. The molecular genetic era has resulted in spectacular 60 Febrile seizures plus (FS) is a sub-syndrome where children advances in classification, diagnosis and biological under have febrile seizures occurring outside the age range of 3 standing of numerous inherited neurological disorders months to 6 years, or have associated febrile tonic-clonic including muscular dystrophies, familial neuropathies and seizures. Many family members have a phenotype indistin spinocerebellar degenerations. These disorders are all guishable from the classical febrile convulsion syndrome and uncommon or rare and have simple Mendelian inheritance. In 65 some have FS" with additional absence, myoclonic, atonic, or contrast, common neurological diseases like epilepsy, have complex partial seizures. The severe end of the GEFS" spec complex inheritance where they are determined by multiple trum includes myoclonic-astatic epilepsy. US 8,129,142 B2 3 4 The cumulative incidence for epilepsy by age 30 years chromosome 6p was first reported in 1988 (Greenberg et al., (proportion Suffering from epilepsy at Some time) is 1.5% 1988b). This finding was supported by two collaborating (Hauser et al., 1993). Accurate estimates for the cumulative laboratories, in separate patient samples, and Subsequently incidence of the IGEs are unavailable. In epidemiological three groups provided further evidence for a 6p locus for studies where attempts are made to Subclassify epilepsies, 5 juvenile myoclonic epilepsy in some, but not all, of their rather few cases of IGE are diagnosed, and many cases are families. However, genetic defects have not been found and unclassified. This is probably because cases are rarely the exact locus of the gene or genes, in relationship to the directly examined by epileptologists. In clinic- or office HLA region, remains controversial. Strong evidence for link based series seen by experts, most cases are classifiable and age to chromosome 6 also comes from a study of a single large IGEs account for about 25% of cases. This suggests that about 10 family with juvenile myoclonic epilepsy, but in this pedigree 0.3% of the population suffer from IGE at some time. the locus is well outside the HLA region. A locus on chromo In outbred populations many patients with classical IGE Some 15q has also been Suggested for juvenile myoclonic appear to be sporadic as siblings and parents are usually epilepsy, but was not confirmed by two other studies. unaffected. Systematic EEG studies on clinically unaffected In general, the results of studies of the putative chromo family members show an increase in age-dependent occur 15 Somal 6p locus in the HLA region in patients with absence rence of generalized epileptiform discharges compared to epilepsies or other forms of idiopathic generalized epilepsies controls. In addition, to the approximate 0.3% of the popula have been negative. The major exception is that study of tion with clinical IGE, systematic EEG studies suggest that probands with tonic-clonic seizures on awakening, a Sub about 1% of healthy children have generalized epileptiform syndrome closely related to juvenile myoclonic epilepsy, Sug discharges while awake (Cavazzuti et al., 1980: Okubo et al., gests linkage to 6p. 1994). Linkage for classical remitting childhood absence epilepsy Approximately 5-10% of first degree relatives of classical remains elusive, but in a family with persisting absence evolv IGE probands have seizures with affected relatives usually ing into a juvenile myoclonic epilepsy phenotype, linkage to having IGE phenotypes or febrile seizures. While nuclear chromosome 1 p has been claimed. An Indian pedigree with families with 2-4 affected individuals are well recognized and 25 persisting absence and tonic-clonic seizures may link to 8q24. 3 generation families or grandparent-grandchild pairs are Linkage to this region was also suggested by a non-paramet occasionally observed (Italian League Against Epilepsy ric analysis in IGE, irrespective of subsyndrome, but was not Genetic Collaborative Group, 1993), families with multiple confirmed in another study. Other loci for IGEs that have been affected individuals extending over 4 or more generations are reported in single studies include 3p 14, 8p. 18 and possibly exceptionally rare. 30 5p. The unusual example of recessively inherited infantile For GEFS", however, a number of large multi-generation onset IGE described in Italy maps to 16p in a single family. families showing autosomal dominant inheritance with Thus, like most disorders with complex inheritance, the incomplete penetrance are known. Similar to classical IGE, literature on genetics of classical IGES is confusing and con analysis of sporadic cases and small families with GEFS" tradictory. Some, and perhaps much, of this confusion is due phenotypes does not suggest simple Mendelian inheritance. 35 to heterogeneity, with the likelihood of a number of loci for Indeed, bilineal inheritance, where there is a history of epi IGEs. The studies reviewed above were principally per lepsy on maternal and paternal sides, is observed in both formed on multiple Small families, so heterogeneity within GEFS and classical IGE families (Singh et al., 1999; Italian and between samples is probable. Whether all, some, or none League Against Epilepsy Genetic Collaborative Group, of the linkages reported above will be found to harbour rel 1993). 40 evant genes for IGE remains to be determined. Most of the Within single families with classical IGE or GEFS", studies reviewed above used analysis methods assuming affected individuals often have different sub-syndromes. The Mendelian inheritance, an assumption that is not correct for closer an affected relative is to the proband, the more similar outbred communities. Some studies used multiple models are their sub-syndromes, and siblings often have similar Sub (autosomal recessive, autosomal dominant). Although para syndromes (Italian League Against Epilepsy Genetic Col 45 metric linkage analysis may be reliable in some circumstance laborative Group, 1993). Less commonly, families are of analyzing complex disease, it can lead to spurious findings observed where most, or all, known affected individuals have as highlighted by the literature on linkage in major psychoses one classical IGE Sub-syndrome such as childhood absence (Risch and Botstein, 1996). epilepsy or juvenile myoclonic epilepsy (Italian League In so far as GEFS is concerned, linkage analysis on rare Against Epilepsy Genetic Collaborative Group, 1993). 50 multi-generation large families with clinical evidence of a Importantly, Sub-syndromes are identical in affected major autosomal dominant gene have demonstrated loci on monozygous twins with IGE. In contrast, affected dizygous chromosomes 19q and 2d. Both the 19q and 2d GEFS" loci twins, may have the same or different Sub-syndromes. Clas have been confirmed in independently ascertained large fami sical IGE and GEFS" sub-syndromes tend to segregate sepa lies, and genetic defects have been identified. Families linked rately (Singh et al., 1999). 55 to 19qare known and a mutation in the gene for the B1 subunit In some inbred communities, pedigree analysis strongly of the neuronal sodium channel (SCN1B) has been identified Suggests recessive inheritance for juvenile myoclonic epi (Wallace et al., 1998). This mutation results in the loss of a lepsy and other forms of IGE (Panayiotopoulos and Obeid, critical disulphide bridge of this regulatory subunit and 1989; Berkovic et al., 2000). In such families, sub-syndromes causes a loss of function in vitro. Families linked to 2d are are much more similar in affected siblings than in affected 60 also known and mutations in the pore-forming C. Subunit of sib-pairs from outbred families. Recently, a family with an the neuronal sodium channel (SCN1A) have been identified infantile form of IGE with autosomal recessive inheritance, (PCT/AU01/01648: Wallace et al., 2001b: Escayget al., confirmed by linkage analysis, was described in Italy (Zara et 2000). Studies on the more common small families with al., 2000). GEFS" have not revealed these or other mutations to date. Most work on the molecular genetics of classical IGEs has 65 In addition to the SCN1B and SCN1A mutations in been done on the Sub-syndrome of juvenile myoclonic epi GEFS", four other gene defects have been discovered for lepsy where a locus in proximity or within the HLA region on human idiopathic epilepsies through the study of large fami US 8,129,142 B2 5 6 lies. Mutations in the alpha-4 subunit of the neuronal nico nels. These are typically point mutations resulting in a Subtle tinic acetylcholine receptor (CHRNA4) occur in the focal change of function. The critical postulate is that two muta epilepsy syndrome of autosomal dominant nocturnal frontal tions, usually, but not exclusively, in different subunit alleles lobe epilepsy (Australian patent AU-B-56247/96; Steinleinet (“digenic model”), are required for clinical expression of al., 1995). Mutations in the gamma-2 subunit of the GABAA IGE. It was further proposed that receptor (GABRG2) have been identified in childhood a) A number of different mutated subunit pairs can be absence epilepsy, febrile seizures (including febrile seizures responsible for IGE. Combinations of two mutated sub plus) and myoclonic epilepsy (PCT/AU01/00729; Wallace et units lead to an IGE genotype with ~30% penetrance. al., 2001a). Finally, mutations in two potassium channel b) The total allele frequency of mutated subunits is ~8%. It genes (KCNQ2 and KCNO3) were identified in benign famil 10 was calculated that approximately 15% of the popula ial neonatal convulsions (Singh et al., 1998; Biervert et al., 1998; Charlier et al., 1998). Although initially regarded as a tion has one or more mutated Subunit genes and 1% have special form of IGE, this unusual syndrome is probably a two or more mutated Subunits. form of inherited focal epilepsy. c) Sub-syndromes are principally determined by the spe Further to these studies, mutations in other genes have been 15 cific combination of mutated Subunit pairs, although one identified to becausative of epilepsy. These include mutations or more other genes, including ion channel Subunits, of in the beta-2 subunit (CHRNB2) of the neuronal nicotinic smaller effect may modify the phenotype. acetylcholine receptor (PCT/AU01/00541; Phillips et al., d) Mutated subunit combinations that cause classical IGEs 2001) and the delta subunit (GABRD) of the GABAA recep are largely separate from those that cause GEFS, tor (PCT/AU01/00729). although some subunits may be involved in both Syn A number of mouse models approximating human IGE are dromes. known. These mice mutants have ataxia in addition to gener e) Individuals with single change of function mutations alized spike-and-wave discharges with absences or tonic would not have IGE, but such mutations may contribute clonic seizures. Recessive mutations in calcium channel Sub to simple febrile seizures, which are observed with unit genes have been found in lethargic (CACNB4), tottering/ 25 increased frequency in relatives of IGE probands. leaner (CACNA1A), and stargazer (CACNG2) mutants. The The model also proposes that subunit mutations with more slow-wave epilepsy mouse mutant has a mutation in the severe functional consequences (eg breaking a disulphide Sodium/hydrogen exchanger gene, which may have impor bridge in SCN1B or amino acid substitution in the pore form tant downstream effects on pH-sensitive ion channels. ing regions of SCN1A for GEFS") cause autosomal dominant The human and mouse literature is now Suggesting that the 30 generalized epilepsies with a penetrance of 60-90%. The idiopathic epilepsies comprise a family of channelopathies precise sub-syndromes in GEFS are determined by minor with mutations in ion channel subunits of Voltage-gated (eg allelic variation or mutations in other ion channel subunits. SCN1A, SCN1B, KCNQ2, KCNQ3) or ligand-gated (eg Such “severe” mutations are rare (allele frequency <0.01%) CHRNA4, CHRNB2, GABRG2, GABRD) types. These and are infrequent causes of GEFS". They very rarely, or channels are typically comprised of a number of Subunits, 35 perhaps never, cause classical IGE. specified by genes on different chromosomes. The Stoichiom The identification of molecular changes in ion channel etry and conformation of ion channel Subunits are not yet well Subunits is therefore a significant step towards the elucidation understood, but many have multiple subunits in a variety of of genetic variants that alone or in combination (based on the combinations. digenic model) give rise to an epilepsy phenotype, and to The involvement of ion channels in other neuro/physi 40 other neuro/physiological disorders associated withion chan ological disorders has also been observed (reviewed in nel dysfunction. Dworakowska and Dolowy, 2000). Mutations in voltage The present inventors have identified a number of novel gated Sodium, potassium, calcium and chloride channels as mutations or variants in genes encoding Subunits of ion chan well as ligand-gated channels such as the acetylcholine and nels in individuals with epilepsy. It will be appreciated that for GABA receptors may lead to physiological disorders such as 45 each molecular defect one can provide an isolated nucleic hyper- and hypo-kalemic periodic paralysis, myotonias, acid molecule coding for a protein having a biological func malignant hyperthermia, myasthenia and cardiac arrhyth tion as part of an ion channel in a mammal, wherein a muta mias. Neurological disorders other than epilepsy that are tion event selected from the group consisting of point muta associated with ion channel mutations include episodic tions, deletions, insertions and rearrangements has occurred ataxia, migraine, Alzheimer's disease, Parkinson's disease, 50 So as to affect the functioning of the ion channel. In some Schizophrenia, hyperekplexia, anxiety, depression, phobic instances this single mutation alone will produce a phenotype obsessive symptoms, as well as neuropathic pain, inflamma of epilepsy or other neuro/physiological disorders associated tory pain and chronic/acute pain. Some kidney disorders such with ion channel dysfunction. as Bartter's syndrome, polycystic kidney disease and Dent's In the case where a single mutation alone does not produce, disease, secretion disorders such as hyperinsulinemic 55 say, an epilepsy phenotype, there would be provided one or hypoglycemia of infancy and cystic fibrosis, and vision dis more additional isolated nucleic acid molecules coding for orders such as congenital stationary night blindness and total proteins having a biological function as part of anion channel colour-blindness may also be linked to mutations in ion chan in a mammal, wherein a mutation event selected from the nels. group consisting of point mutations, deletions, insertions and 60 rearrangements has occurred so as to affect the functioning of DISCLOSURE OF THE INVENTION the ion channel. The cumulative effect of the mutations in each isolated nucleic acid molecule in vivo is to produce a In a new genetic model for the idiopathic generalised epi epilepsy or another neuro/physiological disorders in said lepsies (IGEs) described in PCT/AU01/00872 (the disclosure mammal. The mutations may be in nucleic acid molecules of which is incorporated herein by reference) it has been 65 coding for protein subunits belonging to the same ion channel postulated that most classical IGE and GEFS' cases are due to or may be in nucleic acid molecules coding for protein Sub the combination of two mutations in multi-subunition chan units that belong to differention channels. US 8,129,142 B2 7 8 Typically Such mutations are point mutations and the ion -continued channels are voltage-gated channels such as a Sodium, potas sium, calcium or chloride channels or are ligand-gated chan Subunit Exon nels such as members of the nAChR/GABA super family of Gene Intron DNA Mutation receptors, or a functional fragment or homologue thereof. 5 KCNQ2 Exon 8 c1057C-eG KCNQ2 Exon 11 c1288C-T Mutations may include those in non-coding regions of the KCNQ2 Exon 14 c1710A->T ion channel Subunits (eg mutations in the promoter region KCNQ2 Exon 15 c1856T-eG which affect the level of expression of the subunit gene, KCNQ2 Intron 9 IVS9+(46-48)delCCT mutations in intronic sequences which affect the correct splic KCNQ3 Intron 11 IVS11-43G->A 10 KCNQ3 Intron 12 IVS12-29G->A ing of the subunit during mRNA processing, or mutations in GABRB1 Exon 5 cSO8C-T the 5' or 3' untranslated regions that can affect translation or GABRB1 Exon 9 c1329G->A stability of the mRNA). Mutations may also and more pref GABRB1 Exon 8 cQ7SC-eT erably will be in coding regions of the ion channel Subunits GABRG3 Exon 8 cQ95T-C (eg nucleotide mutations may give rise to an amino acid GABRA1 SUTR c-142A->G 15 GABRA1 SUTR c-31C->T change in the encoded protein or nucleotide mutations that do GABRA2 3' UTR c1615G->A not give rise to an amino acid change but may affect the GABRAS SUTR c-271G->C GABRAS SUTR c-228A->G stability of the mRNA). GABRAS SUTR c-149G->C Mutation combinations may be selected from, but are not GABRB2 SUTR c-159C-T restricted to, those identified in Table 1. GABRB2 3' UTR c1749C-T Accordingly in one aspect of the present invention there is GABRP SUTR c-101C->T GABRB1 Intron 1 IVS1-24T-eG provided a method of identifying a subject predisposed to a GABRB1 Intron 6 IVS6-72T-eG disorder associated withion channel dysfunction, comprising GABRB1 Intron 7 IVSA-34A-eG ascertaining whether at least one of the genes encoding ion GABRB3 Intron 1 IVS1-14C-T channel Subunits in said Subject has undergone a mutation GABRB3 Intron 7 IVS7+58delAA 25 GABRD Intron 6 IVS6+132insC event selected from the group consisting of the mutation GABRD Intron 6 IVS6+130 insC events set forth in the following Table: GABRD Intron 6 IVS6-73deCGCGCCCACCGCCCCTTCCGCG GABRG3 Intron 8 IVS8-102C-T

