Page 1 of 59 Diabetes
Adipocyte Metrnl antagonizes insulin resistance through PPARγ signaling
Zhi Yong Li1, Jie Song1, Si Li Zheng1, Mao Bing Fan1, Yun Feng Guan1, Yi Qu1, Jian Xu2,
Pei Wang1 and Chao Yu Miao1
1Department of Pharmacology, Second Military Medical University, 325 Guo He Road,
Shanghai 200433, China
2Department of Laboratory Diagnosis, Changhai Hospital, Second Military Medical
University, 174 Chang Hai Road, Shanghai 200433, China
Corresponding author: Chao Yu Miao, [email protected]
Z. Y.L. and J.S. contributed equally to this work.
Running Title: Fat derived Metrnl controls insulin sensitivity
1
Diabetes Publish Ahead of Print, published online August 25, 2015 Diabetes Page 2 of 59
ABSTRACT
Adipokines play important roles in metabolic homeostasis and disease. We have recently identified a novel adipokine Metrnl, also known as Subfatin for its high expression in subcutaneous fat. Here, we demonstrate a pro differentiation action of Metrnl in white adipocytes. Adipocyte specific knockout of Metrnl exacerbates insulin resistance induced by high fat diet, while adipocyte specific transgenic overexpression of Metrnl prevents insulin resistance induced by high fat diet or leptin deletion. Body weight and adipose content are not changed by adipocyte Metrnl. Consistently, no correlation is found between serum Metrnl level and body mass index in humans. Metrnl promotes white adipocyte differentiation, expandability, lipid metabolism and inhibits adipose inflammation to form functional fat, which contributes to its activity against insulin resistance. The insulin sensitization of Metrnl is blocked by PPARγ inhibitors or knockdown. However, Metrnl does not drive white adipose browning. Acute intravenous injection of recombinant Metrnl has no hypoglycemic effect, and one week intravenous administration of Metrnl is unable to rescue insulin resistance exacerbated by adipocyte Metrnl deficiency. Our results suggest adipocyte Metrnl controls insulin sensitivity at least via its local autocrine/paracrine action through PPARγ pathway. Adipocyte Metrnl is an inherent insulin sensitizer and may become a therapeutic target for insulin resistance.
2
Page 3 of 59 Diabetes
Insulin resistance is a common feature of morbid obesity and a critical risk factor for
metabolic syndrome, type 2 diabetes and cardiovascular diseases (1 4). New
insulin sensitizing therapies are needed (1,3). Adipose tissue releases various adipokines
for metabolic homeostasis and disease (3,5). Both brown adipose tissue and subcutaneous
white adipose tissue appear metabolically protective (1,4 8). To discover potential
beneficial adipokines, we have screened secretory proteins from either brown fat or
subcutaneous white fat (9). Most of our previous studies are focused on the function and
molecular mechanism of Visfatin which is highly expressed in brown fat, and we
demonstrate this protein acting via Nampt enzyme activity in fat and other tissues (10 13).
Recently, we have identified a novel adipokine Metrnl, also known as Subfatin (9) and
Cometin (14), whose expression is abundant in subcutaneous white fat and relatively low in
brown fat (9). The function of Metrnl is largely unknown, due to very limited studies on
this protein (9,14 16) and only two of them investigating the function of this protein
(14,15).
Metrnl is undetected (14) or low (9) expression in the adult brain, but it is expressed in
the restricted sites of the brain during development and may act as a neurotrophic factor to
promote neurite outgrowth (14). Our previous data show that Metrnl is a secreted protein,
highly expressed in rat, mouse and human subcutaneous white adipose tissue, and easily
detected in the incubation medium of white adipose tissue (9), suggesting a role of Metrnl
in white adipose biology and metabolic homeostasis. We thus generated both
adipocyte specific knockout and overexpression mice to explore the function of Metrnl.
3
Diabetes Page 4 of 59
Very recently, a progress has been made for Metrnl function on metabolism by the
Spiegelman laboratory (15). The study showed that Metrnl expression was upregulated in white adipose tissue upon acute cold exposure at 4°C and in muscle following an acute bout of concurrent exercise or forced overexpression of PGC1α4. Increasing circulating levels of Metrnl induced browning of white adipose tissue via eosinophils dependent increase of IL4 expression and M2 macrophage activation. However, this action chain only lasted for less than a week after either intravenous injection or adipose local injection of adenoviral vectors encoding Metrnl (15). The chronic effect of adipose Metrnl on metabolism and its mechanism are still unclear.
In this study, we demonstrate that Metrnl promotes differentiation of white adipocytes in vitro. Through creating conditional knockout and transgenic overexpression mice, we show that adipocyte Metrnl is an insulin sensitizing factor in vivo. Furthermore, we show that the insulin sensitization of Metrnl is attributed to improvement of adipose dysfunction and mediated by PPARγ pathway.
4
Page 5 of 59 Diabetes
RESEARCH DESIGN AND METHODS
Generation of adipocyte specific Metrnl knockout mice (Metrnl / ). A targeting vector
was constructed by inserting LoxP sites flanking exon 3 and coding region of exon 4 of
Metrnl gene with a neomycin cassette flanked by FRT sites (Supplementary Fig. 1A). After
homologous recombination in C57BL/6 derived ES cells and selection with neomycin,
positive surviving clones were identified with Southern blot and used for generating
chimeras, which were backcrossed with C57BL/6 mice to generate MetrnlloxP neo/wt in
Ozgene Pty. Ltd. (Australia). MetrnlloxP neo/wt mice were verified with Southern blot and
polymerase chain reaction (PCR) using primers in Supplementary Table 1 (Supplementary
Fig. 1B and C). Fabp4 Cre mice [B6.Cg Tg(Fabp4 cre)1Rev/J; JAX Stock No. 005069]
were used to generate adipocyte specific Metrnl knockout mice. The breeding strategy for
Metrnl / was provided in Supplementary Fig. 1D G. Littermate Cre negative MetrnlloxP/loxP
mice were used as control, similar to previous studies (8). All animal experiments were
performed in accordance with the National Institute of Health Guide for the Care and Use
of Laboratory Animals and approved by the animal ethical committee of the Second
Military Medical University.
Generation of trangenic mice with adipocyte specific overexpression of Metrnl
(Metrnl Tg). The cDNA of mouse Metrnl tagged with his6 was subcloned into Not I site of
a plasmid that contains 5.4 kb promoter/enhancer of the Fabp4 (Addgene). Transgenic
mice expressing Metrnl-his6 gene were obtained by microinjection of fertilized eggs from
C57BL/6J mice at Shanghai Research Center for Model Organisms (China). These
5
Diabetes Page 6 of 59
transgenic mice were backcrossed to C57BL/6J mice for 4 to 6 generations before being used for experiments. Littermate wild type mice were used as control.
Generation of adipocyte specific overexpression of Metrnl in leptin knockout mice
(Leptin / Metrnl Tg). Heterozygous leptin knockout mice (Leptin+/ ) were purchased from
Shanghai Research Center for Model Organisms (China) and crossed with Metrnl Tg to obtain Leptin+/ Metrnl Tg which were further crossed with Leptin+/ to generate
Leptin / Metrnl Tg mice (Supplementary Fig. 3B). Littermate leptin / mice were used as control.
Human subjects. Human serum samples were collected from a group of males undergoing a physical examination. The written informed consents were obtained from all subjects and the research was approved by the medical ethical committee of the Second Military
Medical University. The basic clinical data of these subjects were described in
Supplementary Table 2.
Animal feeding and energy expenditure measurements. Male mice were used for the study. Animals were housed under controlled temperature (23–25°C) and lighting (12 h light dark cycle) with free access to tap water and standard chow (Sino–British SIPPR/BK
Lab Animal Ltd.) or high fat diet (HFD) containing about 60% of calories from lipids
(D12492; Research Diets). Energy expenditure and respiratory exchange ratio of mice were measured by indirect calorimetry using an Oxymax system (TSE system). Briefly, mice
6
Page 7 of 59 Diabetes
were housed in individual chambers. CO2 and O2 levels were detected every 21 minutes for
a period of 3 days after 2 days of acclimation.
Animal treatment. Metrnl Tg and wild type mice were fed HFD or HFD with PPARγ
inhibitor (GW9662, 8 mg/kg/day) (Sigma) for 16 weeks. Otherwise, Metrnl Tg and
wild type mice were fed HFD for 16 weeks, and subsequently administered with another
PPARγ inhibitor (bisphenol A diglycidyl ether, BADGE, 30 mg/kg/day) (17) (Sigma) or
vehicle via intraperitoneal injection for 3 weeks. Then, glucose tolerance test (GTT) and
insulin tolerance test (ITT) were performed to evaluate insulin sensitivity of these mice. To
achieve PPARγ knockdown in vivo, lentivirus containing the scramble or PPARγ shRNA
(18) was administrated to Metrnl Tg and wild type mice fed HFD via intravenous injection
(108 PFU/mouse). GTT was performed 10 days after injection.
For treatment of Metrnl / mice with recombinant Metrnl protein, a catheter was placed
into external jugular vein of the mouse and tunneled subcutaneously and exteriorized
between the scapulae under anesthesia. After two days of recovery, the conscious mouse
was intravenously given with recombinant Metrnl (1.75 g/mouse/day) or vehicle for 7
days.
GTT and ITT. Both GTT and ITT were performed as we described elsewhere (12).
Hyperinsulinemic euglycemic clamp study. Hyperinsulinemic euglycemic clamp studies
were carried out as described elsewhere (19), with some modifications. Briefly, mice were
7
Diabetes Page 8 of 59
anesthetized with sodium pentobarbital (75 mg/kg), and an infusion catheter was inserted into the right jugular vein. Insulin (Novo Nordisk) was given primarily (150 mU/kg) and was administered continuously (150 mU/kg/hour) via intravenous infusion. Blood glucose concentration was monitored every 5 minutes via tail vein bleeding. And the intravenous infusion rate of a 20% glucose solution was adjusted to maintain blood glucose at 5 mmol/L for more than 30 minutes.
Biochemical measurements. Blood glucose was detected with OneTouch UltraSmart
Glucose Meter (Lifescan). Serum triglycerides were measured with a serum triglyceride determination kit (Sigma). Liver triglycerides were extracted by the method of Bligh and
Dyer (20) and measured with the triglyceride determination kit. Total cholesterol, low and high density lipoprotein cholesterol in serum were measured by enzymatic assays using
Hitachi 7600 modular chemistry analyzer with the corresponding reagent (ZhengKang
Biotech). Mouse and human serum Metrnl levels were examined with the corresponding
ELISA kits (R&D Systems or Antibodies Online). Insulin, leptin, adiponectin, TNFα and
IL6 levels were measured by ultra sensitive mouse insulin ELISA kit (Mercodia), mouse leptin and adiponectin ELISA kits (Millipore), mouse TNFα and IL6 ELISA kits (R&D systems), respectively. Lipase activity was measured with lipase activity fluorometric assay kit (Biovision). Malondialdehyde (MDA) was measured with Lipid Peroxidation MDA
Assay Kit (Beyotime Biotechnology), and reactive oxygen species (ROS) was detected with CM H2DCFDA probe (Life Technology).
8
Page 9 of 59 Diabetes
Lipid overload test. Lipid overload test was performed as described elsewhere (21).
