Kreuzungstypgene Und Sexualzyklus Bei Dem Penicillin-Produzenten

Home , Gymnascella, Penicillium chrysogenum

Kreuzungstypgene und Sexualzyklus bei dem Penicillin- Produzenten Penicillium chrysogenum

Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Fakultät für Biologie und Biotechnologie an der Internationalen Graduiertenschule Biowissenschaften der Ruhr-Universität Bochum

angefertigt am Lehrstuhl für Allgemeine und Molekulare Botanik

vorgelegt von Julia Böhm

aus Recklinghausen

Bochum April, 2014

Referent: Prof. Dr. Ulrich Kück Korreferent: Prof. Dr. Dominik Begerow

Mating-type genes and the sexual cycle of the penicillin producer Penicillium chrysogenum

Dissertation to obtain the degree Doctor Rerum Naturalium (Dr. rer. nat.) Submitted to the International Graduate School of Biosciences, Faculty of Biology and Biotechnology at the Ruhr-University Bochum, Germany

Thesis performed at the Department of General and Molecular Botany

submitted by Julia Böhm

from Recklinghausen, Germany

Bochum April, 2014

1st Supervisor: Prof. Dr. Ulrich Kück 2nd Supervisor: Prof. Dr. Dominik Begerow

Danksagung

Zu Beginn bedanke ich mich herzlich bei meinem Doktorvater Herrn Prof. Dr. Ulrich Kück für das äußerst interessante Thema, die zahlreichen wissenschaftlichen Anregungen und Diskussionen, die sehr guten Arbeitsbedingungen und das rege Interesse am Fortschreiten dieser Arbeit.

Herrn Prof. Dr. Dominik Begerow danke ich für die freundliche Übernahme des Korreferates.

Allen Mitarbeitern des Lehrstuhls für Allgemeine und Molekulare Botanik danke ich für die gute Zusammenarbeit und das tolle Arbeitsklima. Insbesondere bedanke ich mich bei Stefanie Mertens, die mir immer mit guten Ratschlägen zur Seite stand und stets ein offenes Ohr für Sorgen oder Probleme hatte. Des Weiteren danke ich herzlich Ingeborg Godehardt, Katerina Koutsantas und Susanne Schlewinski für die Unterstützung bei einigen Experimenten. Zudem danke ich Elke Adolph und Stephanie Lorenz für die Autoklavierarbeiten, besonders wenn ich wieder mal eben 100 Kolben brauchte. Ich danke Gabi Frenßen-Schenkel für die Hilfe bei der Erstellung von Abbildungen.

Meinen Doktorbrüdern und Doktorschwestern danke ich für die schöne Zeit und die vielen hilfreichen Diskussionen. Insbesondere danke ich Steffen Nordzieke und Anna Beier für die Unterstützung, das Zuhören und vor allem das gemeinsame Lachen. Ich danke Tim Dahlmann für die gute und auch nervenaufreibende Zusammenarbeit, gerade bei unserem gemeinsamen Projekt.

Dr. Sandra Bloemendal und Dr. Ines Teichert danke ich für das intensive und kritische Lesen dieser Arbeit und die hilfreichen Anmerkungen und Korrekturvorschläge.

Der Firma Sandoz GmbH (Kundl, Österreich) sowie der Christian Doppler Forschungsgesellschaft (Wien, Österreich) danke ich für die Bereitstellung finanzieller Mittel und ihrem steten Interesse am Fortgang des gesamten Forschungsprojektes. Insbesondere danke ich Herrn Dr. H. Kürnsteiner, Herrn Dr. I. Zadra und Herrn T. Specht für die interessanten Diskussionen und ihre Unterstützung.

Ein herzlicher Dank gilt auch Herrn Prof. Dr. Thomas Stützel und Frau Sabine Adler des Lehrstuhls für Evolution und Biodiversität der Pflanzen für die Nutzung des Rasterelektronenmikroskops. Zudem danke ich Herrn Paul Dyer und Frau Céline O´Gorman für die gute Zusammenarbeit.

Weiterhin danke ich ganz besonders meiner Familie, im Besonderen meinen Eltern und meinem Freund Nils, für die Unterstützung, Liebe, Geduld und das Vertrauen in mich. Zudem möchte ich mich bei meinen Mädels für die jahrelange Freundschaft und Unterstützung bedanken.

Inhaltsverzeichnis I

Inhaltsverzeichnis

Inhaltsverzeichnis ...... I

Abkürzungsverzeichnis ...... III

I. EINFÜHRUNG ...... 1

1. Einleitung ...... 1 2. Anamorph versus Teleomorph ...... 2 2.1 Die Gattung Penicillium (Anamorph) ...... 3 2.2 Die Gattung Eupenicillium (Teleomorph) ...... 4 3. Fortpflanzungssysteme in Ascomyceten ...... 6 4. Kreuzungstyp-Loci ...... 8 4.1 Kreuzungstyp-Loci der Hefe Saccharomyces cerevisiae ...... 10 4.2 Kreuzungstyp-Loci in Ascomyceten ...... 11 4.3 Kreuzungstyp-Loci in Basidiomyceten ...... 12 4.4 Funktion der Kreuzungstyp-Loci ...... 13 5. Potential für sexuelle Reproduktion in als asexuell geltenden Ascomyceten ...... 14 6. Zusammenfassung ...... 17

II. PROBLEMSTELLUNG ...... 19

III. BÖHM J, , HOFF B, O´GORMAN CM, WOLFERS S, KLIX V, BINGER D, ZADRA I,

KÜRNSTEINER H, PÖGGELER S, DYER PS, KÜCK U (2013) Sexual reproduction and mating-type-mediated strain development in the

penicillin-producing fungus Penicillium chrysogenum 23

IV. BÖHM J, DAHLMANN TA, GÜMÜSER H, KÜCK U (2014)

A MAT1-2 wild-type strain from Penicillium chrysogenum: Functional mating- type locus characterization, genome sequencing, and mating with an industrial penicillin-producing strain 24

Inhaltsverzeichnis II

V. GESAMTDISKUSSION ...... 25

1. Die MAT-Transkriptionsfaktoren kontrollieren asexuelle Entwicklungsprozesse ...... 25 2. Hyphenmorphologie und Pelletbildung sind Kreuzungstyp-abhängig reguliert ...... 32 3. MAT1-1-1 reguliert die Penicillin-Biosynthese ...... 35 4. Der sexuelle Zyklus kann in Penicillium chrysogenum induziert werden ...... 38

VI. ZUSAMMENFASSUNG ...... 46

VII. SUMMARY ...... 47

VIII. LITERATUR ...... 48

IX. EIGENANTEIL AN PUBLIKATIONEN ...... 68

X. LEBENSLAUF ...... 69

Abkürzungsverzeichnis III

Abkürzungsverzeichnis

Allgemein gebräuchliche Abkürzungen sowie Einheiten, die dem internationalen Einheitensystem (SI-Einheiten) zuzuordnen sind, sowie Präfixe für dezimale Teile und Vielfache sind nicht gesondert aufgeführt. Aminosäuren sind entweder im Ein- bzw. Drei-Buchstaben-Code aufgeführt. Des Weiteren gelten folgende Abkürzungen:

Δ Deletion Abb. Abbildung AS Aminosäure(n) α α-Box-Domäne bp Basenpaare DIC Differentielle Interferenz-Kontrast-Mikroskopie DNA Desoxyribonukleinsäure H Stunde HMG High mobility group IST Internal transcribed spacer ORF Open reading frame PCR Polymerase-Kettenreaktion qRT-PCR quantitative real-time-PCR rDNA ribosomale DNA RFLP Restriktionsfragmentlängenpolymorphismus RIP Repeat-induced point mutation RNA Ribonukleinsäure SNP Single nucleotide polymorphism UV Ultraviolett

I EINFÜHRUNG 1

I. EINFÜHRUNG 1. Einleitung Die Vermehrung von Pilzen kann auf zwei Arten erfolgen, nämlich asexuell über die Bildung von mitotischen Sporen oder sexuell durch die Produktion von meiotischen Sporen. Dies hat zur Folge, dass die asexuellen Sporen genetisch identisch zu ihren Eltern sind, wohingegen die sexuellen Sporen durch Rekombination während der Meiose genetisch verschieden zu ihren Eltern sind (Milgroom 1996). Bereits seit 1904 ist die Sexualität von Pilzen Thema der Forschung (Blakeslee 1904). Der sexuelle Zyklus ist charakterisiert durch die koordinierte Fusion von sexuell kompatiblen Zellen. Es werden dabei haploide und diploide Phasen durchlaufen, welche die Prozesse der Karyogamie, also die Fusion von haploiden Kernen und meiotische Teilungen von diploiden Kernen beinhalten (Nelson 1996, Shiu und Glass 2000). Die Produkte der Meiose sind wiederum haploide Zellen, die sexuellen Sporen (Nelson 1996, Coppin et al. 1997, Bistis 1998). Die meisten sexuellen Arten sind daneben auch in der Lage, sich asexuell zu vermehren. Der Wechsel zwischen beiden Reproduktionsmechanismen ist dabei anhängig von verschiedensten Umweltfaktoren. In Aspergillus nidulans wird beispielsweise der sexuelle Zyklus durch Kohlenstoff- und Sauerstoffmangel induziert (Paoletti et al. 2007). Im Reich der Pilze sind etwa 98 % aller bekannten Arten den Dikarya zuzuordnen. Dieses Unterreich unterteilt sich in die Abteilungen Ascomyceten und Basidiomyceten, die sich vermutlich vor etwa 500 Millionen Jahren in ihrer Entwicklung getrennt haben (Berbee und Taylor 1993, James et al. 2006). Zu den Ascomyceten zählen etwa 64.000 Arten aufgeteilt in 14 Klassen mit 60 Ordnungen, womit sie die größte Gruppe innerhalb der Pilze darstellen (Hawksworth und Rossman 1997, Hibbett et al. 2007, Kirk et al. 2008, Schoch et al. 2009). Per Definition sind Ascomyceten fähig, sich sexuell zu vermehren und dabei Fruchtkörper zu bilden, die die namensgebenden Asci mit den sexuellen Sporen enthalten. Traditionell erfolgte deshalb die Klassifizierung anhand der Fruchtkörper-Morphologie, die sich in Apothezien, Kleistothezien, Perithezien und Pseudothezien unterteilen lässt (Nelson 1996, Clarkson et al. 2003). Hingegen wurden Pilze, die sich ausschließlich asexuell fortpflanzen können oder deren sexueller Zyklus bislang nicht identifiziert werden konnte, der Abteilung der Deuteromyceten oder Fungi Imperfecti zugeordnet (Hennebert und Weresub 1977). I EINFÜHRUNG 2

Dies stellt allerdings eine künstliche und redundante Einteilung dar, da die Mehrheit der Deuteromyceten aufgrund von Sequenzvergleichen taxonomisch eher der Abteilung der Ascomyceten zugeordnet werden kann. Die Spezies der Deuteromyceten sind daher näher verwandt mit sexuellen Arten als sie es untereinander sind (Taylor 1995, Turgeon 1998, James et al. 2006). Somit gehören nach heutigen Analysen sowohl sexuelle als auch asexuelle Arten zur Abteilung der Ascomyceten, die nun zu etwa 40 % aus Arten besteht, für die bislang ausschließlich die asexuelle Fortpflanzung bekannt ist (Hibbett et al. 2007, Shenoy et al. 2007, Houbraken und Samson 2011, Samson et al. 2011). In den folgenden Kapiteln werden nun detailliert die asexuelle und sexuelle Entwicklung von Ascomyceten, die Kreuzungstyp-Loci der Dikarya und das Potential asexueller Arten für die sexuelle Entwicklung beschrieben.

2. Anamorph versus Teleomorph Aufgrund der früheren Unterteilung in Ascomyceten und Deuteromyceten und somit der Unterscheidung zwischen sexuellen und asexuellen Arten, wurde 1910 durch den International Code of Botanical Nomenclature (ICBN) eine duale Nomenklatur eingeführt. Es entstanden Artnamen, welche die anamorphen und teleomorphen Strukturen der Pilze beschreiben. Als Anamorphe oder Nebenfruchtform wird das asexuelle Entwicklungsstadium eines Pilzes bezeichnet. Die Morphologie der asexuellen Strukturen ist hierbei namensgebend für die Art. Als Teleomorphe oder Hauptfruchtform wird das sexuelle Stadium eines Pilzes benannt; hierbei wird die Morphologie der Fruchtkörper für die Artbezeichnung herangezogen. Dies führte dazu, dass eine Art zwei Artnamen haben konnte, die einmal das anamorphe und einmal das teleomorphe Stadium beschreiben, ohne dass diese beiden Arten miteinander in Verbindung gebracht wurden. Ein Beispiel hierfür sind Hypocrea jecorina (teleomorph) und Trichoderma reesei (anamorph), die bis Mitte der 90er Jahre nicht als eine Art erkannt wurden (Kuhls et al. 1996, Druzhinina et al. 2006). Es gibt jedoch eine Reihe von asexuellen Pilzen, deren sexueller Zyklus bislang nicht bekannt ist. Diese Arten lassen sich aufgrund aktueller molekularer Analysen phylogenetisch in sexuelle Gattungen einordnen, wie beispielsweise Penicillium innerhalb der Gattungen Eupenicillium oder Talaromyces (Houbraken und Samson 2011, Samson et al. 2011). Im Folgenden soll nun detailliert auf die anamorphe Gattung Penicillium, zu der auch der I EINFÜHRUNG 3

in dieser Arbeit untersuchte Organismus gehört, und die entsprechende teleomorphe Gattung Eupenicillium eingegangen werden.

2.1 Die Gattung Penicillium (Anamorph) Die Gattung Penicillium wurde erstmals 1809 von Heinrich Friedrich Link beschrieben, umfasst etwa 250 Arten und gehört phylogenetisch zur Familie der Trichocomaceae (Pitt 1979, Berbee et al. 1995, Peterson 2000, Houbraken und Samson 2011). Es handelt sich um haploide, filamentöse, mitosporische, allgemein ubiquitäre und opportunistische Saprophyten (Raper und Thom 1949, Pitt 1979). Als Grundform der Gattung gilt die Art Penicillium expansum (Thom 1910). Alle Arten der Gattung Penicillium sind per Definition asexuell, da sie anhand der für die asexuelle Sporulation gebildeten Strukturen charakterisiert werden. Sie bilden verzweigte, septierte Konidiophore, an deren Enden Sporen-bildende Zellen, die Phialiden, sitzen. Diese Zellen bilden die asexuellen Sporen, die so genannten Konidiosporen (Konidien). Die gesamte Struktur wird als Penicillius (lat. penicillius = Pinsel) bezeichnet und ist namensgebend für diese Gattung. Traditionell wurde die Anzahl der Verzweigungen im Konidiophor und somit die Morphologie des Penicillius für die Unterscheidung der Arten herangezogen. Der erste Schlüssel zur Unterscheidung der Arten wurde 1910 von Charles Thom aufgestellt (Thom 1910), weitere zwanzig Jahre später erfolgte die Unterteilung in die vier Untergattungen Furcatum, Aspergilloides, Penicillium und Biverticillium (Thom 1930). Das ubiquitäre saprobe Vorkommen und die Fähigkeit zur Produktion von Sekundärmetaboliten wie Mykotoxinen oder Pharmazeutika, zu denen Penicillin und Lovastatin gehören, sind typisch für diese Gattung (Geiser et al. 2000, Pitt und Hocking 2009, Samson et al. 2010). Somit kommt ihr eine besondere Bedeutung zu, da sie viele Arten beinhaltet, die in der Medizin, Biotechnologie und Lebensmittelindustrie genutzt werden (Pitt 1979, Peterson und Horn 2009). Phylogenetische Analysen zeigen, dass Furcatum, Aspergilloides und Penicillium zusammen mit der teleomorphen Gattung Eupenicillium eine monophyletische Gruppe bilden. Die vierte Untergattung Biverticillium verhält sich paraphyletisch zu den anderen und bildet eine Gruppe mit der teleomorphen Gattung Talaromyces (Berbee und Taylor 1993, Peterson 1993, Pitt 1993, Berbee et al. 1995, Peterson 2008). Diese phylogenetischen Beziehungen basieren auf morphologischen Untersuchungen, konnten I EINFÜHRUNG 4

allerdings durch molekulare Analysen wie 18S rDNA-Analysen, ITS-5.8S rDNA- Analysen, β-Tubulin-Sequenzierungen und RFLP-Analysen bestätigt werden (LoBuglio und Taylor 1993, Berbee et al. 1995, Ogawa und Sugiyama 2000, Houbraken und Samson 2011, Samson et al. 2011). Biotechnologisch relevante Beispiele der Untergattung Penicillium sind Penicillium chrysogenum als industrieller Produzent des β-Lactam-Antibiotikums Penicillin, der Antimykotikum-Produzent P. griseofulvum, und die Arten P. roqueforti und P. camemberti, die für die Käseproduktion eingesetzt werden (De Carli und Larizza 1988, Berbee und Taylor 1993, Pitt 1993, Samson et al. 2010). P. chrysogenum ist durch seine Produktion des Antibiotikums Penicillin mit einem Weltmarkwert von 8 Milliarden US$ wohl eine der bekanntesten Arten innerhalb der Penicillien (Demain 2009). Penicillin revolutionierte die Behandlungsmöglichkeiten bei Infektionskrankheiten und wird auch heute zur Bekämpfung bakterieller Infektionen in der Humanmedizin eingesetzt. P. griseofulvum ist der Produzent des Antimykotikums Griseofulvin, welches in der Medizin bei Hauterkrankungen eingesetzt wird (Pitt 1979, Frisvad und Samson 2004). P. camemberti wurde 1906 das erste Mal beschrieben. Er wird zur Produktion von weißem Schimmelkäse, wie Brie oder Camembert, genutzt und ist eine domestizierte Art, deren natürlicher Ursprung unbekannt ist (Raper und Thom 1949, Pitt 1979, Frisvad und Samson 2004). P. roqueforti wurde ebenfalls 1906 das erste Mal beschrieben und wird zur Produktion von blauem Schimmelkäse, wie Roquefort oder Stilton, genutzt (Pitt 1979). Er produziert zudem Mykotoxine sowie auch Mycophenolsäure, die als Immunosuppressivum eingesetzt wird (Frisvad und Samson 2004).

2.2 Die Gattung Eupenicillium (Teleomorph) Das erste Mal wurde ein teleomorphes Stadium innerhalb einer Penicillium-Art 1874 von Julius Oskar Brefeld beschrieben (Pitt 1979). Diese Art war in der Lage, sklerotisierte Kleistothezien zu bilden, die Ketten von Asci mit ornamentierten ellipsoiden Ascosporen beinhalteten. Brefeld bezeichnete diese Art als „Penicillium crustaceum Fries, Penicillium glaucum Link“, später wurde sie als Penicillium crustaceum (L.) Fr. beschrieben (Pitt 1979). 1892 wurde schließlich von Friedrich Ludwig der neue Gattungsname Eupenicillium für das teleomorphe Stadium von I EINFÜHRUNG 5

Penicillium-Arten eingeführt und die Art in Eupenicillium crustaceum (L.) Fr. (P. glaucum) umbenannt (Pitt 1979). Durch die Bestimmungen des ICBN (Artikel 59) lautet der korrekte Name dieser Art inzwischen Eupenicillium crustaceum Ludwig (Scott und Stolk 1967). Der Gattungsname Eupenicillium geriet zwischenzeitlich in Vergessenheit, so dass 1922 die Gattung Carpenteles für Kleistothezien bildende Penicillium-Arten eingeführt wurde (Pitt 1979). 1967 wiederum wurden alle Arten der Gattung Carpenteles in die Gattung Eupenicillium übertragen und weitere neue Arten beschrieben (Scott und Stolk 1967, Scott 1968, Stolk 1968). 1974 wurde dann schließlich ein synoptischer Schlüssel zur Bestimmung von Eupenicillium-Arten eingeführt (Pitt 1974). Die gebildeten Kleistothezien der Gattung Eupenicillium können eine Größe von über 100 µm im Durchmesser erreichen und weisen eine gelbbraune bis orangebraune Färbung auf. Die Wände der Fruchtkörper bestehen aus mehreren Lagen dickwandiger pseudoparenchymatischer Zellen. Sie können ihre volle Reife bereits nach 10 bis 14 Tagen erreichen, in einigen Arten dauert die Bildung von Asci und Ascosporen jedoch drei Wochen oder länger. Die in den Fruchtkörpern enthaltenen Asci entstehen einzeln oder in Ketten und enthalten meist acht unregelmäßig verteilte Ascosporen. Diese sind ellipsoid oder sphärisch, durchsichtig bis gelb und Hitze-resistent (Pitt 1979). Die meisten Arten dieser Gattung sind bodenbürtig und produzieren Mykotoxine (Pitt und Hocking 1997). Parallel zur Beschreibung der ersten Eupenicillium-Art wurde eine weitere Penicillium- Art entdeckt, die ebenfalls in der Lage ist, Fruchtkörper zu bilden. Dabei handelte es sich jedoch nicht um Kleistothezien, sondern um Gymnothezien (Pitt 1979). Gymnothezien sind eine relativ simple Form der Fruchtkörper und bestehen aus einem verwobenen Netzwerk aus Hyphen, welches die Asci umgibt. 1955 wurde der teleomorphe Gattungsname Talaromyces für diese Arten eingeführt (Benjamin 1955). Als repräsentative Art dieser Gattung gilt Talaromyces vermiculatus (Dangeard) C. R. Benjamin, basierend auf P. vermiculatum Dangeard (Benjamin 1955). Die Arten dieser Gattung bilden gelb-weiße Gymnothezien, die keine definierte Zellwand besitzen und aus lose zusammengelagerten Hyphen bestehen (Orr et al. 1977). Die Entstehung von Asci und Ascosporen ist vergleichbar zu Eupenicillium mit der Entwicklung von ellipsoiden, Hitze-resistenten Ascosporen (Pitt 1979). Somit grenzt sich die Gattung Eupenicillium durch die Art der gebildeten Fruchtkörper I EINFÜHRUNG 6

von der Gattung Talaromyces ab. Eupenicillium-Arten haben stets nur Penicillium- Anamorphe, Talaromyces-Arten können Anamorphe in den Gattungen Penicillium, Paecilomyces, Geosmithia und Merimbla haben (Malloch und Cain 1972, 1973, Pitt 1993, Berbee et al. 1995, Ogawa und Sugiyama 2000, Pitt und Hocking 2009). Von den ca. 100 teleomorphen Eupenicillium-Arten, die nah verwandt zur Gattung Penicillium sind, haben alle einen homothallischen, selbstfertilen sexuellen Zyklus (Pitt et al. 2000). Es ist bislang nur eine selbst-sterile heterothallische (siehe Abschnitt 2) Art bekannt, die phylogenetisch zur Gattung Penicillium gehört. Diese wird allerdings der anderen teleomorphen Gattung Talaromyces zugeordnet. Es handelt sich hierbei um die Art Talaromyces derxii (Penicillium derxii) (Takada und Udagawa 1988). Heutzutage ist somit keine heterothallische Art der Gattung Eupenicillium mit Anamorphen in der Gattung Penicillium bekannt. Kürzlich wurden die Vorschläge zur Änderung des Artikels 59 auf der 2011 IBC Nomenclature Section in Melbourne angenommen und die Richtlinie „One Fungus – One Name“ geschaffen (Hawksworth 2011, Hawksworth et al. 2011, Norvell 2011). Priorität wird bei der singulären Nomenklatur auf die älteste Familie, Gattung und Sektion gelegt. Auf Grundlage dieser Richtlinie definierten Houbraken und Samson (2011) mittels phylogenetischer Analysen ausgewählter Loci die Gattung Penicillium neu und bildeten eine monophyletische Gattung für beide anamorphe und teleomorphe Arten unter dem Namen Penicillium sensu stricto, wozu nun auch die meisten Eupenicillium-Spezies gehören.

3. Fortpflanzungssysteme in Ascomyceten In Ascomyceten existieren zwei generelle sexuelle Fortpflanzungssysteme, Heterothallismus und Homothallismus. Heterothallische Arten, wie Neurospora crassa und Aspergillus fumigatus, sind selbst-steril und benötigen einen Partner des anderen Kreuzungstyps, um den sexuellen Zyklus durchlaufen zu können (Metzenberg und Glass 1990, Pöggeler 2002, O'Gorman et al. 2009). Der Kreuzungstyp wird in Pilzen über den Kreuzungstyp-Locus (mating type locus = MAT locus) festgelegt, dessen Aufbau und Funktion in Kapitel 3 detailliert erläutert wird. Homothallische Arten sind selbst-fertil und können den sexuellen Zyklus ohne Partner abschließen, sind aber auch in der Lage, sich mit einem Kreuzungspartner zu paaren (Burnett 2003). Die beiden I EINFÜHRUNG 7

Kreuzungstyp-Loci liegen hier gemeinsam in einem Genom vor, entweder fusioniert, wie in Sordaria macrospora (Pöggeler et al. 1997), oder ungekoppelt auf zwei verschiedenen Chromosomen, wie in A. nidulans (Paoletti et al. 2007). Beide Fortpflanzungssysteme führen zu gleichen Vorgängen in der sexuellen Entwicklung mit einem Wechsel des Ploidie-Zustands, der Meiose und der Bildung rekombinanter Nachkommen; dennoch unterscheiden sie sich in einigen Aspekten, wie beispielsweise der Zellfusion (Shiu und Glass 2000). Zudem führt die Kreuzung zweier kompatibler Partner in heterothallischen Arten grundsätzlich zur Rekombination der genetischen Information in den Nachkommen, da zwei verschiedene Kerne und somit auch Genome beteiligt sind (Glass und Kuldau 1992). In homothallischen Arten ist die Selbstung äquivalent zur asexuellen Vermehrung, da es bis auf wenige Ausnahmen, wie das Phänomen der eingeschlechtlichen Rekombination in Cryptococcus neoformans (Ni et al. 2013), nicht zur Rekombination kommt und die Nachkommen dieselbe genetische Information besitzen (Nauta und Hoekstra 1992). Da sich diese Arten allerdings auch mit anderen Stämmen paaren können, wird die genetische Vielfalt erhalten. Ein Diskussionspunkt der aktuellen Forschung ist, welches der beiden Fortpflanzungssysteme der Ursprungszustand sein könnte. Beide Systeme sind in verschiedenen Arten einer Gattung vertreten, wie es beispielsweise auch in Penicillium- und Aspergillus-Arten der Fall ist (Heitman 2006). Zudem konnte in Cochliobolus heterostrophus der Wechsel des Fortpflanzungssystems durch genetische Veränderung des Kreuzungstyp-Locus herbeigeführt werden, was einen Hinweis darauf gibt, dass beide Systeme einen gemeinsamen evolutionären Ursprung haben (Yun et al. 1999). Ob nun der Homothallismus aus dem Heterothallismus heraus entstanden ist oder umgekehrt, ist nicht bekannt, es gibt allerdings Argumente für beide Möglichkeiten. Für einen homothallischen Ursprungszustand spricht, dass in Aspergillus-Arten, wie zum Beispiel A. fumigatus, der eine Kreuzungstyp-Locus Teile des anderen Locus enthält, so dass der Wechsel von Homo- zu Heterothallismus durch Genverlust zu erklären wäre (Geiser et al. 1998, Varga 2003, Galagan et al. 2005). Die Entdeckung, dass einige Arten, wie beispielsweise Cryptococcus neoformans, fähig sind, den sexuellen Zyklus ohne Beteiligung des Kreuzungstyp-Locus zu durchlaufen, unterstützt die Vorstellung, dass die Ursprungsform ein homothallischer Pilz mit nur einem Kreuzungstyp-Locus ist (Ni et al. 2011). I EINFÜHRUNG 8

Andere Daten weisen darauf hin, dass das heterothallische Fortpflanzungssystem wahrscheinlich ursprünglich in Zygomyceten, Basidiomyceten und Ascoymceten ist (Coppin et al. 1997, Kronstad und Staben 1997, Yun et al. 1999, Butler et al. 2004, Butler 2007, Fraser et al. 2007, Rydholm et al. 2007). Bei der Entstehung von homothallischen Arten würde dann ein Kreuzungstyp-Locus verloren gehen, welcher dann im Genom des Organismus mit dem verbliebenen Locus aufgenommen würde (Turgeon 1998, Paoletti et al. 2007). Hierfür spricht zudem, dass in heterothallischen Arten die Kreuzungstyp-Loci konserviert vorliegen, in homothallischen Arten jedoch die Gen-Anordnung und Orientierung variiert (Yun et al. 1999). Auch phylogenetische Analysen zeigen, dass homothallische Cochliobolus-Arten polyphyletisch sind. Hier konnte zudem nachgewiesen werden, dass in der homothallischen Art Cochliobolus luttrellii verglichen mit der heterothallischen Art C. heterostrophus 115 Aminosäuren am 3`-Ende des MAT1-1 Proteins und 49 Aminosäuren am 5`-Ende des MAT1-2 Proteins fehlen. Ein Rekombinationsereignis an einer 8 bp Sequenz, die in beiden Kreuzungstyp-Loci von C. heterostrophus identisch vorliegt, würde zur exakten Sequenz des fusionierten Kreuzungstyp-Locus in C. luttrellii führen (Turgeon 1998). Homothallische Arten vereinen zudem die Vorteile von heterothallischen und asexuellen Arten. Ascosporen sind resistenter und langlebiger als Konidiosporen. Durch das Kreuzen verschiedener Isolate können günstige Mutationen kombiniert und ungünstige Mutationen behoben werden. Somit kann eine homothallische Art besser überleben und sich in einer heterothallischen Population verteilen als umgekehrt (Coppin et al. 1997). So existieren nur vergleichsweise wenige heterothallische Aspergillus- und Penicillium- Arten, wohingegen eine größere Anzahl von homothallischen Arten bekannt ist (Galagan et al. 2005, Fraser et al. 2007). In den Gattungen Eupenicillium und Talaromyces ist von den etwa 100 teleomorphen Arten nur eine heterothallische Art bekannt (Pitt et al. 2000). Da in heterothallischen Arten die sexuelle Entwicklung nur zwischen Partnern des gegensätzlichen Kreuzungstyps stattfinden kann, soll in den folgenden Kapiteln detailliert auf die Struktur, Organisation und Funktion der Kreuzungstyp-Loci eingegangen werden.