Subunit Exon 30 Inafurther aspect there is provided a method of identifying Gene introl DNA Mutation a subject predisposed to a disorder associated with ion chan SCN1A Exon 5 c664C->T nel dysfunction, comprising ascertaining whether at least one SCN1A Exon 8 c1 152G->A of the genes encoding ion channel Subunits in said Subject has SCN1A Exon 9 c1 183G->C undergone a mutation event as set forth in one of SEQ ID SCN1A Exon 9 C12O7T-C 35 Numbers: 1-72. SCN1A Exon 9 c1237T-A SCN1A Exon 9 c1265T->A In another aspect of the present invention there is provided SCN1A Exon 21 ca.19C->T an isolated nucleic acid molecule encoding a mutant or vari SCN1A Exon 26 c5339T->C ant ion channel Subunit wherein a mutation event selected SCN1A Exon 26 c5674C->T from the group consisting of the mutation events set forth in SCN1B Exon 3 c254G->A 40 SCN2A Exon 6A c668G->A the following Table: SCN2A Exon 16 c2674G->A SCN2A Exon 17 c3OO7C->A SCN2A Exon 19 c3598A->G SCN2A Exon 20 c.3956G->A Subunit Exon SCN2A Exon 12 c1785T->C Gene introl DNA Mutation SCN2A Exon 27 ca919T->A 45 SCN1A intron 9 IVS9-1G->A SCN1A Exon 5 c664C->T SCN1A intron 23 IVS23-33G->A SCN1A Exon 8 c1152G->A SCN2A intron 7 IVSA-61T-A SCN1A Exon 9 c1183G->C SCN2A intron 19 IVS19-55A->G SCN1A Exon 9 C12O7T-C SCN2A intron 22 IVS22-31A->G SCN1A Exon 9 c1237T-A SCN2A intron 2 IVS2-28G->A 50 SCN1A Exon 9 c1265T->A SCN2A intron 8 IVS8-3T-C SCN1A Exon 21 ca.19C->T SCN2A intron 11 IVS11-49A->G SCN1A Exon 26 c5339T->C SCN2A intron 11 IVS11-16C->T SCN1A Exon 26 c5674C->T SCN2A tron 17 IVS17-71C-T SCN1B Exon 3 c254G->A SCN2A intron 17 IVS17-74delG SCN2A Exon 6A c668G->A SCN2A intron 17 IVS17-74insG 55 SCN2A Exon 16 c2674G->A CHRNAS Exon 4 c4OOG->A SCN2A Exon 17 c3OO7C->A CHRNA2 Exon 4 c373G-eA SCN2A Exon 19 c.3598A->G CHRNA3 Exon 2 c110G->A SCN2A Exon 20 c.3956G->A CHRNA2 Exon 4 c351C-T SCN2A Exon 12 c1785T->C CHRNA2 Exon 5 c771C-T SCN2A Exon 27 ca919T->A CHRNA3 Exon 2 c159A->G SCN1A intron 9 IVS9-1G->A CHRNA3 Exon 4 c291G->A 60 SCN1A intron 23 IVS23-33G->A CHRNA3 Exon 4 c345G->A SCN2A intron 7 IVSA-61T-A CHRNA2 Intron 3 IVS3-16C-T SCN2A intron 19 IVS19-55A->G CHRNA3 Intron 3 IVS3-ST-C SCN2A intron 22 IVS22-31A->G CHRNA3 Intron 4 IVS4-8G->C SCN2A intron 2 IVS2-28G->A KCNQ2 Exon 1 c204-c.205 insC SCN2A intron 8 IVS8-3T-C KCNQ2 Exon 1 c1A->G 65 SCN2A intron 11 IVS11-49A->G KCNQ2 Exon 1 c2T-C SCN2A intron 11 IVS11-16C->T US 8,129,142 B2 9 10 -continued bance in the calmodulin binding affinity of the Subunit, so as to produce an epilepsy phenotype. Subunit Exon In one form of the invention, the mutations are in exon 8 or Gene introl DNA Mutation exon 15 of the KCNO2 subunit and result in the replacement SCN2A tron 17 IVS17-71C-T of an arginine residue with a glycine residue at amino acid SCN2A intron 17 IVS17-74delG position 353, or the replacement of a leucine residue with an SCN2A intron 17 IVS17-74insG CHRNAS Exon 4 c4OOG->A arginine at amino acid position 619. The R353G mutation CHRNA2 Exon 4 c373G-eA occurs as a result of a C to G nucleotide substitution at CHRNA3 Exon 2 c110G->A position 1057 of the KCNQ2 coding sequence as shown in CHRNA2 Exon 4 c351C-T 10 SEQID NO: 44. The L619R mutation occurs as a result of a CHRNA2 Exon 5 c771C-T CHRNA3 Exon 2 c159A->G T to G nucleotide substitution at position 1856 of the KCNO2 CHRNA3 Exon 4 c291G->A coding sequence as shown in SEQID NO: 47. CHRNA3 Exon 4 c345G->A Inafurtherform of the invention, the mutations are in exon CHRNA2 Intron 3 IVS3-16C-T 11 or exon 14 of the KCNQ2 subunit and result in the replace CHRNA3 Intron 3 IVS3-ST-C 15 CHRNA3 Intron 4 IVS4-8G->C ment of an arginine residue with a stop codon at amino acid KCNQ2 Exon 1 c204-c.205 insC position 430, or the replacement of an arginine residue with a KCNQ2 Exon 1 c1A->G serine at amino acid position 570. The R43OX mutation KCNQ2 Exon 1 c2T-C occurs as a result of a C to Tnucleotide Substitution at position KCNQ2 Exon 8 c1057C-eG KCNQ2 Exon 11 c1288C->T 1288 of the KCNQ2 coding sequence as shown in SEQ ID KCNQ2 Exon 14 c1710A->T NO: 45. The R570S mutation occurs as a result of an A to T KCNQ2 Exon 15 c1856T->G nucleotide substitution at position 1710 of the KCNQ2 cod KCNQ2 intron 9 IVS9+(46-48)delCCT ing sequence as shown in SEQID NO: 46. KCNQ3 intron 11 IVS11-43G->A KCNQ3 intron 12 IVS12-29G->A Preferably these mutations create a phenotype of benign GABRB1 Exon 5 cSO8C-T familial neonatal seizures (BFNS). GABRB1 Exon 9 c1329G->A 25 Inafurther aspect of the present invention there is provided GABRB1 Exon 8 cQ7SC-eT a combination of two or more isolated nucleic acid molecules GABRG3 Exon 8 cQ9ST-C GABRA1 SUTR c-142A->G each having a novel mutation event as laid out in Table 1. The GABRA1 SUTR c-31C->T cumulative effect of the mutations in each isolated nucleic GABRA2 3' UTR c1615G->A acid molecule in vivo is to produce an epilepsy or another GABRAS SUTR c-271G->C 30 disorder associated withion channel dysfunction as described GABRAS SUTR c-228A->G above in said mammal. GABRAS SUTR c-149G->C GABRB2 SUTR c-159C-T In a particularly preferred embodiment of the present GABRB2 3' UTR c1749C-T invention, the isolated nucleic acid molecules have a nucle GABRP SUTR c-101C->T otide sequence as shown in any one of SEQ ID Numbers: GABRB1 Intron 1 IVS1-24T-eG 35 GABRB1 Intron 6 IVS6-72T-eG 1-72. The sequences correspond to the novel DNA mutations GABRB1 Intron 7 IVSA-34A-sG or variants laid out in Table 1. GABRB3 Intron 1 IVS1-14C-T In another aspect of the present invention there is provided GABRB3 Intron 7 IVS7+58delAA an isolated nucleic acid molecule comprising any one of the GABRD Intron 6 IVS6+132insC GABRD Intron 6 IVS6+130insC nucleotide sequences set forth in SEQID Numbers: 1-72. GABRD Intron 6 IVS6-73 deCGCGCCCACCGCCCCTTCCGCG 40 In another aspect of the present invention there is provided GABRG3 Intron 8 IVS8-102C-T an isolated nucleic acid molecule consisting of any one of the nucleotide sequences set forth in SEQID Numbers: 1-72. The nucleotide sequences of the present invention can be has occurred. engineered using methods accepted in the art for a variety of In still another aspect of the present invention there is 45 purposes. These include, but are not limited to, modification provided an isolated nucleic acid molecule encoding a mutant of the cloning, processing, and/or expression of the gene or variant ion channel Subunit wherein a mutation event has product. PCR reassembly of gene fragments and the use of occurred as set forth in one of SEQID Numbers: 1-72. synthetic oligonucleotides allow the engineering of the nucle The mutation event disrupts the functioning of anion chan otide sequences of the present invention. For example, oligo nel So as to produce a phenotype of epilepsy, and/or one or 50 nucleotide-mediated site-directed mutagenesis can introduce more other disorders associated with ion channel dysfunc further mutations that create new restriction sites, alter tion, including but not restricted to, hyper- or hypo-kalemic expression patterns and produce splice variants etc. periodic paralysis, myotonias, malignant hyperthermia, As a result of the degeneracy of the genetic code, a number myasthenia, cardiac arrhythmias, episodic ataxia, migraine, of polynucleotide sequences, some that may have minimal Alzheimer's disease, Parkinson's disease, Schizophrenia, 55 similarity to the polynucleotide sequences of any known and hyperekplexia, anxiety, depression, phobic obsessive symp naturally occurring gene, may be produced. Thus, the inven toms, neuropathic pain, inflammatory pain, chronic/acute tion includes each and every possible variation of a poly pain, Bartter's syndrome, polycystic kidney disease, Dent's nucleotide sequence that could be made by selecting combi disease, hyperinsulinemic hypoglycemia of infancy, cystic nations based on possible codon choices. These combinations fibrosis, congenital stationary night blindness and total 60 are made in accordance with the standard triplet genetic code colour-blindness, either alone or in combination with one or as applied to the polynucleotide sequences of the present more additional mutations or variations in the ion channel invention, and all such variations are to be considered as being Subunit genes. specifically disclosed. In another aspect of the present invention there is provided The nucleic acid molecules of this invention are typically an isolated nucleic acid molecule encoding a mutant KCNO2 65 DNA molecules, and include cDNA, genomic DNA, syn subunit, wherein the mutation event has occurred in the C-ter thetic forms, and mixed polymers, both sense and antisense minal domain of the KCNQ2 subunit and leads to a distur Strands, and may be chemically or biochemically modified, or US 8,129,142 B2 11 12 may contain non-natural or derivatised nucleotide bases as vectors which may contain viral origins of replication and/or will be appreciated by those skilled in the art. Such modifi endogenous expression elements and a selectable marker cations include labels, methylation, intercalators, alkylators gene on the same or on a separate vector. The selectable and modified linkages. In some instances it may be advanta marker confers resistance to a selective agent, and its pres geous to produce nucleotide sequences possessing a Substan ence allows growth and recovery of cells which successfully tially different codon usage than that of the polynucleotide express the introduced sequences. Resistant clones of stably sequences of the present invention. For example, codons may transformed cells may be propagated using tissue culture be selected to increase the rate of expression of the peptide in techniques appropriate to the cell type. a particular prokaryotic or eukaryotic host corresponding The protein produced by a transformed cell may be with the frequency that particular codons are utilized by the 10 secreted or retained intracellularly depending on the host. Other reasons to alter the nucleotide sequence without sequence and/or the vector used. As will be understood by altering the encoded amino acid sequences include the pro those of skill in the art, expression vectors containing poly duction of RNA transcripts having more desirable properties, nucleotides which encode a protein may be designed to con Such as a greater half-life, than transcripts produced from the tain signal sequences which direct secretion of the protein naturally occurring mutated sequence. 15 through a prokaryotic or eukaryotic cell membrane. The invention also encompasses production of nucleic acid In addition, a host cell strain may be chosen for its ability to sequences of the present invention entirely by synthetic modulate expression of the inserted sequences or to process chemistry. Synthetic sequences may be inserted into expres the expressed protein in the desired fashion. Such modifica sion vectors and cell systems that contain the necessary ele tions of the polypeptide include, but are not limited to, acety ments for transcriptional and translational control of the lation, glycosylation, phosphorylation, and acylation. Post inserted coding sequence in a Suitable host. These elements translational cleavage of a “prepro’ form of the protein may may include regulatory sequences, promoters, 5' and 3' also be used to specify protein targeting, folding, and/or activ untranslated regions and specific initiation signals (such as an ity. Different host cells having specific cellular machinery and ATG initiation codon and Kozak consensus sequence) which characteristic mechanisms for post-translational activities allow more efficient translation of sequences encoding the 25 (e.g., CHO or HeLa cells), are available from the American polypeptides of the present invention. In cases where the Type Culture Collection (ATCC) and may be chosen to ensure complete coding sequence, including the initiation codon and the correct modification and processing of the foreign protein. upstream regulatory sequences, are inserted into the appro When large quantities of the protein product of the gene are priate expression vector, additional control signals may not be needed, such as for antibody production, vectors which direct needed. However, in cases where only coding sequence, or a 30 high levels of expression of this protein may be used, such as fragment thereof, is inserted, exogenous translational control those containing the T5 or T7 inducible bacteriophage pro signals as described above should be provided by the vector. moter. The present invention also includes the use of the Such signals may be of various origins, both natural and expression systems described above in generating and isolat synthetic. The efficiency of expression may be enhanced by ing fusion proteins which contain important functional the inclusion of enhancers appropriate for the particular host 35 domains of the protein. These fusion proteins are used for cell system used (Scharf et al., 1994). binding, structural and functional studies as well as for the The invention also includes nucleic acid molecules that are generation of appropriate antibodies. the complements of the sequences described herein. In order to express and purify the protein as a fusion pro The present invention allows for the preparation of purified tein, the appropriate cDNA sequence is inserted into a vector polypeptide or protein from the polynucleotides of the 40 which contains a nucleotide sequence encoding another pep present invention, or variants thereof. In order to do this, host tide (for example, glutathionine Succinyl transferase). The cells may be transformed with a novel nucleic acid molecule fusion protein is expressed and recovered from prokaryotic or as described above, or with nucleic acid molecules encoding eukaryotic cells. The fusion protein can then be purified by two or more mutantion channel Subunits. If the mutant Sub affinity chromatography based upon the fusion vector units form a part of the same ion channel a receptor protein 45 sequence. The desired protein is then obtained by enzymatic containing two or more mutant Subunits may be isolated. If cleavage of the fusion protein. the mutant subunits are subunits of differention channels the Fragments of the polypeptides of the present invention may host cells will express two or more mutant receptor proteins. also be produced by direct peptide synthesis using Solid Typically said host cells are transfected with an expression phase techniques. Automated synthesis may be achieved by vector comprising a DNA molecule according to the inven 50 using the ABI 431 A Peptide Synthesizer (Perkin-Elmer). tion or, in particular, DNA molecules encoding two or more Various fragments of this protein may be synthesized sepa mutant ion channel Subunits. A variety of expression vector/ rately and then combined to produce the full-length molecule. host systems may be utilized to contain and express The present invention is also concerned with polypeptides sequences encoding polypeptides of the invention. These having a biological function as an ion channel in a mammal, include, but are not limited to, microorganisms such as bac 55 wherein a mutation event selected from the group consisting teria transformed with plasmid or cosmid DNA expression of Substitutions, deletions, truncations, insertions and rear vectors; yeast transformed with yeast expression vectors; rangements has occurred so as to affect the functioning of the insect cell systems infected with viral expression vectors ion channel. In some instances this single mutation alone will (e.g., baculovirus); or mouse or other animal or human tissue produce an epilepsy phenotype or other neuro/physiological cell Systems. Mammalian cells can also be used to express a 60 disorders associated with ion channel dysfunction. protein using a vaccinia virus expression system. The inven In the case where a single mutation alone does not produce, tion is not limited by the host cell or vector employed. say, an epilepsy phenotype, there would be provided one or The polynucleotide sequences, or variants thereof, of the more additional isolated mammalian polypeptides having present invention can be stably expressed in cell lines to allow biological functions as part of an ion channel in a mammal, long term production of recombinant proteins in mammalian 65 wherein a mutation event selected from the group consisting systems. Sequences encoding the polypeptides of the present of Substitutions, deletions, truncations, insertions and rear invention can be transformed into cell lines using expression rangements has occurred so as to affect the functioning of the US 8,129,142 B2 13 14 ion channel. The cumulative effect of the mutations in each sequence as shown in any one of SEQ ID Numbers: 73-95. isolated mammalian polypeptide in Vivo being to produce The sequences correspond to the novel amino acid changes epilepsy or another neuro/physiological disorder in said laid out in Table 1 for those instances where the DNA muta mammal. The mutations may be in polypeptide subunits tion results in an amino acid change. belonging to the same ion channel as described above, but According to still another aspect of the present invention may also be in polypeptide subunits that belong to different there is provided an isolated polypeptide, said polypeptide ion channels. being a mutant KCNQ2 subunit, wherein the mutation event Typically the mutation is an amino acid Substitution and the has occurred in the C-terminal domain of the KCNO2 subunit ion channel is a Voltage-gated channel Such as a Sodium, and leads to a disturbance in the calmodulin binding affinity potassium, calcium or chloride channel or a ligand-gated 10 of the Subunit, so as to produce an epilepsy phenotype. channel such as a member of the naChR/GABA super family In one form of the invention the mutations are substitutions of receptors, or a functional fragment or homologue thereof. in which an arginine residue is replaced with a glycine resi Mutation combinations may be selected from, but are not due, or a leucine residue is replaced with an arginine. Prefer restricted to, those represented in Table 1. 