Real time PCR, Western blot, flow cytometry, and immunohistochemistry. These
experiments were performed as we described elsewhere (9,11). For real time PCR, RNA
was abstracted with RNeasy Plus Universal Tissue Mini Kit (Qiagen). Primers were
provided in Supplementary Table 4. For Western blot, antibodies for PPARγ (Santa Cruz),
Metrnl (produced by ourselves)(9), AKT, and p AKT(Ser473) (Cell Signaling Technology)
were used at dilution 1:1000. For flow cytometry, adipose tissue was minced and digested
with 0.1% collagenase (Sigma), and filtered through a 100 m cell strainer. After
centrifugation, cell pellet was re suspended in PBS and stained with fluorescent labelled
antibodies (Miltenyi Biotec). For immunohistochemistry, antibody for Metrnl (Sigma) was
used at dilution 1:100.
Cell culture and differentiation induction. Culture and differentiation induction of
3T3 L1 (Shanghai Institutes for Biological Sciences), mouse primary embryonic fibroblasts,
and C3H10T1/2 (ATCC) cells were performed as we described elsewhere (9,22). Culture
medium of CHO cells with or without Metrnl overexpression and Metrnl recombinant
protein (R&D systems) were added into the culture medium when adipocytes were induced
to differentiation.
Lentivirus mediated overexpression and knockdown of Metrnl in cells. To construct
Metrnl short hairpin RNA lentivirus, three targeting sequences were designed, including
9
Diabetes Page 10 of 59
5’ GGGCGCTCATTGTTAACCT 3’, 5’ GCTTCCAGTATGAGCTGATGA 3’, and
5’ CACGCTTTAGTGACTTTCAAA 3’. Only the last target displayed a knockdown efficiency more than 90% (Fig. 1B). To construct Metrnl expressing lentivirus, the coding sequence of Metrnl was obtained from the previously constructed plasmid pCI Metrnl his6
(9), the overexpression of Metrnl was verified with Western blot (Fig. 1C). Cells were infected at an MOI of 20.
Metrnl concentration in the medium of cultured adipose tissue, primary adipocytes and 3T3 L1 adipocytes. For collecting incubation medium of adipose tissue, white adipose tissue was incubated with 4 ml Opti DMEM medium (Life technologies) for 24 hours. Metrnl concentration in the medium was normalized to the weight of adipose tissue.
For collecting culture medium of primary adipocytes, white adipose tissue was digested with 0.1% collagenase (Sigma) for 60 minutes. Undigested tissue was removed by filtration with 400 m nylon mesh. Primary adipocytes were washed and cultured with 4 ml
Opti DMEM medium for 24 hours. Metrnl concentration in the medium was normalized to the total volume of adipocytes. For collecting culture medium of mature 3T3 L1 adipocytes,
3T3 L1 preadipocytes with or without lentivirus mediated Metrnl overexpression were induced to differentiation. Culture medium was changed to Opti DMEM medium and collected 24 hours later. The concentration of Metrnl in the medium was measured with
ELISA kit (R&D Systems).
Oil red O staining. Oil red O staining was performed as we described elsewhere (22).
10
Page 11 of 59 Diabetes
Statistical analysis. All data are expressed as mean ± SEM. Statistical analysis was
performed with Prism 5.0 software (GraphPad Software). All data were tested for normality
applying the Kolmogorov Smirnov test. If normality was given and there were no
significant differences in variance between groups (F test), a two tailed Student t test was
used to evaluate the differences. Otherwise, nonparametric Mann Whitney U test was
applied. P < 0.05 denoted the presence of a statistically significant difference.
11
Diabetes Page 12 of 59
RESULTS
Metrnl promotes differentiation of white adipocytes. We firstly explored the effect of
Metrnl on adipogenesis using cell culture model. Differentiation induction in 3T3 L1 preadipocytes overexpressing or silencing Metrnl demonstrated that Metrnl upregulated adipocyte mature specific markers and promoted lipid accumulation (Fig. 1A C). Besides, overexpression of Metrnl increased the expression of PPARγ in primary mouse embryonic fibroblasts and C3H10T1/2 cells after induced differentiation to adipocytes (Fig. 1D).
Consistent with our previous data (9), Metrnl was detectable in the incubation medium of white adipose tissue (Fig. 1E). Metrnl was also detectable in the culture medium of either primary adipocytes or 3T3 L1 adipocytes. As expected, the medium Metrnl levels were increased in 3T3 L1 adipocytes overexpressing Metrnl. Moreover, PPARγ expression was induced by culture medium from Metrnl overexpressed CHO cells (Fig. 1F) or specifically by Metrnl recombinant protein in a concentration dependent manner (Fig. 1G), indicating the secreted Metrnl can regulate adipocyte differentiation.
Adipocyte specific deficiency of Metrnl exacerbates insulin resistance induced by high fat diet. To understand the in vivo long term effects of Metrnl in adipose biology and metabolic homeostasis, we created conditional knockout mice with adipocyte specific ablation of Metrnl (Metrnl / , i.e. MetrnlloxP/loxPFabp4 Cre; Fig. 2A). Metrnl expression was reduced by 57% in adipose tissue of Metrnl / mice, while Metrnl serum concentration was comparable between Metrnl / and control mice (Fig. 2B).
Under normal chow diet (NCD), Metrnl / mice displayed no changes in body weight,
12
Page 13 of 59 Diabetes
food intake and energy expenditure, compared to control mice (Supplementary Fig. 2A and
B). Blood glucose and serum insulin levels also demonstrated no significant differences
between Metrnl / and control mice during GTT (Supplementary Fig. 2C). Further, the
16 week old mice were exposed to HFD for 2 months. Body weight, food intake, energy
expenditure, lean/fat mass, liver weight, and adipose weight had no significant differences
(Fig. 2C and Supplementary Fig. 2D F), whereas insulin resistance detected by both GTT
(Fig. 2D) and ITT (Fig. 2E) became more severe in Metrnl / mice, indicating local adipose
Metrnl deficiency deteriorates HFD induced insulin resistance. Meanwhile, white
adipocyte size was obviously decreased in Metrnl / mice (Fig. 2F). Metrnl expression was
also decreased in brown adipose tissue (BAT) of Metrnl / mice (Fig. 2B), which did not
significantly affect BAT weight (Supplementary Fig. 2F), BAT gene expressions relating to
lipid metabolism and thermogenesis (Supplementary Fig. 2G), and energy expenditure
(Supplementary Fig. 2B and D).
Adipocyte specific overexpression of Metrnl prevents insulin resistance induced by
HFD or leptin deletion. To further investigate the function of Metrnl in white adipose
biology and insulin sensitivity, transgenic mice with adipocyte specific overexpression of
Metrnl were generated (Fig. 3A). Metrnl Tg mice were verified with PCR and
immunohistochemistry (Fig. 3A and Supplementary Fig. 3A). Metrnl expression was
markedly increased in adipose tissue of Metrnl Tg mice, while Metrnl serum concentration
only demonstrated an upregulation trend (P=0.057) in Metrnl Tg mice (Fig. 3A).
Under NCD, no significant differences of body weight, food intake, and insulin
13
Diabetes Page 14 of 59
sensitivity were observed between Metrnl Tg and wild type mice (Supplementary Fig.
4A C), while mean adipocyte size was slightly increased in Metrnl Tg mice
(Supplementary Fig. 4D). Under HFD, body weight, food intake, lean/fat mass, energy expenditure, and distribution of adipose tissue were not altered in Metrnl Tg mice (Fig. 3B and Supplementary Fig. 4E G). However, insulin resistance induced by HFD was obviously attenuated in all transgenic clones in GTT (Fig. 3C and Supplementary Fig. 4H and I). Metrnl Tg mice also showed more sensitive to insulin than wild type mice did in
ITT (Fig. 3D). The insulin sensitization of Metrnl was further verified by a significant increase in glucose infusion rate during hyperinsulinemic euglycemic clamps study in
Metrnl Tg mice (Fig. 3E). Meantime, white adipocyte size was significantly increased in
Metrnl Tg mice fed HFD (Fig. 3F). In addition, acute intravenous injection with recombinant Metrnl did not lower blood glucose in HFD fed mice (Fig. 3G), in contrast to chronic hypoglycemic effect in Metrnl Tg mice.
To verify that Metrnl can prevent not only HFD induced but also hyperphagia induced insulin resistance, we further prepared a genetic model with adipocyte specific overexpression of Metrnl in leptin / obese mice (Leptin / Metrnl Tg). Body weight was still unchanged (Fig. 3H), whereas insulin resistance was markedly improved in Leptin / Metrnl
Tg compared with leptin / mice (Fig. 3I). Similarly, intravenous injection of recombinant
Metrnl had no acute hypoglycemic effect in leptin / mice (Fig. 3J).
To further know the relationship between serum Metrnl and body mass index in humans, we performed an investigation in 87 human subjects undergoing a physical examination.
Metrnl serum concentration was measurable, and no correlation was found between Metrnl
14
Page 15 of 59 Diabetes
serum concentration and body mass index (Fig. 3K). Serum Metrnl levels were also not
correlated with serum glucose, total cholesterol, or triglyceride levels (Supplementary
Table 3).
Adipocyte Metrnl enhances insulin stimulated phosphorylation of AKT in white
adipose tissue. The insulin signaling pathway was assessed by analysis of insulin induced
phosphorylation of AKT at Ser473 in white fat, brown fat, muscle, and liver.
Insulin stimulated phosphorylation of AKT in white adipose tissue was significantly
increased in Metrnl Tg mice and decreased in Metrnl / mice. However, no alterations were
observed in other examined tissues in either Metrnl / or Metrnl Tg mice (Fig. 4).
The insulin sensitization of Metrnl is attributed to improvement of adipose
dysfunction and blocked by inhibition or knockdown of PPARγ. Adipokines and
inflammation play crucial roles in obesity associated local and systemic insulin resistance
(5,23). Serum adiponectin and leptin were unchanged in Metrnl knockout and transgenic
mice (Supplementary Fig. 5). TNFα expression in adipose tissue significantly increased in
Metrnl / mice and decreased in Metrnl Tg mice under HFD, while IL6 had no alterations
(Fig. 5A and B). Expressions of anti inflammatory factors IL4, IL10 and IL13 in adipose
tissue were not significantly changed in Metrnl Tg mice under HFD (Fig. 5C-E). Further,
different concentrations of lipopolysaccharide (LPS) were injected intraperitoneally. The
elevated TNFα serum concentrations were similar between Metrnl Tg and wild type mice
under LPS stimulations (Fig. 5F). Hence, Metrnl inhibits chronic HFD induced, but not
15
Diabetes Page 16 of 59
acute LPS induced inflammation.
Considering lipid overload induces insulin resistance (1,24) and adipose tissue can buffer lipid flux (25), we wonder the effect of Metrnl on lipid metabolism. For blood lipid profiles, Metrnl attenuated HFD induced hypertriglyceridemia (Fig. 5G), but not hypercholesterolemia (Supplementary Fig. 6A). Accumulation of liver triglyceride was not significantly changed in Metrnl / mice under HFD (Fig. 5H). During acute lipid overload test, overexpression of Metrnl enhanced serum triglyceride clearance (Fig. 5I). Blood triglyceride is degraded by lipase (26). The activity of lipase was elevated in adipose tissue of Metrnl Tg mice, but not in muscle (Fig. 5J). Lipoprotein lipase was significantly increased in adipose tissue of Metrnl Tg mice (Supplementary Fig. 6B).
Oxidative stress plays a role in regulation of insulin sensitivity (27). Malondialdehyde
(MDA), a primary biomarker of free radical mediated lipid damage and oxidative stress, in adipose tissue, liver, and muscle was not significantly changed in either Metrnl / or Metrnl
Tg mice fed HFD (Supplementary Fig. 7). Consistently, ROS was also not altered in
3T3 L1 adipocytes either overexpressing or silencing Metrnl.