4. Kreuzungstyp-Loci In Eukaryoten haben sich verschiedenste, unabhängige Systeme entwickelt, die das I EINFÜHRUNG 9

Geschlecht eines Organismus bestimmen (Fraser und Heitman 2005). In Wirbeltieren erfolgt die Bestimmung des Geschlechts über Geschlechts-Chromosomen, in niederen Eukaryoten wird dies durch bestimmte Regionen im Genom, die sogenannten Kreuzungstyp-Loci, bestimmt. Damit die sexuelle Entwicklung in heterothallischen Arten stattfinden kann, ist das Vorhandensein der gegensätzlichen Kreuzungstyp-Loci in zwei Kreuzungspartnern erforderlich. An diesem Locus befindet sich in heterothallischen Arten eine von zwei unterschiedlichen Sequenzen an der identischen Stelle im Genom, die in Form und Struktur voneinander abweichen. Da die Sequenzen verschieden sind, kann man hier nicht von Allelen sprechen, welche alternative Formen eines Gens an der gleichen Position im Genom darstellen. Daher wurde der Begriff Idiomorph eingeführt (Turgeon und Yoder 2000). Umgeben ist der Keuzungstyp-Locus häufig von den konservierten Genen SLA2, welches für einen cytoskeleton assembly control factor kodiert, und APN2, welches für eine DNA-Lyase kodiert (Galagan et al. 2005, Dyer 2007, Paoletti et al. 2007, Rydholm et al. 2007). In homothallischen Arten befinden sich die Kreuzungstypgene, wie bereits erwähnt, gekoppelt oder ungekoppelt im selben Genom eines Organismus (Pöggeler et al. 1997, Pöggeler und Kück 2000, Dyer et al. 2003, Galagan et al. 2005, Paoletti et al. 2007). Die Kreuzungstyp-Loci enthalten in der Regel ein bis drei offene Leserahmen (open reading frames, ORFs), die für Proteine mit unterschiedlichen DNA-Bindedomänen kodieren. Der MAT1-1 Kreuzungstyp-Locus kodiert hierbei in der Regel mindestens für ein Protein mit einer α-Box-DNA-Bindedomäne, welches dem α1-Protein der Hefe Saccharomyces cerevisiae gleicht. Dies ist in MAT1-1-Stämmen das entscheidende Protein für die sexuelle Identität und die anschließende sexuelle Entwicklung (Glass et al. 1990, Saupe et al. 1996, Ferreira et al. 1998). Der MAT1-2 Locus hingegen kodiert mindestens für ein Protein mit einer high mobility group (HMG)-DNA-Bindedomäne, welches ebenfalls für die sexuelle Identität von Relevanz ist (Chang und Staben 1994). In heterothallischen Arten kann der sexuelle Zyklus nur zwischen Individuen gegensätzlicher Kreuzungstypen eingeleitet werden (Metzenberg 1990, Metzenberg und Glass 1990). Der Kreuzungstyp-Locus bestimmt allerdings nicht nur die sexuelle Identität von Pilzen, sondern auch spätere Prozesse der sexuellen Entwicklung (Debuchy und Turgeon 2006, Debuchy et al. 2010).

I EINFÜHRUNG 10

Abb. 1: Organisation der Kreuzungstyp-Loci in Ascomyceten und Basidiomyceten. Dargestellt sind vergleichend die beiden Kreuzungstyp-Loci MAT1-1 und MAT1-2. Die Genbezeichnungen befinden sich unterhalb der Pfeile, wobei jeweils die homologen Gene untereinander und in gleicher Farbe dargestellt sind. Durch die Farbgebung wird ebenfalls die entsprechende DNA-Bindedomäne gekennzeichnet, die α-Box-Domäne in dunkelblau, die Homeodomäne in türkis und gelb, die HMG-Domäne in rot und hellblau, die PPF-Domäne in mittelblau und keine bekannte Domäne in weiß. Die Pfeile deuten die Orientierung der Gene am Locus an.

4.1 Kreuzungstyp-Loci der Hefe Saccharomyces cerevisiae Besonders intensiv wurden die Kreuzungstypgene in der Hefe S. cerevisiae analysiert. Traditionell wird hier nicht in einen MAT1-1 und MAT1-2 Locus unterteilt, sondern zwischen MATα und MATa-Stämmen unterschieden. In Abbildung 1 sind die Kreuzungstyp-Loci der Hefe denen aus filamentösen Ascomyceten und Basidiomyceten vergleichend gegenübergestellt. Der MATα-Kreuzungstyp-Locus besteht aus zwei Genen, α1 und α2, die für die Proteine MATα1 und MATα2 kodieren (Haber 2012). MATα1 ist hierbei der Transkriptionsfaktor mit der charakteristischen α-Box DNA- Bindedomäne, der zusammen mit dem Protein Mcm1 α-spezifische Gene aktiviert. Dazu gehören die Gene des α-Faktors, welcher als Pheromon in der Zell-Zell- Erkennung wirkt, und des Ste2-Pheromonrezeptors, welcher das entgegengesetzte Pheromon, den a-Faktor erkennt (Klar 1987, Hagen et al. 1993, Bruhn und Sprague I EINFÜHRUNG 11

1994). MATα2 hingegen ist ein Protein mit einer Homeodomäne, welches zusammen mit Mcm1 als Repressor auf a-spezifische Gene, wie das Pheromonvorläufer-Gen des a-Faktors und das Gen des Ste3-Pheromonrezeptors, wirkt (Bardwell 2005). Am MATa- Locus befinden sich ebenfalls zwei Gene, die einerseits für den Homeodomänen- Transkriptionsfaktor MATa1 kodieren und andererseits für ein Protein, dessen Funktion bisher noch nicht geklärt ist (Tatchell et al. 1981). In diploiden Zellen bilden die beiden Transkriptionsfaktoren MATa1 und MATα2 ein Heterodimer, welches die Expression von Genen, die spezifisch für den haploiden Zustand sind, unterdrückt und von Genen spezifisch für den diploiden Zustand aktiviert (Dolan und Fields 1991). Ein Phänomen in S. cerevisiae ist zudem die Fähigkeit, den Kreuzungstyp-Locus zu wechseln, was als mating-type switch bezeichnet wird. Hierfür liegen zwei intakte, aber nicht exprimierte, Kopien der Kreuzungstyp-Idiomorphe, HMLα (Hidden MAT Left) and HMRa (Hidden MAT Right), an beiden Enden des gleichen Chromosoms, auf dem sich der eigentliche Kreuzungstyp-Locus befindet, vor. Sie dienen als Spender während des Kreuzungstyp- Wechsels und ihre Expression wird durch kurze Heterochromatin-Fragmente unterdrückt (Nasmyth 1982, Weiss und Simpson 1998, Ravindra et al. 1999). Während des mating-type switch wird der eigentliche MAT-Locus durch eine Kopie des entsprechenden HMLα- oder HMRa-Locus ersetzt. Dabei verbleiben die beiden Spender-Loci unverändert im Genom (Hicks et al. 1979). Dieses asymmetrische Rekombinationsereignis wird als Genkonversion bezeichnet und durch Doppelstrangbrüche, hervorgerufen durch die HO-Endonuklease, induziert (Strathern et al. 1982, Kostriken et al. 1983). Aufgrund der Fähigkeit des Kreuzungstyp-Wechsels ist S. cerevisiae funktionell homothallisch.

4.2 Kreuzungstyp-Loci in Ascomyceten In Hyphenpilzen werden die Kreuzungstyp-Loci als MAT1-1 und MAT1-2 bezeichnet (Turgeon und Yoder 2000). Die Gene an diesen Loci wurden entsprechend bekannter Homologe in anderen Organismen benannt und ansonsten der Reihe nach durchnummeriert, wobei grundsätzlich das MAT1-1-1 Gen für das Protein mit der α-Box-Domäne kodiert und das MAT1-2-1 Gen für das Protein mit der HMG-Domäne (Debuchy und Turgeon 2006). Diese HMG-Domäne ist in der Hefe nicht vorhanden, ist aber Bestandteil vieler Transkriptionsfaktoren von niederen und höheren Eukaryoten. I EINFÜHRUNG 12

HMG-Proteine gelten als Grundform der Kreuzungstyp-Proteine in Pilzen, da die Kreuzungstyp-Loci sexM und sexP der Zygomyceten, die sich früh von den Dikarya abgespalten haben, für HMG-Domänen-Proteine kodieren und keine α-Box-Proteine vorliegen (Idnurm et al. 2008). Gut untersucht ist der Kreuzungstyp-Locus in N. crassa (Metzenberg und Glass 1990, Ferreira et al. 1998, Pöggeler und Kück 2000, Ni et al. 2011). Wie in Abbildung 1 zu sehen ist, liegen am MAT1-1 Locus die drei Gene MAT1-1-1, MAT1-1-2 und MAT1-1-3 vor. Hierbei kodiert MAT1-1-1 für das α-Box- Protein, MAT1-1-2 für ein Protein mit einer konservierten PPF-Domäne, benannt nach den drei konservierten Aminosäureresten Prolin, Prolin und Phenylalanin, und MAT1-1-3 für ein Protein mit einer HMG-Domäne, deren Struktur aber verschieden zur HMG-Box der Proteine am MAT1-2 Locus ist (Metzenberg und Glass 1990, Debuchy und Turgeon 2006). Am MAT1-2 Locus befinden sich zwei Gene, besagtes MAT1-2-1 Gen, welches für das Protein mit der HMG-DNA-Bindedomäne kodiert und das MAT1-2-2-Gen, dessen Funktion unbekannt ist (Staben und Yanofsky 1990, Pöggeler und Kück 2000). Interessanterweise liegt in der nah mit N. crassa verwandten Art S. macrospora ein homothallisches Fortpflanzungssystem und somit Orthologe der Kreuzungstypgene verbunden an einem Locus vor. Es existieren ebenfalls die Gene MAT1-1-1, MAT1-1-2 und MAT1-2-1. Zudem scheint das MAT1-1-3 Gen eine fusionierte Variante der MAT1-1-3 und MAT1-2-2 Gene aus N. crassa zu sein (Pöggeler et al. 1997, Pöggeler und Kück 2000). Wie in Abbildung 1 zu sehen ist, liegt in P. chrysogenum an jedem Locus nur ein MAT-Gen vor. MAT1-1-1 kodiert für das Protein mit der konservierten α-Box-Domäne, MAT1-2-1 für das Protein mit der HMG- DNA-Bindedomäne (Hoff et al. 2008). Tatsächlich haben alle heterothallischen Ascomyceten ein bipolares Kreuzungssystem, da nur zwei Kreuzungstypen existieren und auch die Nachkommen nur einen der beiden Kreuzungstypen haben können. Dies führt in natürlichen Populationen zu einer 1:1-Verteilung der Kreuzungstyp-Loci.

4.3 Kreuzungstyp-Loci in Basidiomyceten Anders als in Ascomyceten kann in Basidiomyceten auch ein tetrapolares Kreuzungssystem mit zwei ungekoppelten Loci, a und b, im jeweiligen Organismus auftreten (Raper und Raper 1966, Raper 1983). Ein gut untersuchtes Beispiel ist Ustilago maydis (Schulz et al. 1990, Bölker et al. 1992). Der b-Locus enthält zwei I EINFÜHRUNG 13

gegenläufig orientierte Gene, die für die Homeodomänen-Proteine bE und bW kodieren, wie in Abbildung 1 zu erkennen ist. Die Proteine des b-Locus sind homolog zu den α2- und a1-Proteinen der Hefe und müssen für die Induktion der sexuellen Entwicklung ebenfalls ein Heterodimer bilden (Kronstad und Leong 1989, 1990, Kämper et al. 1995, Kahmann und Bölker 1996, Kronstad und Staben 1997). Der a-Locus enthält die Gene des Pheromon-Pheromonrezeptor-Systems, die an der Partner-Erkennung und der Zellfusion während des Kreuzungsprozesses beteiligt sind (Bölker et al. 1992). Der b-Locus ist multi-allelisch und es existieren 25 Allele dieses Locus in U. maydis. Der a-Locus hingegen ist biallelisch, womit zwei Allele des Locus vorliegen (Casselton und Olesnicky 1998). Für die Induktion des sexuellen Zyklus müssen in beiden Kreuzungspartnern beide Loci verschieden sein (Casselton und Olesnicky 1998).

4.4 Funktion der Kreuzungstyp-Loci Da die Proteine der Kreuzungstyp-Loci spezifische, konservierte DNA-Bindedomänen beinhalten, geht man davon aus, dass sie als Transkriptionsfaktoren wirken (Coppin et al. 1997, Jacobsen et al. 2002, Dyer 2007). Es konnte gezeigt werden, dass die HMG- Bindedomäne allein ausreichend für die DNA-Bindung in vitro ist (Kronstad und Staben 1997). Wie bereits erwähnt, sind die α- und HMG-Box-Proteine für die Bestimmung der sexuellen Identität essentiell (Kronstad und Staben 1997). Zudem gelten sie als Hauptregulatoren der Expression von Pheromon- und Pheromonrezeptor-Genen, die in hetero- und homothallischen Pilzen notwendig für die Zell-Zell-Erkennung, die Befruchtung und die Kernfusion sind (Pöggeler 2000, Seo et al. 2004). Das Pheromon-Pheromonrezeptorsystem ist besonders gut in den Hefen S. cerevisiae und Schizosaccharomyces pombe untersucht. Hier wird durch Pheromone die Fusion von Zellen des gegensätzlichen Kreuzungstyps vermittelt. MATa-Zellen sekretieren hierbei das a-Faktor-Pheromon, MATα-Zellen das α-Faktor-Pheromon. Diese binden an den Oberflächenrezeptor der Zellen des gegensätzlichen Kreuzungstyps. Diese Pheromonbindung aktiviert einen Signalweg, der zum G1 Zellzyklus-Arrest, zur Fusion der haploiden Zellen und zur Bildung von diploiden MATa/α-Zellen führt (Kurjan 1993, Leberer et al. 1997). Das reife α-Faktor-Pheromon ist ein 13 Aminosäuren langes Peptid, welches durch Proteolyse eines langen Vorläufers entsteht. Das a-Faktor- Pheromon ist eine Mischung aus zwei 12 Aminosäuren langen Lipopeptiden, die aus zwei ähnlichen Vorläufern mit einem C-terminalen CaaX-Motiv gebildet werden (Duntze et al. 1994). Die Pheromonrezeptoren Ste2p und Ste3p gehören zur Familie der G-Protein-gekoppelten Rezeptoren (GPCRs) mit sieben Transmembran-Domänen. Kontrolliert wird die Expression der I EINFÜHRUNG 14

Pheromonvorläufer- und Pheromonrezeptor-Gene direkt durch die von den Kreuzungstyp-Loci kodierten Transkriptionsfaktoren (Debuchy 1999).

Des Weiteren konnte gezeigt werden, dass die MAT-Transkriptionsfaktoren essentiell für die Fruchtkörper-Bildung und die Meiose in vielen sexuellen Ascomyceten mit sexuellem Zyklus sind (Arnaise et al. 1997, Arnaise et al. 2001, Miller und Brooks 2005, Pöggeler et al. 2006a, Debuchy et al. 2010, Klix et al. 2010, Szewczyk und Krappmann 2010). Somit ist es möglich, dass die Kreuzungstypgene als Transkriptionsfaktoren neben der Regulation der sexuellen Entwicklung auch zusätzliche Funktionen übernommen haben und Prozesse, wie die asexuelle Sporulation, Morphologie und den Sekundärmetabolismus, kontrollieren (Glass et al. 1990, Staben und Yanofsky 1990, Kück und Böhm 2013). Die Aufklärung der Funktion der Kreuzungstypgene in P. chrysogenum soll daher Gegenstand dieser Arbeit sein.

5. Potential für sexuelle Reproduktion in als asexuell geltenden Ascomyceten Wie bereits erwähnt, gelten etwa 40 % der Ascomyceten als asexuell. Dabei ist nicht klar, ob es sich dabei um eindeutig asexuelle Arten handelt oder ob der sexuelle Zyklus bislang nur nicht induziert werden konnte. Für letzteres spricht, dass auf Grundlage der steigenden Anzahl der zur Verfügung stehenden Genom-Sequenzierungen immer mehr Hinweise auf mögliche sexuelle Zyklen in diesen Pilzen vorhanden sind. Ein erster indirekter Hinweis hierfür ist das Vorhandensein der Kreuzungstyp-Loci und ihre 1:1- Verteilung in einer potentiell heterothallischen Population (Linde et al. 2003, Paoletti et al. 2005, Groenewald et al. 2006, Woo et al. 2006). So konnten in verschiedensten Ascomyceten, auch innerhalb der Gattungen Aspergillus und Penicillium, die Kreuzungstypgene nachgewiesen werden, die in Tabelle 1 zusammengefasst sind. In weiteren Analysen konnte zudem die Expression dieser Gene sowie auch der Gene für das Pheromon-Pheromonrezeptorsystem nachgewiesen werden, wie beispielsweise in P. chrysogenum (Sharon et al. 1996, Yun et al. 2000, Kerenyi et al. 2004, Galagan et al. 2005, Paoletti et al. 2005, Woo et al. 2006, Hoff et al. 2008). Dass diese Gene auch funktional sind, konnte über heterologe Komplementationsstudien in Arten mit bekanntem sexuellen Zyklus überprüft werden (Arnaise et al. 1993, Sharon et al. 1996, Coppin et al. 1997, Pöggeler et al. 1997, Pyrzak et al. 2008). Ein Beispiel hierfür ist der MAT1-1 Locus von Acremonium chrysogenum, der in einen Stamm mit deletiertem I EINFÜHRUNG 15

Tabelle 1: Hinweise auf einen sexuellen Zyklus in als asexuell geltenden Ascomyceten. Organismus Hinweise auf sexuellen Zyklus Referenz

Acremonium - Nachweis des MAT1-1 Locus Pöggeler et al. (2008) chrysogenum - Nachweis der Funktionalität der MAT-Gene Ashbya gossypii - Nachweis der Kreuzungstyp-Loci Dietrich et al. (2013) Aspergillus flavus - Induktion des sexuellen Zyklus Horn et al. (2009a) Olarte et al. (2012) Aspergillus fumigatus - Induktion des sexuellen Zyklus O`Gorman et al. (2009) Aspergillus niger - Nachweis des MAT1-1 Locus Pel et al. (2007) Aspergillus nomius - Induktion des sexuellen Zyklus Horn et al. (2011) Aspergillus oryzae - Nachweis der Kreuzungstyp-Loci Wada et al. (2012) - 1:1-Verteilung der Kreuzungstypen Aspergillus - Induktion des sexuellen Zyklus Horn et al. (2009b) parasiticus Aspergillus terreus - Induktion des sexuellen Zyklus Arabatzis und Velegraki (2013) Aspergillus - Induktion des sexuellen Zyklus Horn et al. (2013) tubingensis Fusarium tucumaniae - Induktion des sexuellen Zyklus Covert et al. (2007) Penicillium - Nachweis der Kreuzungstyp-Loci Braumann et al. (2008) chrysogenum - Nachweis der Expression von MAT Hoff et al. (2008) Genen und Pheromongenen - 1:1-Verteilung der Kreuzungstypen - RIP-Mutation Trichoderma reesei - Induktion des sexuellen Zyklus Seidl et al. (2009)

MAT Locus von Podospora anserina eingebracht wurde. Die anschließende Kreuzung mit einem MAT1-2 Isolat von P. anserina führte zur Fruchtkörper-Bildung und der Produktion von Ascosporen. Somit konnte der Nachweis erbracht werden, dass der MAT1-1 Locus von A. chrysogenum die sexuelle Entwicklung induzieren kann und I EINFÜHRUNG 16

somit funktional ist (Pöggeler et al. 2008). Einen weiteren Hinweis auf einen sexuellen Zyklus liefert der Nachweis des Gen-Silencing-Prozesses der repeat-induced point (RIP)-Mutation und beteiligter homologer Proteine dieses Prozesses in asexuellen Arten, wie A. oryzae, A. niger, P. roqueforti, T. reesei und P. chrysogenum, da dieser während der sexuellen Entwicklung auftritt (Hamann et al. 2000, Galagan und Selker 2004, Galagan et al. 2005, Monroy und Sheppard 2005, Montiel et al. 2006, Braumann et al. 2008, Martinez et al. 2008, Ropars et al. 2012). Der Prozess der RIP-Mutation wurde erstmalig in N. crassa nachgewiesen (Selker et al. 1987). Dieses Phänomen tritt während der Rekombination nach der Befruchtung, aber vor der Karyogamie auf und sorgt für die Mutation duplizierter Gene, wie Transposons, im Genom. Dabei erfolgen C zu G- und A zu T-Austausche in der Original-Sequenz und der inserierten Sequenz. Dadurch steigt die Wahrscheinlichkeit der Entstehung eines Stop-Codons und somit des Funktionsverlusts beider Sequenzen (Montiel et al. 2006). In Pilzen hat sich dieser Vorgang als Genom-Abwehrmechanismus gegen transposable Elemente durchgesetzt. Dieser Vorgang konnte auch in anderen Arten als N. crassa nachgewiesen werden, wie in den sexuellen Arten A. nidulans, Podospora anserina und A. fumigatus.

Aufgrund dieser Daten wurden zahlreiche Kreuzungsversuche von als asexuell geltenden Arten unternommen. Die ersten erfolgreichen Kreuzungen wurden mit A. fumigatus durchgeführt (O'Gorman et al. 2009). Hierzu wurden die bekannten Bedingungen zur Induktion des sexuellen Zyklus von A. nidulans verwendet, wie Sauerstoff-Mangel, Haferflocken-Medium und Dunkelheit (Todd et al. 2007). Ähnliche Bedingungen führten dazu, dass die sexuelle Entwicklung auch in zahlreichen anderen Aspergillus-Arten, wie A. terreus und A. flavus induziert werden konnte, wie in Tabelle 1 zusammengefasst ist (Horn et al. 2009a, Horn et al. 2009b, Horn et al. 2011, Arabatzis und Velegraki 2013, Horn et al. 2013, Swilaiman et al. 2013). Interessanterweise konnten parallel erfolgreiche Kreuzungen in industriell genutzten Isolaten von Trichoderma reesei durchgeführt werden (Seidl et al. 2009). Dies galt als problematisch, da diese Stämme für lange Zeit im Labor gehalten wurden und durch Mutagenese-Prozesse für die industrielle Produktion optimiert wurden. Diese Mutationen hätten auch Gene für die sexuelle Entwicklung betreffen können, was zum Funktionsverlust hätte führen können. Weitere Beispiele für die erfolgreiche Induktion eines sexuellen Zyklus in als asexuell geltenden Ascomyceten sind Fusarium tucumaniae und Fusarium virguliforme (Covert et al. 2007). I EINFÜHRUNG 17

Dennoch garantiert die Anwesenheit der Kreuzungstyp-Loci nicht immer, dass auch ein sexueller Zyklus induziert werden kann. Mutationen in für den sexuellen Zyklus essentiellen Genen können zu einem Funktionsverlust führen, wie beispielsweise in Candida parapsilopsis (Logue et al. 2005). Ein weiterer Grund könnte das Fehlen eines passenden Kreuzungspartners sein. Hypomyces solani-Isolate beider Kreuzungstypen sind in der Natur beispielsweise nicht am selben Ort zu finden. Werden sie allerdings zusammengebracht, kann der sexuelle Zyklus abgeschlossen werden (Snyder et al. 1975). In A. chrysogenum, dem Produzenten des β-Lactam Antibiotikums Cephalosporin C, konnte der MAT1-1 Locus, der auch exprimiert wird, in Produktions- und Wildtypstämmen nachgewiesen werden (Pöggeler et al. 2008). Somit würde die Möglichkeit eines sexuellen Zyklus bestehen, allerdings konnte bisher kein Stamm mit MAT1-2 Locus identifiziert werden. Ein weiterer Grund für den Verlust des sexuellen Zyklus kann auch langes Halten der Stämme unter Laborbedingungen und wiederholtes Überimpfen sein, wie es bei Histoplasma capsulatum der Fall ist. Hier besitzen die Stämme intakte Kreuzungstyp-Loci, dennoch verlieren sie nach einiger Zeit im Labor die Fähigkeit den sexuellen Zyklus zu durchlaufen (Fraser et al. 2007). Eventuell wurden auch die optimalen Bedingungen zur Induktion des sexuellen Zyklus noch nicht identifiziert. In S. pombe beispielsweise führt ein Mangel an Stickstoff zu einer erhöhten Expression der Kreuzungstypgene (Pöggeler 2001), in A. nidulans induziert ein Kohlenstoff- und Sauerstoffmangel den sexuellen Zyklus (Paoletti et al. 2007). Wie bereits erwähnt, wird der sexuelle Zyklus in Aspergillus-Arten durch Sauerstoffabschluss und Inkubation auf Vollmedium in Dunkelheit induziert. In T. reesei und Pyronema confluens hingegen ist die Anwesenheit von Licht unabkömmlich (Nowrousian und Kück 2006, Seidl et al. 2009). Zusammenfassend kann festgehalten werden, dass das Potential für einen sexuellen Zyklus in zahlreichen, auch biotechnologisch relevanten Ascomyceten, wie P. chrysogenum, gegeben ist. Nach Identifizierung der passenden Kreuzungspartner und der optimalen Kreuzungsbedingungen sollte die sexuelle Entwicklung in vielen dieser Pilze möglich sein.

6. Zusammenfassung Innerhalb der Ascomyceten sind viele Arten bekannt, die sich ausschließlich asexuell I EINFÜHRUNG 18

fortpflanzen können (Hawksworth et al. 1995). Hier stellt sich die Frage, ob diese wirklich strikt asexuell sind oder der sexuelle Zyklus bislang nur nicht induziert werden konnte. Phylogenetische Analysen zeigen, dass sexuelle und asexuelle Arten nah verwandt sind; sie sind sogar innerhalb einer Gattung verteilt, wie Eupenicillium crustaceum und Penicillium chrysogenum in der Gattung Penicillium (Houbraken und Samson 2011). Weitere Analysen zeigten jedoch, dass viele asexuelle Arten die genetischen Voraussetzungen für die sexuelle Entwicklung besitzen. So sind die Kreuzungstyp-Loci und Gene des Pheromon-Pheromonrezeptorsystems meist vorhanden und funktionell (Hoff et al. 2008). Durch dieses Wissen und die Wahl der optimalen Kreuzungsbedingungen konnte bereits in einer immer größer werdenden Anzahl von Pilzen der sexuelle Zyklus induziert werden, wie beispielsweise in A. fumigatus (O'Gorman et al. 2009). Interessanterweise gelten gerade viele biotechnologisch relevante Pilze als asexuell. Sollte in diesen ebenfalls der sexuelle Zyklus induziert werden können, eröffnet dies die Möglichkeit, sexuelle Kreuzungen zur Erzeugung rekombinanter Stämme und somit auch zur Stammoptimierung für die industrielle Produktion pharmazeutisch wichtiger Produkte einzusetzen.