15 ably the substitutions are R353G and L619R transitions as Accordingly, in a further aspect of the present invention illustrated by SEQID NOS: 92 and 95 respectively. there is provided an isolated polypeptide, said polypeptide Inafurtherform of the invention the mutations result in the being a mutant or variant ion channel Subunit wherein a replacement of an arginine for a stop codon, or an arginine is mutation event selected from the group consisting of the replaced with a serine. Preferably the mutations are R43OX mutation events set forth in the following Table: and R570S transitions as illustrated by SEQID NOS: 93 and 94 respectively. In a still further aspect of the present invention there is Subunit provided a combination of two or more isolated polypeptides Gene Amino Acid Change each having a novel mutation event as laid out in Table 1. The SCN1A R222X 25 cumulative effect of the mutations in each isolated polypep SCN1A W384X tide molecule in vivo is to produce an epilepsy or another SCN1A A395P disorder associated withion channel dysfunction as described SCN1A F403L above in said mammal. SCN1A Y413N SCN1A V422E In a particularly preferred embodiment of the present SCN1A R1407X 30 invention, the isolated polypeptides have an amino acid SCN1A M178OT sequence as shown in any one of SEQ ID Numbers: 73-95. SCN1A R1892X The sequences correspond to the novel amino acid changes SCN1B R8SH laid out in Table 1. SCN2A R223Q SCN2A V892I According to still another aspect of the present invention SCN2A L1003 35 there is provided an isolated polypeptide comprising the SCN2A T12OOA amino acid sequence set forth in any one of SEQID Numbers: SCN2A R1319Q CHRNAS W134 73-95. CHRNA2 A12ST According to still another aspect of the present invention CHRNA3 R37H there is provided a polypeptide consisting of the amino acid KCNQ2 K69fsX119 40 sequence set forth in any one of SEQID Numbers: 73-95. KCNQ2 M1W KCNQ2 M1T According to still another aspect of the present invention KCNQ2 R353G there is provided a method of preparing a polypeptide, com KCNQ2 R43OX prising the steps of: KCNQ2 R57OS (1) culturing host cells transfected with an expression vec KCNQ2 L619R 45 tor comprising a nucleic acid molecule as described above under conditions effective for polypeptide pro has occurred. duction; and In a further aspect of the invention there is provided an (2) harvesting the mutant ion channel Subunit. isolated polypeptide, said polypeptide being a mutant or vari The mutant ion channel subunit may be allowed to ant ion channel Subunit wherein a mutation event has 50 assemble with other subunits constituting the channel that are occurred such that the polypeptide has the amino acid either wild-type or themselves mutant subunits, whereby the sequence set forth in one of SEQ ID Numbers: 73-95. The assembled ion channel is harvested. mutation event disrupts the functioning of an ion channel so According to still another aspect of the invention there is as to produce a phenotype of epilepsy, and/or one or more provided a polypeptide which is the product of the process other disorders associated with ion channel dysfunction, 55 described above. including but not restricted to, hyper- or hypo-kalemic peri Substantially purified protein or fragments thereof can then odic paralysis, myotonias, malignant hyperthermia, myasthe be used in further biochemical analyses to establish second nia, cardiac arrhythmias, episodic ataxia, migraine, Alzhe ary and tertiary structure. Such methodology is known in the imer's disease, Parkinson's disease, Schizophrenia, art and includes, but is not restricted to, X-ray crystallography hyperekplexia, anxiety, depression, phobic obsessive symp 60 of crystals of the proteins or of the assembled ion channel toms, neuropathic pain, inflammatory pain, chronic/acute incorporating the proteins or by nuclear magnetic resonance pain, Bartter's syndrome, polycystic kidney disease, Dent's (NMR). Determination of structure allows for the rational disease, hyperinsulinemic hypoglycemia of infancy, cystic design of pharmaceuticals to interact with the ion channel as fibrosis, congenital stationary night blindness and total a whole or through interaction with a specific subunit protein colour-blindness. 65 (see drug screening below), alter the overall ion channel In a particularly preferred embodiment of the present protein charge configuration or charge interaction with other invention, the isolated polypeptide has an amino acid proteins, or to alter its function in the cell. US 8,129,142 B2 15 16 It will be appreciated that the mutant ion channel subunits In a still further aspect of the invention there is provided an included as part of the present invention will be useful in antibody which is immunologically reactive with a polypep further applications which include a variety of hybridisation tide as described above, but not with a wild-type ion channel and immunological assays to screen for and detect the pres or ion channel subunit thereof. ence of either a normal or mutated gene or gene product. The In particular, there is provided an antibody to an assembled invention enables therapeutic methods for the treatment of ion channel containing a mutation in a subunit comprising the epilepsy as well as other disorders associated with ion chan channel, which is causative of epilepsy or another disorder nel dysfunction and also enables methods for the diagnosis or associated with ion channel dysfunction when expressed prognosis of epilepsy as well as other disorders associated alone or when expressed in combination with one or more with ion channel dysfunction. 10 Therapeutic Applications other mutations in subunits of the same or differention chan According to still another aspect of the invention there is nels. Such antibodies may include, but are not limited to, provided a method of treating epilepsy as well as other dis polyclonal, monoclonal, chimeric, and single chain antibod orders associated with ion channel dysfunction, including but ies as would be understood by the person skilled in the art. not restricted to, hyper- or hypo-kalemic periodic paralysis, 15 For the production of antibodies, various hosts including myotonias, malignant hyperthermia, myasthenia, cardiac rabbits, rats, goats, mice, humans, and others may be immu arrhythmias, episodic ataxia, migraine, Alzheimer's disease, nized by injection with a polypeptide as described above or Parkinson's disease, Schizophrenia, hyperekplexia, anxiety, with any fragment or oligopeptide thereof which has immu depression, phobic obsessive symptoms, neuropathic pain, nogenic properties. Various adjuvants may be used to increase inflammatory pain, chronic/acute pain, Bartter's syndrome, immunological response and include, but are not limited to, polycystic kidney disease, Dent's disease, hyperinsulinemic Freunds, mineral gels such as aluminium hydroxide, and hypoglycemia of infancy, cystic fibrosis, congenital station Surface-active substances such as lysolecithin. Adjuvants ary night blindness or total colour-blindness, comprising used in humans include BCG (bacilli Calmette-Guérin) and administering a selective antagonist, agonist or modulator of Corynebacterium parvum. an ion channel or ion channel Subunit, when the ion channel 25 It is preferred that the oligopeptides, peptides, or fragments contains a mutation in a subunit comprising the channel, as used to induce antibodies to the mutant ion channel have an described above, to a subject in need of such treatment. Said amino acid sequence consisting of at least amino acids, and, mutation event may be causative of the disorder when more preferably, of at least 10 amino acids. It is also prefer expressed alone or when expressed in combination with one able that these oligopeptides, peptides, or fragments are iden or more additional mutations in Subunits of the same or dif 30 tical to a portion of the amino acid sequence of the natural ferent ion channels, which are typically those identified in protein and contain the entire amino acid sequence of a small, Table 1. naturally occurring molecule. Short stretches of ion channel In still another aspect of the invention there is provided the amino acids may be fused with those of another protein, such use of a selective antagonist, agonist or modulator of an ion as KLH, and antibodies to the chimeric molecule may be channel or ion channel Subunit when the ion channel contains 35 produced. a mutation in a Subunit comprising the channel, as described Monoclonal antibodies to a mutant ion channel may be above, said mutation being causative of epilepsy as well as prepared using any technique which provides for the produc other disorders associated with ion channel dysfunction, tion of antibody molecules by continuous cell lines in culture. including but not restricted to, hyper- or hypo-kalemic peri These include, but are not limited to, the hybridoma tech odic paralysis, myotonias, malignant hyperthermia, myasthe 40 nique, the human B-cell hybridoma technique, and the EBV nia, cardiac arrhythmias, episodic ataxia, migraine, Alzhe hybridoma technique. (For example, see Kohler et al., 1975; imer's disease, Parkinson's disease, Schizophrenia, Kozbor et al., 1985; Cote et al., 1983; Cole et al., 1984). hyperekplexia, anxiety, depression, phobic obsessive symp Monoclonal antibodies produced may include, but are not toms, neuropathic pain, inflammatory pain, chronic/acute limited to, mouse-derived antibodies, humanised antibodies pain, Bartter's syndrome, polycystic kidney disease, Dent's 45 and fully human antibodies. disease, hyperinsulinemic hypoglycemia of infancy, cystic Antibodies may also be produced by inducing in vivo pro fibrosis, congenital stationary night blindness or total colour duction in the lymphocyte population or by screening immu blindness, when expressed alone or when expressed in com noglobulin libraries or panels of highly specific binding bination with a second mutation in a subunit of the same or reagents as disclosed in the literature. (For example, see differention channel, as described above, in the manufacture 50 Orlandi et al., 1989: Winter and Milstein, 1991). of a medicament for the treatment of the disorder. Antibody fragments which contain specific binding sites In one aspect, a Suitable antagonist, agonist or modulator for a mutantion channel may also be generated. For example, will restore wild-type function to the ion channel or channels Such fragments include, F(ab')2 fragments produced by pep containing the mutations of the present invention, or will sin digestion of the antibody molecule and Fab fragments negate the effects the mutant channel or channels have on cell 55 generated by reducing the disulfide bridges of the F(ab')2 function. fragments. Alternatively, Fab expression libraries may be Using methods well known in the art, a mutantion channel constructed to allow rapid and easy identification of mono may be used to produce antibodies specific for the mutant clonal Fab fragments with the desired specificity. (For channel that is causative of the disease or to screen libraries of example, see Huse et al., 1989). pharmaceutical agents to identify those that bind the mutant 60 Various immunoassays may be used for Screening to iden ion channel. tify antibodies having the desired specificity. Numerous pro In one aspect, an antibody, which specifically binds to a tocols for competitive binding or immunoradiometric assays mutant ion channel or mutant ion channel Subunit of the using either polyclonal or monoclonal antibodies with estab invention, may be used directly as an agonist, antagonist or lished specificities are well known in the art. Such immunoas modulator, or indirectly as a targeting or delivery mechanism 65 says typically involve the measurement of complex formation for bringing a pharmaceutical agent to cells or tissues that between an ion channel and its specific antibody. A two-site, express the mutant ion channel. monoclonal-based immunoassay utilizing antibodies reactive US 8,129,142 B2 17 18 to two non-interfering ion channel epitopes is preferred, but a fied from these screens may also be of therapeutic application competitive binding assay may also be employed. in affected individuals carrying other ion channel Subunit In a further aspect of the invention there is provided a gene mutations if the molecule is able to correct the common method of treating epilepsy as well as other disorders associ underlying functional deficit imposed by these mutations and ated with ion channel dysfunction, including but not those of the invention. restricted to, hyper- or hypo-kalemic periodic paralysis, myo There is therefore provided a method of treating epilepsy as tonias, malignant hyperthermia, myasthenia, cardiac arrhyth well as other disorders associated with ion channel dysfunc mias, episodic ataxia, migraine, Alzheimer's disease, Parkin tion comprising administering a compound that is a Suitable son's disease, Schizophrenia, hyperekplexia, anxiety, agonist, antagonist or modulator of an ion channel and that depression, phobic obsessive symptoms, neuropathic pain, 10 has been identified using the mutant ion channel Subunits of inflammatory pain, chronic/acute pain, Bartter's syndrome, the invention. polycystic kidney disease, Dent's disease, hyperinsulinemic In some instances, an appropriate approach for treatment hypoglycemia of infancy, cystic fibrosis, congenital station may be combination therapy. This may involve the adminis ary night blindness or total colour-blindness, comprising tering an antibody or complement (antisense) to a mutantion administering an isolated nucleic acid molecule which is the 15 channel or ion channel subunit of the invention to inhibit its complement (antisense) of any one of the nucleic acid mol functional effect, combined with administration of wild-type ecules described above and which encodes an RNA molecule ion channel subunits which may restore levels of wild-type that hybridizes with the mRNA encoding a mutant ion chan ion channel formation to normal levels. Wild-type ion chan nel subunit of the invention, to a subject in need of such nel Subunits of the invention can be administered using gene treatment. therapy approaches as described above for complement In a still further aspect of the invention there is provided the administration. use of an isolated nucleic acid molecule which is the comple There is therefore provided a method of treating epilepsy as ment (antisense) of a nucleic acid molecule of the invention well as other disorders associated with ion channel dysfunc and which encodes an RNA molecule that hybridizes with the tion comprising administration of an antibody or complement mRNA encoding a mutant ion channel Subunit of the inven 25 to a mutantion channel orion channel Subunit of the invention tion, in the manufacture of a medicament for the treatment of in combination with administration of wild-type ion channel epilepsy as well as other disorders associated with ion chan Subunits. nel dysfunction, including but not restricted to, hyper- or In still another aspect of the invention there is provided the hypo-kalemic periodic paralysis, myotonias, malignant use of an antibody or complement to a mutantion channel or hyperthermia, myasthenia, cardiac arrhythmias, episodic 30 ion channel subunit of the invention in combination with the ataxia, migraine, Alzheimer's disease, Parkinson's disease, use of wild-type ion channel Subunits, in the manufacture of schizophrenia, hyperekplexia, anxiety, depression, phobic a medicament for the treatment of epilepsy as well as other obsessive symptoms, neuropathic pain, inflammatory pain, disorders associated with ion channel dysfunction. chronic/acute pain, Bartter's syndrome, polycystic kidney In further embodiments, any of the agonists, antagonists, disease, Dent's disease, hyperinsulinemic hypoglycemia of 35 modulators, antibodies, complementary sequences or vectors infancy, cystic fibrosis, congenital stationary nightblindness of the invention may be administered in combination with or total colour-blindness. other appropriate therapeutic agents. Selection of the appro Typically, a vector expressing the complement (antisense) priate agents may be made by those skilled in the art, accord of the polynucleotides of the invention may be administered ing to conventional pharmaceutical principles. The combina to a subject in need of such treatment. Many methods for 40 tion of therapeutic agents may act synergistically to effect the introducing vectors into cells or tissues are available and treatment or prevention of the various disorders described equally suitable for use in vivo, in vitro, and ex vivo. For ex above. Using this approach, therapeutic efficacy with lower Vivo therapy, vectors may be introduced into stem cells taken dosages of each agent may be possible, thus reducing the from the patient and clonally propagated for autologous potential for adverse side effects. transplant back into that same patient. Delivery by transfec 45 Any of the therapeutic methods described above may be tion, by liposome injections, or by polycationic amino poly applied to any Subject in need of such therapy, including, for mers may be achieved using methods which are well known example, mammals such as dogs, cats, cows, horses, rabbits, in the art. (For example, see Goldman et al., 1997). monkeys, and most preferably, humans. Additional antisense or gene-targeted silencing strategies Drug Screening may include, but are not limited to, the use of antisense 50 According to still another aspect of the invention, nucleic oligonucleotides, injection of antisense RNA, transfection of acid molecules of the invention as well as peptides of the antisense RNA expression vectors, and the use of RNA inter invention, particularly purified mutant ion channel Subunit ference (RNAi) or short interfering RNAs (siRNA). Still fur polypeptide and cells expressing these, are useful for the ther, catalytic nucleic acid molecules Such as DNAZymes and screening of candidate pharmaceutical agents for the treat ribozymes may be used for gene silencing (Breaker and 55 ment of epilepsy as well as other as other disorders associated Joyce, 1994; Haseloff and Gerlach, 1988). These molecules with ion channel dysfunction, including but not restricted to, function by cleaving their target mRNA molecule rather than hyper- or hypo-kalemic periodic paralysis, myotonias, malig merely binding to it as in traditional antisense approaches. nant hyperthermia, myasthenia, cardiac arrhythmias, epi In a further aspect, a suitable agonist, antagonist or modu sodic ataxia, migraine, Alzheimer's disease, Parkinson's dis lator may include peptides, phosphopeptide's or Small 60 ease, Schizophrenia, hyperekplexia, anxiety, depression, organic or inorganic compounds that can restore wild-type phobic obsessive symptoms, neuropathic pain, inflammatory activity of ion channels containing mutations in the subunits pain, chronic/acute pain, Bartter's syndrome, polycystic