Adipocyte differentiation is a key factor in forming functional fat for insulin sensitivity and lipid metabolism (7,28,29). Gene markers relating to adipocyte differentiation and lipid metabolism were detected in both Metrnl knockout and transgenic mice (Fig. 5K and L), showing that Metrnl upregulated key transcription factors for adipocyte differentiation
(PPARγ, C/EBPα) and lipid metabolism genes for lipid transport (FABP4, CD36), lipogenesis (ACC, FASN), lipolysis (Lipe, PNPLA), and lipid storage (Perilipin).
PPARγ is the master regulator of adipocyte differentiation, lipid metabolism and
16
Page 17 of 59 Diabetes
adipose inflammation in forming functional fat (7,30,31), and PPARγ activation in
adipocytes is sufficient for systemic insulin sensitization (32). In addition to mRNA level,
PPARγ protein was increased markedly in adipose tissue of Metrnl Tg mice (Fig. 5L).
Hence, we speculate that PPARγ plays a critical role in Metrnl mediated beneficial effects.
Consistent with this speculation, PPARγ inhibition by long term treatment with either of
small molecule inhibitors, GW9662 and BADGE (17), completely abolished the
insulin sensitizing effect of Metrnl in HFD fed Metrnl Tg mice (Fig. 6). In addition,
knockdown of PPARγ via lentivirus mediated shRNA interference abolished the
Metrnl induced upregulation of adipose marker genes in 3T3 L1 adipocytes (Fig. 7A F)
and canceled the Metrnl improved glucose tolerance in GTT (Fig. 7G and H).
There exists no white adipose browning in adipocyte specific Metrnl knockout and
transgenic overexpression mice. It has been reported that Metrnl can induce white
adipose browning through eosinophils mediated increase of IL4 expression and activation
of M2 macrophages in white adipose tissue in a short period (15). We thus used inguinal
subcutaneous white adipose tissue to verify whether this mechanism is involved in the
chronic beneficial effects of Metrnl in our models. No significant differences were
observed for gene expression of anti inflammatory factors (IL4, IL10 and IL13),
thermogenesis associated genes (UCP1, PGC1α, Dio2 and ERRα), eosinophil and M2
macrophage markers (Siglec F, Ccr3, Mrc 1, Clec10a and Retnla) in both Metrnl / and
Metrnl Tg models compared to their corresponding controls, under either NCD or HFD. No
significant changes were found for eosinophils and M2 macrophages in Metrnl Tg mice fed
17
Diabetes Page 18 of 59
either NCD or HFD (Fig. 8A F and Supplementary Fig. 8). Moreover, thermogenesis associated genes, anti inflammatory factors, and activation of M2 macrophages displayed no differences between Metrnl Tg and wild type mice after a
72 hour cold challenge (Supplementary Fig. 9).
Intravenous administration of recombinant Metrnl for one week is unable to reverse insulin resistance in adipocyte specific Metrnl knockout mice. We used C57 mice to study pharmacokinetics of Metrnl after single injection of recombinant Metrnl (1.75
g/mouse) via a venous catheter in conscious mice (Fig. 8G). Serum Metrnl dramatically increased at 15 minutes (226 ng/ml), then rapidly decreased within 4 hours (8 ng/ml at 4 hours), but was still markedly above basal level at 24 hours after injection. These serum
Metrnl levels within 24 hours were obviously higher than those in Metrnl / mice (Fig. 2B) and Metrnl Tg mice (Fig. 3A). We thus used this dose of Metrnl (1.75 g/mouse) performing rescue experiment in HFD fed Metrnl / mice. After one week treatment, GTT indicated no effect of this Metrnl therapy on insulin resistance of Metrnl / mice (Fig. 8H).
Neurons and macrophages remain unchanged in adipocyte specific Metrnl knockout mice. In this study, adipocyte specific Metrnl deficiency was produced by Fabp4 cre driver.
This driver is also expressed in central nervous system and activated macrophages (33,34).
We performed further experiments to know whether Metrnl expression was altered in neurons and macrophages, thus affecting the function of these cells in Metrnl / mice.
Metrnl expression appeared unchanged in cultured primary neurons of Metrnl / mice, and
18
Page 19 of 59 Diabetes
the neurite outgrowth was also unaltered (Supplementary Fig. 10A and B). In cultured
primary macrophages of Metrnl / mice, Metrnl expression showed no significant changes.
And, neither TNFα nor IL6 expression was altered between Metrnl / and control mice after
treatment with vehicle or LPS (Supplementary Fig. 10C).
19
Diabetes Page 20 of 59
DISCUSSION
In this study, we demonstrate an insulin sensitization of Metrnl using both adipocyte specific knockout and overexpression models. The results support that adipocyte
Metrnl ameliorates overall insulin resistance through acting on local adipose tissue in an autocrine/paracrine fashion. Firstly, serum Metrnl concentrations remain unchanged in the
Metrnl / mice, while the phenotype of deteriorated insulin resistance in Metrnl / mice is obvious and unambiguous. Secondly, insulin stimulated phosphorylation of AKT is enhanced by adipocyte Metrnl in white adipose tissue, but not in other major metabolic tissues. Thirdly, using intravenous administration of recombinant Metrnl (1.75 g/mouse) to increase circulating Metrnl level for one week is unable to rescue insulin resistance exacerbated by adipocyte deficiency of Metrnl. Although our present data stated above suggest that adipocyte Metrnl controls insulin sensitivity via its autocrine/paracrine action, we do not exclude the endocrine action of Metrnl under certain conditions. To know whether Metrnl may regulate insulin sensitivity in an endocrine fashion, future study needs to test longer periods of treatment with higher doses of Metrnl.
In both knockout and transgenic overexpression mice, white adipose tissue is remodeled obviously and expression of genes relating to adipocyte differentiation, lipid metabolism, and inflammation are regulated remarkably by adipocyte Metrnl. These obvious changes in white adipose tissue are in contrast with no significant changes in brown adipose tissue, indicating that the role of Metrnl in white fat is more important than that in brown fat. In addition, energy expenditure is also unaltered in adipocyte specific Metrnl knockout and transgenic overexpression mice. Thus, the regulation of adipocyte Metrnl on insulin
20
Page 21 of 59 Diabetes
sensitivity is mediated by white adipose tissue, rather than brown adipose tissue.
The normal and proper function of adipose tissue plays a critical role in maintaining
insulin sensitivity (35). Improved adipose tissue function and expandability in parallel with
adipose remodeling can remedy metabolic complications (36). In this study, Metrnl
expands adipocytes significantly, upregulates lipid metabolism related genes, improves
insulin sensitivity, and attenuates hypertriglyceridemia under HFD. Under NCD, although
Metrnl Tg mice do not show insulin sensitization and hypolipidemic effects, the increased
adipocyte size and enhanced lipid disposal ability are observed. These suggest the
improved adipocyte function and expansion occur prior to its measurable beneficial effect
on insulin resistance and hypertriglyceridemia.
Metrnl may regulate both lipogenesis and lipolysis in white adipocytes. It promotes
lipid accumulation and lipogenesis related genes expression during adipogenesis in vitro,
and enlarges adipocytes and upregulates lipogenesis related genes in vivo, suggesting a
pro lipogenesis effect of Metrnl. Meanwhile, Metrnl upregulates lipolysis related genes in
vitro and in vivo, and enhances lipase activity in white adipose tissue, suggesting a
pro lipolysis of Metrnl. Along with the above mentioned phenotypes, the adipose content is
constant, implying triglyceride turnover is increased, but balanced. It is proposed that
improving adipose triglyceride turnover may be a potential target for treatment of insulin
resistance (37), which could be a possible mechanism involved in the insulin sensitization
of Metrnl.
PPARγ is the key regulator of adipocyte differentiation and function. And PPARγ
mutant can exacerbate insulin resistance and reduce adipocyte size (38). In our study,
21
Diabetes Page 22 of 59
adipose PPARγ expression is dramatically upregulated by Metrnl in vitro and in vivo, suggesting it is involved in Metrnl enhanced adipose function and expansion. Consistently, both inhibition and knockdown of PPARγ can abolish Metrnl improved insulin resistance， proving that Metrnl antagonizes insulin resistance via PPARγ pathway. Regarding the links between Metrnl and PPARγ, further studies are needed. In particular, the initial mechanism remains to be clarified; does Metrnl act as a ligand exerting function through receptor signaling pathway, or does it act as an enzyme exerting function through biochemical reaction pathway?
We have not observed white adipose browning in the transgenic mice, which appears inconsistent with the previous study (15). The discrepancy could be explained by different experimental models, relatively acute models in the previous study and chronic models in the present study. In the previous study, both administration of Metrnl expressing adenoviral vectors and high dose of Metrnl protein cause an abrupt increase of Metrnl in adult mice. The plasma Metrnl levels increase by more than 5 folds in the previous study, much higher than those in the transgenic mice of the present study. Of note, the previous study shows that Metrnl driven adipose browning occurs only in a very short period between days 5 and 7 postinjection (15) and disappears one week after injection (15). This transient phenotype seems not paradoxical with our results of no adipose browning in the transgenic mice.
We use Fabp4 promoter to create adipocyte specific knockout and overexpression mice.
Because Fabp4 is also expressed in non adipose tissues, especially in central nervous system and activated macrophages (33,34), one limitation of the present study is potentially
22
Page 23 of 59 Diabetes
non specific effect from non adipocytes. Our further experiments exclude the possible
effects from neurons and macrophages. Neuronal Metrnl expression and neurite outgrowth
are unaltered in Metrnl / mice. Also, Metrnl expression and LPS induced upregulation of
TNFα and IL6 in macrophages are unchanged in Metrnl / mice. Nevertheless, generation
of more adipocyte specific knockout model (e.g. using Adipoq Cre) will be helpful to
prove the unique role of adipocyte Metrnl in insulin sensitivity.
In conclusion, the current study demonstrates an important role of Metrnl in white
adipose biology (Fig. 8I). Adipocyte Metrnl antagonizes obesity induced insulin resistance
by improving adipose function, including adipocyte differentiation, metabolism activation
and inflammation inhibition. The insulin sensitization of adipocyte Metrnl is through
PPARγ pathway. Considering adipocyte Metrnl improves insulin resistance without
increasing body weight, it may be a new promising therapeutic target for metabolic
syndrome and type 2 diabetes.
23
Diabetes Page 24 of 59
ACKNOWLEDGMENTS
This work was supported by grants from the National Natural Science Foundation of China
(81130061 to C. Y.M., 81202572 to Z. Y.L., 81422049 to P.W. and 81373414 to C. Y.M.), the National Basic Research Program of China (2009CB521902 to C. Y.M.), and the
National Science and Technology Major Project (2009ZX09303 002 to C. Y.M.).
No potential conflicts of interest relevant to this article were reported.
C. Y.M. and Z. Y.L. designed the study and wrote the manuscript. Z. Y.L., J.S., S. L.Z.,
M. B.F., Y. F.G., Y.Q., J.X. and P.W. performed the experiments. All authors contributed to the analysis of experimental data. C. Y.M. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.