II PROBLEMSTELLUNG 19

II. PROBLEMSTELLUNG Die sexuelle Entwicklung in Ascomyceten ist ein energiereicher Prozess, bei dem spezielle Fortpflanzungsorgane oder Fruchtkörperstrukturen gebildet werden (Rice 2002). So entstehen in heterothallischen Arten zu Beginn die weiblichen Fortpflanzungsorgane, die Ascogone, und beim Partner mit gegensätzlichem Kreuzungstyp die männlichen Strukturen, die Antheridien. Nach der Befruchtung beginnt die Fruchtkörperbildung, während die Kerne der verschiedenen Kreuzungspartner sich vervielfältigen und in die spezialisierten, ascogenen Hyphen wandern. Die anschließende Hakenbildung sorgt dafür, dass jeweils zwei Kerne koordinierte Mitosen durchlaufen und durch Septenbildung anschließend laterale und basale einkernige Zellen und eine apikale zweikernige Zelle entstehen, in welcher die Karyogamie stattfindet. In dem dabei entstehenden diploiden Kern erfolgt die Meiose, gefolgt von einer bis mehreren post-meiotischen Mitosen. Die dabei gebildeten haploiden Zellen stellen dann die Ascosporen dar (Nelson 1996, Coppin et al. 1997, Bistis 1998, Shiu und Glass 2000). Trotz des hohen Energiebedarfs bringt die sexuelle Vermehrung erhebliche Vorteile gegenüber der asexuellen Vermehrung mit sich. Sie führt zur genetischen Variabilität und zahlreichen neuen Genotypen innerhalb einer Population (Milgroom 1996). Eine ungünstige oder schädliche Mutation kann durch Rekombination entfernt werden (Hurst und Peck 1996, Zeyl und Bell 1997, Goddard und Hayes 2007), während positive Mutationen zusammengeführt werden können und die Population sich besser und schneller einer veränderten Umwelt anpassen kann (Felsenstein 1974, Hurst und Peck 1996, Zeyl und Bell 1997, Goddard et al. 2005, Goddard und Hayes 2007). Durch die Möglichkeit der sexuellen Kreuzung könnten klassische genetische Analysen durchgeführt und die Stammentwicklung industrieller und biotechnologisch relevanter Pilze, wie beispielsweise Penicillium chrysogenum, untersucht werden. So führte in Tapesia yallundae und Mycosphaerella graminicola der sexuelle Zyklus zu der Entdeckung von Resistenzmechanismen und der Entwicklung von Abwehrmaßnahmen gegen diese Pflanzen-pathogenen Pilze, was eine enorme ökonomische Bedeutung hat (Dyer et al. 2001, Brading et al. 2002). Der Hyphenpilz P. chrysogenum wurde bislang den Deuteromyceten oder Fungi imperfecti zugeordnet, da bisher ausschließlich eine asexuelle Vermehrung mittels II PROBLEMSTELLUNG 20

Konidiosporen beschrieben wurde. Dennoch konnten durch PCR-Analysen die für die sexuelle Entwicklung notwendigen Kreuzungstyp-Loci, MAT1-1 und MAT1-2 mit den entsprechenden Genen MAT1-1-1 und MAT1-2-1 identifiziert werden (Hoff et al. 2008). Durch quantitative real-time-PCR konnte zudem der Nachweis erbracht werden, dass diese Gene exprimiert vorliegen (Hoff et al. 2008). Gleiches gilt für die Pheromonvorläufer- und Pheromonrezeptor-Gene, die in anderen Pilzen, wie der Hefe S. cerevisiae, für die Initiation des sexuellen Zyklus notwendig sind. Sequenzanalysen verschiedener P. chrysogenum-Stämme zeigten, dass sowohl ein für eine heterothallische Population typisches 1:1-Verhältnis der MAT-Loci existiert (Hoff et al. 2008, Henk et al. 2011), als auch Anzeichen für die RIP-Mutation vorliegen (Braumann et al. 2008). Diese Ergebnisse deuten daraufhin, dass P. chrysogenum das Potential für die sexuelle Entwicklung besitzt. P. chrysogenum hat eine hohe biotechnologische Relevanz aufgrund seiner Produktion des β-Lactam-Antibiotikums Penicillin (Demain 2009). Anfang des 20. Jahrhunderts machte Alexander Fleming die Entdeckung, dass P. chrysogenum eine Substanz sekretiert, die das Wachstum von grampositiven Bakterien hemmt (Fleming 1929). Später konnte diese Substanz, genannt Penicillin, isoliert und analysiert werden, so dass Howard Florey, Ernst Chain und Norman Heatley die klinische Wirkung und Effizienz während des zweiten Weltkriegs demonstrieren konnten (Keller et al. 2005). Die Penicillin-Mengen waren jedoch gering, so dass die Suche nach einem Hochproduzenten-Stamm begann. 1943 wurde vom US Department of Agriculture Northern Regional Research Laboratory (NRRL) in Peoria, Illinois, von einer Cantaloupe-Melone der Stamm NRRL1951 isoliert, der höhere Mengen Penicillin produzieren konnte (Backus et al. 1946). Wie in Abbildung 2 zu sehen ist, starteten ausgehend von diesem Isolat eine Reihe von konventionellen Mutagenese-Programmen, um Stämme mit noch höheren Penicillin-Titern zu erzeugen (Backus und Stauffer 1955). So entstand durch UV- und Röntgenstrahl-Mutagenese der Stamm Q176, der für die später beschriebenen Kreuzungsexperimente in dieser Arbeit genutzt wurde, der Stamm Wisconsin 54-1255, dessen Genom 2008 sequenziert und der Öffentlichkeit zugänglich gemacht wurde und anschließend die industriell genutzten Stämme, die vom Stamm P2 abstammen (Backus und Stauffer 1955, Lein 1986, van den Berg et al. 2008). Alle heutzutage in der Industrie genutzten Stämme sind Nachkommen dieses Stammes. II PROBLEMSTELLUNG 21

Abb. 2: Stammentwicklung industriell genutzter P. chrysogenum-Stämme. Ausgehend vom Original-Isolat NRRL 1951 wurden über verschiedenste Mutagenese- Verfahren die Stämme der Wisconsin-Linie erzeugt. Da der Stamm NRRL 1951 den MAT1-1 Locus trägt, besitzen auch alle Abkömmlinge den MAT1-1 Kreuzungstyp. Die typischen Charakteristika der erzeugten Stämme sind stichpunktartig aufgeführt. Die gebildete Penicillin-Menge ist in g/L angegeben (Nielsen 1997). Die gestrichelten Pfeile deuten an, dass zwischen den dargestellten Stämmen weitere Abkömmlinge der Linie liegen, die hier nicht explizit genannt werden.

Durch seine rein asexuelle Fortpflanzungsweise konnten sexuelle Kreuzungen bisher aber nicht zur Stammoptimierung herangezogen werden. In dieser Arbeit sollten die Funktionen der durch die Kreuzungstypgene kodierten Transkriptionsfaktoren MAT1-1-1 und MAT1-2-1 aufgeklärt und der sexuelle Zyklus in P. chrysogenum durch Kreuzen verschiedener Stämme des gegensätzlichen Kreuzungstyps unter geeigneten Bedingungen induziert sowie rekombinante Nachkommen mittels molekular-genetischer Analysen nachgewiesen werden. In vorangegangenen Arbeiten konnte bereits eine regulatorische Funktion von MAT1-1-1 auf verschiedenste Prozesse, wie den Sekundärmetabolismus und die Morphologie, nachgewiesen werden (Böhm 2010). MAT1-1-1 Deletionsstämme zeigten einen deutlich reduzierten Penicillin-Titer in Hemmhoftests und HPLC-Analysen. Außerdem konnte sowohl in den Deletionsstämmen als auch in MAT1-1-1 II PROBLEMSTELLUNG 22

Überexpressionsstämmen eine veränderte Pellet-Morphologie nachgewiesen werden. Diese Ergebnisse sollten nun im Detail analysiert und auf molekularer Ebene verifiziert werden. Hierzu wurden einerseits Komplementationsstämme hergestellt, andererseits die transkriptionelle Regulation durch den MAT1-1-1 Transkriptionsfaktor anhand vorliegender Microarray-Daten verifiziert. Zur näheren Analyse des Pellet-Phänotyps wurden mikroskopische Analysen hinsichtlich des Keimungsverhaltens und der Hyphenmorphologie durchgeführt. Zudem erfolgte eine funktionelle Charakterisierung des MAT1-2 Locus. Hierzu wurden, wie für den MAT1-1 Locus, Knockoutstämme sowie Komplementanten erstellt und zusammen mit Überexpressionsstämmen im Hinblick auf die Morphologie und die Konidienbildung funktionell charakterisiert. Für diese Analysen musste ein geeigneter MAT1-2 Wildtyp-Stamm gewählt werden, da alle industriell genutzten Stämme den MAT1-1 Locus tragen. Des Weiteren wurden künstlich homothallische Stämme hergestellt, die neben dem ursprünglichen MAT1-1-1 Gen auch das MAT1-2-1 Gen tragen. Hiermit sollte analysiert werden, ob die Kreuzungstypgene in P. chrysogenum neben ihrer eigentlichen Funktion in der Festlegung der sexuellen Identität auch Funktionen bei der Regulation von Prozessen mit biotechnologischer Relevanz übernommen haben. Ein weiterer Ansatz dieser Arbeit war der molekulargenetische Nachweis der sexuellen Rekombination. In den letzten Jahren wurden zahlreiche Beispiele für zuvor als asexuell klassifizierte Pilze, wie Aspergillus fumigatus oder Trichoderma reesei, bekannt, in denen der sexuelle Zyklus induziert und die Bildung rekombinanter Nachkommen nachgewiesen werden konnte (O'Gorman et al. 2009, Seidl et al. 2009). Mit dem Wissen der Organisation der Kreuzungstyp-Loci wurden nun gezielt Kreuzungen zwischen Isolaten des entgegensetzten Kreuzungstyps in P. chrysogenum angesetzt und auf die Induktion des sexuellen Zyklus hin untersucht. Nach erfolgreicher Kreuzung sollte eine Methode zur Analyse der Nachkommen hinsichtlich der Rekombination auf molekularer Ebene etabliert werden. Zusammenfassend besteht das Ziel dieser Dissertation darin, die Beteiligung des MAT1-1 und des MAT1-2 Locus an den regulatorischen Netzwerken des Sekundärmetabolismus und der Morphologie in P. chrysogenum aufzuklären sowie über den Nachweis der sexuellen Rekombination einen neuen Ansatzpunkt für eine gezielte Stammoptimierung zu erbringen. III BÖHM ET AL. 2013 23

Sexual reproduction and mating-type-mediated strain development in the penicillin-producing fungus Penicillium chrysogenum

Böhm J, Hoff B, O´Gorman CM, Wolfers S, Klix V, Binger D, Zadra I, Kürnsteiner H, Pöggeler S, Dyer PS, Kück U (2013)

Proceedings of the National Academy of Sciences 110 (4): 1476-1481

Sexual reproduction and mating-type–mediated strain development in the penicillin-producing fungus Penicillium chrysogenum

Julia Böhma, Birgit Hoffa,1, Céline M. O’Gormana,b, Simon Wolfersa, Volker Klixc, Danielle Bingera,2, Ivo Zadrad, Hubert Kürnsteinerd, Stefanie Pöggelerc, Paul S. Dyerb, and Ulrich Kücka,3 aChristian Doppler Laboratory for “Fungal Biotechnology,” Lehrstuhl für Allgemeine und Molekulare Botanik, Ruhr-Universität Bochum, D-44780 Bochum, Germany; bSchool of Biology, University of Nottingham, University Park, Nottingham NG7 2RD, United Kingdom; cAbteilung Genetik Eukaryotischer Mikroorganismen, Institut für Mikrobiologie und Genetik, Georg-August Universität Göttingen, D-37077 Göttingen, Germany; and dAnti-Infectives Microbiology, Sandoz GmbH, 6250 Kundl, Austria

Edited by Joan Wennstrom Bennett, Rutgers University, New Brunswick, NJ, and approved December 6, 2012 (received for review October 16, 2012)

Penicillium chrysogenum is a filamentous fungus of major medical sensu lato is composed of at least two distinct species, Penicillium and historical importance, being the original and present-day indus- rubens and P. chrysogenum sensu stricto, with Fleming’s strain and trial source of the antibiotic penicillin. The species has been consid- NRRL1951 reidentified as P. rubens (6, 7). However, for the ered asexual for more than 100 y, and despite concerted efforts, it purposes of this study, we refer to all isolates as P. chrysogenum has not been possible to induce sexual reproduction, which has given that this is a nomen conservandum (8). prevented sexual crosses being used for strain improvement. How- P. chrysogenum is only known to reproduce by asexual means. ever, using knowledge of mating-type (MAT) gene organization, However, accumulating evidence suggests that it might have the fi “ ” we now describe conditions under which a sexual cycle can be in- potential for sexual reproduction with an unidenti ed or cryptic duced leading to production of meiotic ascospores. Evidence of re- sexual stage present (9). We recently discovered mating-type combination was obtained using both molecular and phenotypic (MAT) and pheromone signaling genes in P. chrysogenum (10), markers. The identified heterothallic sexual cycle was used for strain which are involved with mating in other sexual fungi (11). For sex development purposes, generating offspring with novel combina- to occur in heterothallic (obligate outcrossing) ascomycete fungi, MICROBIOLOGY MAT1-1 MAT1-2 tions of traits relevant to penicillin production. Furthermore, the complementary and isolates must be present (11). Significantly, a MAT1-1 locus, with a MAT1-1–1 gene MAT1-1–1 mating-type gene, known primarily for a role in govern- encoding a putative alpha-box transcription factor, is present in ing sexual identity, was also found to control transcription of NRRL1951 and all its derivatives, whereas the original Fleming a wide range of genes with biotechnological relevance including strain contains the opposite MAT1-2 locus (10). In addition, re- those regulating penicillin production, hyphal morphology, and combination has been reported within natural populations of conidial formation. These discoveries of a sexual cycle and MAT P. chrysogenum together with a near 1:1 distribution of MAT1-1 and gene function are likely to be of broad relevance for manipulation MAT1-2 isolates (6), and there is evidence of repeat induced point of other asexual fungi of economic importance. mutation in the genome, a process associated with meiosis (12). Recent findings suggest that sexual reproduction can be trig- sexual recombination | secondary metabolism | ascomycete gered in supposedly asexual fungi (13–16) if the correct growth conditions are identified (17, 18). The principle aim of the cur- ilamentous fungi are of great value to the pharmaceutical in- rent study was therefore to determine whether a functional Fdustry because of their extensive secondary metabolism (1). sexual cycle could be induced in P. chrysogenum, using knowl- Examples of fungal products include statins from Aspergillus terreus edge of MAT gene organization in the species to set up directed and Penicillium citrinum, immunosuppressants from Tolypocla- crosses between known MAT1-1 and MAT1-2 isolates, and if the dium inflatum and Penicillium brevicompactum, and antibiotics sexual cycle could be used for strain development purposes. We from Acremonium chrysogenum and Penicillium chrysogenum. also investigated whether MAT genes, which are defined pri- Strain improvement programs generally use random mutagenesis marily by their role in governing sexual identity (11, 19), might and, more recently, recombinant technologies to generate im- have additional roles in regulating other developmental pro- proved derivatives (2). A common feature of most industrial fila- cesses of biotechnological relevance. mentous fungi is that they lack a sexual cycle, which has prevented the generation of novel strains by sexual crossing. This method Results offers particular advantages because crosses can be set up between Induction of a Sexual Life Cycle in P. chrysogenum. Applying isolates with different desirable traits, and meiotic recombination knowledge of MAT gene presence, we set up 24 crosses between occurs throughout the whole genome, potentially generating con- P. chrysogenum strains of known MAT1-1 and MAT1-2 genotype. siderable genetic variation for screening purposes (2). These strains were either wild type (from different geographic P. chrysogenum is the major industrial source of the beta-lactam antibiotic penicillin, which has annual worldwide sales of about US$ 8 billion (3). Sir Alexander Fleming made the for- Author contributions: J.B., B.H., C.M.O., S.W., V.K., D.B., I.Z., H.K., S.P., P.S.D., and U.K. tuitous discovery of penicillin as a result of a contaminant, designed research; J.B., B.H., C.M.O., S.W., V.K., and D.B. performed research; J.B., B.H., P. chrysogenum, inhibiting growth of a bacterial culture. Fifteen C.M.O., S.W., V.K., and D.B. analyzed data; and J.B., C.M.O., P.S.D., and U.K. wrote years later, a higher-yielding strain, NRRL1951, was isolated at the paper. the US Department of Agriculture Northern Regional Research The authors declare no conflict of interest. Laboratory (NRRL) in Peoria, Illinois, from a moldy cantaloupe, This article is a PNAS Direct Submission. which generated sufficient amounts for the commercial production of penicillin (4). Since then, conventional mutagenesis Freely available online through the PNAS open access option. programs have been used to develop strains with elevated pen- 1Present address: BASF SE, 67056 Ludwigshafen, Germany. icillin titers. All P. chrysogenum production strains currently used 2Present address: BP BioFuels, Global Technology Center, San Diego, CA 92121. worldwide are derivatives of NRRL1951 and show amplification 3To whom correspondence should be addressed. E-mail: [email protected]. of the genomic region encoding penicillin biosynthesis genes (5). This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. Recent phylogenetic analyses have revealed that P. chrysogenum 1073/pnas.1217943110/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1217943110 PNAS Early Edition | 1of6 Fig. 1. The sexual cycle of P. chrysogenum.(A) Paired culture of Q176 (MAT1-1) and IB 08/921 (MAT1-2) incubated for 5 wk at 20 °C in the dark on oatmeal agar supplemented with biotin. Cleistothecia were found at the junction zones (arrows) of mycelia from both mating types. Scale bar: 2 cm (Top Left). Light (Upper Right) and scanning electron (Middle and Bottom Left and Lower Right) micrographs illustrate cleistothecia (arrows), asci (arrowhead), and ascospores (star), with a chain of smaller conidia for comparison (asterisk). Scale bars: 10 μm(Middle and Bottom Left) and 100 μm(Lower Right). (B) Phenotypic evidence of recombination in selected ascospore progeny (AS), as indicated, compared with parental isolates Q176 and IB 08/921. Front and reverse views show conidial density and chrysogenin formation, respectively. The Bottom row shows results of a penicillin bioassay with halo formation on a bacterial lawn. (C) Molecular evidence of recombination by PCR analysis (Top) and restriction fragment length polymorphism (RFLP) analysis (Middle and Bottom). DNA from four ascospore lineages (designated AS) and two parental strains (Q176 and IB 08/921) was used for analysis with mating-type locus-specific primers. Mating types are distinguished by the size of PCR amplicons. For RFLP analysis, gene-specific primers were used for amplification of DNA, followed by restriction enzyme digestion with PdmI (nsdD) and HinfI (hypo.; Pc24g01940). Strain designation color indicates either MAT1-1 (blue) or MAT1-2 (red) genotype. origins) or production strains with high penicillin titers (Table agar was supplemented with biotin, cleistothecia were produced S1). Various combinations of growth media and pairings were within 5 wk that contained viable ascospores (Fig. 1A and Table tested, including the use of conditions recently shown to induce S1). Thus, the addition of biotin was necessary for completion of sexual reproduction in Aspergillus fumigatus and related aspergilli the sexual cycle. Biotin is also essential for sexual development in (18, 20). When crosses were performed on different oatmeal certain Sordaria and Chaetomium species (22). agars in sealed Petri dishes in the dark at 15–27 °C, cleistothecia [sexual reproductive structures characteristic of Penicillium spe- Molecular and Phenotypic Evidence for Recombination in the Ascospore cies and some other ascomycete fungi (18, 21)] were formed in Offspring. To verify that sexual outcrossing had occurred, it was most but not all crosses in the contact zone of the two mating necessary to provide evidence of recombination. Therefore, more partners after incubation from 5 wk to 3 mo, but these were than 150 ascospore progeny from the Q176 × IB 08/921 cross sterile with no ascospores produced. were isolated. These parental isolates are phenotypically distinct: However, in one cross, Q176 (MAT1-1; a derivative of Q176 produces pale green conidia, the yellow pigment chrys- NRRL1951) × IB 08/921 (MAT1-2; wild type), when the oatmeal ogenin, and shows an elevated penicillin titer relative to most

Table 1. Molecular characterization of ascospore progeny from cross Q176 × IB 08/921 † Genotypic marker*,

Genotypes MAT Chry ﬂbC hypo nsdD pcbC pclA stuA Number‡

Parental Q176 1 1 1 1 1 1 1 1 IB 08/921 2 2 2 2 2 2 2 2 Recombinant Group 1 1 2 2 2 1 2 1 1 27 (75) Group 2 2 2 2 2 1 2 1 2 1 (2.8) Group 3 1 2 2 1 1 2 1 1 6 (16.6) Group 4 1 2 2 1 2 2 1 1 1 (2.8) Group 5 1 2 2 2 2 2 1 1 1 (2.8)

Progeny were classified into five recombinant groups based on 12 genotypic markers (eight shown) obtained by Southern hybridization or RFLP analysis (see Fig. 1C and Fig. S1). Numerical values (1 and 2) indicate whether the gene was derived from the MAT1-1 (dark gray shading) or the MAT1-2 (light gray shading) parent, respectively. Gene abbreviations and products: Chry, putative chrysogenin synthase; flbC, C2H2 conidiation transcription factor; hypo, hypothetical gene (Pc24g01940); nsdD, GATA-type sexual development transcription factor; pcbC, isopenicillin N synthase; pclA, phenylacetyl-CoA ligase; stuA, helix–loop–helix transcription factor. *The following genes failed to identify additional recombinant phenotypes, most probably due to linkage with other marker genes (see Fig. S1B): flbB, bZIP transcription factor; fluG, developmental activator; penDE, acyl- CoA:isopenicillin N acyltransferase; UDP, UDP-glucose 4-epimerase like. †See Fig. 1C and Fig. S1 for details. ‡ Number of progeny per group; number in parentheses indicates the percentage.

2of6 | www.pnas.org/cgi/doi/10.1073/pnas.1217943110 Böhm et al. wild-type strains, whereas IB 08/921 produces dark green conidia, no detectable chrysogenin, and only has weak antibacterial activity. As shown in Fig. 1B, recombinant strains were found with novel characteristics derived from both parents. For example, offspring AS 16-2-6 had dark green conidia, chrysogenin production, and a distinct halo indicating significant penicillin biosynthesis. A very notable phenotype was seen in offspring AS 1-2- 54, which lacked chrysogenin production (similar to parent IB 08/ 921), but which formed a marked clearing zone (similar to parent Q176). Chrysogenin contaminates crystalline penicillin powders, and during the 20th century commercial producers had to extract this pigment, resulting in a reduced penicillin yield (4). Thus, we demonstrate here that sexual crossing offers a way to bring together previously separate traits of interest to develop improved strains that have high penicillin titer and lack chrysogenin. This sexual crossing and offspring screening approach could also be applied to different fungi for the removal of other unwanted secondary metabolites such as mycotoxins (23). Ascospore offspring were also screened for recombination at the molecular level. After comparing sequences from a total of 56 genes, 11 genes were identified across seven contigs of the P. chrysogenum genome that exhibited restriction site polymorphisms between the parental isolates, meaning that different alleles could be distinguished by a single restriction enzyme di- gest (Fig. 1C and Fig. S1 A and B). In addition, mating type was determined by Southern hybridization of genomic DNA with MAT-specific probes or PCR analysis with MAT-specific primer pairs (Fig. 1C). Consistent with the phenotypic data, screening of

36 recombinant ascospore lines revealed at least ﬁve different MICROBIOLOGY recombinant molecular phenotypes indicating independent chromosomal assortment (groups 1–5; Table 1). A strong bias toward the group 1 phenotype was observed, possibly explained by genome heterogeneity of the two unrelated mating partners pre- venting recombination of certain linkage groups. Two of the marker genes, nsdD and stuA,werepresentonthesamesinglecontig. Three of the progeny groups (groups 2, 4, and 5) contained nsdD and stuA alleles derived from the different parental strains, demonstrating that intrachromosomal recombination had occurred. Evidence of recombination was also obtained from a second cross of two F1 progeny from the original Q176 × IB 08/921 cross (Fig. S1C). Overall, these data conﬁrmed that P. chrysogenum possesses a heterothallic sexual breeding system.

Construction of MAT1-1–1 Deletion and Overexpression Strains. These findings indicated that the MAT genes were functional in P. chrysogenum in relation to sexual reproduction. This encour- aged us to study the functionality of MAT genes in regard to other developmental pathways relevant to penicillin biosynthesis in P. chrysogenum. Strain P2niaD18, which has a high penicillin V titer under laboratory conditions and is a MAT1-1 derivative of NRRL1951, was chosen for study (10). An additional strain, ΔPcku70, with a deleted ku70 gene was constructed from P2niaD18 to promote efficient gene replacement (24). ΔPcku70 was then transformed with a construct in which the MAT1-1–1 ORF was replaced with a phleomycin resistance cassette (Fig. S2A), leading to the production of two mutants (ΔMAT1-1–1 EK5 and EK6) lacking the MAT1-1–1 gene. A complemented control strain (ΔMAT1-1–1::MAT1-1–1) was then constructed by rein- serting the MAT1-1–1 gene together with a terbinafine resistance marker (25). Finally, two MAT1-1–1 overexpression strains (P2:: Fig. 2. Functional analysis of the MAT1-1–1 gene. (A) Results of a bioassay MAT1-1–1 T2 and T5) were constructed by transforming P2niaD18 used to assess penicillin production in parental and representative recombi- with an insert with the MAT1-1–1 gene under control of the con- nant MAT1 strains from 48 to 96 h growth. Error bars represent mean ± SD = stitutive gpd promoter of Aspergillus nidulans. All recombinant (n 3) from three independent experiments measuring halo formation. (B) strains were genetically characterized (Fig. S2 A–C) and are sub- Hyphal morphology of germinating conidia on solid media (24 h, 48 h) and “ ” subsequent pellet formation in liquid shaking cultures (72 h, 192 h) formed by sequently referred to as recombinant MAT1 strains. As predicted parental and representative recombinant MAT1 strains as indicated. Micro- from previous studies with MAT gene deletants of A. nidulans, μ – Δ graphs are representative of three independent experiments. Scale bars: 20 m Gibberella zeae,andSordaria macrospora (26 28), the MAT1 (24 h), 100 μm (48 h), and 2,000 μm (72 and 192 h). (C)Quantification of deletion strains were sterile when crossed to the fertile MAT1-2 conidia production by parental and representative MAT1 recombinant strains isolate IB 08/921, being unable to form ascospores, although after 168 h growth on complete culture medium in the light or dark. Bottom cleistothecia were formed (Table S1). panel shows typical morphology of respective strains.