kid which comprise the channels as described above. ney disease, Dent's disease, hyperinsulinemic hypoglycemia Peptides, phosphopeptides or Small organic or inorganic of infancy, cystic fibrosis, congenital stationary night blind compounds Suitable for therapeutic applications may be iden 65 ness or total colour-blindness. tified using nucleic acids and peptides of the invention in drug Still further, it provides the use of a polypeptide complex screening applications as described below. Molecules identi for the screening of candidate pharmaceutical compounds. US 8,129,142 B2 19 20 Still further, it provides the use wherein high throughput actor will result in positive light emission. These assays ulti screening techniques are employed. mately enable identification and isolation of the candidate Compounds that can be screened in accordance with the compounds. invention include, but are not limited to peptides (such as High-throughput drug screening techniques may also soluble peptides), phosphopeptides and Small organic or inor employ methods as described in WO84/03564. Small peptide ganic molecules (such as natural product or synthetic chemi test compounds synthesised on a solid Substrate can be cal libraries and peptidomimetics). assayed formutantion channel Subunit polypeptide or mutant In one embodiment, a screening assay may include a cell ion channel binding. Bound mutantion channel or mutantion based assay utilising eukaryotic or prokaryotic host cells that channel subunit polypeptide is then detected by methods well 10 known in the art. In a variation of this technique, purified are stably transformed with recombinant molecules express polypeptides of the invention can be coated directly onto ing the polypeptides or fragments of the invention, in com plates to identify interacting test compounds. petitive binding assays. Binding assays will measure the for The invention also contemplates the use of competition mation of complexes between a specific mutant ion channel drug screening assays in which neutralizing antibodies Subunit polypeptide orion channel incorporating a mutantion 15 capable of specifically binding the mutant ion channel com channel Subunit polypeptide, and the compound being tested, pete with a test compound for binding thereto. In this manner, or will measure the degree to which a compound being tested the antibodies can be used to detect the presence of any will inhibit or restore the formation of a complex between a peptide that shares one or more antigenic determinants of the specific mutant ion channel Subunit polypeptide or ion chan mutant ion channel. nel incorporating a mutant ion channel Subunit polypeptide, The polypeptides of the present invention may also be used and its interactor or ligand. for screening compounds developed as a result of combina The invention is particularly useful for screening com torial library technology. This provides a way to test a large pounds by using the polypeptides of the invention in trans number of different substances for their ability to modulate formed cells, transfected or injected oocytes, or animal mod activity of a polypeptide. A substance identified as a modu els bearing mutated ion channel Subunits such as transgenic 25 lator of polypeptide function may be peptide or non-peptide animals or gene targeted (knock-in) animals (see transformed in nature. Non-peptide “small molecules” are often preferred hosts). Drug candidates can be added to cultured cells that for many in vivo pharmaceutical applications. In addition, a express a single mutantion channel Subunit or combination of mimic or mimetic of the Substance may be designed for mutantion channel Subunits (appropriate wild-type ion chan pharmaceutical use. The design of mimetics based on a 30 known pharmaceutically active compound (“lead com nel subunits should also be expressed for receptor assembly), pound) is a common approach to the development of novel can be added to oocytes transfected or injected with either a pharmaceuticals. This is often desirable where the original mutant ion channel Subunit or combination of mutant ion active compound is difficult or expensive to synthesise or channel Subunits (appropriate wild-type ion channel Subunits where it provides an unsuitable method of administration. In must also be injected for receptor assembly), or can be admin 35 the design of a mimetic, particular parts of the original active istered to an animal model containing a mutantion channel or compound that are important in determining the target prop combination of mutant ion channels. Determining the ability erty are identified. These parts or residues constituting the of the test compound to modulate mutantion channel activity active region of the compound are known as its pharmacoph can be accomplished by a number of techniques known in the ore. Once found, the pharmacophore structure is modelled art. These include for example measuring the effect on the 40 according to its physical properties using data from a range of current of the channel (e.g. calcium-, chloride-, sodium-, sources including x-ray diffraction data and NMR. A tem potassium-ion flux) as compared to the current of a cell or plate molecule is then selected onto which chemical groups animal containing wild-type ion channels. Current in cells which mimic the pharmacophore can be added. The selection can be measured by a number of approaches including the can be made such that the mimetic is easy to synthesise, is patch-clamp technique (methods described in Hamill et al. 45 likely to be pharmacologically acceptable, does not degrade 1981) or using fluorescence based assays as are known in the in vivo and retains the biological activity of the lead com art (see Gonzalez et al. 1999). Drug candidates that alter the pound. Further optimisation or modification can be carried current to a more normal level are useful for treating or out to select one or more final mimetics useful for in Viva or preventing epilepsy as well as other disorders associated with clinical testing. ion channel dysfunction. 50 It is also possible to isolate a target-specific antibody and Non cell-based assays may also be used for identifying then solve its crystal structure. In principle, this approach compounds that can inhibit or restore binding between the yields a pharmacophore upon which Subsequent drug design polypeptides of the invention or ion channels incorporating can be based as described above. It may be possible to avoid the polypeptides of the invention, and their interactors. Such protein crystallography altogether by generating anti-idio assays are known in the art and include for example AlphaS 55 typic antibodies (anti-ids) to a functional, pharmacologically creen technology (PerkinElmer Life Sciences, MA, USA). active antibody. As a mirror image of a mirror image, the This application relies on the use of beads such that each binding site of the anti-ids would be expected to be an ana interaction partner is bound to a separate bead via an anti logue of the original receptor. The anti-id could then be used body. Interaction of each partner will bring the beads into to isolate peptides from chemically or biologically produced proximity, Such that laser excitation initiates a number of 60 peptide banks. chemical reactions ultimately leading to fluorophores emit Another alternative method for drug screening relies on ting a light signal. Candidate compounds that inhibit the structure-based rational drug design. Determination of the binding of the mutant ion channel Subunit, or ion channel three dimensional structure of the polypeptides of the inven incorporating the mutant Subunit, with its interactor will tion, or the three dimensional structure of the ion channels result in loss of light emission, while candidate compounds 65 which incorporate these polypeptides allows for structure that restore the binding of the mutant ion channel Subunit, or based drug design to identify biologically active lead com ion channel incorporating the mutant Subunit, with its inter pounds. US 8,129,142 B2 21 22 Three dimensional structural models can be generated by a Sorbitol; salt-forming counterions such as Sodium; and/or number of applications, Some of which include experimental non-ionic Surfactants such as Tween, Pluronics or polyethyl models such as x-ray crystallography and NMR and/or from ene glycol (PEG). in silico studies of structural databases such as the Protein The formulation of pharmaceutical compositions for use in Databank (PDB). In addition, three dimensional structural accordance with the present invention will be based on the models can be determined using a number of known protein proposed route of administration. Routes of administration structure prediction techniques based on the primary may include, but are not limited to, inhalation, insufflation sequences of the polypeptides (e.g. SYBYL Tripos Associ (either through the mouth or nose), oral, buccal, rectal or ated, St. Louis, Mo.), de novo protein structure design pro parental administration. grams (e.g. MODELER—MSI Inc., San Diego, Calif., or 10 Diagnostic and Prognostic Applications MOE Chemical Computing Group, Montreal, Canada) or Polynucleotide sequences encoding anion channel Subunit ab initio methods (e.g. see U.S. Pat. Nos. 5,331,573 and may be used for the diagnosis or prognosis of epilepsy, as well 5,579.250). as other as other disorders associated with ion channel dys Once the three dimensional structure of a polypeptide or function, including but not restricted to, hyper- or hypo-kale polypeptide complex has been determined, structure-based 15 mic periodic paralysis, myotonias, malignant hyperthermia, drug discovery techniques can be employed to design bio myasthenia, cardiac arrhythmias, episodic ataxia, migraine, logically-active compounds based on these three dimensional Alzheimer's disease, Parkinson's disease, Schizophrenia, structures. Such techniques are known in the art and include hyperekplexia, anxiety, depression, phobic obsessive symp examples such as DOCK (University of California, San Fran toms, neuropathic pain, inflammatory pain, chronic/acute cisco) or AUTODOCK (Scripps Research Institute, La Jolla, pain, Bartter's syndrome, polycystic kidney disease, Dent's Calif.). A computational docking protocol will identify the disease, hyperinsulinemic hypoglycemia of infancy, cystic active site or sites that are deemed important for protein fibrosis, congenital stationary night blindness or total colour activity based on a predicted protein model. Molecular data blindness, and the use of the nucleic acid molecules incorpo bases, such as the Available Chemicals Directory (ACD) are rated as part of the invention in diagnosis or prognosis of these then screened for molecules that complement the protein 25 disorders, or a predisposition to these disorders, is therefore model. contemplated. The nucleic acid molecules incorporating the Using methods such as these, potential clinical drug can novel mutation events laid out in Table 1 may be used for this didates can be identified and computationally ranked in order purpose. to reduce the time and expense associated with typical wet The polynucleotides that may be used for diagnostic or lab drug screening methodologies. 30 prognostic purposes include oligonucleotide sequences, Compounds identified through screening procedures as genomic DNA and complementary RNA and DNA mol described above, and which are based on the use of the mutant ecules. The polynucleotides may be used to detect and quan nucleic acid and polypeptides of the invention, can also be titate gene expression in biological samples. Genomic DNA tested for their effect on correcting the functional deficit used for the diagnosis or prognosis may be obtained from imposed by other gene mutations in affected individuals 35 body cells, such as those present in the blood, tissue biopsy, including other ion channel Subunit mutations. Surgical specimen, or autopsy material. The DNA may be Such compounds form a part of the present invention, as do isolated and used directly for detection of a specific sequence pharmaceutical compositions containing these and a pharma or may be amplified by the polymerase chain reaction (PCR) ceutically acceptable carrier. prior to analysis. Similarly, RNA or cDNA may also be used, Pharmaceutical Preparations 40 with or without PCR amplification. To detect a specific Compounds identified from Screening assays and shown to nucleic acid sequence, hybridisation using specific oligo restore ion channel wild-type activity can be administered to nucleotides, restriction enzyme digest and mapping, PCR a patient at a therapeutically effective dose to treat or amelio mapping, RNAse protection, and various other methods may rate epilepsy as well as other disorders associated with ion be employed. Oligonucleotides specific to particular channel dysfunction, as described above. A therapeutically 45 sequences can be chemically synthesized and labelled radio effective dose refers to that amount of the compound suffi actively or nonradioactively and hybridised to individual cient to result in amelioration of symptoms of the disorder. samples immobilized on membranes or other solid-supports Toxicity and therapeutic efficacy of Such compounds can or in Solution. The presence, absence or excess expression of be determined by standard pharmaceutical procedures in cell any one of the mutantion channel genes of the invention may cultures or experimental animals. The data obtained from 50 then be visualized using methods such as autoradiography, these studies can then be used in the formulation of a range of fluorometry, or colorimetry. dosages for use in humans. In a further diagnostic or prognostic approach, the nucle Pharmaceutical compositions for use in accordance with otide sequences of the invention may be useful in assays that the present invention can be formulated in a conventional detect the presence of associated disorders, particularly those manner using one or more physiological acceptable carriers, 55 mentioned previously. The nucleotide sequences may be excipients or stabilisers which are well, known. Acceptable labelled by standard methods and added to a fluid or tissue carriers, excipients or stabilizers are non-toxic at the dosages sample from a patient under conditions suitable for the for and concentrations employed, and include buffers such as mation of hybridisation complexes. After a suitable incuba phosphate, citrate, and other organic acids; antioxidants tion period, the sample is washed and the signal is quantitated including absorbic acid; low molecular weight (less than 60 and compared with a standard value. If the amount of signal in about 10 residues) polypeptides; proteins, such as serum the patient sample is significantly altered in comparison to a albumin, gelatin, or immunoglobulins; binding agents includ control sample then the presence of altered levels of nucle ing hydrophilic polymers such as polyvinylpyrrolidone; otide sequences in the sample indicates the presence of the amino acids such as glycine, glutamine, asparagine, arginine associated disorder. Such assays may also be used to evaluate or lysine; monosaccharides, disaccharides, and other carbo 65 the efficacy of a particular therapeutic treatment regimen in hydrates including glucose, mannose, or dextrins; chelating animal studies, inclinical trials, or to monitor the treatment of agents such as EDTA; Sugar alcohols such as mannitol or an individual patient. US 8,129,142 B2 23 24 In order to provide a basis for the diagnosis or prognosis of inhibitors of an ion channel. Antibodies useful for diagnostic epilepsy and other disorders as described above, which are or prognostic purposes may be prepared in the same manner associated with the ion channel Subunit mutations or variants as described above for therapeutics. Diagnostic or prognostic of the invention, the nucleotide sequence of each gene can be assays for ion channels include methods that utilize the anti compared between normal tissue and diseased tissue in order 5 body and a label to detect a mutantion channel inhuman body to establish whether the patient expresses a mutant gene. fluids or in extracts of cells or tissues. The antibodies may be In order to provide a basis for the diagnosis or prognosis of used with or without modification, and may be labelled by a disorder associated with abnormal expression of an ion covalent or non-covalent attachment of a reporter molecule. channel Subunit gene of the invention, a normal or standard A variety of protocols for measuring the presence of profile for expression is established. This may be accom 10 mutant ion channels, including but not restricted to, ELISAS, plished by combining body fluids or cell extracts taken from RIAs, and FACS, are known in the art and provide a basis for normal Subjects, either animal or human, with a sequence, or diagnosing or prognosing a disorder. The expression of a a fragment thereof, encoding the relevant ion channel Subunit mutant ion channel or combination of mutantion channels is gene, under conditions suitable for hybridisation or amplifi established by combining body fluids or cell extracts taken cation. Standard hybridisation may be quantified by compar 15 from test mammalian Subjects, preferably human, with anti ing the values obtained from normal Subjects with values body to the ion channel or channels under conditions suitable from an experiment in which a known amount of a Substan for complex formation. The amount of complex formation tially purified polynucleotide is used. Another method to may be quantitated by various methods, preferably by pho identify a normal or standard profile for expression of an ion tometric means. Antibodies specific for the mutant ion chan channel subunit gene is through quantitative RT-PCR studies. nels will only bind to individuals expressing the said mutant RNA isolated from body cells of a normal individual is ion channels and not to individuals expressing only wild-type reverse transcribed and real-time PCR using oligonucleotides channels (ie normal individuals). This establishes the basis specific for the relevant gene is conducted to establish a for diagnosing the disorder. normal level of expression of the gene. Standard values Once an individual has been diagnosed or prognosed with obtained in both these examples may be compared with val 25 a disorder, effective treatments can be initiated as described ues obtained from Samples from patients who are