24
Page 25 of 59 Diabetes
REFERENCES
1. Johnson AM, Olefsky JM. The origins and drivers of insulin resistance. Cell 2013;152:673 684 2. Ahima RS, Lazar MA. Physiology. The health risk of obesity better metrics imperative. Science 2013;341:856 858 3. Okada Iwabu M, Yamauchi T, Iwabu M, et al. A small molecule AdipoR agonist for type 2 diabetes and short life in obesity. Nature 2013;503:493 499 4. Miao CY. Introduction: Adipokines and cardiovascular disease. Clin Exp Pharmacol Physiol 2011;38:860 863 5. Ouchi N, Parker JL, Lugus JJ, Walsh K. Adipokines in inflammation and metabolic disease. Nat Rev Immunol 2011;11:85 97 6. Tran TT, Yamamoto Y, Gesta S, Kahn CR. Beneficial effects of subcutaneous fat transplantation on metabolism. Cell Metab 2008;7:410 420 7. Cristancho AG, Lazar MA. Forming functional fat: a growing understanding of adipocyte differentiation. Nat Rev Mol Cell Biol 2011;12:722 734 8. Li P, Fan W, Xu J, et al. Adipocyte NCoR knockout decreases PPARgamma phosphorylation and enhances PPARgamma activity and insulin sensitivity. Cell 2011;147:815 826 9. Li ZY, Zheng SL, Wang P, et al. Subfatin is a novel adipokine and unlike Meteorin in adipose and brain expression. CNS Neurosci Ther 2014;20:344 354 10. Wang P, Xu TY, Guan YF, Su DF, Fan GR, Miao CY. Perivascular adipose tissue derived visfatin is a vascular smooth muscle cell growth factor: role of nicotinamide mononucleotide. Cardiovasc Res 2009;81:370 380 11. Wang P, Xu TY, Guan YF, et al. Nicotinamide phosphoribosyltransferase protects against ischemic stroke through SIRT1 dependent adenosine monophosphate activated kinase pathway. Ann Neurol 2011;69:360 374 12. Wang P, Zhang RY, Song J, et al. Loss of AMP activated protein kinase alpha2 impairs the insulin sensitizing effect of calorie restriction in skeletal muscle. Diabetes 2012;61:1051 1061 13. Wang P, Guan YF, Du H, Zhai QW, Su DF, Miao CY. Induction of autophagy contributes to the neuroprotection of nicotinamide phosphoribosyltransferase in cerebral ischemia. Autophagy 2012;8:77 87 14. Jorgensen JR, Fransson A, Fjord Larsen L, et al. Cometin is a novel neurotrophic factor that promotes neurite outgrowth and neuroblast migration in vitro and supports survival of spiral ganglion neurons in vivo. Exp Neurol 2012;233:172 181 15. Rao RR, Long JZ, White JP, et al. Meteorin like is a hormone that regulates immune adipose interactions to increase beige fat thermogenesis. Cell 2014;157:1279 1291 16. Ushach I, Burkhardt AM, Martinez C, et al. METEORIN LIKE is a cytokine associated with barrier tissues and alternatively activated macrophages. Clin Immunol 2014;156:119 127 17. Naveiras O, Nardi V, Wenzel PL, Hauschka PV, Fahey F, Daley GQ. Bone marrow adipocytes as negative regulators of the haematopoietic microenvironment. Nature 2009;460:259 263 18. Liao W, Nguyen MT, Yoshizaki T, et al. Suppression of PPAR gamma attenuates insulin stimulated glucose uptake by affecting both GLUT1 and GLUT4 in 3T3 L1 adipocytes. Am J Physiol Endocrinol Metab 2007;293:E219 227 19. Ayala JE, Bracy DP, Malabanan C, et al. Hyperinsulinemic euglycemic clamps in conscious, unrestrained mice. J Vis Exp 2011;10.3791/3188
25
Diabetes Page 26 of 59
20. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol 1959;37:911 917 21. Khan T, Muise ES, Iyengar P, et al. Metabolic dysregulation and adipose tissue fibrosis: role of collagen VI. Mol Cell Biol 2009;29:1575 1591 22. Song DD, Chen Y, Li ZY, Guan YF, Zou DJ, Miao CY. Protein tyrosine phosphatase 1B inhibits adipocyte differentiation and mediates TNFalpha action in obesity. Biochim Biophys Acta 2013;1831:1368 1376 23. Hotamisligil GS, Shargill NS, Spiegelman BM. Adipose expression of tumor necrosis factor alpha: direct role in obesity linked insulin resistance. Science 1993;259:87 91 24. Savage DB, Petersen KF, Shulman GI. Disordered lipid metabolism and the pathogenesis of insulin resistance. Physiol Rev 2007;87:507 520 25. Frayn KN. Adipose tissue as a buffer for daily lipid flux. Diabetologia 2002;45:1201 1210 26. Wang H, Eckel RH. Lipoprotein lipase: from gene to obesity. Am J Physiol Endocrinol Metab 2009;297:E271 288 27. Evans JL, Goldfine ID, Maddux BA, Grodsky GM. Are oxidative stress activated signaling pathways mediators of insulin resistance and beta cell dysfunction? Diabetes 2003;52:1 8 28. Kim JK, Gavrilova O, Chen Y, Reitman ML, Shulman GI. Mechanism of insulin resistance in A ZIP/F 1 fatless mice. J Biol Chem 2000;275:8456 8460 29. Guilherme A, Virbasius JV, Puri V, Czech MP. Adipocyte dysfunctions linking obesity to insulin resistance and type 2 diabetes. Nat Rev Mol Cell Biol 2008;9:367 377 30. Tontonoz P, Spiegelman BM. Fat and beyond: the diverse biology of PPARgamma. Annu Rev Biochem 2008;77:289 312 31. Ahmadian M, Suh JM, Hah N, et al. PPARgamma signaling and metabolism: the good, the bad and the future. Nat Med 2013;19:557 566 32. Sugii S, Olson P, Sears DD, et al. PPARgamma activation in adipocytes is sufficient for systemic insulin sensitization. Proc Natl Acad Sci U S A 2009;106:22504 22509 33. Martens K, Bottelbergs A, Baes M. Ectopic recombination in the central and peripheral nervous system by aP2/FABP4 Cre mice: implications for metabolism research. FEBS Lett 2010;584:1054 1058 34. Makowski L, Boord JB, Maeda K, et al. Lack of macrophage fatty acid binding protein aP2 protects mice deficient in apolipoprotein E against atherosclerosis. Nat Med 2001;7:699 705 35. Virtue S, Vidal Puig A. It's not how fat you are, it's what you do with it that counts. PLoS Biol 2008;6:e237 36. Kim JY, van de Wall E, Laplante M, et al. Obesity associated improvements in metabolic profile through expansion of adipose tissue. J Clin Invest 2007;117:2621 2637 37. Arner P, Bernard S, Salehpour M, et al. Dynamics of human adipose lipid turnover in health and metabolic disease. Nature 2011;478:110 113 38. Gray SL, Nora ED, Grosse J, et al. Leptin deficiency unmasks the deleterious effects of impaired peroxisome proliferator activated receptor gamma function (P465L PPARgamma) in mice. Diabetes 2006;55:2669 2677
26
Page 27 of 59 Diabetes
Figure Legends FIG. 1. Metrnl promotes differentiation of white adipocytes and may act in a secreted
manner. (A C) Oil red O staining (A) and gene expression (B and C) in differentiated
3T3 L1 adipocytes after lentivirus mediated knockdown (shRNA) or overexpression (OE)
of Metrnl. n=4 5. (D) Metrnl overexpression increases PPARγ expression in primary mouse
embryonic fibroblasts (MEF) and C3H10T1/2 pluripotent cells after induced differentiation
to adipocytes. n=5. (E) Medium Metrnl levels in incubated white adipose tissue, in
incubated primary adipocytes, and in differentiated 3T3 L1 adipocytes with and without
lentivirus mediated Metrnl overexpression (OE). n=2. (F) Culture medium (CM) from
Metrnl overexpressed CHO cells increases PPARγ and FABP4 expression in differentiated
3T3 L1 adipocytes. n=4. (G) Metrnl recombinant protein promotes PPARγ expression. n=4.
Data are mean ± SEM. *P<0.05, **P<0.01.
FIG. 2. Adipocyte specific ablation of Metrnl exacerbates insulin resistance induced by
high fat diet (HFD). (A) Schematic representation of Metrnl conditional knockout mice.
Metrnl / indicates adipocyte specific deletion of Metrnl. (B) Metrnl levels in different
tissues (n=4) and serum (n=7 12) between Metrnl / and control mice. WAT, inguinal
subcutaneous and epididymal white adipose tissue. BAT, interscapular brown adipose tissue.
(C) Body weight (n=5) and food intake (n=4) in Metrnl / mice fed HFD for 2 months. (D)
Glucose tolerance test in Metrnl / mice fed HFD. n=5. (E) Insulin tolerance test in Metrnl /
mice fed HFD. n=5. (F) H&E staining of WAT, adipocyte area distribution and mean
adipocyte area in Metrnl / and control mice fed HFD. Bar=100 m. The adipocyte area was
calculated from epididymal WAT sections from 4 Metrnl / mice and 5 control mice (>1500 27
Diabetes Page 28 of 59
cells counted per group) using Image J software. Data are mean ± SEM. *P<0.05,
**P<0.01.
FIG. 3. Adipocyte specific overexpression of Metrnl prevents insulin resistance induced by high fat diet (HFD) or leptin deletion, and there is no correlation between serum Metrnl and body mass index in humans. (A) Schematic representation of the transgenic construct
(top left) for adipocyte specific overexpression of Metrnl in mice (Metrnl Tg), verification of Metrnl expression in white adipose tissue (WAT) with immunohistochemistry
(bottom left) and detection of WAT Metrnl expression with real time PCR (middle, n=5) and serum Metrnl concentration with ELISA (right, P=0.057) in Metrnl Tg (n=8) and wild type mice (WT, n=6). Bar=100 m. (B) Body weight curve (n=8) and food intake
(n=4) in Metrnl Tg mice fed HFD for 16 weeks. (C and D) Glucose tolerance test (GTT) (C, n=5) and insulin tolerance test (ITT) (D, n=5 6) in Metrnl Tg mice fed HFD for 16 weeks.
(E) Mean glucose infusion rate during the hyperinsulinemic euglycemic clamp study in
Metrnl Tg mice fed HFD for 4 or 7 months. n=7 9. (F) H&E staining of WAT, adipocyte area distribution and mean adipocyte area in Metrnl Tg mice fed HFD for 16 weeks.
Bar=100 m. The adipocyte area was calculated from epididymal WAT sections from 5 mice per group (>2500 cells counted per group) using Image J software. (G) No effect of intravenous injection of recombinant Metrnl (250 g/kg) on blood glucose in HFD induced obese C57 mice. Insulin (0.55 U/kg) as positive control. n=4. (H and I) Body weight (H) and GTT (I) in 7 week old WT (n=3), leptin / (n=7) and Leptin / Metrnl Tg mice (n=7). (J)
No effect of intravenous injection of recombinant Metrnl (250 g/kg) on blood glucose in
28
Page 29 of 59 Diabetes
leptin / obese mice. n=7. (K) No correlation between Metrnl serum concentration and body
mass index in human subjects undergoing physical examination. Data are mean ± SEM.
*P<0.05, **P<0.01. NS, not significant.
FIG. 4. The effects of Metrnl on insulin stimulated phosphorylation of AKT. (A)
Phosphorylation of AKT at Ser473 in white adipose tissue (WAT), brown adipose tissue
(BAT), muscle, and liver in Metrnl / and control mice fed high fat diet (HFD) for 4 months.
n=5 6. (B) Phosphorylation of AKT at Ser473 in WAT, BAT, muscle, and liver in Metrnl Tg
and wild type mice fed HFD for 16 weeks. Tissues were collected 8 minutes after
intravenous injection of insulin (5 U/kg). n=7 9. *P<0.05, **P<0.01.