Böhm et al. PNAS Early Edition | 3of6 Penicillin Production Is Regulated by the MAT1-1–1 Gene. We first between parental and deletion strains when plated on solid media. assessed functionality of MAT1-1–1 in penicillin production us- An approximate 25% increase in sporulation was seen in both ing a bioassay measuring clearing zone formation in bacterial ΔMAT1 strains relative to other strains when grown in the light lawns (Fig. 2A). Overexpression and complemented strains did (Fig. 2C). Again, this is a unique report of MAT genes influencing not deviate significantly from the parental strains. However, both asexual sporulation in fungi. ΔMAT1 mutants showed a significant reduction in penicillin biosynthesis throughout the time course compared with control Microarray Time-Course Analysis of MAT1-1–1 Regulated Gene strains (e.g., a 60% reduction at 72 h), although all strains Expression. To understand the molecular basis for the observed exhibited similar mycelial dry weight production. The reduced phenotypes, a microarray time-course experiment was performed penicillin titer was confirmed by HPLC analysis (Fig. S3A). That to investigate MAT1-1–1 dependent transcriptional regulation MAT genes can influence fungal secondary metabolite pro- further, comparing expression of the ΔMAT1 mutant relative to duction is a previously undescribed finding of high industrial the ΔPcku70 parent up to 96 h growth. A total of 2,421 genes relevance because many other filamentous fungi are used as the showed differential regulation over this period, as defined by sources of key natural products (1, 17). a threshold of at least twofold change in expression levels (Fig. 3A). Between 23 and 30 genes of mostly unknown function were down- MAT1-1–1 Gene Controls Hyphal Morphology, Conidiation, and Pellet or up-regulated, respectively, at all time points (Table S2). Con- Formation. We next assessed the effect of MAT1-1–1 expression sistent with the data above, genes related to conidiation and on hyphal morphology. This is an important industrial trait be- morphology, (e.g., PcbrlA, PcdewA, PcdewB) were down-regulated cause fungi exhibit distinct morphologies in submerged culture in the ΔMAT1 strain (Table S2). The three penicillin biosynthesis depending on the extent of branching and/or elongation of hy- genes (pcbAB, pcbC, penDE) were also down-regulated at 60 and phae. Freely dispersed hyphal suspensions can be formed that 96 h; this result was confirmed by quantitative real-time PCR are highly viscous or hyphae may aggregate to form “pellets” (qRT-PCR) analysis (Fig. 3B). Other microarray studies have also with lower viscosity. Inspection of strains revealed important demonstrated that MAT genes have a wide-ranging effect on morphological differences when grown for 24–48 h on solid or in fungal gene expression (26, 29–31). shaken liquid media (Fig. 2B and Fig. S3B). Conidia of the parental and complemented strains germinated mostly to yield one Functionality of the P. chrysogenum Pheromone and Pheromone or two hyphae exhibiting dichotomous branching. By contrast, Receptor Genes. The microarray analysis also revealed that three conidia of the overexpression strains exhibited long germinating elements of a putative pheromone signaling pathway were expressed, hyphae without any terminal branching. Conidia of the ΔMAT1 comprising a previously identified pheromone precursor (Pcppg1) strains produced short hyphae with intensively branching tips, and two pheromone receptor (Pcpre1, Pcpre2) genes (10) (Fig. S4). often with more than two emergent hyphae. These phenotypic We therefore examined their functionality using yeast bioassays. differences were confirmed quantitatively (Fig. S3 C and D). Successful pheromone binding and signaling would be expected to Cultures were then grown from 72 to 192 h in shaken liquid result in cell cycle arrest and change in cell morphology and lead to culture, comparable to applied fermentation conditions. Phe- formation of a halo in lawns of Saccharomyces cerevisiae (32–34). notypic differences were even more pronounced, with gene de- On the basis of similarity to the S. cerevisiae MFα proteins, the letion and overexpression strains producing significantly larger P. chrysogenum Pcppg1 gene was predicted to produce a decap- pellets than control strains (Fig. 2B and Fig. S3E). Thus, these eptide pheromone of sequence KWCGHIGQGC, expected to previously undescribed results demonstrated that MAT genes can bind to the cognate PcPRE2 receptor protein. And indeed, influence the morphology and polarity of germinating hyphae. S. cerevisiae wild-type cells (ScSTE2p) or yeasts heterologously The influence of MAT1-1–1 expression on conidial formation expressing PcPRE2 exhibited polarized growth, leading to was also investigated. There were clear differences in sporulation pear-shaped forms (shmoos) of unconjugated haploid cells, in

Fig. 3. MAT1-1–1 dependent transcriptional regulation. (A) Venn diagram of differentially regulated genes in the ΔMAT1-1–1 EK5 strain. For array analysis, mRNA was used from cultures grown for 36, 60, and 96 h. Arrows indicate transcriptionally up- or down-regulated genes. (B) qRT-PCR analysis to quantify transcriptional expression of the penicillin biosynthesis genes in ΔMAT1-1–1 strains EK5 and EK6 when grown as liquid shaking or surface cultures. Values are mean log2-transformed average expression ratios of at least three biological replicates from two independently derived deletion strains (mean ΔMAT1-1–1 EK5/EK6 n ≥ 3) relative to the ΔPcku70 parental strain.

4of6 | www.pnas.org/cgi/doi/10.1073/pnas.1217943110 Böhm et al. response to either the native S. cerevisiae α-factors or the synthetic decapeptide pheromone PcPPG1, respectively (35) (Fig. 4A). This finding was further confirmed by bioassays in which addition of the synthetic PcPPG1 pheromone to lawns of S. cerevisiae that were heterologously expressing PcPRE2 resulted in halo formation (Fig. 4B). Thus, PcPRE2 and PcPPG1 represent a functional pheromone-receptor pair likely involved in the observed mating of P. chrysogenum. Discussion We have provided unequivocal evidence for a heterothallic sexual cycle involving production of recombinant ascospore progeny in P. chrysogenum and demonstrated that sexual crosses can be used to develop new strains with improved industrial characteristics. Sex in P. chrysogenum could be induced on oatmeal agar as reported recently for other supposedly “asexual” Aspergillus and Penicillium species (18, 20, 36, 37). However, it was necessary to supplement the agar with biotin to achieve complete sexual development, and similar supplementation might be required for other sexually recalcitrant species (17, 18). Even with biotin supplementation, not all of the crosses tested generated cleistothecia with ascospores, suggesting that P. chrysogenum is composed of isolates on a continuum of sexual fertility, rather than being purely sexual or asexual, as suggested by the “slow decline” hypothesis (38). Comparable results were obtained when highly derived industrial strains from Trichoderma, showing female ste- rility, were used in crosses with natural isolates of the teleomorph Hypocrea jecorina (14). In this context, a fitness trade-off between

retention of mating ability and growth-rate advantage has been MICROBIOLOGY demonstrated in S. cerevisiae (39). Further work is now required to determine the extent of sexual fertility within natural populations of P. chrysogenum. The previously undescribed sexual state of P. chrysogenum was morphologically similar to that of known sexual Eupenicillium species, but no new teleomorph name is Fig. 4. Bioassay of functionality of the P. chrysogenum pheromone and proposed in agreement with recent taxonomic revisions (18, 40). pheromone receptor genes. (A)ShmooingofS. cerevisiae in response to the Our results are of significance to the understanding of the bi- synthetic pheromone PcPPG1 and to S. cerevisiae α-factor. MATa cells (YDB103, ology and evolution of P. chrysogenum (a species of great impor- ste2Δ, sst2Δ) expressing the Pcpre2 (PcPRE2) gene were treated for 0, 2, or 4 h tance in its own right) and are of industrial relevance because the with either the synthetic pheromone PcPPG1 at 5 μMorDMSO.Asacontrol, sexual cycle now offers a valuable tool for strain improvement, such the wild type (Wt; MATa strain Y06055 sst2Δ) expressing the endogenous S. as increasing penicillin production. Sexual reproduction offers cerevisiae STE2 gene was treated with synthetic α-factor or DMSO. On average particular advantages over conventional mutagenesis and genetic after 4 h, 50% of cells responded only to the specific pheromone by shmoo recombinant technologies for a number of reasons (2). It involves formation without any detected cross-reactivity of the pheromones. Scale bar, μ recombination throughout the whole genome, thereby providing 10 m. (B) Pheromone induced growth arrest (halo formation) of S. cerevisiae fi transformants expressing the P. chrysogenum Pcpre2 gene (PcPRE2; halo di- signi cant genetic variation for screening purposes. For many in- ± Δ dustrial processes, multiple genes might have to be manipulated to ameter: 2.3 0.15 cm), or as a control the S. cerevisiae strain Y06055 (sst2 ) expressing the endogenous STE2 pheromone receptor gene (ScSTE2p; halo optimize strains, and gene-by-gene manipulations/mutations would diameter: 2.4 ± 0.13 cm). Averages of halo diameters from eight independent be too slow to develop novel production strains in a reasonable experiments (n = 8) were measured. No cross-reactivity of the pheromones time. Sexual reproduction offers an invaluable method to allow could be detected. DMSO served as mock solution. α, S. cerevisiae α-factor targeted crosses to be set up, providing a faster and economically pheromone; Pc, P. chrysogenum decapeptide pheromone (KWCGHIGQGC); cheaper procedure, without the need for prior knowledge of the Sm, S. macrospora undecapeptide (QWCRIHGQSCW). genetic basis of traits of interest. Also, continued random mutagenesis and high-throughput screening can lead to undesirable deleterious mutations and genetic instability in producer strains fermentations is a highly important feature of production strains in (41). For example, production strains of P. chrysogenum contain large-scale fermenters because this can influence productivity as multiple point mutations as well as major amplifications and a result of oxygen depletion and nutritional gradients (45). The deletions compared with the genome sequence of the progenitor discovery that overexpression or deletion of the MAT1-1–1 gene Wisconsin strain (42). By contrast, sexual reproduction allows significantly affected pellet formation indicates that manipulation recombination of traits without introducing further mutations of MAT genes might therefore provide a unique strategy for strain and offers a means to restore the fitness of industrial strains and improvement. Overexpression of MAT genes might also increase eliminate ku70/ku80 mutations that can lead to genome in- the production of certain secondary metabolites of interest, given stability (43). that the P. chrysogenum ΔMAT1 mutants showed a significant Furthermore, we have demonstrated that the P. chrysogenum reduction in penicillin biosynthesis. The possible influence of the MAT1-1–1 gene regulates transcription of a wide range of genes MAT1-2–1 gene family now merits future investigation. including those controlling penicillin production, hyphal mor- Finally, these findings for P. chrysogenum are of broader sig- phology, and conidial formation, all traits of biotechnological nificance because they indicate that sexual recombination might relevance. This is a major finding because MAT genes have pre- also be feasible for other filamentous fungi of economic impor- viously been primarily known for their role in determining sexual tance that are assumed to be exclusively asexual, thus the findings identity, as well as for other aspects of sexual development (19). are of general relevance to strain development and mating in We had previously observed that hyphal morphology, and conse- fungi. The revelation of a sexual life cycle in P. chrysogenum quently pellet formation, in P. chrysogenum is dependent on illustrates an ongoing fungal “sexual revolution” (18) and the a wide range of factors (44). Hyphal morphology in submerged overall reproductive versatility of fungi, which exhibit a remarkable

Böhm et al. PNAS Early Edition | 5of6 balance between sexual and asexual reproduction in response to Köllnflocken (Kölln) medium, or Schmelzflocken (Schmelz) medium (Peter different environmental conditions (46). Kölln KGaA) (in each case 40 g/L), with or without addition of sildenafil citrate (Sil) (100 μM), vardenafil citrate (Var) (100 μM), or biotin (6.4 μg/L) after Materials and Methods autoclaving. A 1 × 107 spore suspension of each isolate was prepared, and 20 Strains and Growth Conditions. Details of bacterial and fungal strains in- μL of each suspension was inoculated as previously described (20). The plates vestigated in this study are summarized in SI Materials and Methods and were sealed with Parafilm and incubated at 15, 18, 20, or 27 °C in the dark. Table S3. Maintenance and growth conditions were as described (47, 48). Further details for examination of crosses are provided in SI Materials Growth conditions for P. chrysogenum are detailed in SI Materials and and Methods. Methods. DNA-mediated transformation of P. chrysogenum to construct gene deletion and overexpression strains and further rescue of deletion Interaction Studies. The interaction of pheromones and pheromone receptors strains (Fig. S2) were done in principal as described recently (49). Detailed from P. chrysogenum was studied using the heterologous yeast system that information on strain constructions and functional analysis is provided in SI Materials and Methods and Tables S4 and S5. was described previously (32) and is detailed further in SI Materials and Methods. Light and Scanning Electron Microscopy. Details about specimen preparation are provided in SI Materials and Methods. ACKNOWLEDGMENTS. WearegratefultoI.Godehardt,S.Mertens, In vitro recombinant techniques, sequence analysis, and penicillin quan- K. Kalkreuter, and J. del Buono for their excellent technical assistance, G. Frenßen-Schenkel for the artwork, and V. Kock for help with the construction tifications are detailed in SI Materials and Methods. of gene deletion strains. We thank M. Kirchmair, J. Frisvad, M. Fisher, and D. Henk for providing wild-type strains of P. chrysogenum, T. Stützel and S. Adler for their Mating and Analysis of Recombinant Ascospore Lines. Strains of opposite help with electron microscope preparations, and M. Nowrousian for help with mating type were inoculated onto either oatmeal agar medium (OA) (Pinhead bioinformatic calculations. This work was funded by Sandoz GmbH, the Christian Oatmeal; Odlums Group), OA (U.K.) (Traditional Rolled Oats; Quaker Oats), Doppler Society, and the Wellcome Trust.

1. Keller NP, Turner G, Bennett JW (2005) Fungal secondary metabolism - from 26. Klix V, et al. (2010) Functional characterization of MAT1-1-specific mating-type genes biochemistry to genomics. Nat Rev Microbiol 3(12):937–947. in the homothallic ascomycete Sordaria macrospora provides new insights into es- 2. Adrio JL, Demain AL (2006) Genetic improvement of processes yielding microbial sential and nonessential sexual regulators. Eukaryot Cell 9(6):894–905. products. FEMS Microbiol Rev 30(2):187–214. 27. Paoletti M, et al. (2007) Mating type and the genetic basis of self-fertility in the model 3. Barber MS, Giesecke U, Reichert A, Minas W (2004) Industrial enzymatic production of fungus Aspergillus nidulans. Curr Biol 17(16):1384–1389. cephalosporin-based beta-lactams. Adv Biochem Eng Biotechnol 88:179–215. 28. Lee J, Lee T, Lee YW, Yun SH, Turgeon BG (2003) Shifting fungal reproductive mode 4. Backus MP, Stauffer JF (1955) The production and selection of a family of strains in by manipulation of mating type genes: obligatory heterothallism of Gibberella zeae. Penicillium chrysogenum. Mycologia 47:429–463. Mol Microbiol 50(1):145–152. 5. van den Berg MA, Westerlaken I, Leeflang C, Kerkman R, Bovenberg RA (2007) 29. Wada R, et al. (2012) Presence and functionality of mating type genes in the supposedly Functional characterization of the penicillin biosynthetic gene cluster of Penicillium asexual filamentous fungus Aspergillus oryzae. Appl Environ Microbiol 78(8):2819–2829. chrysogenum Wisconsin54-1255. Fungal Genet Biol 44(9):830–844. 30. Bidard F, et al. (2011) Genome-wide gene expression profiling of fertilization com- 6. Henk DA, et al. (2011) Speciation despite globally overlapping distributions in Peni- petent mycelium in opposite mating types in the heterothallic fungus Podospora cillium chrysogenum: The population genetics of Alexander Fleming’s lucky fungus. anserina. PLoS ONE 6(6):e21476. Mol Ecol 20:4288–4301. 31. Pöggeler S, et al. (2006) Microarray and real-time PCR analyses reveal mating type-de- 7. Houbraken J, Frisvad JC, Samson RA (2011) Fleming’s penicillin producing strain is not pendent gene expression in a homothallic fungus. Mol Genet Genomics 275(5):492–503. Penicillium chrysogenum but P. rubens. IMA Fungus 2(1):87–95. 32. Mayrhofer S, Pöggeler S (2005) Functional characterization of an alpha-factor-like 8. McNeill J, et al., eds (2006) International Code of Botanical Nomenclature (Vienna Sordaria macrospora peptide pheromone and analysis of its interaction with its Code): Adopted by the Seventeenth International Botanical Congress, Vienna, Aus- cognate receptor in Saccharomyces cerevisiae. Eukaryot Cell 4(4):661–672. tria, July 2005 (ARG Gantner, Ruggell, Liechtenstein), Regnum Vegetabile Ed, Vol 146. 33. Hsueh YP, Xue C, Heitman J (2009) A constitutively active GPCR governs morphogenic 9. Kück U, Pöggeler S (2009) Cryptic sex in fungi. Fungal Biol Rev 23:86–90. transitions in Cryptococcus neoformans. EMBO J 28(9):1220–1233. 10. Hoff B, Pöggeler S, Kück U (2008) Eighty years after its discovery, Fleming’s Penicillium 34. Fowler TJ, DeSimone SM, Mitton MF, Kurjan J, Raper CA (1999) Multiple sex pher- strain discloses the secret of its sex. Eukaryot Cell 7(3):465–470. omones and receptors of a mushroom-producing fungus elicit mating in yeast. Mol 11. Ni M, Feretzaki M, Sun S, Wang X, Heitman J (2011) Sex in fungi. Annu Rev Genet 45: Biol Cell 10(8):2559–2572. 405–430. 35. Cross F, Hartwell LH, Jackson C, Konopka JB (1988) Conjugation in Saccharomyces 12. Braumann I, van den Berg M, Kempken F (2008) Repeat induced point mutation in two cerevisiae. Annu Rev Cell Biol 4:429–457. asexual fungi, Aspergillus niger and Penicillium chrysogenum. Curr Genet 53(5):287–297. 36. Houbraken J, Frisvad JC, Samson RA (2010) Sex in Penicillium series Roqueforti. IMA 13. Taylor J, Jacobson D, Fisher M (1999) The evolution of asexual fungi: reproduction, Fungus 1(2):171–180. speciation and classification. Annu Rev Phytopathol 37:197–246. 37. Arabatzis M, Velegraki A (2012) Sexual reproduction in the opportunistic human 14. Seidl V, Seibel C, Kubicek CP, Schmoll M (2009) Sexual development in the industrial pathogen Aspergillus terreus. Mycologia, 10.3852/11-426. workhorse Trichoderma reesei. Proc Natl Acad Sci USA 106(33):13909–13914. 38. Dyer PS, Paoletti M (2005) Reproduction in Aspergillus fumigatus: Sexuality in a sup- 15. Hull CM, Raisner RM, Johnson AD (2000) Evidence for mating of the “asexual” yeast posedly asexual species? Med Mycol 43(Suppl 1):S7–S14. Candida albicans in a mammalian host. Science 289(5477):307–310. 39. Lang GI, Murray AW, Botstein D (2009) The cost of gene expression underlies a fitness 16. Magee PT, Magee BB (2004) Through a glass opaquely: The biological significance of trade-off in yeast. Proc Natl Acad Sci USA 106(14):5755–5760. mating in Candida albicans. Curr Opin Microbiol 7(6):661–665. 40. Hawksworth DL, et al. (2011) The amsterdam declaration on fungal nomenclature. 17. Dyer PS, O’Gorman CM (2012) Sexual development and cryptic sexuality in fungi: IMA Fungus 2(1):105–112. Insights from Aspergillus species. FEMS Microbiol Rev 36(1):165–192. 41. Schoustra S, Rundle HD, Dali R, Kassen R (2010) Fitness-associated sexual reproduction 18. Dyer PS, O’Gorman CM (2011) A fungal sexual revolution: Aspergillus and Penicillium in a filamentous fungus. Curr Biol 20(15):1350–1355. show the way. Curr Opin Microbiol 14(6):649–654. 42. van den Berg MA, et al. (2008) Genome sequencing and analysis of the filamentous 19. Debuchy R, Berteaux-Lecellier V, Silar P (2010) Mating systems and sexual morpho- fungus Penicillium chrysogenum. Nat Biotechnol 26(10):1161–1168. genesis in Ascomycetes. Cellular and Molecular Biology of Filamentous Fungi, eds 43. Kück U, Hoff B (2010) New tools for the genetic manipulation of filamentous fungi. Borkovich KA, Ebbole DJ (ASM Press, Washington, DC), pp 501–535. Appl Microbiol Biotechnol 86(1):51–62. 20. O’Gorman CM, Fuller HT, Dyer PS (2009) Discovery of a sexual cycle in the opportu- 44. Hoff B, et al. (2010) Two components of a velvet-like complex control hyphal mor- nistic fungal pathogen Aspergillus fumigatus. Nature 457(7228):471–474. phogenesis, conidiophore development, and penicillin biosynthesis in Penicillium 21. Pöggeler S, O’Gorman CM, Hoff B, Kück U (2011) Molecular organization of the chrysogenum. Eukaryot Cell 9(8):1236–1250. mating-type loci in the homothallic Ascomycete Eupenicillium crustaceum. Fungal 45. Papagianni M (2004) Fungal morphology and metabolite production in submerged Biol 115(7):615–624. mycelial processes. Biotechnol Adv 22(3):189–259. 22. Molowitz R, Bahn M, Hock B (1976) The control of fruiting body formation in the 46. Metin B, Findley K, Heitman J (2010) The mating type locus (MAT) and sexual re- ascomycete Sordaria macrospora Auersw. by arginine and biotin: A two-factor production of Cryptococcus heveanensis: Insights into the evolution of sex and sex- analysis. Planta 128:143–148. determining chromosomal regions in fungi. PLoS Genet 6(5):e1000961. 23. Frisvad JC, Thrane U, Samson RA, Pitt JI (2006) Important mycotoxins and the fungi 47. Bullock WO, Fernandez JM, Short JM (1987) XL1-Blue: A high-efficiency plasmid which produce them. Adv Exp Med Biol 571:3–31. transforming recA Escherichia coli strain with β-galactosidase selection. BioTechniques 24. Hoff B, Kamerewerd J, Sigl C, Zadra I, Kück U (2010) Homologous recombination in 5:376–379. the antibiotic producer Penicillium chrysogenum: Strain DeltaPcku70 shows up-reg- 48. Sambrook J, Russell DW (2001) Molecular Cloning. A Laboratory Manual (Cold Spring ulation of genes from the HOG pathway. Appl Microbiol Biotechnol 85(4):1081–1094. Harbor Lab Press, Cold Spring Harbor, NY). 25. Sigl C, Handler M, Sprenger G, Kürnsteiner H, Zadra I (2010) A novel homologous 49. Kamerewerd J, Zadra I, Kürnsteiner H, Kück U (2011) PcchiB1, encoding a class V dominant selection marker for genetic transformation of Penicillium chrysogenum: chitinase, is affected by PcVelA and PcLaeA, and is responsible for cell wall integrity in Overexpression of squalene epoxidase-encoding ergA. J Biotechnol 150(3):307–311. Penicillium chrysogenum. Microbiology 157(Pt 11):3036–3048.

6of6 | www.pnas.org/cgi/doi/10.1073/pnas.1217943110 Böhm et al. Supporting Information

Böhm et al. 10.1073/pnas.1217943110 SI Materials and Methods Sequencing of both amplicons identified RFLPs for differential Culture Conditions for Penicillium chrysogenum. All strains in- restriction enzyme analysis. In a subsequent step, amplified DNA vestigated in this study were grown at 27 °C and 120 rpm in liquid from each ascospore group was cut with the selected restriction complete culture medium (CCM); in case of the liquid-static enzymes (Fig. S1A) to detect which parental gene copy was present. cultures, shaking was avoided. For solid media, CCM, M322, or minimal medium (MM) was used as previously described (1, 2). Transformation. DNA-mediated transformation of P. chrysogenum For microarray analysis, strains were grown on sterile membranes strains was performed as recently described (3, 5). The ergA gene was used as a selection marker as described (6) with some modi- (Pall Life Sciences) layered on solid M322 medium. All liquid fi media were inoculated with 5.0 × 106 spores from freshly prepared cations: for regeneration of protoplasts, solid MM was used spore suspensions derived from cultures grown on M322 medium containing 5% (wt/vol) KCl and 2% (wt/vol) glucose as the sole – carbon source. Twenty-four hours after transformation, the medium for 4 5 d. For quantitative real-time analysis, CCM was inoculated μ fi with 2 × 108 spores. Solid media were inoculated with 107 spores. For was overlaid with agar containing 0.7 g/mL terbina ne. quantifications of conidia, mycelia were grown on CCM for 168 h. Construction of MAT1-1–1 Deletion Strains. The sequences of all plasmids and oligonucleotides used for construction of the gene Light Microscopy. The microscopic observations of hyphal morphology at different growth phases were performed as described deletion cassette are listed in Tables S4 and S5. For construction of previously (3). For pellet quantification assays, strains were grown the deletion vector, the strategy recently described by Hoff et al. (3) was used to generate the recombinant plasmid pKOMAT-1, con- at 27 °C and 120 rpm in CCM, and samples were taken at dif- fl ′ ferent time points. The flasks were inoculated with 1 × 107 taining the Tn5Phleo marker gene, anked by sequences located 5 and 3′ of the MAT1-1–1 gene. This plasmid was used as a template spores/mL freshly prepared spore suspensions. For each time to amplify the linear KO-MAT-1 cassette with primers 5′-Mat_ point, three 2-mL samples were taken from the culture. Images sense and 3′-MAT_anti. The PCR fragment was used for trans- were obtained with a stereomicroscope (Stemi 2000-C; Zeiss) formation of ΔPcku70 (7), which facilitates homologous recom- equipped with a digital camera (AxioCamERc 5s) and digitally bination (7). Resulting transformants were screened and analyzed processed using Adobe Photoshop CS4. Pellet sizes were mea- as previously described (3). DNA from single spore isolates was sured using the programs ImageJ (http://rsbweb.nih.gov/ij/) and used to verify the complete lack of the MAT1-1–1 gene by Southern Microsoft Excel 2010. hybridization analysis (Fig. S2A). Scanning Electron Microscopy. Cleistothecia were removed with Rescue of MAT1-1–1 Deletion Strains. For complementation analysis, a sterile needle tip. The samples were fixed as described (4) for at ΔMAT1-1–1 EK5 and EK6 were transformed with plasmid least 24 h at room temperature, dehydrated in an ascending – – pKompMAT-1_ergA. This plasmid carries the MAT1-1 1 gene ethanol series, transferred to formaldehyde dimethylacetal for with the native 5′ and 3′ regions using the ergA gene as a select- 48 h, critical point dried, and mounted on metal stubs, sputter able marker, under the control of the strong Pacn-promoter of coated with gold for 180 s using an SEM Coating Unit E 5100 P. chrysogenum (6). The successful rescue of the MAT1-1–1 gene (Polaron Equipment Ltd), and examined on a Zeiss DSM 950 was verified by Southern hybridization, and the corresponding scanning electron microscope. Recorded images were processed strains were designated ΔMAT1-1–1::MAT1-1–1 (Fig. S2C). with Adobe Photoshop CS4 software. Construction of MAT1-1–1 Overexpression Strains. For generating Examination of Crosses and Ascospore Isolates. The crosses were MAT1-1–1 overexpression strains, plasmid pPgpd-MAT-1-ptrA examined for cleistothecial production periodically with a Zeiss was transformed into strain P2niaD18. Here, the MAT1-1–1 Stemi 2000 stereomicroscope. Cleistothecia were removed with gene is under the control of the strong constitutive gpd promoter a sterile needle tip, cleaned of adhering conidia by rolling on of Aspergillus nidulans. Resulting transformants were selected preparation agar [7% (wt/vol) agar], and then squashed with a using pyrithiamine-supplemented agar plates, as the constructs μ μ needletipin200 L of sterile water. Aliquots of 50 L were carry the ptrA resistance gene and were named P2::MAT1-1–1. fl plated on oatmeal agar medium or Kölln ocken agar supple- Copy numbers of integrated plasmids were tested by Southern μ mented with biotin (6.4 g/L), incubated at 27 °C, and examined hybridization using a 32P-radiolabeled MAT1-1–1 probe (Fig. S2B). daily for germinating ascospores. Ascospore isolates were grown on CCM and characterized phenotypically with respect to spore Interaction Studies with Pheromones and Receptors from P. chrysogenum. color, chrysogenin production, and penicillin biosynthesis (3). Two For the heterologous expression of the P. chrysogenum phero- different types of genetic markers were chosen for molecular mone receptor gene Pcpre2 in Saccharomyces cerevisiae, we used characterization. First, mating type was determined by Southern the yeast expression vector pPGK (8). The ORF of Pcpre2 was hybridization. EcoRI-restricted genomic DNA from individual amplified by PCR with the oligonucleotides Pre2-hom-f and strains was blotted and hybridized with probes specificforthe Pre2-hom-r (Table S5) and inserted into the BamHI linearized MAT1-1–1 or MAT1-2–1 gene. In a second approach, genome da- vector pPGK by homologous recombination (9) to obtain the tabases (www.ncbi.nlm.nih.gov) were searched with BLASTn to desired plasmid pPGK-PcPRE2. Plasmid pPGK-PcPRE2 was identify suitable molecular markers from the major contigs. Se- transformed into the yeast strain YDB103 (MATa ste2Δ sst2:: lected genes from the parental strains Q176 and IB 08/921 were KanMX4) (1). Shmoo formation (Fig. 4A) was assayed as de- amplified by PCR and sequenced for comparison. Finally, re- scribed previously (10). striction fragment length polymorphisms (RFLPs) of 11 gene Yeast halo assays were conducted as described previously (10). sequences were chosen and used to identify single point muta- YDB103 containing pPGK-PcPRE2 or strain Y06055 [MATa, tions by endonuclease restriction of amplified genomic DNA. As his3Δ1, leu2Δ0, lys2Δ0, ura3Δ0, YLR452c::kanMX4 (sst2Δ); listed in Table S5, oligonucleotide pairs were used to amplify the Euroscarf] were used. Five microliters of synthetic pheromone from corresponding gene fragments from the two parental strains. either Sordaria macrospora (SmPPG1; GeneScript Corporation),

Böhm et al. www.pnas.org/cgi/content/short/1217943110 1of12 P. chrysogenum (PcPPG1; GeneScript Corporation) or S. cerevisiae calibration of penicillin activity, the area of the inhibition zone (α-factor; Sigma-Aldrich) were applied to filter disks (6 mm; Sar- was normalized to the dry weight of the mycelium. Media were torius Stedim) at a concentration of 3 nmol. No halo formation was buffered to pH 6 to obtain optimal conditions for penicillin bio- seen when synthetic S. cerevisiae α-factor or DMSO was added in synthesis. Penicillin titers were also determined using HPLC as control experiments. As a positive control, we applied the syn- described (11). The standard protocol involved measurement of α thetic S. cerevisiae -factor to strain Y06055, which produces the S. penicillin production in liquid shaking cultures after 72 h growth, α cerevisiae -factor receptor Ste2p. as this is the optimal time point for penicillin biosynthesis. fi Identi cation of P. chrysogenum Genes and Sequence Analysis. The Nucleic Acids Isolation, cDNA Synthesis, Microarray, and Quantitative sequences for all genes in this study were obtained from the public Real-Time PCR. Preparation of nucleic acids, hybridizations, and National Center for Biotechnology Information Entrez database cDNA synthesis for microarray and quantitative real-time PCR P. chrys- (www.ncbi.nlm.nih.gov/entrez/). The genome sequence of (qRT-PCR) analysis were carried out as described recently (7). ogenum ATCC28089 (Wisconsin 54–1255) served as the source. The time-course microarray analysis was performed using Sequence alignments were performed with the program MultAlign ΔPcku70 as the reference strain (7). qRT-PCR was carried out (http://multalin.toulouse.inra.fr/multalin/) and displayed using fi GeneDoc (www.nrbsc.org/gfx/genedoc/index.html). as described previously (7) with the following modi cations: The Promega GoTaq qPCR Master Mix was used as recommended Penicillin Bioassay and HPLC Analysis. For penicillin bioassays with by the manufacturer, and incubation cycles were performed on Staphylococcus aureus as a sensitive indicator bacterium, 30 μLof a StepOnePlus Real-Time PCR System (Applied Biosystems) supernatant from the culture broth was used in a halo test. For with the primers listed in Table S5.