symptom above. Treatments can be directed to amend the combination atic for a disorder. Deviation from standard values is used to of ion channel Subunit mutations or may be directed to one establish the presence of a disorder. mutation. Once the presence of a disorder is established and a treat Microarray ment protocol is initiated, hybridisation assays or quantitative 30 In further embodiments, complete cDNAs, oligonucle RT-PCR studies may be repeated on a regular basis to deter otides or longer fragments derived from any of the polynucle mine if the level of expression in the patient begins to approxi otide sequences described herein may be used as probes in a mate that which is observed in the normal subject. The results microarray. The microarray can be used to diagnose or prog obtained from Successive assays may be used to show the nose epilepsy, as well as other disorders associated with ion efficacy of treatment over a period ranging from several days 35 channel dysfunction, through the identification of genetic to months. variants, mutations, and polymorphisms in the ion channel According to a further aspect of the invention there is subunits that form part of the invention, to understand the provided the use of a polypeptide as described above in the genetic basis of a disorder, or can be used to develop and diagnosis or prognosis of epilepsy as well as other disorders monitor the activities of therapeutic agents. associated with ion channel dysfunction, including but not 40 According to a further aspect of the present invention, restricted to, hyper- or hypo-kalemic periodic paralysis, myo tissue material obtained from genetically modified non-hu tonias, malignant hyperthermia, myasthenia, cardiac arrhyth man animal models generated as a result of the identification mias, episodic ataxia, migraine, Alzheimer's disease, Parkin of specific ion channel Subunit human mutations (see below), son's disease, Schizophrenia, hyperekplexia, anxiety, particularly those disclosed in the present invention, can be depression, phobic obsessive symptoms, neuropathic pain, 45 used in microarray experiments. These experiments can be inflammatory pain, chronic/acute pain, Bartter's syndrome, conducted to identify the level of expression of specific ion polycystic kidney disease, Dent's disease, hyperinsulinemic channel subunits, or the level of expression of any cDNA hypoglycemia of infancy, cystic fibrosis, congenital station clone from whole-tissue libraries, in diseased tissue as ary night blindness or total colour-blindness. opposed to normal control tissue. Variations in the expression When a diagnostic or prognostic assay is to be based upon 50 level of genes, including ion channel Subunits, between the proteins constituting an ion channel, a variety of approaches two tissues indicates their possible involvement in the disease are possible. For example, diagnosis or prognosis can be process either as a cause or consequence of the original ion achieved by monitoring differences in the electrophoretic channel Subunit mutation present in the animal model. These mobility of normal and mutant proteins that form the ion experiments may be used to determine gene function, to channel. Such an approach will be particularly useful in iden 55 understand the genetic basis of a disorder, to diagnose or tifying mutants in which charge Substitutions are present, or prognose a disorder, and to develop and monitor the activities in which insertions, deletions or substitutions have resulted in of therapeutic agents. Microarrays may be prepared, used, a significant change in the electrophoretic migration of the and analyzed using methods known in the art. (For example, resultant protein. Alternatively, diagnosis or prognosis may see Schena et al., 1996; Heller et al., 1997). be based upon differences in the proteolytic cleavage patterns 60 Transformed Hosts of normal and mutant proteins, differences in molar ratios of The present invention also provides for the production of the various amino acid residues, or by functional assays dem genetically modified (knock-out, knock-in and transgenic), onstrating altered function of the gene products. non-human animal models comprising nucleic acid mol In another aspect, antibodies that specifically bind mutant ecules containing the novel ion channel mutations or variants ion channels may be used for the diagnosis or prognosis of a 65 as laid out in Table 1. These animals are useful for the study disorder, or in assays to monitor patients being treated with a of the function of ion channels, to study the mechanisms by complete ion channel or agonists, antagonists, modulators or which combinations of mutations in ion channel Subunits US 8,129,142 B2 25 26 interact to give rise to disease and the effects of these muta enzymes that recognise homologous DNA sequences and tions on tissue development, for the screening of candidate exchange them via double crossover. pharmaceutical compounds, for the creation of explanted Gene targeting vectors are usually introduced into ES cells mammalian cell cultures which express mutant ion channels using electroporation. ES cell integrants are then isolated via or combinations of mutant ion channels, and for the evalua an antibiotic resistance gene present on the targeting vector tion of potential therapeutic interventions. and are Subsequently genotyped to identify those ES cell Animal species which are Suitable for use in the animal clones in which the gene under investigation has integrated into the locus of interest. The appropriate ES cells are then models of the present invention include, but are not limited to, transmitted through the germline to produce a novel mouse rats, mice, hamsters, guinea pigs, rabbits, dogs, cats, goats, strain. sheep, pigs, and non-human primates such as monkeys and 10 In instances where gene ablation results in early embryonic chimpanzees. For initial studies, genetically modified mice lethality, conditional gene targeting may be employed. This and rats are highly desirable due to the relative ease in gen allows genes to be deleted in a temporally and spatially con erating knock-in, knock-out or transgenics of these animals, trolled fashion. As above, appropriate ES cells are transmitted their ease of maintenance and their shorter life spans. For through the germline to produce a novel mouse strain, how certain studies, transgenic yeast or invertebrates may be Suit 15 ever the actual deletion of the gene is performed in the adult able and preferred because they allow for rapid screening and mouse in a tissue specific or time controlled manner. Condi provide for much easier handling. For longer term studies, tional gene targeting is most commonly achieved by use of the non-human primates may be desired due to their similarity cre/lox System. The enzyme cre is able to recognise the 34 with humans. base pair loXp sequence Such that loXp flanked (or floxed) To create an animal model for a mutated ion channel, oran DNA is recognised and excised by cre. Tissue specific cre animal model incorporating a combination of mutations, sev expression in transgenic mice enables the generation of tissue eral methods can be employed. These include, but are not specific knock-out mice by mating gene targeted floxed mice limited to, generation of a specific mutation in a homologous with cre transgenic mice. Knock-out can be conducted in animal gene, insertion of a wild type human gene and/or a every tissue (Schwenk et al., 1995) using the deleter mouse humanized animal gene by homologous recombination, 25 or using transgenic mice with an inducible cre gene (such as insertion of a mutant (single or multiple) human gene as those with tetracycline inducible cre genes), or knock-out can genomic or minigene cDNA constructs using wild type or be tissue specific for example through the use of the CD19-cre mouse (Rickert et al., 1997). mutant or artificial promoter elements, or insertion of artifi Once knock-in animals have been produced which contain cially modified fragments of the endogenous gene by a specific mutation in a particularion channel Subunit, mating homologous recombination. The modifications include inser 30 combinations may be initiated between Such animals so as to tion of mutant stop codons, the deletion of DNA sequences, or produce progeny containing combinations of two or more ion the inclusion of recombination elements (lox p sites) recog channel mutations. These animals effectively mimic combi nized by enzymes Such as Cre recombinase. nations of mutations that are proposed to cause human IGE To create transgenic mice in order to study gain of gene cases. These animal models can Subsequently be used to function in Vivo, any mutant ion channel Subunit gene of the 35 study the extent and mechanisms of disease as related to the invention can be inserted into a mouse germ line using stan mutated ion channel combinations, as well as for the screen dard techniques such as oocyte microinjection. Gain of gene ing of candidate therapeutic compounds. function can mean the over-expression of a gene and its According to still another aspect of the invention there is protein product, or the genetic complementation of a muta provided the use of genetically modified non-human animals tion of the gene under investigation. For oocyte injection, one 40 as described above for the screening of candidate pharmaceu or more copies of the mutant gene can be inserted into the tical compounds (see drug screening above). These animals pronucleus of a just-fertilized mouse oocyte. This oocyte is are also useful for the evaluation (eg therapeutic efficacy, then reimplanted into a pseudo-pregnant foster mother. The toxicity, metabolism) of candidate pharmaceutical com live-born mice can then be screened for integrants using pounds, including those identified from the invention as analysis of tail DNA for the presence of the relevant human 45 described above, for the treatment of epilepsy as well as other ion channel Subunit gene sequence. The transgene can be as other disorders associated with ion channel dysfunction as either a complete genomic sequence injected as aYAC, BAC, described above. PAC or other chromosome DNA fragment, a cDNA with It will be clearly understood that, although a number of either the natural promoter or a heterologous promoter, or a prior art publications are referred to herein, this reference minigene containing all of the coding region and other ele 50 does not constitute an admission that any of these documents ments found to be necessary for optimum expression. forms part of the common general knowledge in the art, in To generate knock-out mice or knock-in mice, gene target Australia or in any other country. ing through homologous recombination in mouse embryonic Throughout this specification and the claims, the words stem (ES) cells may be applied. Knock-out mice are gener “comprise', 'comprises and "comprising are used in a non ated to study loss of gene function in vivo while knock-in 55 exclusive sense, except where the context requires otherwise. mice (which are preferred) allow the study of gain of function It will be apparent to the person skilled in the art that while or to study the effect of specific gene mutations. Knock-in the invention has been described in some detail for the pur mice are similar to transgenic mice however the integration poses of clarity and understanding, various modifications and site and copy number are defined in the former. alterations to the embodiments and methods described herein For knock-out mouse generation, gene targeting vectors 60 may be made without departing from the scope of the inven can be designed such that they delete (knock-out) the protein tive concept disclosed in this specification. coding sequence of the relevant ion channel Subunit gene in the mouse genome. In contrast, knock-in mice can be pro BRIEF DESCRIPTION OF THE DRAWINGS duced whereby a gene targeting vector containing the relevant ion channel Subunit gene can integrate into a defined genetic 65 Preferred forms of the invention will now be described, by locus in the mouse genome. For both applications, homolo way of example only, with reference to the following gous recombination is catalysed by specific DNA repair examples and the accompanying drawings, in which: US 8,129,142 B2 27 28 FIG. 1 provides an example of ion channel subunit stoichi long and contains a conserved “A domain followed by a ometry and the effect of multiple versus single ion channel short stretch thought to be involved in subunit assembly. Subunit mutations. Four KCNQ subunits are thought to combine to form a FIG. 1A: A typical channel may have five subunits of three functional potassium channel. All five known KCNO proteins different types. can form homomeric channels in vitro and the formation of FIG.1B: In outbred populations complex diseases such as heteromers appears to be restricted to certain combinations. idiopathic generalized epilepsies may be due to mutations in For instance KCNQ2 and KCNQ3, which are predominantly two (or more) different subunit genes. Because only one allele expressed in the central nervous system, form a heteromulti of each Subunit gene is abnormal, half the expressed subunits meric channel that mediates the neuronal muscarinic-regu will have the mutation. 10 lated current (M-current), also known as the M-channel (or FIG. 1C: In inbred populations, both alleles of a single M-type K channel). The M-current is a slowly activating, subunit gene will be affected, so all expressed subunits will be non-inactivating potassium conductance known to regulate mutated. neuronal excitability by determining the firing properties of FIG. 1D: Autosomal dominant disorders can be attributed neurons and their responsiveness to synaptic input (Wang et to single ion channel Subunit mutations that give rise to severe 15 al., 1998). Because it is the only current active at voltages near functional consequences. the threshold for action potential initiation, the M-current has FIG. 2 represents the location of mutations identified in the a major impact on neuronal excitability. KCNO2 ion channel Subunit constituting the potassium chan Sodium (the alpha Subunit) and calcium channels are nel. M: Missense mutation; T: Truncation mutation; F: thought to have evolved from the potassium channel Subunit, Frameshift mutation; S: Splice site mutation. and they each consist of four domains covalently linked as the FIG. 3 provides examples of epilepsy pedigrees where one molecule, each domain being equivalent to one of the mutation profiles of ion channel Subunits for individuals con Subunits that associate to form the potassium channel. Each of stituting the pedigree have begun to be determined. These the four domains of the Sodium and calcium channels are examples have been used to illustrate how the identification of comprised of six transmembrane segments. novel ion channel Subunit mutations and variations in IGE 25 Voltage-gated Sodium channels are required to generate the individuals can combine to give rise to the disorder. electrical excitation in neurones, heart and skeletal muscle FIG. 4 shows the results of yeast two-hybrid analysis of fibres, which express tissue specific isoforms. Sodium chan R353G and L619R KCNQ2 mutants. Yeast were transformed nels are heteromers of a pore forming alpha Subunit and a with the empty DB (BAIT) plasmid (DBLeu), DB-Q2C wt, modulatory beta-1 subunit, with an additional beta-2 subunit DB-Q2C R353G mutant or the DB-Q2 L619R mutant as 30 in neuronal channels. Ten genes encoding sodium channel indicated in A and the AD-CaM (TARGET) vector was intro alpha subunits and 3 genes encoding different beta Subunits duced by gap-repair. Yeast control strains (InvitrogenTM) were have so far been identified. The beta subunits of the sodium included on all plates for comparison. Control 1 has no inter channels do not associate with the alpha Subunits to formany action. Control 2 has a weak interaction. Control 3 has a part of the pore, they do however affect the way the alpha pore moderately strong interaction. Control 4 has a strong interac 35 forming Subunit functions. tion and control 5 has a very strong interaction. B. Growth of As with sodium channels, calcium channels consist of a transformed yeast and controls on-leu -tryp selection. Yeast single pore forming alpha Subunit, of which at least six types can grow on-leu if they contain the DB plasmid, and -tryp if have been identified to date, and several accessory subunits they have AD plasmid. C. Growth of transformed yeast and including four beta, one gamma and one alpha2-delta gene. controls on-leu-tryp -his--40 mM3AT after 48 hrs. Yeast can 40 Many of these subunits also encode multiple splice variants grow on -his-3-AT if the his reporter gene is activated by adding to the diversity of receptor subunits of this family of interaction between the BAIT and TARGET plasmids. D-F. ion channels. Lacz Filter assay for interaction between BAIT and TARGET The ion channels in the naChR/GABA super family show plasmids, photos taken after 2 hrs (D), 7hrs (E) and 24hrs (F). a theoretical pentameric channel. Gamma-Aminobutyric acid Activation of the B-galactosidase reporter gene by interaction 45 (GABA) is the most abundant inhibitory neurotransmitter in of the BAIT and TARGET plasmids leads to the dark appear the central nervous system. GABA-ergic inhibition is medi ance of colonies. ated by two major classes of receptors, type A (GABA-A) and FIG. 5 shows the results of CaM affinity experiments with type B (GABA-B). GABA-B receptors are members of the the R353G and L619R KCNQ2 mutants. The chart below class of receptors coupled to G-proteins and mediate a variety shows the values from the CPRG assay for B-galactosidase 50 of inhibitory effects via secondary messenger cascades. activity as a measure of KCNQ2C-CaM binding efficiency. GABA-A receptors are ligand-gated chloride channels that The area of each bar in the chart equates to the CaM binding mediate rapid inhibition. efficiency of the BAIT. Broken lines indicate statistical com The GABA-A channel has 16 separate, but related, genes parison by Student's t test *P<0.01, ** P<0.001. encoding Subunits. These are grouped on the basis of 55 sequence identity into alpha, beta, gamma, delta, epsilon, MODES FOR PERFORMING THE INVENTION theta and pi Subunits. There are six alpha subunits (C.1-C6), three beta subunits (B1-B3) and three gamma subunits (Y1 Potassium channels are the most diverse class of ion chan Y3). Each GABA-A receptor comprises five subunits which nel. The C. elegans genome encodes about 80 different potas may, at least in theory, be selected from any of these subunits. sium channel genes and there are probably more in mammals. 