FIG. 5. Metrnl regulates adipose inflammation, metabolism and differentiation in vivo. (A
and B) Expression of inflammatory factors IL6 (A) and TNFα (B) in white adipose tissue
(WAT) detected by real time PCR (n=6) and ELISA (n=4 7) in Metrnl / mice fed high fat
diet (HFD) for 2 months and in Metrnl Tg mice fed HFD for 16 weeks. (C-E) Expression of
anti inflammatory factors IL4 (C), IL10 (D) and IL13 (E) in white adipose tissue detected
by real time PCR in Metrnl Tg (n=6) and wild type (n=7) mice fed HFD for 16 weeks. (F)
Lipopolysaccharides (LPS) induced changes of serum TNFα levels in normal chow diet
(NCD) fed Metrnl Tg mice. n=4 6. (G) Serum triglyceride (TAG) in HFD fed Metrnl /
(n=5) and Metrnl Tg mice (n=8). (H) Liver triglyceride content in HFD fed Metrnl / (n=6)
and control mice (n=5). Bar=100 m. (I) Lipid overload test in NCD fed Metrnl Tg mice.
AUC, area under curve. n=4. (J) Lipase activity in soleus muscle and WAT of NCD fed
29
Diabetes Page 30 of 59
Metrnl Tg (n=6) and wild type mice (n=7). (K and L) Expression of genes relating to adipocyte differentiation and lipid metabolism in WAT of HFD fed Metrnl / (K, n=6) and
Metrnl Tg (L, n=4 6) mice. Data are mean ± SEM. *P<0.05, **P<0.01. NS, not significant.
FIG. 6. Inhibition of PPARγ abolishes the insulin sensitizing action of Metrnl. (A and B)
Mice are fed high fat diet (HFD) with or without PPARγ inhibitor (GW9662, 8 mg/kg/day) for 16 weeks. Glucose tolerance test (GTT) (A) and insulin tolerance test (ITT) (B). n=4 5.
(C and D) After 16 weeks of HFD, mice are intraperitoneally injected with PPARγ inhibitor
(BADGE, 30 mg/kg/day) or vehicle, and fed with HFD, for additional 3 weeks. GTT (C, n=5) and ITT (D, n=4). Data are mean ± SEM. *P<0.05, **P<0.01. NS, not significant.
FIG. 7. Knockdown of PPARγ abolishes Metrnl induced upregulation of adipocyte marker genes and the insulin sensitizing action of Metrnl. (A F) Real time PCR analysis for expression of Metrnl (A), PPARγ (B), C/EBPα (C), FABP4 (D), LPL (E), and PNPLA2 (F) in 3T3 L1 adipocytes transfected with lentivirus containing Metrnl gene or PPARγ shRNA with target sequence 5’ CTATGATATGAATTCCTTAAT 3’. n=4. (G) The expression of
PPARγ in white adipose tissue of Metrnl Tg and wild type mice fed high fat diet (HFD) for
14 weeks after 11 days of intravenous administration of lentivirus containing shRNA of
PPARγ. (H) Glucose tolerance test in Metrnl Tg and wild type mice fed HFD for 14 weeks after 10 days of lentivirus mediated transduction of scramble or PPARγ shRNA. n=4 5.
Data are mean ± SEM. *P<0.05. NS, not significant.
30
Page 31 of 59 Diabetes
FIG. 8. There exists no white adipose browning in Metrnl Tg mice, and intravenous
administration of recombinant Metrnl for one week does not rescue insulin resistance in
Metrnl / mice fed high fat diet (HFD). (A F) Real time PCR analysis for Metrnl expression
(A), anti inflammatory factors (B), thermogenesis associated genes (C), and gene markers
of eosinophil and M2 macrophage (D), and flow cytometry analysis of M2 macrophage (E)
and eosinophil (F), in inguinal subcutaneous white adipose tissue of Metrnl Tg and
wild type mice fed HFD for 4 7 months. n≥10. (G) Serum Metrnl levels at indicated time
points after single intravenous administration of recombinant Metrnl (1.75 g/mouse) via a
venous catheter. n=2. (H) Mice are fed with HFD for 8 weeks. At 7 weeks after HFD, mice
are intravenously administrated with recombinant Metrnl (1.75 g/mouse, body
weight=29.00 ± 0.73 g) or vehicle once a day for 7 days, and then for glucose tolerance test
(GTT). n=4 for wild type mice and n=6 for Metrnl / treated with vehicle or Metrnl protein.
(I) Influence and possible mechanism of adipocyte Metrnl on insulin resistance.
Adipocyte specific knockout of Metrnl deteriorates insulin resistance, while
adipocyte specific overexpression of Metrnl produces insulin sensitization against
obesity induced insulin resistance. Adipocyte Metrnl upregulates PPARγ expression,
enhances adipocyte differentiation and lipid metabolism (both lipogenesis and lipolysis),
inhibits adipose inflammation, and ultimately antagonizes insulin resistance under HFD.
Data are mean ± SEM. *P<0.05, **P<0.01.
31
Figure 1 Diabetes Page 32 of 59 A B C 1.5 Scramble 20 Control Metrnl Metrnl OE MetrnlshRNA GAPDH ** 15 1.0 * Scramble Metrnl shRNA 10 Control * * * * ** Metrnl OE 0.5 ** ** ** 5 **
Relative expression Relative ** Relative expression ** * 0.0 0 γ α γ α LPL LPL ACC Control Metrnl OE ACC FASN FASN Metrnl PPAR FABP4 PPAR FABP4 C/EBP PNPLA2 C/EBP PNPLA2 D G MEF C3H10T1/2 E F Control CM 12 3 8 4000 400 250000 6 Metrnl OE CM * ** 200000 6 ** 3000 300 2 150000 4 * 8 γ expression γ expression 100000 4 2000 200 3000 * 4 1 2000 2 * 2 1000 100
1000 Relative expression Medium Metrnl (pg/ml) Medium Metrnl Medium Metrnl (pg/ml/g) Medium Metrnl (pg/ml/ml) 0 0 0 0 Relative PPARγ expression 0 Relative PPAR Relative Relative PPAR Relative 0 0 Metrnl (ng/ml) 0 50 500 WT WT Adipose tissue Primary adipocyte Control PPARγ FABP4 Metrnl OE Metrnl OE Metrnl OE FigurePage 33 of 59 2 Diabetes A B 1.2 1000 ATG TGA stop WT WT allele Metrnl-/- 800 1 2 3 4 0.8 600 Targeted allele PGK-NEO 3 4 4 * + Rosa26-Flp 400 0.4 Floxed allele 200
1 2 34 4 loxP expression Relative Serum Metrnl (pg/ml) Serum + Fabp4-Cre * FRT Metrnl-/- 0.0 0 -/- 1 2 4 WT WAT BAT Liver Heart Brain Muscle Metrnl
C HFD D HFD E HFD 32 WT 50 4 3 16 WT -/- ** Metrnl ** ** Metrnl-/- 40 3 24 * * 12 2 ** 30 ** 2 16 8 20 * * 1 ** * * 1 8 4 * Body weight (g) Body weight 10 WT -/- Serum insulin (ng/ml) insulin Serum
Metrnl (mmol/L) glucose Blood Blood glucose (mmol/L) glucose Blood
0 (g/day/mouse) intake Food 0 0 0 0 -/- -/- 0 30 60 90 120 150 0 30 60 0 15 30 45 60 75 90 105120 WT WT Time after glucose (min) Time after glucose (min) Time after insulin (min) Metrnl Metrnl F HFD
)
50 2 2500
WT m -/- µ 40 Metrnl 2000 ** 30 1500
20 1000
Distribution (%) Distribution 10 500
0 0
Mean adipocyte area ( -/- WT
-/- 0-1000 WT Metrnl >13000 Metrnl 1000-2000 2000-3000 3000-4000 4000-5000 5000-6000 6000-7000 7000-8000 8000-9000 9000-10000 10000-11000 11000-12000 12000-13000 Adipocyte area (μm2) Figure 3 Diabetes Page 34 of 59
A B HFD C HFD WT WT 4 2000 50 5 30 250 WT * Metrnl Tg Metrnl Tg Fabp4-promoter Metrnl-his6 Poly A ** ** 40 Metrnl Tg 4 200 * 3 1500 20 ** 30 3 ** 150 2 1000 20 2 * 100 10 *
1 500 (g) Body weight 10 1 50 Serum Metrnl (pg/ml) Metrnl Serum Serum insulin (pg/ml) insulin Serum Blood glucose (mmo/L) glucose Blood Relative Metrnl expression Metrnl Relative WT Metrnl Tg 0 0 0 mouse) (g/day/ intake Food 0 0 0 6 8 10 12 14 16 18 20 22 0 30 60 90 120 180 0 30 60 90 WT WT WT Age (weeks) Time after glucose (min) Time after glucose (min) Metrnl Tg Metrnl Tg Metrnl Tg D HFD E HFD F HFD ) 12 WT 10 40 2 6000 WT m ** Metrnl Tg * µ 8 Metrnl Tg 30 8 * 4000 ** 6 * 20 4 * 2000 4 (mg/kg/min) * * Distribution (%) Distribution 10 * 2 * Blood glucose (mmol/L) glucose Blood
0 rate infusion Mean glucose 0 0 0 Mean adipocyte area ( 0 15 30 45 60 90 Metrnl Tg WT Time after insulin (min) WT WT 0-1000 >13000 Metrnl Tg Metrnl Tg 1000-2000 2000-3000 3000-4000 4000-5000 5000-6000 6000-7000 7000-8000 8000-9000 9000-10000 10000-11000 11000-12000 12000-13000 Adipocyte area (µm2) -/- HFD Leptin G H I WT WT J K -/- Vehicle human Vehicle NS Leptin Leptin-/- 15 50 40 5 12 Metrnl 500 Metrnl -/- ) n=87 Leptin Metrnl Tg Leptin-/- Metrnl Tg 4 Insulin r=-0.1028 Insulin 40 400 30 3 P=0.3434 10 8 30 * 2 300 20 * ** * ** 1 * 20 200 5 * * 0.3 4 * * *
Body weight (g) Body weight 10 0.2 10 100 Serum Metrnl (pg/ml Serum
Serum insulin (ng/ml) Serum insulin 0.1 Blood glucose (mmol/L) glucose Blood Blood glucose (mmol/L) glucose Blood Blood glucose (mmol/L) glucose Blood 0 0 0 0.0 0 0 0 15 30 45 60 -/- 0 30 60 90 120 150 180 0 30 60 120 0 15 30 45 60 15 20 25 30 35 40 Time after injection (min) WT Time after glucose (min) Time after glucose (min) Time after injection (min) Body mass index (kg/m2) Leptin -/- Metrnl Tg
Leptin FigurePage 35 of 59 4 Diabetes A HFD B HFD WT Metrnl-/- WT Metrnl Tg Insulin - + + + + + - + + + + Insulin - + + + + - + + + + p-AKT (Ser473) p-AKT (Ser473) WAT WAT AKT AKT
p-AKT (Ser473) p-AKT (Ser473) BAT BAT AKT AKT
p-AKT (Ser473) p-AKT (Ser473) Muscle Muscle AKT AKT
p-AKT (Ser473) p-AKT (Ser473) Liver Liver AKT AKT
WAT BAT Muscle Liver WAT BAT Muscle Liver 1.5 1.5 1.5 1.5 4 1.5 1.5 1.5 * 3 1.0 1.0 1.0 1.0 1.0 1.0 1.0