1. Ballon DR, et al. (2006) DEP-domain-mediated regulation of GPCR signaling responses. 7. Hoff B, Kamerewerd J, Sigl C, Zadra I, Kück U (2010) Homologous recombination in Cell 126(6):1079–1093. the antibiotic producer Penicillium chrysogenum: Strain DeltaPcku70 shows up-regulation 2. Haas H, Angermayr K, Zadra I, Stöfﬂer G (1997) Overexpression of nreB, a new GATA of genes from the HOG pathway. Appl Microbiol Biotechnol 85(4):1081–1094. factor-encoding gene of Penicillium chrysogenum, leads to repression of the nitrate 8.KangYS,KaneJ,KurjanJ,StadelJM,Tipper DJ (1990) Effects of expression of assimilatory gene cluster. J Biol Chem 272(36):22576–22582. mammalian G alpha and hybrid mammalian-yeast G alpha proteins on the yeast 3. Hoff B, et al. (2010) Two components of a velvet-like complex control hyphal pheromone response signal transduction pathway. Mol Cell Biol 10(6):2582–2590. morphogenesis, conidiophore development, and penicillin biosynthesis in Penicillium 9. Colot HV, et al. (2006) A high-throughput gene knockout procedure for Neurospora chrysogenum. Eukaryot Cell 9(8):1236–1250. reveals functions for multiple transcription factors. Proc Natl Acad Sci USA 103(27): 4. McDowell EM, Trump BF (1976) Histologic ﬁxatives suitable for diagnostic light and 10352–10357. electron microscopy. Arch Pathol Lab Med 100(8):405–414. 10. Mayrhofer S, Pöggeler S (2005) Functional characterization of an alpha-factor-like 5. Kamerewerd J, Zadra I, Kürnsteiner H, Kück U (2011) PcchiB1, encoding a class V Sordaria macrospora peptide pheromone and analysis of its interaction with its chitinase, is affected by PcVelA and PcLaeA, and is responsible for cell wall integrity in cognate receptor in Saccharomyces cerevisiae. Eukaryot Cell 4(4):661–672. Penicillium chrysogenum. Microbiology 157(Pt 11):3036–3048. 11. Schmitt EK, et al. (2004) Winged helix transcription factor CPCR1 is involved in 6. Sigl C, Handler M, Sprenger G, Kürnsteiner H, Zadra I (2010) A novel homologous regulation of beta-lactam biosynthesis in the fungus Acremonium chrysogenum. Eukaryot dominant selection marker for genetic transformation of Penicillium chrysogenum: Cell 3(1):121–134. overexpression of squalene epoxidase-encoding ergA. J Biotechnol 150(3):307–311.

Böhm et al. www.pnas.org/cgi/content/short/1217943110 2of12 Fig. S1. Analysis of recombinant ascospore lineages. (A) RFLP analysis with different marker genes to detect genetic recombination. Sequence analysis identiﬁed point mutations in different genes derived from both parental strains Q176 and IB 08/921. In some cases, these point mutations generated new restriction sites, which were used to distinguish the two gene variants. Numbers indicate restriction fragments when PCR products were digested withthe indicated endonucleases. (B) Location of marker genes used for RFLP analysis of recombinant ascospore groups displayed on contigs of the P. chrysogenum genome (www.ncbi.nlm.nih.gov/genbank/). All genes shown were tested for sequence polymorphisms between the two parental strains Q176 and IB 08/921. The genes with suitable polymorphisms are highlighted in bold. Only the genes highlighted in red were used in the RFLP analysis. (C) Phenotypes of parental Legend continued on following page

Böhm et al. www.pnas.org/cgi/content/short/1217943110 3of12 strains (AS 38 and AS 25) and ascospore progeny (AP 16, AP 20) as evidence of meiotic recombination during a sexual cross. The two parental strains are F1 progeny from a cross between Q176 and IB 08/921 that differed in spore color (light green versus dark green; Top), chrysogenin production (bright yellow versus fawn reverse coloration; Middle), and penicillin production (differential size of halo; Bottom). Recombinant ascospore progeny AP 16 and AP 20 have novel phenotypes of dark green conidia, chrysogenin production, and a reduced halo size. Strain designation color indicates either MAT1-1 (blue) or MAT1-2 (red) genotype. Molecular analysis of progeny was not performed.

Böhm et al. www.pnas.org/cgi/content/short/1217943110 4of12 Fig. S2. Recombinant P. chrysogenum MAT1-1–1 strains produced for functional analysis of the MAT1-1–1 gene. Constructs to generate (A) deletion, (B) overexpression, and (C) complementing strains are shown, together with results of the corresponding Southern hybridizations used to characterize the recombinant fungal strains. Lane headings indicate results for speciﬁc control or recombinant MAT1-1–1 strains. ble, phleomycin resistance gene; ergA, gene encoding squalene epoxidase (which confers resistance to terbinaﬁne); Pacn, promoter sequence of the P. chrysogenum actin gene; Pgpd, promoter sequence of the A. nidulans gpdA gene; ptrA, pyrithiamine resistance gene.

Böhm et al. www.pnas.org/cgi/content/short/1217943110 5of12 Fig. S3. Penicillin biosynthesis and hyphal morphology of recombinant P. chrysogenum strains. (A) HPLC analysis of penicillin V production in ΔMAT1-1–1 deletion strains and their corresponding reference strains. Measurements were taken after 96 h cultivation. Error bars represent mean ± SD (n = 3) from three independent experiments. (B) Representative examples of hyphal morphology and polarity of germinating conidia when parental and recombinant MAT1-1–1 strains were grown in liquid shaking CCM for the times indicated. The morphology of the germinating conidia from the MAT1-1–1 deletion strain is distinct from the reference strains as shown by the dichotomous branching of the hyphal tips and by the increased number of germ tubes. The P2::MAT1-1–1 overexpression strain shows elongated hyphae without branching, which is further evidenced by the quantitative analysis in C. These observations are identical to those seen on solid media, as shown in Fig. 2B. Scale bars: 20 μm (24 h) and 100 μm (36 h). (C) Quantification of hyphal length and (D) quantification of germ tubes from 50 germinating conidia. As an example, one out of two independent MAT1-1–1 knockout and overexpression strains is shown. (E) Quantification of pellet diameter when parental and recombinant MAT1-1–1 strains were grown in shaking liquid CCM cultures. Measurements were taken at four different time points as indicated. Error bars represent mean ± SD of 100 random pellets. One out of two independent MAT1-1–1 knockout and overexpression strains is shown.

Böhm et al. www.pnas.org/cgi/content/short/1217943110 6of12 Fig. S4. qRT-PCR analysis to quantify transcriptional expression of genes for pheromone and pheromone receptor genes. Values are the log2-transformed average expression ratios of at least three biological replicates of two independently derived deletion strains (mean ΔMAT1-1–1 EK5/EK6, n ≥ 3), relative to the ΔPcku70 parental strain. Strains were grown in liquid shaking (Upper) or surface (Lower) cultures.

Table S1. P. chrysogenum isolates that were crossed in various combinations † MAT1-2*,

IB PC PC PC DAOM DAOM IBT 08/921 0814C 0819C 0826A 155628 59494C 30738 Pc 131 US 68 Pc 105 AS 25

MAT1-1 P2niaD18 4, 5, 6, 8, 9 − (1, 2, 3, 12, 13) − (3) − (3) − (3) 10, 11 ATCC 10106 7 − (4) Q176 6,‡ 7, 8 − (1,2,3,4) − (3) − (3) − (3) ΔMAT1 EK5 1, 12, 13 − (2, 3, 4, 5) − (3) P2::MAT1 T5 4, 5, 7 − (1, 2, 3, 12, 13) P2::MAT2 T2 3 P2::MAT2 T5 3 DAOM 193710 4 PC0820A 1, 2, 3 3 − (1, 2) 3 − (1, 2) PC088B 3 − (1, 2) 3 − (1, 2) 3 − (1, 2) DAOM 155627 − (4) 3 1, 3 − (2) 3 − (1, 2) 3 PC08105C 3 − (1) IBT 14508 − (10) − (10) IBT 30427 10, 11 − (10) − (10) − (10) IBT 22703 10, 11 − (10) US 49 10 − (10) ‡ AS 38 6

Numbers represent different growth conditions where the formation of cleistothecia was observed. Numbers in parentheses indicate conditions whereno fruiting bodies were detected (see Materials and Methods, Mating and Analysis of Recombinant Ascospore Lines for full details): 1, OA at 15 °C; 2, OA at 18 °C, 3, OA at 20 °C, 4, OA at 27 °C; 5, Kölln at 27 °C; 6, OA + biotin at 20 °C; 7, OA + Var at 27 °C; 8, OA + Sil at 27 °C; 9, OA + biotin at 27 °C; 10, OA (U.K.) at 20 °C; 11, OA (U.K.) + biotin at 20 °C; 12, Kölln at 15 °C; 13, Schmelz at 15 °C. OA, oatmeal agar medium (Pinhead Oatmeal; Odlums Group); OA (U.K.), Traditional Rolled Oats (Quaker Oats); Kölln, Köllnflocken medium; Schmelz, Schmelzflocken medium (Peter Kölln KGaA); Sil, sildenafil citrate; Var, vardenafil citrate. *See Table S3 for isolate details. † Shaded boxes indicate pairings that were not tested. ‡ Cleistothecia contained viable ascospores under these conditions.

Böhm et al. www.pnas.org/cgi/content/short/1217943110 7of12 Table S2. List of differentially expressed genes in the ΔMAT1-1–1 mutant according to a microarray analysis Gene ID 36 h 60 h 96 h

Down-regulated at all time points Hypothetical protein Pc12g02560 –2.28 –1.87 –1.46 Hypothetical protein Pc13g14700 –2.06 –1.01 –1.03 Tetratricopeptide repeat domain protein Pc13g15900 –1.63 –2.21 –1.42 Hypothetical protein Pc15g01560 –1.50 –1.38 –2.42 Hypothetical protein Pc18g06580 –3.15 –2.74 –2.39 Hypothetical protein Pc18g06600 –3.38 –4.06 –3.47 Hypothetical protein Pc18g06610 –4.30 –5.13 –5.51 Hypothetical protein Pc18g06620 –1.48 –1.36 –1.67 Hypothetical protein Pc18g06660 –3.13 –1.37 –3.08 HMG box protein Pc18g06680 –2.81 –2.20 –1.53 Vanillin dehydrogenase, putative Pc20g02480 –1.04 –2.45 –1.15 Killer toxin sensitivity protein (Iki1) Pc20g12630 –2.28 –2.13 –2.11 Small oligopeptide transporter, OPT family Pc20g15530 –1.00 –1.69 –1.20 ABC multidrug transporter, putative Pc21g10850 –2.22 –1.30 –1.08 Putative Transcription factor Pc21g17180 –1.15 –1.92 –1.99 Glyoxalase family protein Pc21g21290 –6.09 –6.88 –6.41 FAD dependent oxidoreductase, putative Pc21g21350 –1.06 –1.23 –1.03 Hypothetical protein Pc21g21440 –7.04 –1.44 –1.45 Phosphotransferase enzyme family protein Pc21g21580 –1.11 –1.11 –1.07 Putative Transcription factor Pc22g07530 –3.21 –2.27 –1.20 Integral membrane protein Pc22g16710 –1.82 –1.09 –1.27 Hypothetical protein Pc24g01440 –1.31 –2.59 –1.51 Hypothetical protein Pc24g01600 –4.43 –2.99 –4.91 Up-regulated at all time points MFS transporter, putative Pc03g00020 2.52 3.16 1.35 Arsenate reductase ArsC Pc06g02220 1.03 2.43 1.69 MFS monosaccharide transporter, putative Pc12g02140 1.90 1.92 1.25 Glycosyl hydrolase family protein Pc12g04400 1.08 1.02 1.13 Hypothetical protein Pc13g09280 1.04 1.56 1.16 MFS transporter, putative Pc13g09900 3.72 3.14 3.17 Flavin-binding monooxygenase Pc13g14930 3.06 1.21 3.34 MFS sugar transporter, putative Pc15g00030 1.44 2.18 1.44 Hypothetical protein Pc16g14900 1.01 1.47 1.71 Hypothetical protein Pc17g00990 3.29 2.62 1.87 Hypothetical protein Pc17g01090 1.20 1.05 1.85 Hypothetical protein Pc18g06590 1.26 1.51 1.22 Hypothetical protein Pc19g00170 1.61 1.79 1.63 MFS transporter, putative Pc20g06200 1.76 1.70 3.91 Alpha-ketoglutarate-dependent taurine dioxygenase Pc20g06210 2.38 1.63 4.23 High-afﬁnity glucose transporter Pc20g10820 2.05 1.35 1.48 sesA Pc20g13730 1.24 1.24 1.52 Phytanoyl-CoA dioxygenase Pc21g04130 1.40 1.97 1.41 Cyclin Pc21g20530 1.39 1.28 1.48 Amino acid permease, putative Pc21g20960 2.98 1.67 1.49 FAD dependent oxidoreductase Pc21g21750 1.86 1.89 3.29 Hypothetical protein Pc22g13240 1.31 2.49 2.44 Hypothetical protein Pc22g24550 1.82 2.23 2.63 Hypothetical protein Pc22g25960 1.54 2.70 1.49 Hypothetical protein Pc22g26500 1.32 1.67 1.54 C2H2 ﬁnger domain protein Pc22g27040 1.24 2.03 3.08 Hypothetical protein Pc24g00020 1.07 1.97 1.82 Hypothetical protein Pc24g00750 1.60 1.28 2.44 Hypothetical protein Pc24g00920 1.40 2.84 1.18 Penicillin biosynthesis pcbAB Pc21g21390 −0.87 –2.84 –2.27 pcbC Pc21g21380 −0.82 –1.73 –1.28 penDE Pc21g21370 −0.59 –2.1 –1.35 Asexual development brlA Pc06g00470 –1.22 −0.23 −0.45 dewA Pc16g06690 –4.28 0.02 0.05 dewB Pc13g16010 –1.14 −0.09 −0.02

Böhm et al. www.pnas.org/cgi/content/short/1217943110 8of12 Table S2. Cont. Gene ID 36 h 60 h 96 h

flbA Pc15g00600 1.45 −0.47 0.27 tmpA Pc21g07830 −0.49 0.50 1.00 ppoA Pc22g06980 1.05 –2.54 −0.52 Cell wall agsD Pc22g15390 –1.81 0.45 0.27 Fruit body lectin Pc12g08560 0.20 2.19 2.62 Transcription factors pacC Pc18g00420 0.47 –1.24 −0.46 HMG box protein Pc18g06680 –2.81 –2.2 –1.53 Hypothetical protein Pc22g07530 –3.21 –2.27 –1.2 Hypothetical protein Pc21g17180 –1.15 –1.92 –1.99 HLH transcription factor Pc13g11100 –2.86 –1.18 −0.8 C6 zinc finger domain protein Pc13g10310 −0.07 –2.8 –3.18 Phosphotransferase enzyme family protein Pc18g03150 −0.16 –1.15 –1.02 C2H2 finger domain protein (Ezf) Pc21g21760 0.65 –2.16 –1.14 Hypothetical protein Pc17g01190 –4.16 −0.1 –1.13 Hypothetical protein Pc24g01630 –3.47 −0.29 –1.3 C2H2 finger domain protein Pc22g27040 1.24 2.03 3.08 bZIP transcription factor (Atf21) homolog Pc22g26820 2.31 2.11 0.69 bZIP transcription factor (Atf21) homolog Pc19g00240 2.42 2.68 0.92 Hypothetical protein Pc04g00010 0.18 1.09 1.63 Hypothetical protein Pc13g01210 –1.94 1.87 1.85 zf-fungal binuclear cluster type transcription factor Pc16g05270 0.00 1.1 1.32 bZIP transcription factor JlbA Pc20g15070 −0.06 1.84 1.35 C6 finger domain protein Pc22g19540 –1.32 1.44 1.39

Values are mean log2-transformed ratios relative to the ΔPcku70 parental strain. Colored values indicate genes with at least a twofold transcriptional up-regulation (red) or down-regulation (green). Listed are genes down-regulated or up-regulated at all time points, as well as those that control conidiation or morphology.

Böhm et al. www.pnas.org/cgi/content/short/1217943110 9of12 Table S3. List of bacterial and fungal strains used in this study Strain Characteristics and genotype Mating type Source

IB 08/921 Wild type MAT1-2–1 M. Kirchmair* Pc105 Wild type MAT1-2–1 This study; indoor air Pc131 Wild type MAT1-2–1 This study; indoor air † US 49 Wild type MAT1-1–1 BDUN Collection US 68 Wild type MAT1-2–1 BDUN Collection† IBT 14508 Wild type MAT1-1–1 IBT Culture Collection of Fungi‡ IBT 30738 Wild type MAT1-2–1 IBT Culture Collection of Fungi IBT 30427 Wild type MAT1-1–1 IBT Culture Collection of Fungi IBT 22703 Wild type MAT1-1–1 IBT Culture Collection of Fungi PC0820A Wild type MAT1-1–1 (1) PC088B Wild type MAT1-1–1 (1) PC08105C Wild type MAT1-1–1 (1) PC0814C Wild type MAT1-2–1 (1) PC0819C Wild type MAT1-2–1 (1) PC0826A Wild type MAT1-2–1 (1) DAOM 193710 Wild type MAT1-1–1 (2) DAOM 155627 Wild type MAT1-1–1 (2) DAOM 155628 Wild type MAT1-2–1 (2) DAOM 59494C Wild type MAT1-2–1 (2) ATCC 10106 Type strain; chrysogenin producer MAT1-1–1 (3) Q176 chrysogenin producer MAT1-1–1 (3) − P2niaD18 niaD MAT1-1–1 (4) ΔPcku70 Pcku70Δ::nat1; niaD− MAT1-1–1 (5) ΔMAT1-1–1 EK5 MAT1-1–1Δ::ble; Pcku70Δ::nat1; niaD− This study − ΔMAT1-1–1 EK6 MAT1-1–1Δ::ble; Pcku70Δ::nat1; niaD This study ΔMAT1-1–1::MAT1-1–1 MAT1-1–1Δ::ble; Pcku70Δ::nat1; MAT1-1–1 This study PMAT1-1–1::MAT1-1–1::TMAT1-1–1; ergA; niaD− P2::MAT1-1–1T2 Pgpd::MAT1-1–1; ptrA; niaD− MAT1-1–1 This study − P2::MAT1-1–1T5 Pgpd::MAT1-1–1; ptrA; niaD MAT1-1–1 This study − P2::MAT1-2–1T2 Pgpd::MAT1-2–1; ptrA; niaD MAT1-1–1 This study MAT1-2–1 − P2::MAT1-2–1T5 Pgpd::MAT1-2–1; ptrA; niaD MAT1-1–1 This study MAT1-2–1 AS 38 F1 progeny from Q176 x IB 08/921 MAT1-1–1 This study AS 25 F1 progeny from Q176 x IB 08/921 MAT1-2–1 This study YDB103 sst2Δ::KanMX4 ste2Δ MATa(6) Y06055 his3Δ1, leu2Δ0, lys2Δ0, ura3Δ0, YLR452c::KanMX4, sst2Δ MATa Euroscarf XL1-Blue K12 recA1, endA1, gyrA96, thi1, hsdR17, supE44, (7) relA1, lac-, [F’ proAB, laclqZΔM15, Tn10(tetr)]

*Institute for Microbiology, Innsbruck University, Innsbruck, Austria. † BDUN, Department of Botany, University of Nottingham, Nottingham, UK. ‡ IBT, Culture Collection of Fungi, Mycology Group, BioCentrum-DTU, Technical University of Denmark, Lyngby, Denmark.

1. Henk DA, et al. (2011) Speciation despite globally overlapping distributions in Penicillium chrysogenum: The population genetics of Alexander Fleming’s lucky fungus. Mol Ecol 20:4288–4301. 2. Scott J, Untereiner WA, Wong B, Straus NA, Malloch D (2004) Genotypic variation in Penicillium chysogenum from indoor environments. Mycologia 96(5):1095–1105. 3. Backus MP, Stauffer JF (1955) The production and selection of a family of strains in Penicillium chrysogenum. Mycologia 47:429–463. 4. Hoff B, Pöggeler S, Kück U (2008) Eighty years after its discovery, Fleming’s Penicillium strain discloses the secret of its sex. Eukaryot Cell 7(3):465–470. 5. Hoff B, Kamerewerd J, Sigl C, Zadra I, Kück U (2010) Homologous recombination in the antibiotic producer Penicillium chrysogenum: Strain DeltaPcku70 shows up-regulation of genes from the HOG pathway. Appl Microbiol Biotechnol 85(4):1081–1094. 6. Ballon DR, et al. (2006) DEP-domain-mediated regulation of GPCR signaling responses. Cell 126(6):1079–1093. 7. Bullock WO, Fernandez JM, Short JM (1987) XL1-Blue: A high-efﬁciency plasmid transforming recA Escherichia coli strain with β-galactosidase selection. BioTechniques 5:376–379.

Böhm et al. www.pnas.org/cgi/content/short/1217943110 10 of 12 Table S4. List of plasmids used in this study Plasmid Characteristics Source pDrive/PtrpC-Tn5Phleo trpC promoter of A. nidulans, ble resistance (1) gene of Streptoalloteichus hindustanus pTn5Phleo-3′-FlankeMAT trpC promoter of A. nidulans, ble resistance This study gene of S. hindustanus,3′ flanking region of MAT1-1–1 pKOMAT-1 5′ flanking region of MAT1-1–1, trpC promoter This study of A. nidulans, ble resistance gene of S. hindustanus, 3′ flanking region of MAT1-1–1 pT3T7-gpd gpd promoter of A. nidulans This study pT3T7Pgpd-MAT1 gpd promoter of A. nidulans, MAT1-1–1 gene This study of P. chrysogenum pDrive-ptrA ptrA resistance gene of Aspergillus oryzae This study pPgpd-MAT-1-ptrA gpd promoter of A. nidulans, MAT1-1–1 gene This study of P. chrysogenum, ptrA resistance gene of A. oryzae pDrive-ergA acnP promoter of P. chrysogenum, ergA gene (2) of P. chrysogenum ergA+3′FlankeMAT-1 acnP promoter of P. chrysogenum, ergA gene This study of P. chrysogenum,3′ flanking region of MAT1-1–1 pKompMAT-1_ergA 5′ flanking region of MAT1-1–1, MAT1-1–1 gene This study of P. chrysogenum, acnP promoter of P. chrysogenum, ergA gene of P. chrysogenum,3′ flanking region of MAT1-1–1 pPGK-PcPRE2 Pcpre2 under control of the S. cerevisiae PGK promoter This study

1. Hoff B, et al. (2010) Two components of a velvet-like complex control hyphal morphogenesis, conidiophore development, and penicillin biosynthesis in Penicillium chrysogenum. Eukaryot Cell 9(8):1236–1250. 2. Sigl C, Handler M, Sprenger G, Kürnsteiner H, Zadra I (2010) A novel homologous dominant selection marker for genetic transformation of Penicillium chrysogenum: overexpression of squalene epoxidase-encoding ergA. J Biotechnol 150(3):307–311.