60 Neuronal nicotinic acetylcholine receptors (nAChRs) con About ten potassium channel genes are known to be mutated sist of heterologous pentamers comprising various combina in human disease and include four members of the KCNQ tions of alpha subunits or alpha and beta subunits (O2-C.9; gene Sub-family of potassium channels. KCNO proteins have 32-34). The alpha Subunits are characterised by adjacent six transmembrane domains, a single P-loop that forms the cysteine residues atamino acid positions 192 and 193, and the selectivity filter of the pore, a positively charged fourth trans 65 beta subunits by the lack of these cysteine residues. They are membrane domain that probably acts as a Voltage sensor, and ligand-gated ion channels differentially expressed through intracellular amino and carboxy termini. The C-terminus is out the brain to form physiologically and pharmacologically US 8,129,142 B2 29 30 distinct receptors hypothesised to mediate fast, excitatory EXAMPLE 2 transmission between neurons of the central nervous system or to modulate neurotransmission from their presynaptic Sample Preparation for SSCP Screening position. In chicken and rat, the predominant naChR subtype is 5 A large collection of individuals affected with epilepsy composed of alpha-4 and beta-2 Subunits. The transmem have undergone careful clinical phenotyping and additional brane 2 (M2) segments of the subunits are arranged as alpha data regarding their family history has been collated. helices and contribute to the walls of the neurotransmitter Informed consent was obtained from each individual for gated ion channel. The alpha helices appear to be kinked and blood collection and its use in Subsequent experimental pro orientated in Such a way that the side chains of the highly 10 cedures. Clinical phenotypes incorporated classical IGE conserved M2-leucine residues project inwards when the cases as well as GEFS+ and febrile seizure cases. channel is closed. ACh is thought to cause a conformational DNA was extracted from collected blood using the change by altering the association of the amino acid residues QIAamp DNA Blood Maxi kit (Qiagen) according to manu of M2. The opening of the channel seems to be due to rota 15 facturers specifications or through procedures adapted from tions of the gate forming side chains of the amino acid resi Wyman and White (1980). Stock DNA samples were kept at dues; the conserved polar serines and threonines may form a concentration of 1 lugful. the critical gate in the open channel. In preparation for SSCP analysis, samples to be screened were formatted into 96-well plates at a concentration of 30 EXAMPLE1 2O ngful. These masterplates were Subsequently used to prepare exon specific PCR reactions in the 96-well format. Identification of Mutations in Ion Channels EXAMPLE 3 Previous studies by reference (Wallace et al., 1998: PCT/ AU01/00581; Wallace et al., 2001b: Australian patent AU-B- 25 Identification of Sequence Alterations in Ion Channel 56247/96; Steinlein et al., 1995; PCT/AU01/00541; Phillips Genes et al., 2001; PCT/AU01/00729; PCT/AU01/01648. PCT/ AU02/00910; Wallace et al., 2001a, the disclosures of which SSCP analysis of specific ion channel exons followed by are incorporated herein by reference) have identified muta sequencing of SSCP bandshifts was performed on individuals tions in a number of ion channel subunits associated with 30 constituting the 96-well plates to identify sequence alter epilepsy. These include ion channel Subunits of voltage-gated ations. (eg SCN1A, SCN1B, KCNQ2, KCNQ3) or ligand-gated (eg Primers used for SSCP were labelled at their 5' end with CHRNA4, CHRNB2, GABRG2, GABRD) types. To identify HEX and typical PCR reactions were performed in a total further mutations in ion channel genes, Subunits which com volume of 10 ul. All PCR reactions contained 67 mM Tris 35 HCl (pH 8.8); 16.5 mM (NHA)SO; 6.5 M EDTA; 1.5 mM prise the ion channels were screened for molecular defects in MgCl: 200uMeach DNTP; 10% DMSO, 0.17 mg/ml BSA: epilepsy patients. 10 mM f-mercaptoethanol; 5 lug/ml each primer and 100 Human genomic sequence available from the Human U/ml Taq DNA polymerase. PCR reactions were typically Genome Project was used to characterize the genomic organi performed using 10 cycles of 94° C. for 30 seconds, 60° C. for sation for each subunit gene. Each gene was subsequently a 30 seconds, and 72°C. for 30 seconds followed by 25 cycles screened for sequence changes using single Strand conforma of 94° C. for 30 seconds, 55° C. for 30 seconds, and 72°C. for tion polymorphism (SSCP) analysis in a large sample of 30 seconds. A final extension reaction for 10 minutes at 72°C. epileptics with common sporadic IGE Subtypes eg juvenile followed. myoclonic epilepsy (JME), childhood absence epilepsy Ten to twenty ul of loading dye comprising 50% (v/v) (CAE), juvenile absence epilepsy (JAE) and epilepsy with 45 formamide, 12.5 mM EDTA and 0.02% (w/v) bromophenol generalized tonic-clonic seizures (TCS). Clinical observa blue were added to completed reactions which were subse tions can then be compared to the molecular defects charac quently run on non-denaturing 4% polyacrylamide gels with terized in order to establish the combinations of mutant sub a cross-linking ratio of 35:1 (acrylamide:bis-acrylamide) and units involved in the various disease states, and therefore to containing 2% glycerol. Gel thickness was 100 um, width 168 provide validated drug targets for each of these disease states. 50 mm and length 1600 mm. Gels were run at 1200 volts and This will provide a basis for novel drug treatments directed at approximately 20 mA, at 18°C. and analysed on the GelScan the genetic defects present in each patient. 2000 system (Corbett Research, Australia) according to The coding sequence for each of the ion channel Subunits manufacturers specifications. was aligned with human genomic sequence present in avail PCR products showing a conformational change were Sub able databases at the National Centre for Biotechnology 55 sequently sequenced. This first involved re-amplification of Information (NCBI). The BLASTN algorithm was typically the amplicon from the relevant individual (primers used in used for sequence alignment and resulted in the genomic this instance did not contain 5' HEX labels) followed by organisation (intron-exon structure) of each gene being deter purification of the PCR amplified templates for sequencing mined. Where genomic sequence for an ion channel Subunit using QiaQuick PCR preps (Qiagen) based on manufacturers was not available, BACs or PACs containing the relevant ion 60 procedures. The primers used to sequence the purified ampli channel Subunit were identified through screening of high cons were identical to those used for the initial amplification density filters containing these clones and were Subsequently step. For each sequencing reaction, 25 ng of primer and 100 sequenced. ng of purified PCR template were used. The BigDye sequenc Availability of entire genomic sequence for eachion chan ing kit (ABI) was used for all sequencing reactions according nel Subunit facilitated the design of intronic primers spanning 65 to the manufacturers specifications. The products were run on each exon. These primers were used for both high throughput an ABI 377 Sequencer and analysed using the EditView pro SSCP screening and direct DNA sequencing. gram. US 8,129,142 B2 31 32 Table 1 shows the novel sequence changes identified in the alleles (IGE genotype), and the total abnormal allele fre ion channel Subunits screened. quency will be 0.08 (3x0.027). To determine the familial risks and allele patterns in EXAMPLE 4 affected pairs, the frequency distribution of population mat ings and the percentage of children with 2 or more abnormal Digenic Model Examples alleles must be determined. The frequency of matings with no abnormal alleles (0x0) is 0.72 (0.8485?), for 1x0 and 0x1 In some instances a single mutation in anion channel alone matings 0.24 (2x0.8485x0.1413), for a 1x1 mating 0.020, is insufficient to give rise to an epilepsy phenotype. However and for 2x0 and 0x2 matings 0.0166 etc. From this distribu combinations of mutations each conferring a subtle change of tion of matings the frequency of children with 2 or more function to an ion channel, as proposed by the digenic model abnormal alleles can be shown to be 0.01. For example, the (PCT/AU01/00872), may be sufficient to produce an epilepsy 0x2 and 2x0 matings contribute 0.0033 of this 0.01 frequency phenotype. (0.0166 mating frequencyx0.2 chance of that mating pro ducing a child with 2 or more abnormal alleles). Using mutations and variations in ion channel Subunits To determine parental risk it can be shown that of children previously identified, the digenic model may be validated with 2 abnormal alleles (IGE genotype), 0.49 derive from 1x1 through a parametric analysis of large families in which two matings where no parent is affected, 0.33 derive from a 2x0 abnormal alleles co-segregate by chance to identify muta and 0x2 matings etc. For the 2x0 and 0x2 matings, half the tions which act co-operatively to give an epilepsy phenotype. parents have IGE genotypes and contribute 0.16 (0.33/2) to It is envisaged that the strategy of careful, clinical phenotyp the parental risk with the total parental risk of an IGE geno ing in these large families, together with a linkage analysis type being 0.258. The other matings that contribute to based on the digenic hypothesis will allow identification of affected parent-child pairs are 2x1, 1x2, 3x0, 0x3 etc. the mutations in ion channels associated with IGES. If The sibling risk of an IGE genotype is 0.305. For example molecular genetic studies in IGE are successful using the 2x0 and 0x2 matings contributed 0.08 to the sibling risk digenic hypothesis, such an approach might serve as a model 25 (0.33 fraction of children with 2 abnormal allelesex0.25the for other disorders with complex inheritance. chance of that mating producing a child with 2 or more The digenic hypothesis predicts that the closer the genetic abnormal alleles). Similarly the offspring risk was deter relationship between affected individuals, the more similar mined to be 0.248 by mating individuals with 2 abnormal the Sub-syndromes, consistent with published data (Italian alleles with the general population. Thus at 30% penetrance League Against Epilepsy Genetic Collaborative Group, 30 the risk for IGE phenotype for parents of a proband is 0.077. 1993). This is because more distant relatives are less likely to for siblings 0.091, and for offspring 0.074. share the same combinations of mutated subunits. It can be shown that affected sib pairs share the same Identical twins have the same pair of mutated Subunits and abnormal allele pair in 85% of cases. This is because of all the same minor alleles so the Sub-syndromes are identical. affected sib pairs 44% derive from 1x1 matings and 23% from Affected sib-pairs, including dizygous twins, with the same 35 0x2 and 2x0 matings where all affected siblings have the Sub-syndrome would also have the same pair of mutated same genotype. In contrast, 24% derive from 1x2 matings and subunits, but differences in minor alleles would lead to less 9% from 3x1 and 2x2 matings etc where affected sibling similarity than with monozygous twins. Some sib-pairs and genotypes sometimes differ. dizygous twins, have quite different Sub-syndromes; this For affected parent-child pairs, genotypes are identical in would be due to different combinations of mutated subunits, 40 only 58%. Of affected parent child pairs, 43% derive from when the parents have more than two mutated alleles between 0x2 matings where genotypes are identical, whereas 38% them. derive from 0x3 and 17% from 1x2 where the majority of A special situation exists in inbred communities that par crosses yield different affected genotypes. allels observations on autosomal recessive mouse models. Based on the digenic model it has been postulated that most Here the two mutated alleles of the digenic model are the 45 classical IGE and GEFS" cases are due to the combination of same and thus result in a true autosomal recessive disorder. two mutations in multi-subunition channels. These are typi Because all affected individuals have the same pair of cally point mutations resulting in a subtle change of function. mutated alleles, and a similar genetic background, the phe The critical postulate is that two mutations, usually, but not notypes are very similar. exclusively, in different subunit alleles (“digenic model'), are In outbred communities approximately 1% of the popula 50 required for clinical expression of IGE. tion would have IGE genotypes (2 mutated alleles) and 0.3% The hypothesis that, similar phenotypes can be caused by would clinically express IGE. Most of these would have the combination of mutations in two (or more) different sub mutations in two different channel Subunits. In such commu units (outbred communities), or by the same mutation in two nities most cases would appear 'sporadic” as the risk to first (or more) alleles of the same subunit (inbred communities), degree relatives would be less than 10%. 55 may seem implausible. However, applying the digenic For example, let there be three IGE loci (A.B.C) and let the hypothesis to the theoretical pentameric channel shown in frequency of abnormal alleles (a,b,c) at each locus be FIG. 1, in outbred communities IGE will be due to subunit 0.027 and of normal alleles (a, b, c) be 0.973. Then, the combinations such as C*CfB* BA, C*C*Bf3A or C.C. B*BA* distribution of genotypes aa, aa, aa and aa at locus A will (mutated subunits indicated by *). In inbred communities be 0.0263 (0.027x0.973), 0.0263, 0.0007 and 0.9467 respec 60 C*C*Bf3A or C.O.f3*B* A combinations might cause IGE phe tively, and similarly for loci B and C. In this population notypes. We assume that the mutations will not cause reduced 0.8485 will have no mutated alleles (0.9467), 0.1413 will expression of the alleles and that the altered ion channel have one mutated allele (a or bor c, 0.0263x0.9467x6), excitability, and consequent IGE phenotype, caused by muta 0.0098 will have two abnormal alleles (0.0020 two same tions in two different alleles is similar to that caused by the abnormal alleles, 0.0078, two different abnormal alleles) and 65 same mutation in both alleles of one subunit. Finally, subunit 0.00037 will have more than two abnormal alleles. Thus in mutations with more severe functional consequences (eg this population 0.01, or 1%, will have two or more abnormal breaking a disulphide bridge in SCN1B or amino acid sub US 8,129,142 B2 33 34 stitution in the pore forming regions of SCN1A for GEFS) CAE affected individuals in this family also had the mutation. cause autosomal dominant generalized epilepsies with a pen To test the digenic model of IGEs in the CAE affected indi etrance of 60-90%. Such “severe” mutations are rare (allele viduals, the whole genome screen of this family was reanaly frequency <0.01%) and are infrequent causes of GEFS". sed with only individuals with CAE considered affected. They very rarely, or perhaps never, cause classical IGE. 5 Linkage analysis was performed using FASTLINK v4.0, The relative separate segregation of classical IGE and two-point lod scores were calculated assuming 50% pen GEFS phenotypes is an anecdotal clinical observation of etrance and a 2% phenocopy rate and individuals with FS or ours (Singh et al., 1999), although the separation is not abso FS+ were coded as unknown. Markers producing a lod score lute. The separation is supported by previous family and EEG greater than 1 were reanalysed without a phenocopy rate and studies of Doose and colleagues who described “type A” and 10 “type B liabilities which we may approximate the GEFS" at the observed penetrance for CAE in this family (30%). and classical IGE groupings respectively (Doose and Baier, Results from the analysis revealed significant linkage to chro 1987). mosome 14q22-q23 (lod 3.4). This provides strong evidence The digenic model predicts that affected sib pairs will share for a second locus segregating with CAE affected individuals the same genes in 85% of cases whereas they will have at least 15 in this family. While the GABRG2 mutation is sufficient to one different allele in the remaining 15%. In contrast, only cause FS, the CAE phenotype is thought to be due to both the 58% of parent-child pairs share the same alleles in a 3 locus GABRG2 mutation and a mutation occurring in a gene map model. Thus there should be greater similarity of syndromes ping to the 14q locus, as proposed by the digenic model. between sibling pairs than parent-child pairs. This would be For the application of the digenic model to sporadic cases most objectively measured by age of onset and seizure types. of IGE and affected individuals belonging to smaller families Estimates for the risk offebrile seizures or IGE in relatives in which genotyping and linkage analysis is not a feasible vary. The estimates range from 5%-10% for siblings, 4%–6% approach to disease gene identification, direct mutation for offspring, 3%-6% for parents, and 2-3% for grandparents. analysis of ion channel genes in these individuals has been Underestimation may occur because IGE manifest in youth, carried out as described above. In Table 1 there is provided an and parents and particularly grandparents may be unaware of 25 indication of novel genetic alterations So far identified seizures in themselves in younger years. This is particularly through mutation analysis screening of these individuals. true where there was stigma associated with epilepsy and FIG. 2 provides an example to indicate where some of these where the epilepsy may have been mild and unrecognized. mutations have occurred with respect to the potassium chan Underestimation of sibling and offspring risks occurs when nel KCNO2 gene. unaffected young children are counted, some of whom will 30 The identification of novel mutations and variations in ion develop IGE in adolescence. Overestimation may occur with channel subunits in IGE individuals provides resources to misdiagnosis of seizures or inclusion of seizures unrelated to further test the digenic hypothesis and mutation profiles are IGE (e.g. due to trauma or tumors) starting to accumulate for a number of