2 ** 0.5 0.5 0.5 0.5 0.5 0.5 0.5 1 p-AKT/AKT (fold of change) p-AKT/AKT 0.0 0.0 0.0 0.0 (fold of change) p-AKT/AKT 0 0.0 0.0 0.0 -/- -/- -/- -/- WT WT WT WT WT WT WT WT Metrnl Metrnl Metrnl Metrnl Metrnl Tg Metrnl Tg Metrnl Tg Metrnl Tg Figure 5 Diabetes Page 36 of 59
A HFD B HFD C HFD D HFD 2.5 1.5 600 900 3 1.5 400 * 400 2.0 2.0 * 2.0 300 300 1.5 1.5 1.0 400 600 2 1.0 1.5 200 200 1.0 1.0 1.0 * *
0.5 200 300 1 0.5 protein) (pg/mg α 100 100 0.5 0.5 0.5 IL6 (pg/mg protein) TNF Relative IL4 expression Relative IL6 expression Relative IL10 expression
0.0 0.0 0 0 Relative TNF α expression 0 0.0 0 0 0.0 0.0 -/- -/- -/- -/- WT WT WT WT WT WT WT WT WT WT Metrnl Metrnl Metrnl Tg Metrnl Metrnl Tg Metrnl Metrnl Tg Metrnl Tg Metrnl Tg Metrnl Tg
E HFD F G HFD H HFD 2.0 4 1.2 1.5 3 WT NS Metrnl Tg * ) 1.5 3 mol/L mol/L) 0.8 1.0 2 µ
NS µ g/ml) ** µ mol/g tissue) mol/g ( 1.0 2 µ ( α 1
TNF 0.4 0.5 0.5 1 NS Serum TAG ( TAG Serum Serum TAG ( TAG Serum
Relative IL13 expression 0 0.0 0 0.0 0.0 Triglyceride -/- -/- -/- LPS (mg/kg) 0 1 10 WT Metrnl WT WT WT WT Metrnl Metrnl Metrnl Tg Metrnl Tg WT WT Metrnl Tg Metrnl Tg HFD HFD PPARγ I J NS K L 2.5 WT 12 6 1.5 WT 10 WT GAPDH
) * * -/- Metrnl Tg Metrnl Metrnl Tg ** 2.0 8 ** ** mol/L hour) 8 4 µ × 1.0 1.5 ** * * 6 ** ** 1.0 mol/L * ** 4 * µ 4 2 0.5 ** ** ** ** ** * 0.5 ** 2 ** Relative expression Relative Relative expression Relative AUC ( AUC Serum TAG ( TAG Serum
0.0 0 (mU/min/mg) activity Lipase 0 0.0 0 0 2 4 6 8 γ α α WT WAT ACC Lipe ACC Lipe Time after injection (hours) Muscle CD36 FASN CD36 FASN PPAR FABP4 Perilipin PPARC/EBPγ FABP4 Metrnl Tg C/EBP PNPLA2 PNPLA2 Perilipin PageFigure 37 of 59 6 Diabetes
WT A HFD WT B HFD Metrnl Tg Metrnl Tg NS 30 3000 2.5 WT + GW9662 100 12 WT 800 WT + GW9662 * * NS Metrnl Tg + GW9662 Metrnl Tg ** Metrnl Tg + GW9662 2.0 80 WT + GW9662 600 *
min) 9 min) min) × ×
20 2000 × 1.5 60 Metrnl Tg + GW9662 6 400 1.0 40 10 1000 3 200 0.5 20 AUC (ng/ml AUC AUC (mmol/L AUC AUC (mmol/L AUC Serum insulin (ng/ml) insulin Serum Blood glucose (mmol/L) glucose Blood Blood glucose (mmol/L) glucose Blood 0 0 0.0 0 0 0 0 30 60 90 120 180 0 30 60 0 15 30 45 60 75 90 105 120 135 Time after glucose (min) WT Time after glucose (min) WT Time after insulin (min) WT Metrnl Tg Metrnl Tg Metrnl Tg
WT + GW9662 WT + GW9662 WT + GW9662
C HFD Metrnl Tg + GW9662 WT + Vehicle Metrnl Tg + GW9662 D HFD Metrnl Tg + GW9662 WT + Vehicle Metrnl Tg + Vehicle Metrnl Tg + Vehicle WT + BADGE WT + Vehicle NS NS 40 WT + BADGE 4000 1.5 Metrnl Tg + BADGE 100 12 1000 ) * Metrnl Tg + Vehicle NS Metrnl Tg + BADGE WT + BADGE 80 800 *
30 3000 min) min) Metrnl Tg + BADGE min) × × 1.0 ** 8 × 60 600 20 2000 40 400 0.5 4 10 1000 AUC (ng/ml AUC 20 200 AUC (mmol/L AUC Serum insulin (ng/ml) insulin Serum AUC (mmol/L AUC Blood glucose (mmol/L) glucose Blood Blood glucose (mmol/L glucose Blood 0 0 0.0 0 0 0 0 30 60 90 120 150 180 0 30 60 0 15 30 45 60 75 90 105 120 Time after glucose (min) Time after glucose (min) Time after insulin (min)
WT + Vehicle WT + VehicleWT + BADGE WT + VehicleWT + BADGE WT + BADGE Metrnl Tg + Vehicle Metrnl Tg +Metrnl Vehicle Tg + BADGE Metrnl Tg +Metrnl Vehicle Tg + BADGE Metrnl Tg + BADGE Figure 7 Diabetes Page 38 of 59 A B C D E * 6 * 6 * 3 5 * 10 * * * * 4 8 4 4 2
α expression 3
γ expression 6
NS 2 4 2 2 1 NS 1 2 NS NS Relative LPL expression LPL Relative Relative Metrnl expression Metrnl Relative Relative FABP4 expression FABP4 Relative Relative PPAR Relative 0 0 0 0 C/EBP Relative 0
Rγ shRNARγ shRNA Rγ shRNARγ shRNA Rγ shRNARγ shRNA Rγ shRNARγ shRNA Rγ shRNARγ shRNA PPA PPA PPA PPA PPA PPA PPA PPA PPA PPA Control + Scramble Control + Scramble Control + Scramble Control + Scramble Control + Scramble Metrnl OE + Scramble Metrnl OE + Scramble Metrnl OE + Scramble Metrnl OE + Scramble Metrnl OE + Scramble Control + Control + Control + Control + Control + Metrnl OE + Metrnl OE + Metrnl OE + Metrnl OE + Metrnl OE +
HFD HFD F G H WT + Scramble 8 * 3 20 Metrnl Tg + Scramble 2500 * WT + PPAR γ shRNA * NS 2000 6 15 Metrnl Tg + PPARγ shRNA min)
2 × 1500
4 Rγ expression 10 1000 NS 1 NS 2 5 500 AUC (mmol/L AUC Blood glucose (mmol/L) glucose Blood
0 PPA Relative Relative PNPLA2 expression PNPLA2 Relative 0 0 0 0 30 60 90 120 150 Time after glucose (min)
Rγ shRNARγ shRNA Rγ shRNARγ shRNA Rγ shRNARγ shRNA
PPA PPA WT + Scramble WT + Scramble Control + Scramble Metrnl OE + Scramble Metrnl WTTg ++ ScramblePPA Metrnl WTTg ++ ScramblePPA Control + Metrnl OE + Metrnl Tg + PPA Metrnl Tg + PPA PageFirure 39 of 59 8 Diabetes HFD A HFD B HFD C HFD D HFD E WT WT 6 5 2.0 1.5 2.0 WT Metrnl Tg Metrnl Tg Metrnl Tg 4 ** 1.5 1.5 4 1.0 3 1.0 1.0 2 0.5 2 0.5 0.5 M2 macrophage (%) macrophage M2 1 expression Relative Relative expression Relative Relative expression Relative 0.0 0 Relative Metrnl expression Metrnl Relative 0 0.0 0.0 α α WT WT IL4 IL10 IL13 Dio2 Ccr3 UCP1 ERR Mrc-1 Retnla PGC1 Siglec F Clec10a Metrnl Tg Metrnl Tg HFD HFD F G H I Insulin sensitization 250 Metrnl 6 25 200 * Transgene 20 150 PPARγ 4 * 100 15 12 Metrnl 10 ↑Adipocyte differentiation 2 8 WT
Eosinophil (%) Eosinophil -/- ↑Lipid metabolism 4 5 Metrnl + Vehicle Serum Metrnl (ng/ml) Serum ↓ Blood glucose (mmol/L) glucose Blood -/- Inflammation 0 Metrnl + Metrnl 0 0 0 30 60 90 120 150 Knockout WT 0 min 15 min 45 min 4 hours 8 hours 24 hours Time after glucose (min) Insulin sensitization Metrnl Tg Time after injection Insulin resistance Diabetes Page 40 of 59
SUPPLEMENTARY DATA
A Targeting strategy 3’ probe 12.9 kb 5’ probe E E ATG TGA stop B 14.4 kb B The WT allele 1 2 3 4 5.5-kb left arm 6.5-kb right arm B B E 9.2 kb 7.6 kb E Initially targeted allele PGK-NEO 1 3 4 4 FRT FRT loxP loxP loxP +Rosa26-Flp The floxed allele 1 2 3 4 4 loxP FRT loxP loxP +Fabp4-Cre Metrnl-/- 1 2 4 loxP B 5’ probe 3’ probe C wt/wt loxP-neo/wt wt/wt loxP-neo/wt wt/wt loxP-neo/wt 14.4 kb 12.9 kb 273 bp 9.2 kb 7.6 kb
-/- D Breeding strategy for Metrnl E Genotyping Flp-positive mice
MetrnlloxP-neo/wt Rosa26-Flp 725 bp
t lp w -F 6 2 a s o MetrnlloxP/wtRosa26-Flp C57BL/6J R F Genotyping Metrnl-floxed mice
5’ primer 3’ primer
loxP/wt floxed allele Metrnl 3 4 4 FRT LoxP LoxP
243 bp MetrnlloxP/loxP Fabp4-Cre 131 bp
t t P /w /w x t lo xP w / lo xP MetrnlloxP/wtFabp4-Cre lo G Genotyping Cre-positive mice
100 bp MetrnlloxP/loxPFabp4-Cre (Metrnl-/-) wt Fabp4-Cre Supplementary Fig. 1. Generation of adipocyte-specific Metrnl knockout mice. (A) Scheme describing the generation of conditional knockout mice with adipocyte-specific ablation of Metrnl (Metrnl-/-). B, BamHI; E, EcoRV. (B) Southern blot analysis for validating MetrnlloxP-neo/wt mice with both 5’ (left) and 3’ (right) probes. Genomic DNA is digested with BamHI and probed with the 5’ probe. Expected sizes are wild-type 14.4 kb and targeted allele 9.2 kb. Otherwise, genomic DNA is digested with EcoRV and probed with the 3’ probe. The expected sizes are wild-type 12.9 kb and targeted allele 7.6 kb. (C) Genotyping of MetrnlloxP-neo/wt mice by polymerase chain reaction (PCR) with tail genomic DNA and reverse 1
Page 41 of 59 Diabetes
primer targeting neomycin gene. (D) Breeding strategy for conditional knockout mice with adipocyte-specific ablation of Metrnl (Metrnl-/-). Briefly, MetrnlloxP-neo/wt was crossed to Flp expressing transgenic mice (Rosa26-Flp) to excise neomycin selection cassette (FRT sequence flanking). Subsequently, MetrnlloxP/wtRosa26-Flp was backcrossed to C57BL/6J mice to segregate Flp gene. MetrnlloxP/loxP was generated by inbreeding MetrnlloxP/wt mice and was crossed to Fabp4-Cre mice to generate MetrnlloxP/loxPFabp4-Cre (Metrnl-/-). Ultimately, MetrnlloxP/loxPFabp4-Cre was mated with MetrnlloxP/loxP to generate experimental mice. The background of all the mice used in the breeding process was C57BL/6. (E) Genotyping Flp-positive mice. Flp gene is introduced into MetrnlloxP-neo/wt mice to remove neomycin selection cassette, and subsequently segregated via crossing MetrnlloxP/wtRosa26-Flp with C57BL/6J mice. (F) Genotyping Metrnl-floxed mice. Due to the presence of loxP and FRT sites in the conditional floxed (loxP-flanked) Metrnl allele, the PCR production of conditional floxed Metrnl allele is 243 bp, bigger than that of wild-type Metrnl allele (131 bp). (G) Genotyping Cre-positive mice including MetrnlloxP/wtFabp4-Cre and MetrnlloxP/loxPFabp4-Cre mice.