Böhm et al. www.pnas.org/cgi/content/short/1217943110 11 of 12 Table S5. List of oligonucleotides used in this study Oligonucleotide Sequence (5′–3′) Speciﬁcity

5′-Mat_sense ACGCGTCTGTCAACAAGCAACGC 5′ flanking region of MAT1-1–1 5′-Mat_anti GGATCCGGTAAACAAATATAGGACC 5′ flanking region of MAT1-1–1 3′-Mat_sense AAGCTTCCCATTCACAATTTCGAC 3′ flanking region of MAT1-1–1 3′-Mat_anti GCGGCCGCCCAACCTCCGTGGTTAG 3′ flanking region of MAT1-1–1 ApaI-MAT1 GGGCCCATGTCTACCTCTCTTGATGC MAT1-1–1 gene MluI-MAT1 ACGCGTCTAGTTGTGCCCAAAGATCC MAT1-1–1 gene koMAT 5′-sense GCACGGAGAGCCACGGATGTG 5′ flanking region of MAT1-1–1 koMAT 3′-anti CTTGGCTGTCTGTATATTCCGCG 3′ flanking region of MAT1-1–1 PtrpC__anti1 GGCATTCATTGTTGACCTCCACTAG trpC promoter Tn5-phleo GCGCCTGATACAGAACGAATTGC ble resistance gene 3′MAT-1_inf_fw ATTCGTCGACAAGCTTCCCATTCACAATTTCGACTCGGCT 3′ flanking region of MAT1-1–1 3′MAT-1_inf_rv TAGAATACAGCGGCCGCCGAGGAGTTTGATATTGTCCGTG 3′ flanking region of MAT1-1–1 5′MAT-1_inf_fw CATGCTGCAGACGCGTGAAATACATGTTCCAGGAAGGGGA 5′ flanking region of MAT1-1–1 and MAT1-1–1 gene 5′MAT-1_inf_rv GATCCGATACTGTACGTACTAGTTGTGCCCAAAGATCCGG 5′ flanking region of MAT1-1–1 and MAT1-1–1 gene PcMAT1 -s GGCTATTGCTGTCGACCAAGTT MAT1-1–1 gene PcMAT1-a GTCTGATCGTTGAGTCGTCCACTT MAT1-1–1 gene Pc_HMG_sense CGATGGCGTTCTTGACCTGG MAT1-2–1 gene Pc_HMG_anti GCCTGAACAAAAGGCAGG MAT1-2–1 gene MAT1-1–1_s CGCTTCGTCTACGCAAATGGTGTGCTGGAG MAT1-1–1 gene MAT1-1–1_a GAGAATGTGCTTGTCCCACTCTTCGTTGCG MAT1-1–1 gene PclA_sense TGTGGTATTACCGGGAAGTC pclA (Pc22g14900) gene PclA_anti ACAATTCGTGCCTCGACTCC pclA (Pc22g14900) gene Chry1 GAGTTTGACTCGGGTCTTCG Pc21g16000 gene Chry4 AGCCAATTCCATCTGCTCTG Pc21g16000 gene PcpenDE_s CTGCCACCAAAGAGATGATCC PcpenDEgene PcpenDE_a CCTGGCGTTGAGCGCAGACCT PcpenDEgene pcbC_s CACCCATGGCTTCCACCCCCAAGGCCAATG PcpcbC gene pcbC_a GTGCCATGGCTGTCTGGCCGTTCTTGTTGATTAGAC PcpcbC gene PcFluG-s CCACCATGCCCATAACCTATTGAA PcfluG gene PcFluG-a GCAAATTTCCGATACAAAACCAAC PcfluG gene flbB_for GCCAATGGCATGGACCACTC PcflbB gene flbB_rev TGACCAAGTGCTGTCAAGAG PcflbB gene nsdD_for TAGCGTGGCTTCGCCTAATG PcnsdD gene nsdD_rev TAGAGCACCGAGTAGGGAAG PcnsdD gene Pc23g00420_for TAGAGACCACGGTGCCGAAC Pc2300420 gene Pc23g00420_rev CATTCAAGCGTGCTAGATCC Pc2300420 gene Pc24g01940_for GTCAGCACGCCTATAGACAC Pc24g01940 gene Pc24g01940_rev CTCAGCAACCGGGATATTTC Pc24g01940 gene Pc12g12190_for GCCTTCCAGCTATGCCTACG PcflbC gene Pc12g12190_rev ACGCCCAGGTCTAGCGAAAG PcflbC gene Pc13g04920_for TGAGCAACCAGCGCTCAATG PcstuA gene Pc13g04920_for CTTGCGCCTAGTTCTCCTCC PcstuA gene PcbAB-RT-s GCCGTCAACGAGATATTGGA pcbAB gene PcbAB-RT-a TGGTGAACGGAGAACCAGAC pcbAB gene PcbC-RT-s CCCTCCCGTTCTTCGTCAATC pcbC gene PcbC-RT-a CTGCAGATAGTCGCCGTACGA pcbC gene penDE-RT-s GAATCATCGGGAAGGTTGGA penDE gene penDE-RT-a TCATAGGCCTGGGAAGGAGA penDE gene Pcppg1-RT-s GCTTGCCCCTTGTCCTTCAGA Pcppg1 gene Pcppg1-RT-a CGCTGGTACGCTTGACCTCA Pcppg1 gene Pcpre1-RT-s TGGGACACTGCTGGATGATCT Pcpre1 gene Pcpre1-RT-a GCTAATAACCTGCCGCACATG Pcpre1 gene Pcpre2-RT-s CATGGTGTGGTCCGAGTAGCA Pcpre2 gene Pcpre2-RT-a CGGCGGTGCTGAAAGTCTACT Pcpre2 gene NcSSU1 ATCCAAGGAAGGCAGCAGGC small subunit ribosomal RNA NcSSU2 TGGAGCTGGAATTACCGCG small subunit ribosomal RNA Pre2-hom-f GTAATTATCTACTTTTTACAACAAATATATGGCGACATCATCTCCAATTC Pcpre2 Pre2-hom-r ATTGATCTATCGATTTCAATTCAATTCATCACACGATTGAATTGTTCCTT Pcpre2

Böhm et al. www.pnas.org/cgi/content/short/1217943110 12 of 12 IV BÖHM ET AL. 2014 24

A MAT1-2 wild-type strain from Penicillium chrysogenum: Functional mating-type locus characterization, genome sequencing, and mating with an industrial penicillin-producing strain

Böhm J, Dahlmann TA, Gümüser H, Kück U (2014)

(prepared for submission)

Böhm et al. 2014

A MAT1-2 wild-type strain from Penicillium chrysogenum: Functional mating-type locus characterization, genome sequencing, and mating with an industrial penicillin- producing strain

Authors: Julia Böhm*, Tim Alexander Dahlmann*, Hendrik Gümüser, and Ulrich Kück#

Affiliations:

Christian Doppler Laboratory for „Fungal Biotechnology“, Lehrstuhl für Allgemeine und Molekulare Botanik, Ruhr-Universität Bochum, Universitätsstr. 150, D-44780 Bochum, Germany. Tel: +49-234 - 32 – 26212; Fax: +49-234 - 32 - 14184

*both authors contributed equally to this work

#To whom correspondence should be addressed: [email protected].

Key words: Penicillium chrysogenum, mating type gene, genome sequencing, recombinant progeny

Böhm et al. 2014

Summary

In heterothallic filamentous ascomycetes, mating is controlled by two non-allelic idiomorphs that determine the “sex” of the corresponding strains. We recently discovered mating-type loci in the penicillin-producing fungus, Penicillium chrysogenum; when we crossed strains of the opposite mating-type, we found evidence of a sexual life cycle. All industrial penicillin- production strains worldwide are derived from a MAT1-1 isolate. To date, no MAT1-2 strain has been investigated in detail. Here, we provide the first molecular characterization of a MAT1-2 wild-type strain. Functional analyses of deletion-mutant and overexpression strains showed that the MAT1-2 locus had functions beyond sexual development. Beside fruiting body formation, the MAT locus controls light-dependent asexual sporulation, as well as germination and surface properties of conidiospores. Mating MAT1-2 wild-type with a MAT1-1 high penicillin-producer generated sexual spores. We determined genomic sequences of parental and progeny strains with next generation sequencing and found evidence for genome-wide recombination. SNP calling showed that derived industrial strains had an uneven distribution of point mutations compared to the wild type. We found evidence for meiotic recombination in all chromosomes. Our results suggest that mating-type genes, conventional genetics, and next generation sequencing can be combined to optimize classical strain improvement methods.

Böhm et al. 2014

Introduction

In fungi, mating and sexual propagation are controlled by chromosomal regions, known as mating-type loci, which determine the two opposite sexes. Mating-type loci have been studied most thoroughly in Saccharomyces cerevisiae. In this ascomycetous yeast, “α” and “a” strains carry transcriptionally active mating-type loci, termed “MATα” and “MATa”, respectively. The MATα mating-type locus consists of two genes, α1 and α2, which encode MATα1 and MATα2 proteins (Haber, 2012). MATα1 is a transcription factor (TF) with a characteristic α-box DNA-binding domain; it acts in conjunction with the constitutively expressed, Mcm1 protein, to promote expression of α-specific genes, including genes that express the α-factor mating pheromone and the Ste2 pheromone receptor for the opposite mating pheromone (the a-factor) (Galgoczy et al., 2004; Herskowitz, 1989; Ni et al., 2011). MATα2 encodes a homeodomain protein, which cooperates with Mcm1 to repress a-specific genes that produce the a-factor and the Ste3 pheromone receptor (Bardwell, 2005). Similarly, the MATa locus encodes two proteins. The first, MATa1, is a homeodomain TF with a highly conserved DNA binding domain; the second, MATa2, is a protein of unknown function (Tatchell et al., 1981). In diploid cells, MATa1 and MATα2 form a heterodimer that switches off haploid-specific and supports diploid-specific gene expression (Booth et al., 2010). A remarkable phenomenon in S. cerevisiae is the ability to switch mating type. Two intact, but silent copies of the mating- type alleles, HMLα (Hidden MAT Left) and HMRa (Hidden MAT Right), are located at the opposite ends of the same chromosome that harbors MAT. These alleles serve as donors, which allow a MATa cell to switch to MATα, or vice versa, and they are silenced by the formation of short regions of heterochromatin (Butler et al., 2004). During MAT switching, the MAT locus is replaced by inserting a copy of the sequence from either HMLα or HMRa, and the two donor loci remain unchanged (Hicks et al., 1979). This asymmetric recombination event is termed gene conversion, and it is initiated by a double-strand break induced by the HO endonuclease (Strathern et al., 1982; Kostriken et al., 1983).

In filamentous ascomycetes, the structure of the mating-type loci is evidently different from that of ascomycetous yeasts, and to date, mating-type switching has not been observed in filamentous ascomycetes (Debuchy et al., 2010). Instead, heterothallic strains carry one of two non-allelic idiomorphs called MAT1-1 or MAT1-2. These mating-type loci determine the “sex” of the corresponding strains (Debuchy & Turgeon, 2006; Pöggeler, 2007; Ni et al.,

Böhm et al. 2014

2011; Haber, 2012). The two mating-type idiomorphs typically carry one to several mating- type genes (Glass et al., 1990; Staben & Yanofsky, 1990). All idiomorphs encode conserved TFs, which act as major regulators of sexual communication and mating (Nelson, 1996; Debuchy & Turgeon, 2006). The conserved TF encoded in MAT1-1 is characterized by an α-domain, which shows high similarity to the α-domain TF in the yeast mating-type locus. The conserved TF encoded by MAT1-2 contains a high mobility group (HMG) domain that has no similarity to the mating-type TFs in yeast, but it is found in the TFs of diverse lower or higher eukaryotes. The HMG domain is a DNA-binding sequence that belongs to the MATA_HMG box superfamily. This motif is specific for several non-histone chromosomal proteins and transcription factors, and it is characterized by a conserved intron within the HMG coding sequence (Laudet et al., 1993). Functional analyses of mating-type loci have shown that the encoded TFs are involved in both mating and sexual development (Ni et al., 2011; Kronstad & Staben, 1997).

We previously discovered mating-type loci in diverse strains of the penicillin-producer, Penicillium chrysogenum. The original strain discovered by Alexander Fleming carries a MAT1-2 locus, but all industrial strains derived from a contaminated cantaloupe carry the MAT1-1 locus (Hoff et al., 2008). Both these loci carry a single open reading frame for a TF with either a HMG or α domain. We recently described new functions for the MAT1-1- encoded α-domain TF. Functional analyses provided further evidence that, in addition to sexual mating, MAT1-1 controls developmental processes of biotechnological relevance, such as penicillin biosynthesis, conidiation, and hyphal morphology (Böhm et al., 2013).

Here, we present the first molecular characterization of a MAT1-2 wild-type strain. We performed genome sequencing, and constructed mutants with a deletion or enhanced expression of the mating-type locus. We also showed that the characterized MAT1-2 wild-type strain could mate with an industrial penicillin-producer strain. Genome sequencing of ascospore progeny provided evidence that even highly-developed industrial strains, which have undergone several rounds of mutagenesis, retained the capacity for sexual recombination. Based on genome sequencing data and SNP calling, we provided a genome- wide recombination map for an ascospore progeny. Our data have implications for the use of sexual recombination to generate industrial strains with novel genetic properties.

Böhm et al. 2014

Results

Construction of MAT1-2-1 deletion, complementation, and overexpression strains

Previously, we identified MAT1-1 and MAT1-2 loci in different strains of P. chrysogenum (Hoff et al., 2008). All production strains derived from the Wisconsin lineage (NRRL1951) carry the MAT1-1 locus, but derivatives of the original Fleming strain and diverse wild-type isolates contain the MAT1-2 locus. One of the latter isolates is Pc3, which was shown to mate sexually with a MAT1-1 strain that was a direct descendent of a wild-type isolate (Böhm et al., 2013). For further characterization, we amplified the MAT1-2 locus from Pc3, and the derived sequence showed high similarity to MAT loci in the Fleming isolates, NRRL1249B21 and NRRL824 (Hoff et al., 2008). The identified open reading frame encoded a protein with the conserved HMG domain, which comprised thirteen putative DNA-binding sites (Fig. S1). Within the HMG coding sequence, there is a conserved intron after the first nucleotide of the invariant serine codon, which is present in all known ascomycetous MAT1-2-1 genes (Debuchy & Turgeon, 2006). Sequences adjacent to both MAT idiomorphs are highly conserved in most filamentous ascomycetes, with more than 95% nucleotide identity. They are flanked by SLA2 and APN2, as previously described for other filamentous ascomycetes (Dyer, 2007; Pöggeler et al., 2011; Kück & Böhm, 2013; Hoff et al., 2008). The deletion construct, pKOMAT, was transformed into Pc3; it substitutes the native MAT1-2-1 with the phleomycin resistance cassette. Four independent transformants were generated, and the precise deletion of the MAT1-2-1 gene was verified by Southern analysis (Fig. S2A). Using the deletion strain MAT1-2-1 T10 as host, we constructed complementation strains by ectopically integrating the wild-type MAT1-2-1 gene copy, combined with a pyrithiamine resistance marker, into the genome. On the plasmid (pPgpd-MAT-2-ptrA), the MAT1-2 locus is under the control of the strong constitutive gpd promoter from Aspergillus nidulans. The successful rescue of the deletion and possible multiple integration events were investigated with radiolabeled MAT1-2-1 specific probes (Fig. S2B). We identified 19 strains with ectopic integrations of the MAT1-2-1 gene, and we chose strains with two (T5, T8) or three copies (T24) of the gene for further functional analysis.

Alternatively, we also studied MAT1-2 function by constructing MAT1-2-1 overexpression strains. As hosts, we chose Pc3 and P2niaD18, a high penicillin-producing strain, which carries the MAT1-1 locus. We transformed these strains with the plasmid, pPgpd-MAT-2-ptrA, 5

Böhm et al. 2014 which we had used for complementing the deletion strains (Fig. S3A). The ectopic integration and copy number of pPgpd-MAT-2-ptrA were determined by Southern hybridization (Fig. S3B and C). From six P2niaD18 recombinant strains (P2MAT2-OE), we chose for further study one multicopy-transformant, P2MAT2-OE T1, and two double-copy transformants, P2MAT2-OE T2 and -T5. Similarly, we selected three independent Pc3 recombinant strains (Pc3MAT2-OE), for further functional analysis. One, Pc3MAT2-OE T20 showed multiple integration events; the second, Pc3MAT2-OE T23, carried only one additional copy; and the third, Pc3MAT2-OE T26, carried three ectopic integrations. Subsequent quantitative real-time PCR (qRT-PCR) analyses demonstrated that the extra copies of MAT1-2-1 resulted in enhanced transcriptional expression of MAT1-2-1 in all Pc3MAT2-OE strains. Compared to the reference wild-type Pc3, overexpression strains showed 52- to 169-fold higher transcriptional expression of MAT1-2-1 (Fig. S3D).

MAT1-2 controls light-dependent sporulation

Previously, we demonstrated that the MAT1-1 locus of P. chrysogenum regulates transcription of a wide range of genes; thus, it controls processes such as penicillin biosynthesis, hyphal morphology, and asexual sporulation (Böhm et al., 2013). To determine the involvement of the MAT1-2 locus in asexual spore formation, we measured the number of conidiospores in a defined area. These numbers were compared among Pc3, P2niaD18, and all recombinant MAT1-2 strains. Figure 1 shows that Pc3 exhibited light-dependent sporulation after 168 h of growth. The number of conidiospores generated in light (4.2 × 108 spores/cm2) was approximately twice the number generated in darkness (1.8 × 108 spores/cm2). In contrast, the MAT1-2-1 deletion strains showed increased sporulation in darkness. The sporulation level in darkness (3.4 × 108 spores/cm2) was nearly the same as that observed in light (3.6 × 108 spores/cm2); this suggested that the normal repression of conidiation in darkness was abolished in MAT1-2-1 strains. Moreover, the MAT1-2-1 complementation strains exhibited a restored phenotype; the light-dark effect on asexual sporulation was comparable to that observed in wild-type Pc3. In the MAT1-2-1 overexpression strains, light-dependent sporulation was identical to that observed in the wild-type Pc3 or P2niaD18 strains (Fig. S4A and B). Based on these data, we propose that MAT1-2-1 acts as a repressor of light-dependent sporulation.

Böhm et al. 2014

MAT1-2 controls germination and surface properties of conidiospores

Our previous studies showed that MAT1-1-1 controls conidiospore morphology. Here, we tested whether spore germination and surface properties were affected by MAT1-2-1. Pc3, MAT1-2-1, MAT1-2-1::MAT1-2-1, and Pc3MAT2-OE were incubated for 9 h, and P2niaD18 and P2MAT2-OE were grown for 12 h, due to the delayed germination of conidiospores. To determine effects on germination, we investigated 400 spores from all strains. We observed dramatic effects in all recombinant strains. After 9 h of incubation, about 50% of all conidiospores derived from Pc3 had germinated, and 75% of all germinating spores exhibited a single germ tube. All other spores displayed two germ tubes (Fig. 2A). The MAT1-2-1 deletion strains revealed the opposite phenotype. After 9 h of incubation, 70% of the conidiospores had germinated and nearly 70% of the germinating spores showed two germ tubes. Thus, deletion of MAT1-2-1 led to an enhanced germination rate that was correlated to a higher number of germ tubes. This effect was not completely restored in the complementation strains. Incomplete restoration might be explained by altered gene expression, due to ectopic integration of the MAT1-2-1 gene, which was under the control of the heterologous gpd promoter. Overexpression of genes might lead to partial restoration of the phenotype. As shown in Fig. 2B, the overexpression strains showed a much higher germination rate than the reference strain. After 9 h of incubation, 80% of the conidiospores had germinated, and 60 % displayed two germination tubes.

A different picture was observed with P2niaD18 and its derivatives. The reference strain showed a high germination rate of 75%, and 55% of spores produced two germ tubes. Fig. 2C shows that the MAT1-2-1 overexpression strains had a lower germination rate (35%), and 70- 80% of spores displayed only one germ tube. These results suggest that, in the MAT1-1 host, MAT1-2-1 acted as a repressor of germination, and it regulated the number of germ tubes. In the wild-type strain, MAT1-2-1 had an activating effect on germination, and thus, it led to a higher number of spores with more than one germination tube. In conclusion, our results showed that MAT1-2-1 had an impact on spore germination and germ tube formation.

Investigation of hyphal development after 14 h of incubation revealed that the hyphae length was not significantly altered in any recombinant MAT1-2 strain (data not shown). However, microscopic investigation of MAT1-2-1 overexpression strains revealed that overexpression enhanced conidiospore agglutination. Fig. 3 shows that conidiospores were attached to each

Böhm et al. 2014 other just before germination, and the spores germinated simultaneously. This phenomenon was observed in Pc3MAT2-OE and in recombinant strains derived from P2niaD18. Even when the spore suspensions were vortexed before inoculation, the agglutination effect was observed (data not shown). Therefore, the strains formed clusters of spores, with two, three, or even 20 spores attached to each other. This phenomenon was observed shortly before germination, and led to the formation of pellet-like structures. These morphological features are probably responsible for the observed pellet phenotypes described in the next section.

MAT1-2 controls pellet formation

To analyze the impact of MAT1-2-1 on pellet formation further, we conducted time course experiments in liquid shaking cultures. Reference and recombinant MAT1-2 strains were incubated for 48, 72, 96, and 168 h in liquid CCM. We investigated 240 pellets of each strain at each time point for further measurements. Pellet phenotypes were distinct and consistent for the strains investigated. After 48 h of incubation, 85% of the pellets from strain Pc3 were 2000-4000 µm in diameter (Fig. 4A, Fig. S5A). Over the time course of 168 h, the pellet sizes increased, and 65% of the final pellets were 4000 to 6500 µm in diameter. MAT1-2-1 deletion strains did not show changes in pellet formation; the pellets displayed a similar distribution pattern at all time points (Fig. S6). In contrast, the Pc3 overexpression strains generated larger pellets than the reference strain, after only 72 h of incubation (Fig. 4A). At this time point, only 5% of Pc3 pellets were larger than 5000 µm, but in overexpression strains, 40% of the pellets were larger than 5000 µm, with a maximum diameter of about 7700 µm. At the same time, small pellets of about 2000 µm were also apparent, and these were responsible for a heterogeneous distribution of pellet sizes. This phenomenon was more apparent in P2MAT2-OE strains. P2niaD18 exhibited pellets no larger than 1500 µm, even after 96 h of incubation (Fig. 4B, Fig. S5B). However, the overexpression strains generated pellets of about 2000 µm in diameter, after only 48 h of incubation, but 40% of the pellets were smaller than 500 µm. After 96 h, the distribution pattern shifted towards larger pellets, where 40% of pellets were 2000 µm to 4000 µm, and only 10% of pellets were about 500 µm. These results demonstrated that MAT1-2-1 had an impact on conidiospore morphology and affected pellet morphology, independent of the genetic background of the host. We propose that the observed pellet morphologies arose as a consequence of conidiospore agglutination. Single germinating

Böhm et al. 2014 spores will form rather small pellets. However, the pellet diameter varies with the number of attached spores; thus, pellets of every size are formed.

Mating between wild-type and industrial producer strains

In the present and in a previous investigation, we showed that MAT loci in P. chrysogenum controlled developmental processes that were not related to sexual reproduction. Furthermore, a previous study showed that the MAT1-1 locus is not required for fruiting body formation (Böhm et al., 2013). In the present investigation, we tested whether the MAT1-2 locus was necessary for crossings between MAT1-2 and MAT1-1 strains.

The wild-type P. chrysogenum isolate from Peoria (Wisconsin) is a MAT1-1 strain, designated NRRL 1951. Fig. 5 shows that this strain is the progenitor of Q176 and all derived industrial strains, including Wisconsin 54-1255. Classical mutation of Wisconsin 54-1255 and selection programs resulted in a series of strains with at least 85-fold increases in the penicillin titer. Nippon Kayaku Co. (Japan) provided the producer P2, characterized by an amplified gene cluster, which carries the three penicillin biosynthesis genes (Nielsen, 1997; Lein, 1986). Finally, UV mutagenesis resulted in a nitrate-reductase-deficient strain, designated P2niaD18 (Hoff et al., 2008). The genomic sequence of P2niaD18 was published recently (Specht et al., 2014) and shows at least two chromosomal rearrangements compared to the previously sequenced Wisconsin 54-1255 strain (van den Berg et al., 2008). We crossed Q176 with MAT1-2-1 and Pc3 in two independent sets of experiments with at least 10 mating plates each. After 16 weeks of incubation, we observed cleistothecia only when the intact MAT1-2 locus was present from the parental strain. In strains with MAT1-2-1, we never observed fruiting body formation; this indicated that the encoded gene product is a prerequisite for completion of the sexual life cycle.

In the next set of experiments, we crossed diverse MAT1-2 strains with P2niaD18 (MAT1-1). The MAT1-2 strains included Pc3, the ascospore isolate AS25 (Böhm et al., 2013), and the Fleming strain (Hoff et al., 2008). After five weeks of incubation, 10 crosses were investigated further for cleistothecia formation. We found that crosses with the Fleming strain gave no fruiting body formation, and crosses with Pc3 produced infrequent cleistothecia. The most efficient crossing was obtained with AS25. Therefore, further analyses were conducted with isolates from this crossing. Mature cleistothecia were collected for further ascospore

Böhm et al. 2014 isolation. Compared to previous reports (Böhm et al., 2013), we considerably modified the procedure for isolating ascospores to remove contaminating conidiospores. Cleistothecia were maintained at 60 °C for 30 min to prevent germination of conidiospores, as ascospores are known to be more resistant against heat in various Penicillium and Aspergillus species (Pitt & Hocking, 2009). For isolation of asci and ascospores, cleistothecia were crushed by vortexing with glass beads for 5 min. Isolated ascospores were then screened for recombination at the molecular level by probing for eleven marker genes in a RFLP analysis and by identifying the mating-type locus with Southern hybridization, as described previously (Böhm et al., 2013). Out of 100 isolates screened, we detected nine with a recombinant genotype. As discussed later, this rather low frequency of recombinant isolates can be explained by the low number of markers. One of these recombinant isolates, AS25-3, was used later for genome analysis, and it was compared with Pc3 and AS25 to investigate meiotic recombination at the genomic scale in P. chrysogenum crossings.

Genome sequencing

We determined the genomic sequence of two recombinant ascospore isolates (Fig. 5) with next generation sequencing. Then, we compared the sequences to the recently published sequence of P2niaD18. The P. chrysogenum Pc3 genome was sequenced in paired-end, 100 nt reads on an Illumina HiSeq 2000 system. In total, 13,751,610 reads were obtained, which represented a nominal coverage of ~31-fold across the ~32.4 Mb P2niaD18 genome (Specht et al., 2014). The processed reads were assembled de novo into 1,118 contigs, with a minimum contig length of 1 kb and an N50 of 165,535 bp. All contigs represented 32,038,477 nt, which resulted in a ~98% nominal coverage of the currently assembled P2niaD18 genome sequence. The main features of the Pc3 genome assembly are shown in Table 1. The contigs were aligned to the improved genomic sequence of Wisconsin 54-1255 (Specht et al., 2014) to identify differences in the chromosomal architecture between strains. Compared to Wisconsin 54-1255, we detected at least one chromosomal rearrangement in Pc3 by PCR analysis (Fig. S7). The Pc3 contig 29 contained sequences that located to chromosomes II and III of Wisconsin 54-1255. Interestingly, this translocation was verified for all tested strains of the Wisconsin lineage, including Q176 and P2niaD18. However, NRRL 1951, the wild type ancestor of all the penicillin-producing strains had the same chromosomal architecture at this site as Pc3. This similarity was also reflected in a phylogenetic tree, which was recently

Böhm et al. 2014 established with three marker genes for Penicillium species (Houbraken et al., 2011). Our analysis included eleven Penicillium strains, and Pc3 appeared to be most closely related to NRRL 1951 (Fig. S8). To investigate genomic recombinations among the ascospore isolates, the genomic sequences of AS25 and AS25-3 (for origins, see Fig. 5) were determined by next generation sequencing using 50-nt reads produced with the Illumina HiSeq 2000 system. After filtering, we obtained 15,860,919 reads for AS25 and 20,726,343 reads for AS25-3, resulting in nominal coverages of 22.2× for AS25 and 27.8× for AS25-3 (Table 2).

Mapping and SNP detection

In a first comparison, SNP calling was performed with Pc3 and P2niaD18. We mapped 82.1% of the obtained reads for Pc3 to the reference P2niaD18 sequence, which represented a mean mapping quality of 38.3 and a 31.4-fold coverage. In total, 33,956 SNPs were identified, including 27,271 high quality SNPs (defined in the Experimental Procedures section). SNP analysis of parental strains is prerequisite for detecting recombinant chromosomes in ascospore progeny. In further analyses, only the high quality SNPs were considered. For an optimal resolution, we performed sliding window analyses with 10 kb steps, based on the SNP distribution between Pc3 and P2niaD18 (Fig. S9). This analysis showed an uneven distribution of all SNPs across the four chromosomes. Remarkably, the region that harbored the penicillin gene cluster showed a SNP density (12.6 SNPs/kb) over eleven-fold higher than the average density (1.1 SNPs/kb). This result indicated that the mutagenesis performed in strain improvement programs led to multiple point mutations in gene sequences that were relevant for penicillin biosynthesis. We constructed a consensus sequence for Pc3 that overlapped with 96.5% of the P2niaD18 genome sequence.

The de novo assembled Pc3 genomic sequence was then used as a reference for SNP calling with AS25. We mapped 92.0% of the processed AS25 reads to the 1,118 de novo assembled contigs of Pc3, and only 397 high quality SNPs were predicted. Similarly, the processed short reads from AS25 were mapped to the reference sequence of P2niaD18 to predict parental SNPs that were compared to the ascospore isolate, AS25-3. We could map 90.8% of all AS25-3 reads on AS25 and achieved a 22.2-fold coverage.