subunit changes that In autosomal dominant models the risk to affected relatives are observed in the same individuals. FIG. 3 provides results reduces proportionally (50% for first degree relatives, 25% 35 from some of these profiles. for second degree etc). For all oligogenic or polygenic models FIG. 3A shows a 3 generation family in which individual the risk decreases more quickly. For a digenic model with III-1 has myoclonic astatic epilepsy and contains a N43del three loci, the risks are 9.1% for siblings, 7.4% for offspring, mutation in the SCN3A gene as well as an A1067T mutation 7.7% for parents. Rigorous measurement of the familial in the SCN1A gene. Individual I-1 also has the SCN3A muta recurrence rates, with careful phenotyping and age-corrected 40 tion but alone this mutation is not sufficient to cause epilepsy risk estimates could be compared with the predictions from in this individual. The SCN3A mutation has likely been inher the digenic model, and it is proposed to do this. ited from the grandfather through the mother, while the There is a small amount of information on IGE families SCN1A mutation is likely to arise from the father. Both par regarding haplotype distribution. For example, there is some ents are unaffected but have yet to be screened for the pres evidence for a locus on 8q as determined by parametric link 45 ence of the mutations in these subunits. Individual II-1 is age in a single family (Fong et al., 1998) and by non-para likely to contain an as yet-unidentified ion channel Subunit metric analysis in multiple small families (Zara et al., 1995). mutation acting in co-operation with the SCN3A mutation Interestingly, in the latter study the 8q haplotype not infre already identified in this individual. quently came from the unaffected parent. This would be quite FIG.3B is another 3 generation family in which individual compatible with the digenic model and evaluation of other 50 III-1 has myoclonic astatic epilepsy due to a combination of data sets in this manner could be used to test the hypothesis, the same SCN3A and SCN1A mutations as above. However, and it is proposed to do this. in this family both parents have febrile seizures most likely Following the analysis of one large family with epilepsy due to the presence of just one of the mutations in each parent, where the two main phenotypes were childhood absence epi as proposed by the model. This is in contrast to individuals lepsy (CAE) and febrile seizures (FS), the inheritance of FS 55 II-2 and II-3 in FIG. 4A who also contain one of the mutations was found to be autosomal dominant and the penetrance 75%. in these genes each. These individuals are phenotypically However the inheritance of CAE in this family was not simple normal most likely due to incomplete penetrance of these Mendelian, but Suggestive of complex inheritance with the mutations in each case. involvement of more than one gene. The power of this large FIG. 3C shows a larger multi-generation family in which family was used to explore the complex genetics of CAE 60 individual IV-5 has a mutation in both the SCN3A and further. GABRG2 subunits. In combination, these give rise to severe Linkage analysis on this family in which individuals with myoclonic epilepsy of infancy but alone either cause febrile CAE, FS and FS+ were deemed affected led to the detection seizures (GABRG2 mutation in III-3 and IV-4) or are without of linkage on chromosome 5q and identification of a mutation an effect (SCN3A mutation in III-2) as proposed by the in the GABRG2 gene (R43Q) which is localised to this region 65 model. (Wallace et al., 2001a; PCT/AU01/00729). All 10 tested indi These examples therefore illustrate the digenic model as viduals with FS alone in this family had this mutation and 7 determined from mutation analysis studies of ion channel US 8,129,142 B2 35 36 subunits in affected individuals and highlight the need to 3' and KCNQ2R: 5'-TCACTTCCTGGGCCCGGC identify genetic alterations in the genes encoding ion channel CCAGCC-3'. The 1611 base pair cloned fragment included Subunits. exon 10a (found in all our amplified clones), corresponding to amino acid 373-382 of the KCNQ2 protein. The extra 30 base EXAMPLE 5 pairs (10 amino acids) were included in our numbering. The PCR-product was cloned into the pENTR/D-TOPOR) vector Analysis of Ion Channels and Ion Channel Subunits (InvitrogenTM) via the TOPOR) Cloning reaction according to the manufacturers instructions. Following sequence verifi The structure and function of the mutant ion channels and cation, the KCNO2 cDNA fragment was then subcloned into mutant ion channel Subunits of the present invention can be 10 pDESTTM32, the DNA Binding domain (DB) GatewayTM determined using a variety of molecular biological studies. Destination Vector (InvitrogenTM). These studies may provide clues as to the mechanisms by The ProQuestTM Two-Hybrid human brain cDNA Library which mutations in ion channel subunits effect the function (TARGET) with GatewayTM technology (ResGenTM, Invitro ing of the ion channel. For instance the identification of pro genTM Corporation) was amplified according to the manufac teins that interact with mutant ion channels (or whose inter 15 turer's instructions. Plasmid DNA was purified from the cell action is impeded by a mutation in an ion channel Subunit) pellet using the HiSpeed Plasmid Maxi Kit (Qiagen) accord may help determine the molecular mechanisms that are dis ing to the manufacturers instructions. rupted as a result of a mutation. Procedures Such as the yeast Both the DBLeu (empty bait vector) and DB-KCNQ2 two-hybrid system can be used to discover and identify such wild-type (wt) C-term BAITS were transformed into the yeast interacting proteins. strain May 203 and plated onto minimal selective media The principle behind the yeast two-hybrid procedure is that lacking leucine. A duplicate was carried out where the empty many eukaryotic transcriptional activators, including those in library TARGET (pAD) vector was co-transformed in addi yeast, consist of two discrete modular domains. The first is a tion to each BAIT and plated onto minimal selective media DNA-binding domain that binds to a specific promoter lacking leucine (-leu) and tryptophan (-tryp). Yeast control sequence and the second is an activation domain that directs 25 strains (InvitrogenTM) were included on all plates. Control 1, the RNA polymerase II complex to transcribe the gene down used as a negative control, contained empty plasmids pPC97 stream of the DNA binding site. Both domains are required and pPC86. Control 2 had pPC97-RB and pPC86-E2F1, for transcriptional activation as neither domain can activate which express a relatively weak interaction. Control 3 con transcription on its own. In the yeast two-hybrid procedure, tained plasmids encoding the Drosophila DP (pPC97) and the gene of interest or parts thereof (BAIT), is cloned in such 30 E2F (pPC86) domains that have a moderately strong interac a way that it is expressed as a fusion to a peptide that has a tion, and provide a control for plasmid shuffling. Control 4 DNA binding domain. A second gene, or number of genes, contained pPC97-Fos and pPC86-Jun which express a rela such as those from a cDNA library (TARGET), is cloned so tively strong interaction, and control 5 had a pCL1 plasmid that it is expressed as a fusion to an activation domain. Inter encoding full-length GAL4p and empty pPC86 and was used action of the protein of interest with its binding partner brings 35 as a positive control. the DNA-binding peptide together with the activation domain The constructs were tested for self-activation of the his and and initiates transcription of the reporter genes. The first B-gal reporter genes according to InvitrogenTM instructions. reporter gene will select for yeast cells that contain interact For the yeast-two hybrid screen, competent yeast cells ing proteins (this reporter is usually a nutritional gene were prepared for each BAIT (DB-KCNQ2 wt C-term con required for growth on selective media). The second reporter 40 struct) to be screened, transformed with 31 ug of ProQuestTM is used for confirmation and while being expressed in Two-Hybrid human brain AD (activation domain)-cDNA response to interacting proteins it is usually not required for Library and plated onto minimal selective media lacking leu growth. cine (-leu), tryptophan (-tryp) and histidine (-his) and con KCNQ2 Interactors taining 3-aminotriazole (+3AT). Positive colonies from each Despite the identification of a number of KCNO2 muta 45 screen were PCR-amplified and re-introduced into fresh yeast tions responsible for epilepsy, including those of the present cells containing the BAIT to re-test for two-hybrid interaction study, the underlying biological mechanisms responsible for phenotypes. Those giving rise to more than one PCR product the epilepsy remains largely uncharacterized. Towards iden or that failed to re-test positively were systematically elimi tifying these mechanisms, the large intracellular C-terminal nated. Positives that re-tested were sequenced using the ABI region of KCNQ2 was screened for interactions with other 50 PRISM(R) BigDyex Terminators v3.0 technology. Once iden proteins using the yeast-two hybrid procedure. The C-termi tified, the sequence of the potential interactor was checked to nus accounts for 63% of the KCNO2 protein and, in common verify it was in the same translational frame as the Gal4p-AD with other KCNQ subunits, contains a conserved A domain encoding sequence of the prey construct. (Jentsch, 2000; Schwake et al., 2000) thought to be involved Approximately 3x10 clones from the ProQuestTM Two in Subunit interactions as well as another distal short con 55 Hybrid human brain cDNA Library were screened for inter served region that has been associated with subunit assembly, action with the DB-Q2C wt bait. Among 1039 positive AD at least in KCNQ1 (Jentsch, 2000; Schmitt et al., 2000). cDNAS recovered, re-tested and Subsequently sequenced all A)Yeast-two Hybrid Analysis were identified as the CALM2 gene, encoding the ubiquitous, A yeast two-hybrid screen was carried out using the pro Cat-binding protein, Calmodulin (CaM). QuestTM Two-Hybrid System with GatewayTM Technology 60 The interaction between the C-terminal region of KCNQ2 (InvitrogenTM) according to manufacturer's directions. A and CaM has also been reported by other studies (Wen and KCNQ2 C-terminal entry (BAIT) clone was generated using Levitan, 2002;Yus-Najera et al., 2002; Gamper and Shapiro, the pENTR Directional TOPOR) Cloning Kit (InvitrogenTM) 2003). In mammals, the CaM protein is coded by a multigene The following primers were designed to amplify the intrac family consisting of three bona fide members, CALM1, ellular C-terminal region of KCNO2 based on the sequence of 65 CALM2 and CALM3. Within the non-coding regions of the human KCNQ2 (Genbank accession number NM 172107): CaM transcripts, no striking homology is observed, and KCNQ2F: 5, CACCAAGGTTCAGGAGCAGCACAGG codon usage is maximally divergent amongst the three CaM US 8,129,142 B2 37 38 mRNAs that encode an identical protein. It has been hypoth In order to better quantify f-gal activity, a second assay esised that the existence of a multigene family provides a tight was carried out using the high sensitivity Substrate Chlo and complex level of regulatory control at the level of gene rophenol Red-B-D-Galactopyranoside (CPRG) in liquid cul expression (Palfi et al., 2002). CaM genes are differentially ture. The affinity of the DB-Q2C/AD-CaM interaction was expressed in the CNS during development and differential measured in terms of units off-gal activity, with a Zero value regulation of the CaM genes appears necessary to maintain indicating no expression of the Lac Z reporter gene, and hence the temporal and spatial fidelity of the CaM protein levels in no interaction. all subcellular domains. Besides the fundamental housekeep In the CPRG assay, a value of 0.05 units f-gal activity ing functions associated with CaM, it is also involved in (FIG.5) was significantly different from the empty bait vector specialized neuronal functions, such as the synthesis and 10 replicate (P<0.01, Students ttest), confirming the interaction of the DB-Q2C wt with CaM. release of neurotransmitters, neurite extension, long-term As observed in the Lacz filter assay, the CPRG assay potentiation and axonal transport (Palfi et al., 2002). showed a significant difference in the interaction between the B) Effect of Epilepsy-associated KCNO2 Mutations on the Q2CR353G mutant and CaM as compared to the wt replicate CaM-KCNQ2 Interaction 15 (P<0.01, Student's t test, FIG. 4). To assess the effect that the C-terminus mutations of the These results suggest that the R353G mutation alters the present invention had on CaM binding, two of the identified structural conformation of the KCNO2 C-terminal domain mutations (R353G and L619R) were introduced into the such that it is no longer able to bind to CaM and that this single DB-Q2C construct by mutagenesis and were re-analysed for point mutation is sufficient to abolish the interaction. By an interaction with CaM using the yeast two-hybrid proce abolishing CaM binding, the R353G mutation could lead to dure. an impairment of M-current in vivo due to decreased opening The following primers were used to incorporate the of the channel. c1057C->G (R353G) and c1856T->G (L619R) changes into In contrast, the CPRG assay for the L619R Q2C mutant the pDESTTM32-KCNQ2 C-terminal bait construct. showed a significantly higher level of 3-gal activity units 25 (0.26 units) than the wt replicate (P<0.001, Student's t test, FIG. 5). This finding indicates that the L619R mutation alters R353G F the conformation of the protein in a manner that increases s' - CGCCACCAACCTCTCGGGCACAGACCTGCACTC-3' CaM binding affinity for the KCNO2C-terminal domain by R353 G. R. approximately 5-fold. The increased affinity for CaM may 5'-GAGTGCAGGTCTGTGCCCGAGAGGTTGGTGGCG-3 30 affect the ability of the complex to change conformation normally in response to calcium signalling. Alternatively, the L619R F marked increase in binding of CaM to the KCNQ2L619R 5 - CTTGTCCATGGAGAAGAAGCGGGACTTCCTGGTGAATATC-3' mutant channel may be detrimental to the M-channel function L619R R via disruption of the normal neuronal inhibitory/excitatory s' - GATATTCACCAGGAAGTCCCGCTTCTTCTCCATGGACAAG-3' 35 balance, therefore causing the seizures associated with epi lepsy, particularly BFNS. CaM is known to be involved in Overlapping PCR products were generated using the both the excitatory and inhibitory neurotransmission path ToPOR cloning compatible KCNO2F primer from the initial ways (Ohya and Botstein, 1994) and it has been proposed that cloning and the mutagenesis reverse primers, and the the temporal and spatial restrictions on CaM itself could KCNQ2R primer from the initial cloning with the mutagen 40 enable the tight control of these opposing reactions (Touten esis forward primers. Products were gel extracted and puri hoofd and Strehler, 2000). Hence, the KCNQ2L619R muta fied before a second round of PCR using the initial KCNO2 tion could lead to a disruption of the local CaM pool conse F&R primers. These products were also gel extracted before quently disturbing the finely balanced excitatory and cloning into the pDESTTM32 bait vector via the TOPOR) inhibitory neurotransmission systems. system (as described above). Mutant baits were sequence 45 These results implicate CaM in the pathogenesis of epi verified. lepsy and specifically in the BFNS syndrome. Whilst further The interaction between each DB-Q2C mutant and CaM work will be required to fully elucidate the involvement of the was then tested by the yeast two-hybrid assay and compared KCNQ2-CaM interaction in neuronal excitability and its cor to the interaction with DB-Q2 wt. Three different PCR-am relation with idiopathic epilepsy, these data Suggest that dys plified CaM positive clones from the initial screen were re 50 function of this interaction leads to aberrant neuronal excit introduced by gap-repair' into the prey vector (ppC86) in the ability in some BFNS patients. yeast strain expressing either DB-Q2C wit, DB-Q2C mutants The calmodulin gene (and other ion channel interacting or the empty DBLeu Vector, used as negative control. genes) may therefore be a target for mutation in epilepsy as CaM interaction with the DB-Q2C wt and mutants was well as other disorders associated with ion channel dysfunc then assessed by expression of the HIS3 and Lacz reporter 55 tion. A mutation in an ion channel interacting gene when genes. expressed alone, or when expressed in combination with one The Q2CR353G mutant did not interact with CaM, as seen or more other ion channel mutations or ion channel interact by no growth on HIS3 selective plate (FIG. 4C) and no blue ing gene mutations (based on the digenic model), may give readout in the Lac Z filter assay (seen as dark Squares in FIG. rise to the disorder. The nature of the ion channel interacting 4D-F). On the other hand, the DB-Q2C L619R mutant was 60 genes and proteins can be studied such that these partners can shown to still interact with CaM, as seen by growth on HIS3 also be targets for drug discovery. selective plate (FIG. 4C) and the blue readout in the Lacz filter assay. Interestingly, the DB-Q2C L6.19R mutant INDUSTRIAL APPLICABILITY showed an even greater growth level on HIS3 selective plate than the DB-Q2C wt and also appeared to stain faster and 65 The mutant ion channel receptor subunits of the invention more intensely blue in the Lacz filter assay, Suggesting a are useful in the diagnosis and treatment of diseases Such as stronger interaction between CaM and this mutant. epilepsy and disorders associated with ion channel dysfunc US 8,129,142 B2 39 40 tion including, but not limited to, hyper- or hypo-kalemic toms, neuropathic pain, inflammatory pain, chronic/acute periodic paralysis, myotonias, malignant hyperthermia, pain, Bartter's syndrome, polycystic kidney disease, Dent's myasthenia, cardiac arrhythmias, episodic ataxia, migraine, disease, hyperinsulinemic hypoglycemia of infancy, cystic Alzheimer's disease, Parkinson's disease, Schizophrenia, fibrosis, congenital stationary night blindness and total hyperekplexia, anxiety, depression, phobic obsessive symp colour-blindness. TABLE 1 Examples of mutations and variations identified in ion channel subunit genes SEQ ID Subunit Gene Exon Intron DNA Mutation Amino Acid Change NOS Sodium Channel Subunits Coding exonic variants - amino acid change