2
Diabetes Page 42 of 59
A B 30 WT 5 10 1.0 Metrnl -/- 4 8 0.8 25 3 6 0.6 20 2 4 RER 0.4 15 Heat (kcal/h/kg) Body weight (g) 1 2 0.2
0 0 0.0 10 Food intake (g/day/mouse) - - /- -/ -/ 7 8 9 10 11 12 13 14 15 T -l T l T l n W n W n W tr tr tr Weeks e e e M M M
C D HFD 20 WT 2.5 10 1.0
) WT ) -/- -/- Metrnl 2.0 Metrnl 15 8 0.8
1.5 6 0.6 10
1.0 4 RER 0.4 5 0.5 Heat (kcal/h/kg) 2 0.2 Serum insulin (ng/ml Blood glucose (mmol/L 0 0.0 0.0 0 - 0 30 60 90 120 150 0 30 60 /- -/ T -l T l W n W n Time after glucose (min) Time after glucose (min) tr tr e e M M
E HFD F HFD WT G HFD Metrnl -/- 150 2.5 Lean 2.5 WT Fat -/- 2.0 2.0 Metrnl 100 1.5 1.5
1.0 1.0
50 Weight (g)
% Body Weight 0.5 0.5 Relative expression
0 0.0 0.0 /- - Liver WAT BAT γ N 1 0 T S A2 2 W ACC L CP1 av lipin a FA U C ri PPAR lc25 Metrnl PNP Pe S Supplementary Fig. 2. Basic data of adipocyte-specific Metrnl knockout mice. (A) Body weight curve (n=5-7 mice) and food intake (n=5 mice) in Metrnl-/- mice fed normal chow diet (NCD). (B) Energy expenditure (heat) and respiratory exchange ratio (RER) detected using metabolic cage in Metrnl-/- (n=6 mice) and control mice (n=8 mice) fed NCD at the age of 16 weeks. (C) Glucose tolerance test (GTT) in Metrnl-/- mice fed NCD. n=6 mice, 16-week-old. (D) Energy expenditure (heat) and respiratory exchange ratio (RER) detected using metabolic cage in Metrnl-/- and control mice fed high fat diet (HFD) for 2 months. n=4 mice. (E)
3
Page 43 of 59 Diabetes
Proportions of lean and fat mass were analyzed by magnetic resonance imaging in Metrnl-/- mice fed HFD for 7 weeks. n=5 mice. (F) Weights of liver, epididymal white adipose tissue (WAT) and interscapular brown adipose tissue (BAT) in Metrnl-/- and control mice fed HFD for 2 months. n=5 mice. (G) Expression of brown adipose and lipid metabolism related genes in BAT of Metrnl-/- mice (n=3 mice) and control mice (n=4 mice) fed HFD for 2 months. Values are shown as mean ± SEM.
4
Diabetes Page 44 of 59
A B -/- White adipose tissue Breeding strategy for Leptin Metrnl Tg
Metrnl-His6 -/+ Metrnl Tg Leptin GAPDH
Brown adipose tissue
Metrnl-His6 -/+ Leptin-/+Metrnl Tg Leptin GAPDH Brain
Metrnl-His6
GAPDH
-/- -/- Liver Leptin Metrnl Tg Leptin
Metrnl-His6
GAPDH Genotyping Leptin knockout mice Muscle 351 bp Metrnl-His6 184 bp
GAPDH + -/+ -/- +/ n n ti ptin Heart e Lepti Lep L Metrnl-His6
GAPDH Genotyping Metrnl Tg mice Kidney 350 bp Metrnl-His6
T l GAPDH W etrn M WT p4- lone 2lone 3 Fab CloneC 1 C Clone 4 Supplementary Fig. 3. Validation of transgenic mice with adipocyte-specific overexpression of Metrnl (Metrnl Tg) and generation of Leptin-/-Metrnl Tg mice. (A) The expression of exogenous Metrnl-his6 in different tissues of Metrnl transgenic (four clones) and wild-type (WT) mice is detected by reverse transcription PCR with the reverse primer (see
Supplementary Table 1) designed targeting his6-tag. Exogenous Metrnl (Metrnl-his6) is only expressed in adipose tissue. Initially, four mice clones were obtained. During breeding process, in one of the four clones, all the male offspring were transgenic and all the female offspring were non-transgenic, indicating exogenous Metrnl-his6 sequence was integrated
5
Page 45 of 59 Diabetes
into Y chromosome. This clone was abandoned since the same gender littermate cannot be achieved as control. (B) Breeding strategy and genotyping for Leptin-/-Metrnl Tg mice. Leptin-/-Metrnl Tg mice indicate leptin knockout mice with adipocyte-specific overexpression of Metrnl. Primers for PCR are available in Supplementary Table 1.
6
Diabetes Page 46 of 59
A B C WT 40 WT 8 40 WT 75 Metrnl Tg Metrnl Tg Metrnl Tg 60
30 mouse) 6 30 45 20 4 20 30
Body weight (g) 10 2 10 15 Serum insulin (pg/ml) Blood glucose (mmol/L) 0
0 Food intake (g/day/ 0 0 g 6 8 10 12 14 16 18 20 22 T 0 30 60 90 120 180 0 30 60 90 l T W n tr Time after glucose (min) Time after glucose (min) Age (weeks) e M
D ) 50 2 2500 WT m
µ ** 40 Metrnl Tg 2000
30 * 1500
20 1000
Distribution (%) 10 500
0 Metrnl Tg 0 adipocyte Mean area ( WT T g l T W n tr
0-1000 e >13000 M 1000-2000 2000-3000 3000-4000 4000-5000 5000-6000 6000-7000 7000-8000 8000-9000 9000-10000 10000-11000 11000-12000 12000-13000 Adipocyte area (µm2) HFD HFD HFD E F G WT 150 15 1.0 Lean Metrnl Tg Fat 0.8 2.5 100 10 0.6 WT 2.0
RER 0.4 1.5 50 5
Heat (kcal/h/kg) 0.2 1.0 % Body weight Weight (g)
0 0 0.0 Metrnl Tg 0.5 g g g T T T T T T l l W l W n W rn rn tr t t 0.0 e e e M M M SAT VAT
H HFD I HFD WT WT WT Metrnl Tg Metrnl Tg 32 WT 200 Metrnl Tg 36 250 * Metrnl Tg * * 200 24 150 27 * * 150 16 100 18 * 100 8 50 * 9 50 Serum insulin (pg/ml) Serum insulin (pg/ml) Blood glucose (mmol/L) Blood glucose (mmol/L) 0 0 0 0 0 30 60 90 120 180 0 30 0 30 60 120 0 30 Time after glucose (min) Time after glucose (min) Time after glucose (min) Time after glucose (min) Supplementary Fig. 4. Basic data of transgenic mice with adipocyte-specific overexpression of Metrnl (Metrnl Tg). (A and B) Body weight curve (A, n=6 mice) and food intake (B, n=4 mice) in Metrnl Tg and wild-type (WT) mice fed normal chow diet (NCD). (C) Glucose tolerance test (GTT) in Metrnl Tg and WT mice fed NCD. n=4 mice. No significant differences between Metrnl Tg and WT groups. (D) H&E staining of adipose tissue, adipocyte area distribution and mean adipocyte areas in Metrnl Tg mice fed NCD. Bar=100 m. The adipocyte area was calculated from epididymal adipose tissue sections from 7
7
Page 47 of 59 Diabetes
Metrnl Tg mice and 8 WT mice (>2500 cells counted per group) using Image J software. (E) Proportions of lean and fat mass were measured with micro-computed tomography in Metrnl Tg (n=6 mice) and WT (n=5 mice) fed high fat diet (HFD) for 16 weeks. (F) Energy expenditure (heat) and respiratory exchange ratio (RER) detected using metabolic cage in Metrnl Tg mice fed HFD for 16 weeks. n≥11 mice. (G) Subcutaneous (SAT) and visceral adipose tissue (VAT) content in Metrnl Tg (n=6 mice) and WT (n=5 mice) fed HFD for 16 weeks. Abdominal adipose tissue is measured with micro-computed tomography and weight of SAT (outside abdominal wall) or VAT (inside abdominal wall) is derived from micro-computed tomography-calculated fat volumes. No significant differences between Metrnl Tg and WT groups. (H and I) GTT in other two clones of Metrnl Tg mice and WT mice fed HFD for 16 weeks. n=4 mice. Values are shown as mean ± SEM. *P < 0.05, **P < 0.01.
8
Diabetes Page 48 of 59
A HFD B 1.5 1.5 30 80
60 1.0 1.0 20
40
0.5 0.5 10 20 Adiponectin (ng/ml) Adiponectin (ng/ml)
0.0 0.0 0 0 - Relative adiponectin expression -/- Relative adiponectin expression g -/ WT nl WT WT rnl WT tr nl T t tr e M etrnl Tg Me M C Me 1.5 8
6 1.0
4
0.5 Leptin (ng/ml) Leptin (ng/ml) 2
0.0 0 - -/ g l WT rn WT trnl T e Met M Supplementary Fig. 5. The effects of Metrnl on the expression of adipokines. (A) Adiponectin expression in white adipose tissue was detected by real time PCR in Metrnl-/- and Metrnl Tg mice fed high fat diet (HFD) for 16 weeks. n=5-6 mice. (B and C) Serum adiponectin and leptin levels detected by ELISA in Metrnl-/- and Metrnl Tg mice fed normal chow diet. n=4 or 5 mice in each group. Values are shown as mean ± SEM.
9
Page 49 of 59 Diabetes
A HFD B HFD 6 WT 8 WT 5 -/- Metrnl Tg * Metrnl 4 6 4 3 4 2 2 2 1
0 0 RelativeLPLexpression 0 Serum concentration (mmol/L)
Serum concentration (mmol/L) g o o o o o o T T h h h h h h W l n l C -C -C l C -C -C tr L L a L L e ta D D t D D o L o L M T H T H SupplementaryC Fig. 6. The influence of Metrnl on blood cholesterol levels and adipose lipoprotein lipase expression. (A) Serum cholesterol (Cho) levels in Metrnl-/- mice fed HFD for 2 months (n=5 mice) and in Metrnl Tg mice fed HFD for 16 weeks (n=4 mice). LDL, low density lipoprotein; HDL, high density lipoprotein. (B) Lipoprotein lipase (LPL) expression in white adipose tissue in Metrnl Tg mice fed HFD for 16 weeks. n=4 mice. Values are shown as mean ± SEM. *P < 0.05.