Further, a total of 21,133 high quality SNPs were found between AS25 and P2niaD18, which indicated high genomic divergence of both strains. Based on the reference sequence of

Böhm et al. 2014

P2niaD18, we constructed the AS25 consensus sequence. It contained 7,497 gaps with a total size of 968,572 nt. Thus, the overall SNP calling analysis showed a rather high similarity between Pc3 and AS25 and, at the same time, high sequence divergence with P2niaD18.

SNP calling was also applied to detect recombinant genomic sequences in ascospore isolates. To achieve this, AS25-3 reads were mapped to the parental P2niaD18 sequence. In total, 86.8% of the processed short reads from AS25-3 were mapped to P2niaD18, resulting in a 27.8-fold coverage. From this, we obtained a consensus sequence for AS25-3 that included 6,135 gaps which have a size of 887,230 nt. In addition, 1,252,628 nt were filtered out, due to insufficient coverage. The remaining consensus sequence represented 93.4% of the nuclear genome and showed sufficiently high quality for SNP calling analysis. In a comparison with the P2niaD18 sequence, we identified 21,102 high quality SNPs in the AS25-3 sequence. To facilitate comparison of the different SNP analyses performed in this study, an overview of the results is shown in Table 2. To verify the SNP calling results, DNA was randomly selected from genomic regions of all the sequenced strains and amplified for resequencing. By comparing amplicons with consensus sequences, we tested and verified 52 SNPs, indicating that the results of the SNP calling were highly reliable.

Identification of different inherited genomic regions in ascospore isolates

To identify the different inherited regions in the AS25-3 genome, SNPs from both parental strains were compared to the AS25-3 consensus sequence (Fig. S10). We found that 72.7% of the high quality SNPs could be unambiguously allocated to AS25, and 18.9% seemed to originate from P2niaD18. However, 8.5% of SNPs could not be allocated to either parental strain. Based on these results, we performed a genome-wide scan to determine the distribution of recombination events with a sliding window approach. For optimal resolution, we used 10-kb steps in the sliding window analysis. As shown in Fig. 6, the majority of SNPs in AS25-3 were unique to AS25, and most of the windows that represented SNPs inherited from P2niaD18 were clustered in restricted regions. The grey bars represent regions that could not be allocated to Pc3 or AS25. These regions were mainly located in sequences defined by a low frequency of SNPs. To verify these predicted recombinant sequences, we amplified DNA from 5 recombinant regions for further sequencing. From this analysis, we found that all selected regions contained DNA derived from both parental strains. For example, the sequence corresponding to nucleotides 2,400,500 to 2,404,500 on chromosome I of P2niaD18

Böhm et al. 2014 shows 43 SNPs as shown in Fig. 7. Within this 4 kb region, we detected a recombination site that represented sequences from both parental strains. Within a 300 bp region, five SNPs were derived from AS25 and two from P2niaD18. For further verification, the 300 bp region was amplified separately from all three strains, and the amplicon sequences confirmed the detected SNPs. As shown in Fig. 7, we localized the recombination site in an 81 bp sequence between two SNPs inherited from different parents.

Our data showed that the ascospore isolate, AS25-3, was highly recombinant, and that meiotic recombination had occurred in the crossing between the industrial MAT1-1 penicillin producer, P2niaD18, and the MAT1-2 ascospore isolate, AS25. Furthermore, our data provides evidence that backcrossing an ascospore isolate with P2niaD18 could expand the proportion of genomic DNA derived from the parental industrial strain.

Böhm et al. 2014

Discussion

MAT locus-encoded TFs are involved in regulating mating and sexual development in filamentous fungi. These TFs are critical for MAT identity; they also govern the expression of pheromone and pheromone receptor genes and control meiosis-inducing genes (Van Heeckeren et al., 1998). We recently showed that a MAT1-1-1 encoded TF had adopted additional functions in fungal development (Böhm et al., 2013).

The HMG mating-type TF promotes sexual and represses asexual developmental processes

In this study, we showed that a MAT1-2-1 encoded TF harboring an HMG domain regulated light-dependent conidiosporogenesis and the frequency of conidiospore germination. In contrast to the wild type MAT1-2-1 strains, MAT1-2-1 deletion strains had equivalent sporulation levels in light and darkness and a higher spore germination rate, which correlated with a higher number of germ tubes. Therefore, we propose that MAT1-2-1 acts as a repressor of light-dependent sporulation and conidiospore germination.

Filamentous fungi grow by forming a dense network of hyphae, which develops by hyphal tip extension and branching. In response to different environmental stimuli, such as light, nutrients, or signaling peptides, fungi differentiate specialized structures for either asexual or sexual reproduction. In P. chrysogenum, asexual development and conidiospore production typically takes places under light conditions, and sexual reproduction with the formation of fruiting bodies is induced in darkness (Böhm et al., 2013); the latter resembles the light- controlled development observed in other filamentous fungi; e.g., A. nidulans or A. fumigatus (O'Gorman et al., 2009; Sarikaya Bayram et al., 2010). Our data support the hypothesis that MAT1-2-1 is a prerequisite for sexual reproduction and simultaneously represses asexual development. This hypothesis is consistent with the observation that cleistothecia formation was abolished in MAT1-2-1 strains (Ferreira et al., 1998; Desjardins et al., 2004; Paoletti et al., 2007; Pöggeler et al., 2006).

Another example of MAT1-2-1 controlling conidiosporogenesis was reported for Fusarium verticillioides (Bodor et al., 2012). In that fungus, conidiation was not generally regulated by light, but in MAT1-2-1 deletion strains, asexual sporulation was reduced under diurnal light conditions or in complete darkness. Thus, depending on the fungal species, MAT1-2-1 appears to control various fungal developmental programs.

Böhm et al. 2014

We also showed that MAT1-2-1 in P. chrysogenum controlled spore and germ tube formation. Remarkably, MAT1-2-1 overexpression in the P2niaD18 background showed the opposite effect compared to MAT1-2-1 overexpression in the Pc3 background. In the P2niaD18 background, conidiospores showed a rather low germination frequency, and most of the germinated spores exhibited only a single germ tube. Thus, in the presence of MAT1-1-1, the regulatory function was clearly different, and this difference may have resulted from the expression of two MAT encoded TFs within a single strain.

Based on these results, which only occurred with the presence of MAT1-1-1 in the P2MAT2- OE strain, one might speculate that the MAT TFs formed a heterodimer, and this structure changed their DNA-binding activity and/or specificity. In diverse yeasts, the heterodimeric a1-α2 complex repressed haploid-specific gene expression and supported diploid-specific gene expression, which promoted meiosis (Booth et al., 2010). Similarly, in Ustilago maydis, bE and bW heterodimeric complexes promoted a switch from the haploid yeast phase to the pathogenic dikaryotic phase with filament growth (Kämper et al., 1995). Finally, the human SOX (sex-determining region [SRY]-type high mobility group [HMG] box) family of TFs is known to determine cell fate during organ development. Homodimer formation of SOX proteins inhibited DNA-binding, and heterodimer formation supported DNA-binding capacity (Kasimiotis et al., 2000). Proteins of the fungal velvet family appear to be a novel class of regulators that activate or repress various developmental processes by forming diverse hetero- or homodimeric complexes in A. nidulans. For example, the VosA-VelB heterodimer is essential for the regulation of asexual development and spore viability, whereas the VelB-VeA heterodimer regulates sexual development. The trimeric VelB-VeA-LaeA complex coordinates differentiation and secondary metabolism. Thus, homodimers of different velvet proteins appear to have other functions and different localizations (Sarikaya Bayram et al., 2010).

Our functional characterization of the MAT1-2 locus from P. chrysogenum demonstrated that MAT1-2-1 functions in a broad spectrum of asexual developmental processes, similar to MAT1-1-1. Moreover, the function of MAT1-2 was clearly distinct from the opposite MAT1-1 locus. We showed that MAT1-1-1 acted as a repressor of asexual sporulation in light, because MAT1-1-1 strains showed elevated sporulation, and light did not affect germination frequency. The exact identities of the genes regulated by the mating-type TFs remain to be elucidated.

Böhm et al. 2014

Pellet formation is dependent on expression of mating-type-encoded TFs

Independent of the host strain, we observed the formation of pellets with heterogeneous sizes. We hypothesized that this effect was due to enhanced conidiospore agglutination, which indicated that the MAT1-2 locus regulated the surface properties of asexual spores. Pellet formation is dependent on several morphological processes. Pellets typically result from (i) aggregation of spores before germination, (ii) clustering of germ tubes, or (iii) aggregation of young mycelia. The process depends on the physicochemical and physiological characteristics of spores and hyphae (Prosser, 1995). Pellet size is affected by environmental factors, like, for example, the concentration of the spore inoculum and the pH and composition of the growth medium; however, size is also affected by the genetic properties of particular fungal strains (Fomina & Gadd, 2002). Based on our results, we concluded that pellet size was the result of three phenomena; first, the length of the germ tubes; second, the number of germ tubes of single conidiospores; and third, the hydrophobicity of conidiospores. Recently, we showed that increases in germ tube length led to larger pellets in MAT1-1-1 overexpression strains (Böhm et al., 2013). An increased number of germ tubes in conidiosporogenesis also correlated with increased pellet size in recombinant MAT1-1-1 and MAT1-2-1 strains. In addition, we hypothesized that the agglutination of spores resulted in larger sized pellets, which reached a diameter of nearly 7000 µm. Conidiospores are water repellent to facilitate their dispersal in air (Beever & Dempsey, 1978). It was previously shown that the aggregation of spores is dependent on their surface properties, such as their electrical charge and hydrophobicity, and that aggregation leads to pellet formation (Jones, 1994; Clement et al., 1994). In A. nidulans, the hydrophobicity of conidiospores is based on two small hydrophobic proteins, known as hydrophobins DewA and RodA, which are located in the walls of conidia (Stringer & Timberlake, 1995). Disruption of the corresponding genes produces conidiospores that are more easily wetted than conidiospores from wild-type strains (Stringer & Timberlake, 1995; Stringer et al., 1991; Girardin et al., 1999). Because pellet diameter decreases with decreasing hydrophobicity, it was concluded that high surface hydrophobicity favors pellet formation. Additionally, the stability of the formed agglomerates depends on electrostatic forces, hydrophobic interactions, and chemical interactions, such as polysaccharide bridging (Dynesen & Nielsen, 2003). The aggregated conidiospores are attached to other germinating or non-germinated conidiospores, and the resulting aggregates accumulate to form so-called superaggregates (Dynesen & Nielsen, 2003). This phenomenon probably occurred with the

Böhm et al. 2014

MAT1-2-1 overexpression strains described here. We assumed that the MAT TF altered the surface properties of conidiospores, possibly by changing their hydrophobicity. The significant effects on pellet formation suggested that manipulating MAT genes might therefore provide a unique strategy for strain improvement. Pellet formation is of great interest in industrial fermentation processes, because pellet aggregation reduces the viscosity of the culture broth. This lower viscosity facilitates shearing and aeration of the culture, and thus promotes productivity due to an enhanced supply with oxygen and nutrients. Recently, we demonstrated that the MAT1-1 locus of P. chrysogenum played additional roles in regulating developmental processes that were of biotechnological relevance, such as penicillin biosynthesis, asexual sporulation, and hyphal morphology (Böhm et al., 2013). The present study also revealed that the MAT1-2 locus played additional functions in developmental processes. In other ascomycetes, MAT1-2-1 is mainly described as a regulator of ascospore formation and fruiting body development. Furthermore, MAT1-2-1 regulates the expression of genes involved in sexual development or in the pheromone system. In this study, we demonstrated that MAT1-2-1 also repressed asexual developmental processes and changed pellet formation by altering the surface properties of conidiospores.

Mating and characterization of recombinant progeny by whole genome sequencing

Our mating experiments clearly demonstrated that the MAT1-2 locus is a prerequisite for completion of a sexual life cycle. The MAT1-2-1 deletion strain was unable to form cleistothecia in crossings with a MAT1-1 strain. Our data are consistent with a recent report with the homothallic fungus, Sordaria macrospora (Pöggeler et al., 2006). In that study, deletion of the gene for MAT1-2-1 (Smta-1), which encoded a homologous HMG TF, resulted in mutant strains that lacked fruiting body formation. Similarly, other studies showed that sterile strains were obtained from A. nidulans and A. fumigatus, when the homologous genes were deleted (Paoletti et al., 2007; Szewczyk & Krappmann, 2010).

Based on eleven RFLP markers, we recently demonstrated that fertile crosses generated recombinant ascospore isolates. For those experiments, we crossed a strain that had a low penicillin titer with a wild type strain (Böhm et al., 2013). In the present study, we mated the wild type strain with a highly derived production strain that had undergone several rounds of mutagenesis in strain improvement programs. To determine chromosome-wide recombinations, we applied whole genome next-generation sequencing to Pc3, a wild-type

Böhm et al. 2014

MAT1-2-1 strain, and two progeny strains. By generating sequencing data that afforded >20- fold coverage, we were able to identify reliable, high quality SNPs in the parental strains (Nielsen et al., 2011). The large number of high quality SNPs in parental strains allowed a genome-wide comparative analysis for detecting recombinant genomic regions in progeny chromosomes. The large numbers of SNPs that distinguish strains of the Wisconsin lineage were caused by multiple rounds of conventional mutagenesis previously performed during strain improvement (Elander, 1983; Lein, 1986). The possibility that strains of the Wisconsin lineage can be distinguished based on their mutations was supported by previous reports (van den Berg, 2010). Thus, it was surprising that these penicillin-producing strains have retained the capacity to mate with a MAT1-2-1 wild-type strain.

To characterize progeny, we compared consensus sequences from ascospore isolates, AS25 and AS25-3, to the corresponding positions in both parental sequences, based on SNP calling. With the parental SNPs as markers, we identified recombinant genomic regions in both sequenced ascospore isolates. These recombinant regions indicated that meiotic recombination had occurred during mating.

The genome-wide analysis of SNPs between Pc3 and AS25 revealed a large number of SNPs that were predicted with an allele frequency of 0.5, which indicated sequence dissimilarity due to duplications. This phenomenon could be explained by segmental aneuploidy, as was shown previously in Aspergillus flavus (Olarte et al., 2012). Compared to AS25, the genome of AS25-3 contained fourfold the number of SNPs assigned to Pc3. Thus, we showed that backcrossing products of a progeny strain with an industrial penicillin producer caused an increase in the number of sequences derived from the industrial parent. We assumed that the increased recombination rate was caused by an adaptation in the chromosome architecture during the first mating. It can be expected that an increase in chromosomal similarity promotes an increased chromosomal recombination rate during meiosis. In addition, the increased exchange of genomic sequences indicated that further backcrossing could be used to combine strain-specific traits. It was previously suggested that the occurrence and extent of chromosome length polymorphisms within a species are inversely correlated with the frequency of meiosis (Kistler & Miao, 1992); this hypothesis was based on the observation that extreme karyotypic variation was found in species that only reproduce asexually. Experimental proof was provided from crossing experiments with the model ascomycete,

Böhm et al. 2014

S. macrospora. In this fungus, strains of various geographic origins were crossed that showed a high degree of chromosome variability. Depending on the chromosomal configuration, fertility was reduced in sexual crossings (Pöggeler et al., 2000).

Our data on chromosomal recombination are relevant to the constant commercial demand for the construction of novel production strains. For example, morphology is important for an optimal fermentation process. Similarly, there is a demand for improved penicillin production strains that have the ability to metabolize cheaper carbon substrates. We can assume that many undesirable effects occur during the strain improvement programs, which are typically performed with undirected mutagenesis. Indeed, many industrial strains are adapted to fermentation conditions and show a high degree of genetic instability; thus, they reduce the efficiency of the production process. Sexual reproduction allows recombination of traits without introducing further mutations. Furthermore, sexual mating will offer an opportunity for “genetic healing”, simply by genetic recombination. In other words, recombination provides the potential to correct undesirable mutations that occurred with desirable mutations that provided a benefit in penicillin biosynthesis. For industrial purposes, the combined potentials of asexual reproduction, via conidiospores, and sexual reproduction, through mating, will expand the possibilities for strain improvements. The presence of a sexual cycle also provides the ability to cross penicillin-producer strains. This feature is an invaluable tool, because it permits classical genetic analyses, allowing researchers to determine whether a trait of interest has a mono- or polygenic basis. This will provide valuable insights into the genetic basis of P. chrysogenum and filamentous fungi. For instance, genes that control hyphal morphology, mycotoxin production, and antifungal resistance are of particular economic importance (Keller et al., 2005; Anderson, 2005). Furthermore, this work provides new insights because it successfully combined genome biology with classical genetic and culturing techniques. Our findings have implications for substantially optimizing penicillin production, because they provide fundamental insights into novel strategies for improving industrial fungal strains.

Sequencing Pc3 provides insight into strain development

By mapping the de novo assembled contigs of Pc3 to the chromosomal model of P2niaD18, we were able to identify a major chromosomal rearrangement. Further resequencing of PCR amplicons from both wild-type strains and several low-penicillin producer strains showed that

Böhm et al. 2014 the chromosomal recombination of P2niaD18 appeared only in strains of the Wisconsin lineage. We previously reported the complete genomic sequence of P2niaD18 (Specht et al., 2014), demonstrating that the industrial penicillin producer, P2niaD18, carried two additional major chromosomal rearrangements compared to the low-penicillin producers. Our data suggested that the validated interchromosomal recombination was induced during conventional mutagenesis of the MAT1-1 wild-type NRRL 1951. This makes it a reliable marker for distinguishing MAT1-1 wild-type strains from improved penicillin producer strains. More importantly, our results demonstrated that, despite major chromosomal rearrangements, Penicillium strains could undergo meiotic recombination during sexual development. Thus we suggested that traits from different industrial strains can be combined by recrossing of industrial strains with MAT1-2 ascospore isolates. In addition, a genome- wide comparison of the industrial penicillin producer, P2niaD18, with wild-type Pc3 provided insight into the changes that were generated by mutagenesis during penicillin strain improvement programs. This finding was in clear contrast to comparable studies with wild- type strains of Neurospora crassa and S. cerevisiae. In those investigations, SNPs were distributed evenly over all chromosomes (Pomraning et al., 2011; Swinnen et al., 2012). The highly irregular distribution of SNPs found in the present study could only be explained by the conventional mutagenesis that was performed during strain improvement (Nielsen, 1997). Most importantly, the relative greatest number of SNPs in both strains resided in the penicillin gene cluster, indicating that the strains selected during strain improvement programs had an increased number of SNPs in the coding and non-coding regions of the penicillin gene cluster. By analyzing regions with a statistically enriched number of SNPs, we might potentially identify novel genes involved in penicillin biosynthesis. Due to the close relationship between fungal development and secondary metabolism, we assume that further analysis will lead to the characterization of unknown genes associated with either secondary metabolism or morphogenesis.

In conclusion, this study has extended the concept of using mating-type loci for classical strain improvement (Pöggeler, 2001). Moreover, the new technique of crossing industrial producers and the newly obtained knowledge of genomic regions that were affected during strain improvement will provide a basis for future targeted searches for genes relevant to penicillin biosynthesis. Thus, our results, combined with the available molecular tools for P. chrysogenum, will promote the application of the sexual lifecycle to future studies. This 20

Böhm et al. 2014 approach will increase the knowledge of complex metabolic pathways and provide solutions for improving industrial strains.

Böhm et al. 2014

Experimental procedures

Strains and culture conditions

The Escherichia coli strain, K12 XL1-Blue, was used for general plasmid construction and maintenance (Bullock et al., 1987; Sambrook & Russell, 2001). Standard protocols were used for cloning and propagation of recombinant plasmids (Sambrook & Russell, 2001). All wild- type and recombinant P. chrysogenum strains investigated in this study are summarized in Table S1. Strains were grown at 27 °C with shaking (120 rpm), in liquid complete culture medium (CCM). For solid media, we used CCM or M322, as previously described (Minuth et al., 1982; Hoff et al., 2010b). All liquid and solid media were inoculated with 107 spores from freshly prepared spore suspensions derived from cultures grown on M322 medium for 3-4 days.

Transformation

DNA-mediated transformation of P. chrysogenum strains was performed as recently described (Hoff et al., 2010b).

Construction of MAT1-2-1 deletion strains

For characterization and in vitro recombination, the complete MAT locus of Pc3 was amplified and sequenced with primer pairs 3 × 4, 5 × 9, and 6 × 7 (Table S2). For MAT1-2-1 deletion mutants (MAT1-2-1), we used a previously described deletion vector (Böhm et al., 2013) (Table S3), which was amenable, due to the highly conserved flanking regions of MAT1-1-1 and MAT1-2-1. This vector was designed to substitute the native MAT1-2-1 gene in Pc3 with the phleomycin resistance cassette (Fig. S2A). The plasmid was linearized with the restriction enzymes, MluI and NotI, and the resulting 4.0 kb fragment was used to transform Pc3. The resulting transformants were screened and analyzed, as previously described (Hoff et al., 2010b). Purified DNA from single MAT1-2-1 spore isolates was used to verify the complete lack of the MAT1-2-1 gene by Southern hybridization analysis (Fig. S2A).

Rescue of MAT1-2-1 deletion strains

For complementation analysis, the MAT1-2-1 T10 strain was transformed with the plasmid, pPgpd-MAT-2-ptrA. This plasmid carried the MAT1-2-1 gene, under the control of the strong constitutive gpd promoter of Aspergillus nidulans, and the ptrA gene as a selectable marker.

Böhm et al. 2014

The successful rescue of the MAT1-2-1 gene was verified by Southern hybridization, and the corresponding strains were designated MAT1-2-1::MAT1-2-1 (Fig. S2B).

Construction of MAT1-2-1 overexpression strains

For generating MAT1-2-1 overexpression strains, the pPgpd-MAT-2-ptrA plasmid was transferred into both P2niaD18 and Pc3. The resulting transformants were selected with pyrithiamine-supplemented agar plates, because the construct carried the ptrA resistance gene. Positive transformants were named P2MAT2-OE or Pc3MAT2-OE, respectively. Copy numbers of integrated plasmids were determined by Southern hybridization with a 32P- radiolabeled MAT1-2-1 probe (Fig. S3A and B).

Spore quantification assay

To quantify conidiospores, for each strain, four Petri dishes with solid CCM were inoculated with 200 µl of a suspension containing 107 spores. Two dishes were incubated in constant light, and two in complete darkness for 168 h. From each plate, a defined area of about 1 cm2 was cut out, and the spores were counted with a hemocytometer.

Light microscopy

Microscopic observations of spore germination, hyphal morphology, and pellet quantification assays were performed as previously described (Hoff et al., 2010a; Böhm et al., 2013). To quantify spore germination, in all cases, 400 conidia from each strain were analyzed with light microscopy after growth for 9 h (Pc3 and its derivatives) or 12 h (P2niaD18 and its derivatives) on solid media.

Nucleic acid isolation, cDNA synthesis, and qRT-PCR

Nucleic acid preparations, hybridizations, cDNA synthesis, and quantitative Real-Time (qRT) PCR analyses were carried out as described recently (Hoff et al., 2010a). qRT-PCR was conducted with the following modifications: The PromegaGoTaq® qPCR Master Mix was used as recommended by the manufacturer, and the incubation cycles were performed on a StepOnePlus™ Real-Time PCR System (Applied Biosystems, Life Technologies, Darmstadt, Germany) with the primers listed in Table S2.

Böhm et al. 2014

Crossing experiments

Crossing strains with different mating types were conducted as previously described, with some modifications (Böhm et al., 2013). After isolation, the fruiting bodies were added to 200µl sterile water supplemented with glass beads. The samples were then heated at 60 °C for 30 min and vortexed for 5 min; then, aliquots (50 µl) were plated on oatmeal agar with biotin, incubated at 27 °C, and examined daily for germinating ascospores. Isolated ascospores were characterized and analyzed by RFLP as previously described (Böhm et al., 2013). Progeny of the cross between AS25 and P2niaD18 were named AS25- with continuous numbers.

DNA sequencing and analysis

Genomic DNA was obtained from the P. chrysogenum strains Pc3, AS25, and AS25-3, as described above, and sequenced with an Illumina HiSeq 2000 at GATC Biotech AG (Konstanz, Germany). The wild-type strain, Pc3, was sequenced with a paired-end sequencing strategy, in 100 nt reads, and an expected insert size of ~300 bp. The progeny strains, AS25 and AS25-3, were sequenced in 50 nt single-end reads. Raw sequencing data from next generation sequencing have been deposited in the NCBI sequence read archive (http://www.ncbi.nlm.nih.gov/sra) under the accession numbers XXX for Pc3, XXX for AS25, and XXX for AS25-3. The genomic sequences of P. chrysogenum ATCC28089 (Wisconsin 54-1255) and P2niaD18 were previously published (Specht et al., 2014). The MultAlign program (http://multalin.toulouse.inra.fr/multalin/) was used for sequence alignment, and GeneDoc (http://www.nrbsc.org/gfx/genedoc/index.html) was used for display. Sequences for phylogenetic analysis were obtained from the public NCBI Entrez database (http://www.cbi.nlm.nih.gov/entrez/).

Genome assembly and mapping

The raw sequence reads were processed with quality-score based filtering and trimming with Trimmomatic v0.30 (Lohse et al., 2012). The processed reads of Pc3 were used for de novo assembly with the Velvet assembler v1.2.10 (Zerbino & Birney, 2008). Detailed descriptions of the parameters used with Trimmomatic and Velvet programs are provided (File S1). To detect chromosomal architecture variations between the Pc3 and P2niaD18 strains, the resulting Pc3 contigs were aligned to the genomic sequence of P2niaD18 with BLAST and CONTIGuator v2.7.3 (Altschul et al., 1997; Galardini et al., 2011). The filtered and trimmed

Böhm et al. 2014 reads of all three sequenced strains were mapped against a reference genome with bowtie2 v2.1.0 (Langmead & Salzberg, 2012). The resulting SAM files were processed with SAM tools v0.1.19 (File S1) (Li et al., 2009).

SNP discovery and sequence comparisons

SNPs were extracted from high-throughput DNA-sequencing data with mpileup, available in the SAM tools package (Li et al., 2009). For this purpose, the processed reads were mapped to a parental reference genomic sequence; the parameters for mpileup and further information are given in File S1. To characterize AS25, SNP discovery was performed with the de novo assembled contigs of Pc3 as reference. For isolate AS25-3, the P2niaD18 genome sequence was used as reference (Specht et al., 2014). In addition, the processed reads of AS25 were used for SNP-calling in the P2niaD18 genome.

The resulting SNPs were used to identify the origin of genomic regions in the progeny strains. For this purpose, consensus sequences of Pc3, AS25-3, and AS25 were assembled with the mpileup consensus function, and a custom-made Perl script was used to compare SNPs between parental sequences and a descendant consensus sequence (Fig. S10). All SNPs with a minimum quality score of 50 and an allele frequency of 1.0 were considered high quality SNPs and they were divided into three categories. The first two categories represented SNPs that could be assigned to one of the two parental strains; the third category represented SNPs that could not be assigned to either of the parents, or were ambiguous, due to low coverage. To guarantee reliable results, we further considered SNPs certain when they were located in the consensus sequence, but as unclear in regions filtered out by varFilter due to insufficient read depth. To identify differently inherited regions in the progeny genome, we performed a comparison between the progeny consensus sequence and each parental SNP. Furthermore, we implemented a sliding window analysis with a custom-made Perl script. To estimate background noise and to clearly identify differentially inherited genomic regions, we integrated all uniquely allocated parental SNPs and the vague or inconsistent results into our analysis. For this purpose, we computed a quality score for each sliding window, based on the number of total SNPs and the number of SNPs that could be allocated to one of the parental strains. All SNPs assigned to a parental strain were assigned the value of -1 or 1, and for each window separately, the sum of these values was divided by the total number of analyzed SNPs. The resulting score for each window was taken as an indication of the genomic origin.