SCN1A Exon 5 SCN1A Exon 8 SCN1A Exon 9 SCN1A Exon 9 SCN1A Exon 9 SCN1A Exon 9 SCN1A Exon 21 SCN1A Exon 26 SCN1A Exon 26 SCN1B Exon 3 SCN2A Exon 6A SCN2A Exon 16 SCN2A Exon 17 SCN2A Exon 19 SCN2A Exon 20 Coding exonic variants - no amino acid change

Exon 12 c1785T-C Exon 27 c4919T->A Non-coding variants

intron 9 18 intron 23 19 intron 7 2O intron 19 21 intron 22 22 intron 2 23 intron 8 24 intron 11 25 intron 11 26 intron 17 27 intron 17 28 intron 17 29 Nicotinic Acetylcholine Receptor Subunits Coding exonic variants - amino acid change CHRNAS Exon 4 30, 88 CHRNA2 Exon 4 31, 89 CHRNA3 Exon 2 32, 90 Coding variants - no amino acid change

CHRNA2 Exon 4 33 CHRNA2 Exon 5 34 CHRNA3 Exon 2 35 CHRNA3 Exon 4 36 CHRNA3 Exon 4 c345G->A 37 Non-coding variants

CHRNA2 intron 3 IVS3-16C-T 38 CHRNA3 intron 3 39 CHRNA3 intron 4 IVS4-8G->C 40 Potassium Channel Subunits Coding exonic variants - amino acid change Exon 1 41,91 Exon 1 42 Exon 1 43 Exon 8 44,92 Exon 11 45, 93 Exon 14 46,94 Exon 15 47, 95 Non-coding variants

intron 9 48 intron 11 49 US 8,129,142 B2 41 42 TABLE 1-continued Examples of mutations and variations identified in ion channel Subunit genes SEQID Subunit Gene Exon Intron DNA Mutation Amino Acid Change NOS KCNQ3° Intron 12 IVS12-29G->A 50 GABA Receptor Subunits Coding exonic variants - no amino acid change

GABRB1 Exon 5 cSO8C-T 51 GABRB1 Exon 9 c1329G->A 52 GABRB1 Exon 8 cQ7SC-eT 53 GABRG3 Exon 8 cQ9ST-C S4 Non-coding variants

GABRA1 5' UTR c-142A->G 55 GABRA1 5' UTR c-3 1C->T 56 GABRA2 3' UTR c1615G->A 57 GABRAS 5' UTR c-271G->C 58 GABRAS 5' UTR c-228A->G 59 GABRAS 5' UTR c-149G->C 60 GABRB2 5' UTR c-159C-T 61 GABRB2 3' UTR c1749C-T 62 GABRP 5' UTR c-101C->T 63 GABRB1 Intron 1 IVS1-24T-sG 64 GABRB1 Intron 5 IVS6-72T-sG 65 GABRB1 Intron 7 IVSA-34A-sG 66 GABRB3 Intron 1 IVS1-14C-T 67 GABRB3 Intron 7 IVS7+58delAA 68 GABRD Intron 6 IVS6+132insC 69 GABRD Intron 6 IVS6+130insC 70 GABRD Intron 6 IVS6+73del 71 CGCGCCCACCGCCCCTTCCGCG GABRG3 Intron 8 IVS8-102C-T 72

Note: Mutations or variations only occurring in individuals with epilepsy; Variant seen only in normal control samples; Mutations or variants seen in individuals with epilepsy as well as normal control samples. The KCNQ2 numbering is based on the large isoform (inclusion of exon 10a). The numbering of exons and introns for SCN2A is based on the publication of Kasai et al., 2001,

REFERENCES Commission on Classification and Terminology of the Inter national League against Epilepsy. (1989). Epilepsia 30: References cited herein are listed on the following pages, 389-399. and are incorporated herein by this reference. Cote, R.J. Morrissey, D M. Houghton, A N. Beattie, E J Jr. 40 Oettgen, H F. and Old, L.J. (1983). Proc. Natl. Acad. Sci. Andermann, E. (1982). In: Genetic basis of the epilepsies. USA 80: 2026-2O3O. Anderson, V. E. Hauser, WA. Penry, J. K. and Singh, C F. Doose, H. and Baier, W. K. (1987). Neuropediatrics 18 (Editors). New York, Raven Press. 355-374. (Supplement 1): 1-64. Annegers, J. F. (1996). The treatment of epilepsy. Principles Doose, H. and Baier, W. (1989). Clev: Clin. J. Med. 56 and practice. Second Edition. (Wyllie E (Ed) Williams and 45 (Supplement): 5105-s110. Wilkins). Dworakowska, B. and Dolowy, K. (2000). Acta Biochim. Pol. Bell, J. I. and Lathrop, M. (1996). Nature Genet. 13:377-378. 47: 685-703. Berkovic, S F. Andermann, F. Andermann, E. and Gloor, P. Escayg, A. MacDonald, BT. Meisler, M. H. Baulac, S. Huber (1987). Neurology 37: 993-1000. feld, G. An-Gourfinkel, I. Brice, A. LeGuern, E. Moulard, Berkovic, SF. Reutens, DC. Andermann, E. and Andermann, 50 B. Chaigne, D. Buresi, C. and Malafosse, A. (2000). Nature F. (1994). In: Epileptic seizures and syndromes. Wolf, P. Genet. 24: 343-345. (Editor). London: John Libbey. 25-37. Fong, G. C. Shah, PU. Gee, MN. Serratosa, JM. Castroviejo, Berkovic, S F. Mazarib, A. Neufeld, M. et al. (2000). Neurol I P. Khan, S. Ravat, S. H. Mani, J. Huang, Y. Zhao, H Z. ogy (Supplement 3). 54: A356. Medina, MT. Treiman, L. J. Pineda, G. and Delgado-Es 55 cueta, A.V. (1998). Am. J. Hum. Genet. 63: 1117-1129. Biervert, C. Schroeder, BC. Kubisch, C. Berkovic, SF. Prop Gamper, N. and Shapiro, MS. (2003). J. Gen. Physiol. 122: ping, P. Jentsch, T.J. and Steinlein, O K. (1998). Science 17-31. 279: 403-406. Gardiner, M. (2000). J. Neurol. 247: 327-334. Breaker, RR. and Joyce, G F. (1995). Chem. Biol. 2: 655-600. Goldman, CK. Soroceanu, L. Smith, N. Gillespie, GY. Shaw, CavaZZuti, G. B. Capella, L. and Nalin, A. (1980). Epilepsia 60 W. Burgess, S. Bilbao, G. and Curiel, DT. (1997). Nature 21: 43-55. Biotechnology 15: 462-466. Charlier, C. Singh, NA. Ryan, S.G. Lewis, T B. Reus, B E. Gonzalez, J. E. et al. (1999). Drug. Discov. Today 4: 431-439. Leach, R.J. and Leppert, M. (1998). Nature Genet. 18: Greenberg, D A. Delagado-Escueta, AV. Maldonado, H M. 53-55. and Widellitz, H. (1988a). Genet Epidem. 5: 81-94. Cole, SP. Campling, B G. Atlaw, T. Kozbor, D. and Roder, J 65 Greenberg, D.A. Delgado-Escueta, AV. Widelitz, H. Sparkes, C. (1984). Mol. Cell. Biochem, 62: 109-120. R. S. Treiman, L. Maldonado, H M. Park, M. S. and Collins, F S. (1995). Nature Genet. 9: 347-350. Terasaki, P.I. (1988b). Am. J. Med. Genet. 31:185-192. US 8,129,142 B2 43 44 Greenberg, D A. Durner, M. and Delgado-Escueta, A V. Scheffer, I E. and Berkovic, S F. (1997). Brain 120: 479-90. (1992). Neurology 42 (Suppl 5): 56-62. Schena, M. Shalon, D. Heller, R. Chai, A. Brown, P.O. and Hamill, O P. et al. (1981). Pflugers Arch. 391: 85-100. Davis, R.W. (1996). Proc. Natl. Acad. Sci. USA 93: 10614 Haseloff, J. and Gerlach, W L. (1988). Nature 334:585-591. 10619. Hauser, WA. Annegers, J. F. and Kurland, L. T. (1993). Epi 5 Schmitt, N. Schwarz, M. Peretz, A. Abitbol, I. Attali, B. and lepsia 34: 453-468. Pongs, O. (2000). Embo J. 19:332-340. Heller, R A. Schena, M. Chai, A. Shalon, D. Bedilion, T. Schwake, M. Pusch, M. Kharkovets, T. and Jentsch, T J. Gilmore, J. Woolley, D. E. and Davis R. W. (1997). Proc. (2000). J. Biol. Chem. 275: 13343-13348. Natl. Acad. Sci. USA 94: 2150-2155. Schwenk, F. Baron, U. and Rajewsky, K. (1995). Nucleic Huse, W. D. Sastry, L. Iverson, S.A. Kang, A.S. Alting-Mees, 10 Acids Res. 23: 5080-5081. M. Burton, D. R. Benkovic, S.J. and Lerner, RA. (1989). Singh, NA. Charlie, C. Stauffer, D. DuPont, B R. Leach, R.J. Science 246: 1275-1281. Melis, R. Ronen, G. M. Bjerre, I. Quattlebaum, T. Murphy, Italian League Against Epilepsy Genetic Collaborative J. V. McHarg, M. L. Gagnon, D. Rosales, T O. Peiffer, A. Group. (1993). Epilepsia 34: 819-26. Anderson, V. E. and Leppert, M. (1998). Nature Genet. 18: Janz, D. Beck-Mannagetta, G. and Sander, T. (1992). Neurol 15 25-29. ogy 42 (Suppl 5): 48-55. Singh, R. Scheffer, I E. Crossland, K. and Berkovic, S F. Jentsch, T.J. (2000). Nature Rev. Neurosci. 1: 21-29. (1999). Ann. Neurol. 45: 75-81. Kasai, N. Fukushima, K. Ueki, Y. Prasad, S. Nosakowski, J. Steinlein, O K. Mulley, J. C. Propping, P. Wallace, R. H. Sugata, K. Sugata, A. Nishizaki, K. Meyer, NC. and Smith, Phillips, HA. Sutherland, G R. Scheffer, I E. and Berkovic, R.J. (2001). Gene 264: 113-122. S F. (1995). Nature Genet. 11: 201-203. Kohler, G. and Milstein, C. (1975). Nature 256: 495-497. Todd, J.A. (1999). Lancet 354 (Supplement 1): 15-16. Kozbor, D. Abramow-Newerly, W. Tripputi, P. Cole, S P. Toutenhoofd, SL. and Strehler, E. E. (2000). Cell Calcium 28: Weibel, J. Roder, J.C. and Croce, CM. (1985). J. Immunol. 83-96. Methods 81:31-42. Wallace, RH. Marini, C. Petrou, S. Harkin, L.A. Bowser, DN. Lernmark, A. and Ott, J. (1998). Nature Genet. 19: 213-214. 25 Panchal, R.G. Williams, D.A. Sutherland, G R. Mulley, J.C. Ohya, Y. and Botstein: D. (1994). Science 263:963-966. Scheffer, I E. and Berkovic, SF. (2001a). Nature Genet. 28: Okubo, Y. Matsuura, M. Asai, T. Asai, K. Kato, M. Kojima, T. 49-52. and Toru, M. (1994). Epilepsia 35: 832-841. Wallace, RH. Scheffer, I E. Barnett, S. Richards, M. Dibbens, Orlandi, R. Gussow, D H. Jones, PT. and Winter, G. (1989). L. Desai, R. R. Lerman-Sagie, T. Lev, D. Mazarib, A. Proc. Natl. Acad. Sci. USA 86: 3833-3837. 30 Brand, N. Ben-Zeev, B. Goikhman, I. Singh, R. Kremmidi Palfi, A. Kortvely, E. Fekete. E. Kovacs, B. Varszegi, S. and otis, G. Gardner, A. Sutherland, G R. George, A L Jr. Gulya, K. (2002). Life Sciences 70: 2829-2855. Mulley, J. C. and Berkovic, S F. (2001b). Am. J. Hum. Panayiotopoulos, CP, and Obeid, T. (1989). Ann. Neurol. 25: Genet. 68: 859-865. 440-443. Wallace, R H. Wang, D.W. Singh, R. Scheffer, I. George, A. Phillips, HA. Favre, I. Kirkpatrick, M. Zuberi, S.M. Goudie, 35 Phillips, H. Saar, K. Reis, A. Johnson, E. Sutherland, G. D. Heron, S. E. Scheffer, I E. Sutherland, G R. Berkovic, S Berkovic, S, and Mulley, J. (1998). Nature Genet. 19: F. Bertrand, D. and Mulley, J.C. (2001). Am. J. Hum. Genet. 366-370. 68: 225-231. Wen, H. and Levitan, I B. (2002).J. Neurosci. 22:7991-8001. Reutens, D C. and Berkovic, S F. (1995). Neurology 45: Winter, G. and Milstein, C. (1991). Nature 349: 293–299. 1469-1476. 40 Wyman, AR. and White, R. (1980). Proc. Natl. Acad. Sci. 77: Rickert, RC. Roes, J. and Rajewsky, K. (1997). Nucleic Acids 6754-6758. ReS. 25: 1317-1318. Yus-Najera, E. Santana-Castro, I. and Villarroel, A. (2002).J. Risch, N. and Botstein, D. (1996). Nature Genet. 12: 351 Biol. Chen. 277: 28545-28553. 353. Zara, F. Bianchi, A. Avanzini, G. DiDonato, S. Castellotti, B. Roger, J. Bureau, M. Dravet, C. Dreifuss, FE. Perret, A. and 45 Patel, P.I. and Pandolfo, M. (1995). Hum. Mol. Genet. 4: Wolf, P. (1992). Epileptic syndromes in infancy, childhood 1201-12O7. and adolescence. 2nd Edition. London, John Libbey. Zara, F. Gennaro, E. Stabile, M. Carbone, I. Malacarne, M. Scharf. K D. Materna, T. Treuter, E. and Nover, L. (1994). Majello, L. Santangelo, R. de Falco, F.A. and Bricarelli, F Results Probl. Cell Differ. 20:125-162. D. (2000). Am. J. Hum. Genet. 66: 1552-1557.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 97

<21 Oc SEO ID NO 1 <211 LENGTH; 83.81 <212> TYPE: DNA ORGANISM: Homo sapiens

<4 OOs SEQUENCE: 1

at actgcaga ggtct Ctggit gcatgtgttgt atgtgtgcgt ttgttgttgttgt ttgttgttgtct 60

gtgtgttctg ccc.ca.gtgag actgcago cc ttgtaaatac tittgacacct tttgcaagaa 12O

ggaatctgaa caattgcaac taaggcaca ttgttat cat ct cqtctttg ggtgatgctg 18O

US 8,129,142 B2 151 152 - Continued <4 OOs, SEQUENCE: 21 taggcacctg. atalaga.gctt gcatcgtttc cittittittaag aaatcgt caa ttagagactg 6 O tittctgat ca taaaatttaa tagaatttitt tgact tacag gcc tittgaag atatatacat 12 O tgagcagcga aaalaccatta agaccatgtt agaatatgct gacaaggttt to acttacat 18O att cattctg gaaatgctgc taaagtgggit tgcatatggit tttcaagtgt attittaccala 24 O tgcctggtgc tiggctagact tcc tigattgt tgat 274

<210s, SEQ ID NO 22 &211s LENGTH: 154 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 22 gtattgaata catgtcaaat agaattittga t caattatt c aatttattitt ctaaaattat 6 O aattittgggg aaaaagaaaa tatatgact titt Cttacag gcc acgttta agggatggat 12 O ggat attatg tatgcagotg ttgatt cacg aaat 154

<210s, SEQ ID NO 23 &211s LENGTH: 219 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 23 ttacagggca at atttataa ataatggttt tacttitt Ctc. ttaaaatatt Cittaatatat 6 O attctaagtt ttattt tatg tgttgttgttt totttitt cag acgtttatag tattgaataa 12 O agggaaag.ca at Ctct cat t cagtgccac c cctd.ccctt tacattittaa citc ccttcaa 18O c cct attaga aaattagcta ttaagattitt ggtacattc 219

<210s, SEQ ID NO 24 &211s LENGTH: 242 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 24 gtgcctgt at aaaacagaca ttggcatata ttaaaac agg aaaac caatt agcagacittg 6 O ccgittattga citt cotttct t to ct citaac ctaattacag ccagtgtcct gaaggataca 12 O tctgttgttgaa ggctgg taga aac Cocaact atggctacac gagctittgac acctittagtt 18O gggc citttitt gtcct tattt cgt.ct catga citcaagacitt ctdggaaaac ctittatcaac 24 O tg 242

<210s, SEQ ID NO 25 &211s LENGTH: 388 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 25 gcggcagctg cagcc.gcatc tgctgaatca agagact tca gtggtgctgg togatagga 6 O gttttitt cag agagttctitc agtag catct aagttgagct C caaaagtga aaaagagctg 12 O aaaaac agaa gaaagaaaaa gaalacagaaa gaacagt ctg gagaagaaga gaaaaatgac 18O agagtic ctaa aatcggaatc tgaagacagc ataagaagaa aaggttt cog tttitt cottg 24 O gaaggaagta ggctgacata tgaaaagaga ttittcttctic cacaccaggit aaaaat atta 3OO aattacatga attgttgttct Catalaattitt ttaaaagaat atgcc agaat ttaatggaga 360