10
Diabetes Page 50 of 59
A HFD WAT BAT liver muscle 40 25 2.5 10
20 2.0 8 30 15 1.5 6 20 mol/g protein) mol/g protein) mol/g protein) 10 mol/g protein) 1.0 4 µ µ µ µ 10 5 0.5 2 MDA ( MDA ( MDA ( MDA ( 0 0 0.0 0 - T -/ T -/- T -/- T -/- W W W W trnl trnl e etrnl e etrnl M M M M B HFD WAT BAT Liver muscle 40 25 1.5 6
20 30 1.0 4 15 20 mol/g protein) mol/g protein) mol/g protein) mol/g protein) 10 µ µ µ µ 0.5 2 10 5 MDA ( MDA ( MDA ( MDA ( 0 0 0.0 0 T g T T T W W l Tg W W Tg trnl T rn trnl Tg trnl e et e e M M M M C 150 150
100 100
50 50 (% of control) (% of control) Fluorescence intensity Fluorescence intensity 0 0 l o E ble ntr o C etrnl O cram S M trnl shRNA e M Supplementary Fig. 7. The effects of adipocyte Metrnl on oxidative stress in different tissues. (A) Malondialdehyde (MDA, a marker of lipid peroxidation) levels in white adipose tissue (WAT), brown adipose tissue (BAT), liver, and muscle in Metrnl-/- and control mice fed
11
Page 51 of 59 Diabetes
high fat diet (HFD) for 4 months. n=5-6 mice. (B) MDA levels in WAT, BAT, liver, and muscle in Metrnl Tg and wild-type mice fed HFD for 16 weeks. n=6 mice. (C) Reactive oxygen species (ROS) level was detected with CM-H2DCFDA in 3T3-L1 adipocytes overexpressing or silencing Metrnl. n=4-6. Values are shown as mean ± SEM.
12
Diabetes Page 52 of 59
A B C D 1.5 2.0 2.0 WT WT 2.0 WT -/- Metrnl Metrnl-/- Metrnl-/- 1.5 1.5 1.5 1.0
1.0 1.0 1.0 0.5 * 0.5 0.5 0.5 Relative expression Relative expression Relative expression
Relative Metrnl expression 0.0 0.0 0.0 0.0 - -/ α α l 2 F r3 -1 a la T n IL4 10 13 c c c 0 n W tr IL IL CP1 C1 Dio e r 1 t e U ERR l C M c e PG ig le R M S C E F G H 4 2.0 2.0 2.0 * WT WT WT Metrnl Tg Metrnl Tg Metrnl Tg 3 1.5 1.5 1.5
2 1.0 1.0 1.0
1 0.5 0.5 0.5 Relative expression Relative expression Relative expression
Relative Metrnl expression 0 0.0 0.0 0.0 g α 2 α T 4 P1 1 o F r3 l T IL i R c 0a W n IL10 IL13 C C D R rc-1 1 tr U G E lec C M c e P g le Retnla M Si C I J 6 6 WT Metrnl Tg WT Metrnl Tg 4 4 4 4 1 0 1 0 1 0 2.79% 2.42%4.90% 1 0 2.46% 2.63%4.47% 3 3 3 4 3 4 1 0 1 0 1 0 1 0 2 2 2 2 1 0 1 0 1 0 1 0 2 2 1 1 1 1 Eosinophil (%) 1 0 1 0 1 0 1 0 M2 (macrophage) (%) 0 0 0 0 F4/80-PE 1 0 1 0 Siglec-F-PE 1 0 0 1 2 3 4 0 1 0 0 10 10 10 10 10 100 101 102 103 104 0 1 2 3 4 0 1 2 3 4 g 10 10 10 10 10 10 10 10 10 10 g T T T T l l CD11b-FITC W n CD11b-FITC W n tr tr e e M M Supplementary Fig. 8. Both adipocyte-specific Metrnl knockout mice (Metrnl-/-) and transgenic mice (Metrnl Tg) exhibit no significant changes of eosinophils, M2 macrophages and anti-inflammatory factors, and no adipose browning in inguinal subcutaneous white adipose tissue under normal chow diet (NCD). (A-D) Control (n=4 mice) and Metrnl-/- mice (n=3 mice) fed NCD. 5-month-old. (E-J) Wild-type (n=4 mice) and Metrnl Tg mice (n=5 mice) fed NCD. 4-month-old. Real-time PCR analysis for Metrnl expression (A and E), anti-inflammatory factors (B and F), thermogenesis-associated genes (C and G), eosinophil and M2 macrophage markers (D and H). Flow cytometry analysis of M2 macrophages (I) and eosinophils (J). Values are shown as mean ± SEM. *P < 0.05.
13
Page 53 of 59 Diabetes
A Cold Exposure (72 h) B Cold Exposure (72 h) C Cold Exposure (72 h) WT WT WT 2.0 2.0 1.5 Metrnl Tg Metrnl Tg Metrnl Tg
1.5 1.5 1.0
1.0 1.0
0.5 0.5 0.5 Relative expression Relative expression Relative expression
0.0 0.0 0.0 4 0 3 F 3 1 a a 1 2 L 1 1 r - 0 l P 1 io R I c c rc 1 tn C C D R IL IL le C c e U G E ig M le R P S C Supplementary Fig. 9. No significant changes in thermogenesis-associated genes (A), anti-inflammatory factors (B), and eosinophils and M2 macrophages markers (C) in inguinal subcutaneous white adipose tissue of Metrnl Tg mice after cold stimulation for 72 hours. n=5 mice.
14
Diabetes Page 54 of 59
A B
1.5 250
200 m) µ 1.0 WT 150
100 0.5 -/- Metrnl 50 Neurite length (
Relative expression of0.0 Metrnl 0 - -/- T l-/ T l W trn W trn e e M M C
WT + Vehicle Metrnl-/- + Vehicle WT + LPS Metrnl-/- + LPS
WT WT WT 1.5 6 10 Metrnl -/- Metrnl -/- Metrnl -/- 8 1.0 4
expression 6 α 4 0.5 2 2 Relative IL6Relative expression Relative TNF Relative Metrnl expression 0.0 0 0 Vehicle LPS Vehicle LPS Vehicle LPS Supplementary Fig. 10. Study on primary neurons and macrophages isolated from adipose-specific Metrnl knockout mice (Metrnl-/-). (A and B) Metrnl expression (A) and neurite length (B) in cultured primary neurons from Metrnl-/- and control mice. Isolated E18 embryonic mouse cortical neurons were seeded in poly-D-lysine coated plates with DMEM plus 10% FBS. After incubation for 24 hours, the culture medium was replaced by Neurobasal medium plus 10% B27 supplement for 6 days. Cells were fixed in 2% paraformaldehyde and immunostained with Tuj-1 antibody. The plates were then read on FV1000 confocol microscope with at least 10 fields per well captured for analysis. Bar=20 μm. (C) Expression of Metrnl, TNFα, and IL6 in cultured primary macrophages from Metrnl-/- and control mice. Macrophages were isolated from the mouse peritoneal cavity after
15
Page 55 of 59 Diabetes
intraperitoneal injection of 3% proteose peptone for 3 days. The expression of Metrnl, TNFα and IL6 was detected in cultured macrophages after treatment with vehicle or lipopolysaccharide (LPS, 100 ng/ml) for 12 hours. n=5-8. Bar=100 m.
16
Diabetes Page 56 of 59
Supplementary Table 1. Primers used in this study for genotyping. Gene name Forward primer Reverse primer Neomycin CTTTGGAGTCAGGGATGTTTT GTCATTCTATTCTGGGGGGTG (MetrnlloxP-neo/wt) Flp (Rosa26-Flp) CACTGATATTGTAAGTAGTTTGC CTAGTGCGAAGTAGTGATCAGG Floxed Metrnl TGAGGGTTGGAGGCTCCTAGC GGATGAGCGTTTGAGCACAGC (MetrnlloxP/loxP) Cre (Fabp4-Cre) GCGGTCTGGCAGTAAAAACTATC GTGAAACAGCATTGCTGTCACTT Exogenous Metrnl TGACTTTGTTGTCCGAGGCT AATGGTGATGGTGATGATGG (Metrnl Tg) Leptin (Leptin-/-) CCTTGAAGTACGCAACAAAGCCCC GGAACCGACACAGGGGTCTCCA CTGGGGCTCGACTAGAGCTTGC
17
Page 57 of 59 Diabetes
Supplementary Table 2. Basic data for the human subjects (male, n=87). Range Mean ± SEM.
Age (year) 19 ~ 57 31.33 ± 0.97 Height (cm) 157.8 ~ 183.2 170.70 ± 0.59 Weight (kg) 51.1 ~ 114.0 70.07 ± 1.10 Body mass index (kg/m2) 17.89 ~ 36.06 24.04 ± 0.35 Fasting serum glucose (mmol/L) 4.83 ~ 14.68 5.83 ± 0.12 Fasting serum total cholesterol (mmol/L) 2.34 ~ 6.65 4.21 ± 0.09 Fasting serum triglyceride (mmol/L) 0.33 ~ 5.59 1.27 ± 0.09 Serum Metrnl (pg/ml) 62.88 ~ 466.70 148.50 ± 6.24
18
Diabetes Page 58 of 59
Supplementary Table 3. Correlation analysis between serum Metrnl levels and other physiological indices. n=87 Metrnl (pg/ml)
r P
Age (year) 0.12 0.3726 Height (cm) 0.02 0.9071 Weight (kg) 0.16 0.2452 Body mass index (kg/m2) 0.15 0.2857 Fasting serum glucose (mmol/L) 0.08 0.5582 Fasting serum total cholesterol (mmol/L) 0.01 0.9242 Fasting serum triglyceride (mmol/L) 0.01 0.9124
19
Page 59 of 59 Diabetes
Supplementary Table 4. Primers used in this study for real time PCR. Gene name Forward primer Reverse primer Metrnl CTGGAGCAGGGAGGCTTATTT GGACAACAAAGTCACTGGTACAG PPARγ TCGCTGATGCACTGCCTATG GAGAGGTCCACAGAGCTGATT C/EBPα CAAGAACAGCAACGAGTACCG GTCACTGGTCAACTCCAGCAC FABP4 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC ACC GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT FASN CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA CD36 GCTTGCAACTGTCAGCACAT GCCTTGCTGTAGCCAAGAAC PNPLA2 (ATGL) GGATGGCGGCATTTCAGACA CAAAGGGTTGGGTTGGTTCAG Lipe (HSL) GATTTACGCACGATGACACAGT ACCTGCAAAGACATTAGACAGC Perilipin CTGTGTGCAATGCCTATGAGA CTGGAGGGTATTGAAGAGCCG Cav1 GCGACCCCAAGCATCTCAA ATGCCGTCGAAACTGTGTGT Slc25a20 GACGAGCCGAAACCCATCAG AGTCGGACCTTGACCGTGT IL6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC TNFα CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG IL4 GGTCTCAACCCCCAGCTAGT GCCGATGATCTCTCTCAAGTGAT IL10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG IL13 CCTGGCTCTTGCTTGCCTT GGTCTTGTGTGATGTTGCTCA UCP1 GTGAACCCGACAACTTCCGAA TGCCAGGCAAGCTGAAACTC PGC1α GGACATGTGCAGCCAAGACTCT CACTTCAATCCACCCAGAAAGCT Dio2 CAGTGTGGTGCACGTCTCCAATC TGAACCAAAGTTGACCACCAG ERRα GCAGGGCAGTGGGAAGCTA CCTCTTGAAGAAGGCTTTGCA Siglec F CTGGCTACGGACGGTTATTCG GGAATTGGGGTACTGGACTTG Ccr3 TCGAGCCCGAACTGTGACT CCTCTGGATAGCGAGGACTG Mrc-1 TGATTACGAGCAGTGGAAGC GTTCACCGTAAGCCCAATTT Clec10a CTCTGGAGAGCACAGTGGAG ACTTCCGAGCCGTTGTTCT Retnla CCAATCCAGCTAACTATCCCTCC ACCCAGTAGCAGTCATCCCA GAPDH GTATGACTCCACTCACGGCAAA GGTCTCGCTCCTGGAAGATG
20