Böhm et al. 2014

SNP validation

To validate the accuracy of SNP predictions, PCR analyses were performed, and the products were sequenced with an ABI 3130xl (Department of Chemistry and Biochemistry, Ruhr- University, Bochum, Germany). In addition, we designed primers (Table S2) to verify meiotic crossing-over events. In total, fifty-two SNPs were randomly selected, and five putative recombined loci were sequenced, with DNA from parental and progeny strains as templates. To evaluate the resulting sequences, alignments for multiple sequences were performed with Clustal-Omega (Sievers et al., 2011) and analyzed manually.

Phylogenetic analysis

The Pc3 genomic sequence was used to perform a phylogenetic analysis of diverse isolates from P. chrysogenum, as previously described (Houbraken et al., 2011). The coding sequences of rpb1, rpb2, and cmd were amplified by PCR with appropriate primers (Table S2) for DNA sequence analysis.

Acknowledgments

We acknowledge the excellent technical support by Katerina Koutsantas. We are thankful for Dr. M. Nowrousian for helpful comment on the manuscript, Rebecca Brekau for her help with some of the experiments, and Drs. H. Kürnsteiner, T. Specht and I. Zadra for their continuous interest. J.B. and T.A.D. are members of the RUB Research School. This work was supported by the Christian Doppler-Society (Vienna, Austria) and Sandoz Ltd. (Kundl, Austria).

Böhm et al. 2014

References

Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller & D. J. Lipman, (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389-3402. Anderson, J. B., (2005) Evolution of antifungal-drug resistance: mechanisms and pathogen fitness. Nat Rev Microbiol 3: 547-556. Bardwell, L., (2005) A walk-through of the yeast mating pheromone response pathway. Peptides 26: 339-350. Beever, R. E. & G. P. Dempsey, (1978) Function of rodlets on the surface of fungal spores. Nature 272: 608-610. Bodor, Á., E. Nagygyörgy & L. Hornok, (2012) Inactivation of the mat1-2-1 mating type gene results in reduced asexual sporulation and con10 expression in Fusarium verticillioides. Acta Phytopathologica et Entomologica Hungarica 47: 7-15. Böhm, J., B. Hoff, C. M. O'Gorman, S. Wolfers, V. Klix, D. Binger, I. Zadra, H. Kürnsteiner, S. Pöggeler, P. S. Dyer & U. Kück, (2013) Sexual reproduction and mating-type- mediated strain development in the penicillin-producing fungus Penicillium chrysogenum. Proc Natl Acad Sci U S A 110: 1476-1481. Booth, L. N., B. B. Tuch & A. D. Johnson, (2010) Intercalation of a new tier of transcription regulation into an ancient circuit. Nature 468: 959-963. Bullock, W. O., J. M. Fernandez & J. M. Short, (1987) XL1-Blue: A high-efficiency plasmid transforming recA Escherichia coli strain with ß-galactosidase selection., p. 376-379. BioTechniques. Butler, G., C. Kenny, A. Fagan, C. Kurischko, C. Gaillardin & K. H. Wolfe, (2004) Evolution of the MAT locus and its Ho endonuclease in yeast species. Proc Natl Acad Sci U S A 101: 1632-1637. Clement, J. A., R. Porter, T. M. Butt & A. Beckett, (1994) The role of hydrophobicity in attachment of urediniospores and sporelings of Uromyces viciae-fabae. Mycol Res 98: 1217-1228. Debuchy, R., V. Berteaux-Lecellier & P. Silar, (2010) Mating systems and sexual morphogenesis in ascomycetes. In: Cellular and molecular biology of filamentous fungi. K. A. Borkovich & D. J. Ebbole (eds). Washington, D.C.: ASM Press, pp. 501– 535. Debuchy, R. & B. Turgeon, (2006) Mating-type structure, evolution, and function in Euascomycetes. In: Growth, Differentiation and Sexuality. Springer, pp. 293-323. Desjardins, A. E., D. W. Brown, S. H. Yun, R. H. Proctor, T. Lee, R. D. Plattner, S. W. Lu & B. G. Turgeon, (2004) Deletion and complementation of the mating type (MAT) locus of the wheat head blight pathogen Gibberella zeae. Appl Environ Microbiol 70: 2437- 2444. Dyer, P. S., (2007) Sexual reproduction and significance of MAT in the Aspergilli. In: Sex in fungi: molecular determination and evolutionary implications. J. Heitman, J. W.

Böhm et al. 2014

Kronstad, J. W. Taylor & L. A. Casselton (eds). Washington, D.C: ASM Press, pp. 123-142. Dynesen, J. & J. Nielsen, (2003) Surface hydrophobicity of Aspergillus nidulans conidiospores and its role in pellet formation. Biotechnol Prog 19: 1049-1052. Elander, R., (1983) Strain improvement and preservation of β-lactam-producing microorganisms. In: Antibiotics. Springer, pp. 97-146. Ferreira, A. V., Z. An, R. L. Metzenberg & N. L. Glass, (1998) Characterization of mat A-2, mat A-3 and deltamatA mating-type mutants of Neurospora crassa. Genetics 148: 1069-1079. Fomina, M. & G. M. Gadd, (2002) Influence of clay minerals on the morphology of fungal pellets. Mycol Res 106: 107-117. Gailey, F. B., J. J. Stefaniak, B. H. Olson & M. J. Johnson, (1946) A comparison of penicillin- producing strains of Penicillium notatum-chrysogenum. J Bacteriol 52: 129-140. Galardini, M., E. G. Biondi, M. Bazzicalupo & A. Mengoni, (2011) CONTIGuator: a bacterial genomes finishing tool for structural insights on draft genomes. Source Code Biol Med 6: 11. Galgoczy, D. J., A. Cassidy-Stone, M. Llinas, S. M. O'Rourke, I. Herskowitz, J. L. DeRisi & A. D. Johnson, (2004) Genomic dissection of the cell-type-specification circuit in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 101: 18069-18074. Girardin, H., S. Paris, J. Rault, M. N. Bellon-Fontaine & J. P. Latge, (1999) The role of the rodlet structure on the physicochemical properties of Aspergillus conidia. Lett Appl Microbiol 29: 364-369. Glass, N. L., J. Grotelueschen & R. L. Metzenberg, (1990) Neurospora crassa A mating-type region. Proc Natl Acad Sci U S A 87: 4912-4916. Haber, J. E., (2012) Mating-type genes and MAT switching in Saccharomyces cerevisiae. Genetics 191: 33-64. Herskowitz, I., (1989) A regulatory hierarchy for cell specialization in yeast. Nature 342: 749- 757. Hicks, J., J. N. Strathern & A. J. Klar, (1979) Transposable mating type genes in Saccharomyces cerevisiae. Nature 282: 478-473. Hoff, B., J. Kamerewerd, C. Sigl, R. Mitterbauer, I. Zadra, H. Kürnsteiner & U. Kück, (2010a) Two components of a velvet-like complex control hyphal morphogenesis, conidiophore development, and penicillin biosynthesis in Penicillium chrysogenum. Eukaryot Cell 9: 1236-1250. Hoff, B., J. Kamerewerd, C. Sigl, I. Zadra & U. Kück, (2010b) Homologous recombination in the antibiotic producer Penicillium chrysogenum: strain DPcku70 shows up-regulation of genes from the HOG pathway. Appl Microbiol Biotechnol 85: 1081-1094. Hoff, B., S. Pöggeler & U. Kück, (2008) Eighty years after its discovery, Fleming's Penicillium strain discloses the secret of its sex. Eukaryot Cell 7: 465-470. Houbraken, J., J. C. Frisvad & R. A. Samson, (2011) Fleming's penicillin producing strain is not Penicillium chrysogenum but P. rubens. IMA Fungus 2: 87-95.

Böhm et al. 2014

Jones, E., (1994) Fungal adhesion. Mycol Res 98: 961-981. Kämper, J., M. Reichmann, T. Romeis, M. Bölker & R. Kahmann, (1995) Multiallelic recognition: nonself-dependent dimerization of the bE and bW homeodomain proteins in Ustilago maydis. Cell 81: 73-83. Kasimiotis, H., M. A. Myers, A. Argentaro, S. Mertin, S. Fida, T. Ferraro, J. Olsson, M. J. Rowley & V. R. Harley, (2000) Sex-determining region Y-related protein SOX13 is a diabetes autoantigen expressed in pancreatic islets. Diabetes 49: 555-561. Keller, N. P., G. Turner & J. W. Bennett, (2005) Fungal secondary metabolism - from biochemistry to genomics. Nat Rev Microbiol 3: 937-947. Kistler, H. C. & V. P. Miao, (1992) New modes of genetic change in filamentous fungi. Annu Rev Phytopathol 30: 131-153. Kostriken, R., J. N. Strathern, A. J. Klar, J. B. Hicks & F. Heffron, (1983) A site-specific endonuclease essential for mating-type switching in Saccharomyces cerevisiae. Cell 35: 167-174. Kronstad, J. W. & C. Staben, (1997) Mating type in filamentous fungi. Annu Rev Genet 31: 245-276. Kück, U. & J. Böhm, (2013) Mating type genes and cryptic sexuality as tools for genetically manipulating industrial molds. Appl Microbiol Biotechnol 97: 9609-9620. Langmead, B. & S. L. Salzberg, (2012) Fast gapped-read alignment with Bowtie 2. Nat Methods 9: 357-359. Laudet, V., D. Stehelin & H. Clevers, (1993) Ancestry and diversity of the HMG box superfamily. Nucleic Acids Res 21: 2493-2501. Lein, J., (1986) The Panlabs penicillin strain improvement program. In: Overproduction of microbial metabolites; strain improvement and process control strategies. Z. Vanek & Z. Hostalek (eds). Boston: Butterworth Publishers, pp. 105–139. Li, H., B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, G. Abecasis & R. Durbin, (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics 25: 2078-2079. Lohse, M., A. M. Bolger, A. Nagel, A. R. Fernie, J. E. Lunn, M. Stitt & B. Usadel, (2012) RobiNA: a user-friendly, integrated software solution for RNA-Seq-based transcriptomics. Nucleic Acids Res 40: W622-W627. Minuth, W., P. Tudzynski & K. Esser, (1982) Extrachromosomal genetics of Cephalosporium acremonium. Curr Genet 25: 34-40. Nelson, M. A., (1996) Mating systems in ascomycetes: a romp in the sac. Trends Genet 12: 69-74. Ni, M., M. Feretzaki, S. Sun, X. Wang & J. Heitman, (2011) Sex in fungi. Annu Rev Genet 45: 405-430. Nielsen, J., (1997) Physiological engineering aspects of Penicillium chrysogenum. World Scientific Publishing, Singapore.

Böhm et al. 2014

Nielsen, R., J. S. Paul, A. Albrechtsen & Y. S. Song, (2011) Genotype and SNP calling from next-generation sequencing data. Nat Rev Genet 12: 443-451. O'Gorman, C. M., H. T. Fuller & P. S. Dyer, (2009) Discovery of a sexual cycle in the opportunistic fungal pathogen Aspergillus fumigatus. Nature 457: 471-474. Olarte, R. A., B. W. Horn, J. W. Dorner, J. T. Monacell, R. Singh, E. A. Stone & I. Carbone, (2012) Effect of sexual recombination on population diversity in aflatoxin production by Aspergillus flavus and evidence for cryptic heterokaryosis. Mol Ecol 21: 1453- 1476. Paoletti, M., F. A. Seymour, M. J. Alcocer, N. Kaur, A. M. Calvo, D. B. Archer & P. S. Dyer, (2007) Mating type and the genetic basis of self-fertility in the model fungus Aspergillus nidulans. Curr Biol 17: 1384-1389. Pitt, J. I. & A. D. Hocking, (2009) Fungi and food spoilage. Springer, Dordrecht, Heidelberg, London, New York Pöggeler, S., (2001) Mating-type genes for classical strain improvements of ascomycetes. Appl Microbiol Biotechnol 56: 589-601. Pöggeler, S., (2007) MAT and its role in the homothallic ascomycete Sordaria macrospora. In: Sex in fungi : molecular determination and evolutionary implications. J. Heitman, Kronstad J. W., Taylor J. W. , and Casselton L. A. (ed). Washington, D.C: ASM Press, pp. 171-188. Pöggeler, S., S. Masloff, S. Jacobsen & U. Kück, (2000) Karyotype polymorphism correlates with intraspecific infertility in the homothallic ascomycete Sordaria macrospora. J Evol Biol 13: 281-289. Pöggeler, S., M. Nowrousian, C. Ringelberg, J. J. Loros, J. C. Dunlap & U. Kück, (2006) Microarray and real-time PCR analyses reveal mating type-dependent gene expression in a homothallic fungus. Mol Genet Genomics 275: 492-503. Pöggeler, S., C. M. O'Gorman, B. Hoff & U. Kück, (2011) Molecular organization of the mating-type loci in the homothallic Ascomycete Eupenicillium crustaceum. Fungal Biol 115: 615-624. Pomraning, K. R., K. M. Smith & M. Freitag, (2011) Bulk segregant analysis followed by high-throughput sequencing reveals the Neurospora cell cycle gene, ndc-1, to be allelic with the gene for ornithine decarboxylase, spe-1. Eukaryot Cell 10: 724-733. Prosser, J., (1995) Kinetics of filamentous growth and branching. In: The growing fungus. Springer, pp. 301-318. Sambrook, J. & D. W. Russell, (2001) Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Sarikaya Bayram, Ö., Ö. Bayram, O. Valerius, H. S. Park, S. Irniger, J. Gerke, M. Ni, K. H. Han, J. H. Yu & G. H. Braus, (2010) LaeA control of velvet family regulatory proteins for light-dependent development and fungal cell-type specificity. PLoS Genet 6: e1001226. Sievers, F., A. Wilm, D. Dineen, T. J. Gibson, K. Karplus, W. Li, R. Lopez, H. McWilliam, M. Remmert, J. Soding, J. D. Thompson & D. G. Higgins, (2011) Fast, scalable

Böhm et al. 2014

generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7: 539. Specht, T., T. A. Dahlmann, I. Zadra, H. Kürnsteiner & U. Kück, (2014) Complete genome sequence of the penicillin producer Penicillium chrysogenum (Wisconsin 54-1255) and its derived industrial strain P2niaD18. unpublished. Staben, C. & C. Yanofsky, (1990) Neurospora crassa a mating-type region. Proc Natl Acad Sci U S A 87: 4917-4921. Strathern, J. N., A. J. Klar, J. B. Hicks, J. A. Abraham, J. M. Ivy, K. A. Nasmyth & C. McGill, (1982) Homothallic switching of yeast mating type cassettes is initiated by a double- stranded cut in the MAT locus. Cell 31: 183-192. Stringer, M. A., R. A. Dean, T. C. Sewall & W. E. Timberlake, (1991) Rodletless, a new Aspergillus developmental mutant induced by directed gene inactivation. Genes Dev 5: 1161-1171. Stringer, M. A. & W. E. Timberlake, (1995) dewA encodes a fungal hydrophobin component of the Aspergillus spore wall. Mol Microbiol 16: 33-44. Swinnen, S., K. Schaerlaekens, T. Pais, J. Claesen, G. Hubmann, Y. Yang, M. Demeke, M. R. Foulquie-Moreno, A. Goovaerts, K. Souvereyns, L. Clement, F. Dumortier & J. M. Thevelein, (2012) Identification of novel causative genes determining the complex trait of high ethanol tolerance in yeast using pooled-segregant whole-genome sequence analysis. Genome Res 22: 975-984. Szewczyk, E. & S. Krappmann, (2010) Conserved regulators of mating are essential for Aspergillus fumigatus cleistothecium formation. Eukaryot Cell 9: 774-783. Tatchell, K., K. A. Nasmyth, B. D. Hall, C. Astell & M. Smith, (1981) In vitro mutation analysis of the mating-type locus in yeast. Cell 27: 25-35. van den Berg, M. A., (2010) Functional characterisation of penicillin production strains. Fungal Biology Reviews 24: 73-78. van den Berg, M. A., R. Albang, K. Albermann, J. H. Badger, J. M. Daran, A. J. Driessen, C. Garcia-Estrada, N. D. Fedorova, D. M. Harris, W. H. Heijne, V. Joardar, J. A. Kiel, A. Kovalchuk, J. F. Martin, W. C. Nierman, J. G. Nijland, J. T. Pronk, J. A. Roubos, I. J. van der Klei, N. N. van Peij, M. Veenhuis, H. von Dohren, C. Wagner, J. Wortman & R. A. Bovenberg, (2008) Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat Biotechnol 26: 1161-1168. Van Heeckeren, W. J., D. R. Dorris & K. Struhl, (1998) The mating-type proteins of fission yeast induce meiosis by directly activating mei3 transcription. Mol Cell Biol 18: 7317- 7326. Zerbino, D. R. & E. Birney, (2008) Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Res 18: 821-829.

Böhm et al. 2014

Tables

Table 1. Main features of the P. chrysogenum Pc3 genome assembly

Size of final assembly 32.04 Mb

Number of scaffolds 1,118

Nmax in bases 625,682

N50 in bases 165,535

Number of gaps 1,284

Total gap length percentage 0.1

GC percentage 49.0

Böhm et al. 2014

Table 2. Comparative analyses of parental and progeny strains of P. chrysogenum

Compared strains Resulting Analysis performed Total High quality reads of mapped to coverage SNPs SNPs*

Pc3 P2niaD18 31.4 SNP calling & 33,956 27,271 construction of Pc3 consensus sequence

AS25 P2niaD18 22.2 SNP calling to predict 31,166 21,133 parental SNPs of AS25-3

AS25 Pc3 consensus 22.8 SNP calling 4,448 397

AS25-3 P2niaD18 27.8 SNP calling 32,426 22,430

AS25-3 AS25 consensus 28.0 SNP file & construction 17,694 11,816 of AS25-3 consensus sequence

* SNPs with a quality score greater than fifty and an allele frequency of 1.0

Böhm et al. 2014

Figure Legends

Fig. 1. Quantification of light-dependent conidiospore formation. All strains were grown under constant light or in darkness for 168 h. Error bars represent mean ± SD (n = 3) from three independent experiments.

Fig. 2. Quantification of germinating conidia and germ tubes. Recombinant MAT1-2 and reference strains were grown for 9 h (wild-type) or 12 h (P2niaD18 derivatives) on solid media as indicated. In all cases, 400 conidia from each strain were investigated. A. Pc3, and in the Pc3 background, three independent MAT1-2-1 deletions, complementation strains, and MAT1-2-1 overexpression strains B. P2niaD18 and corresponding MAT1-2-1 overexpression strains

Fig. 3. Micrographs of germinating conidia and formation of spore clusters in the indicated strains. Scale bars: 50 µm (left column) and 100 µm (right).

Fig. 4. Pellet formation in liquid shaking cultures formed by reference and recombinant MAT1-2 strains. Error bars represent mean ± SD of 240 random pellets from three independent strains. A. Quantification of pellet diameter in MAT1-2-1 overexpression strains grown in liquid CCM culture. Measurements were taken at four different time points as indicated. B. Quantification of pellet diameter in MAT1-2-1 overexpression strains in the P2niaD18 background.

Fig. 5. Genealogy of penicillin-production strains of P. chrysogenum. Dashed lines indicate conventional mutagenesis during strain improvement programs. Matings (×) of low-penicillin producer Q176 with wild type Pc3 were performed and ascospore isolate AS25 was obtained (Böhm et al., 2013). AS25 was further crossed with the industrial high-penicillin production strain P2niaD18. The MAT locus of each strain is indicated by blue for MAT1-1 or red for MAT1-2.

Böhm et al. 2014

Fig. 6. Genome-wide distribution of recombination determined by whole genome sequencing. High quality SNPs of the parental strains, P2niaD18 and AS25, were compared to the consensus sequence of the progeny, AS25-3, in a sliding window analysis. All high quality SNPs were assigned to one of the parental strains or marked inconsistent (?). For each 10 kb window, the origin was determined and indicated with different colors. Regions clearly assigned to P2niaD18 are blue, regions inherited from AS25 are red, and inconsistent regions are grey. Locations of genes of particular interest are highlighted.

Fig. 7. Validation of a single meiotic recombination site on chromosome I of AS25-3. On top, the origin of each SNP is shown. Below, a 500-bp sliding-window analysis is shown for the region corresponding to nucleotides 2,400,500 to 2,404,500. SNPs assigned to a parental strain are shown in color: blue for P2niaD18, and red for AS25. A 300 bp region containing SNPs from both parental strains was amplified from AS25-3 and from both parental strains; resequencing confirmed data from next generation sequencing. Abbreviations: NGS, next generation sequencing; PCR, sequences from amplicons.

Böhm et al. 2014

Figures

Fig. 1.

Böhm et al. 2014

Fig. 2.

Böhm et al. 2014

Fig. 3.

Böhm et al. 2014

Fig. 4.

Böhm et al. 2014

Fig. 5.

Böhm et al. 2014

Fig. 6.

Böhm et al. 2014

Fig. 7.

Böhm et al. 2014

Supporting information

Supplementary methods

File S1

I. Calculation of SNPs and construction of consensus sequence a) Quality control and trimming of Illumina raw data Correction and trimming of the raw Illumina HiSeq reads with a size of 100 nt obtained from the ~300 bp PE library sequencing of Pc3 were performed with Trimmomatic v0.30 (Lohse et al. 2012 Nucleic Acids Res. 40:W622-7) using the following parameters. java –jar trimmomatic-0.30.jar PE -phred33 NG-6796_Pc3_lib26819_1663_8_1.fastq NG-6796_Pc3_lib26819_1663_8_2.fastq NG-6796_Pc3_lib26819_1663_8_1_trimmed_paired.fastq NG-6796_Pc3_lib26819_1663_8_1_trimmed_unpaired.fastq NG-6796_Pc3_lib26819_1663_8_2_trimmed_paired.fastq NG-6796_Pc3_lib26819_1663_8_2_trimmed_unpaired.fastq ILLUMINACLIP:Illumina-TruSeq-PE-gDNA.fa:2:30:10 LEADING:10 TRAILING:10 SLIDINGWINDOW:4:18 MINLEN:35

The file Illumina-TruSeq-PE_gDNA.fa contains all used Illumina adapters and primers (PCR- and seq-Primer). The quality of the processed reads was checked with FastQC.

./fastqc ./input/NG-6796_Pc3_lib26819_1663_8_1.fastq

For the correction and trimming of the raw Illumina HiSeq reads with a size of 50 nt obtained from single-end library sequencing of ascospore isolates AS25 and AS25-3 the parameters were adapted to library type and read length. An example is given for the reads obtained from AS25-3. java -jar trimmomatic-0.30.jar SE -phred33 ./input/NG- 6879_P2_x_25_AS_3_lib28637_1722_7_1.fastq NG-6879_P2_x_25_AS_3_trimmed.fastq ILLUMINACLIP:TruSeq-DNA-SE.fa:2:30:10 LEADING:10 TRAILING:10 SLIDINGWINDOW:4:18 MINLEN:20 b) Mapping of reads on a reference genome sequence The processed reads obtained from the next-generation sequencing of Pc3, AS25, and AS25-3 were mapped to the P2niaD18 genome sequence (Specht et al., 2014). Furthermore, processed reads of ascospore isolate AS25 were mapped on the de novo assembled contigs of Pc3 (see section II for assembly details) and reads obtained from ascospore isolate AS25-3 were mapped to an afore predicted consensus sequence of AS25. Mapping of the 100 nt long reads obtained from Pc3 genome sequencing was performed with bowtie2 v2.1.0 (Langmead & Salzberg 2012 Nat Methods 9: 357-9) with the following parameters. Sorted bam files and index files were created with samtools (Li et al. 2009 Bioinformatics 25: 2078-9). The sorted bam file was used for SNP calling (see section I d)).

Böhm et al. 2014

bowtie2-build ./input/P2_niaD18.fa P2_niaD18.build bowtie2 -q -p 4 --phred33 -I 50 -X 1000 --fr P2_niaD18.build -1 ./input/NG- 6796_Pc3_lib26819_1663_8_1_trimmed_paired.fastq -2 ./input/NG- 6796_Pc3_lib26819_1663_8_2_trimmed_paired.fastq -S Pc3_500PE_vs_P2_niaD18.sam samtools view -bS Pc3_500PE_vs_P2_niaD18.sam > Pc3_500PE_vs_P2_niaD18.bam samtools sort Pc3_500PE_vs_P2_niaD18.bam Pc3_500PE_vs_P2_niaD18_sorted samtools index Pc3_500PE_vs_P2_niaD18_sorted.bam

For the mapping of the 50 nt long reads obtained from the single-end libraries of AS25 and AS25-3 were mapped with parameters adapted on single-end libraries. An example is given below. The sam file was sorted and indexed with samtools like mentioned before. bowtie-build2 ./input/P2_niaD18.fa P2_niaD18.build bowtie2 -q -p 4 --phred33 P2_niaD18.build ./input/ NG-6879_P2_x_25_AS_3_trimmed.fastq -S AS3_vs_ P2_niaD18.sam d) SNP-calling SNP calling was performed with mpileup, which is a part of samtools, for all combinations listed in Table 1. The resulting vcf files were used as input for custom-made perl scripts. The varFilter option was used to filter ambiguous loci and low coverage regions. The value for varFilter was set twice as high as the average coverage, calculated from the mapping. On overview of the settings of varFilter used for the different analyses is given in the table below. samtools mpileup -uD -f P2_niaD18.fa Pc3_500PE_vs_P2_niaD18_sorted.bam | bcftools view -bvgc - > Pc3_500PE_vs_P2_niaD18_samtools.raw.bcf bcftools view Pc3_500PE_vs_P2_niaD18_samtools.raw.bcf | vcfutils.pl varFilter -D70 > Pc3_500PE_vs_P2_niaD18_samtools.vcf

reads of mapped on coverage varFilter total SNPs Pc3 P2niaD18 31.4 -D70 33,956 AS25 P2niaD18 22.2 -D50 31,166 AS25 Pc3_assembly 22.8 -D50 4,448 AS25-3 P2niaD18 27.8 -D60 32,426 AS25-3 AS25_consensus 28.0 -D60 17,694

e) Construction of consensus sequences The consensus sequences were constructed with mpileup and bcftools, both parts of samtools, on the basis of afore produced bam files. An example is given below, including the used settings for mpileup and bcftools. The consensus sequences of Pc3, AS25, and AS25-3 were calculated based on the P2niaD18 reference sequences. The consensus sequences were used for comparative SNP analyses as described in section II.

Böhm et al. 2014 samtools mpileup -uf P2_niaD18.fa Pc3_500PE_vs_P2_niaD18_sorted.bam | bcftools view -cg - | vcfutils.pl vcf2fq > Pc3_500PE_vs_P2_niaD18_consensus.fq

II. De novo assembly of the Pc3 genome sequence The corrected reads of Pc3 (see section I) were used for an assembly with Velvet 1.2.10 (Zerbino & Birney 2008 Genome Res 18: 821-9). The files containing the paired ends were shuffled and printed into a single file. shuffleSequences_fastq.pl NG-6796_Pc3_lib26819_1663_8_1_trimmed_paired.fastq NG-6796_Pc3_lib26819_1663_8_2_trimmed_paired.fastq NG-6796_Pc3_lib26819_1663_8_shuffled_trimmed_paired.fastq

Unpaired reads were combined to a single file using the cat command inside the Unix prompt. cat NG-6796_Pc3_lib26819_1663_8_1_trimmed_unpaired.fastq NG-6796_Pc3_lib26819_1663_8_2_trimmed_unpaired.fastq > Pc3_500PE_trimmed_unpaired.fastq

To define the best kmer size for Velvet, we tested values between 31 and 75.

./velveth output 31,75,2 -short -fastq ./input/Pc3_500PE_trimmed_unpaired.fastq -shortPaired -fastq ./input/NG-6796_Pc3_lib26819_1663_8_shuffled_trimmed_paired.fastq

./velvetg output_39 -exp_cov auto -cov_cutoff auto -min_contig_lgth 1000 -ins_length 300

Afterwards, we used the longest de novo assembled contig for mapping of the PC3 reads, in order to predict the average insert length of the library. The insert length was calculated by analyzing the bam- file with FastQC v.0.10.1 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc). Median insert length was calculated with 194 bp and mean insert with 182 bp. The median insert length was used to optimize parameters for Velvet.

./velvetg output_37 -exp_cov auto -cov_cutoff 3 -min_contig_lgth 1000 -ins_length 194

Usage of k-mer sizes greater than 43 shows a decreased value for Nmax and N50. A k-mer size of 37 works best for the 100 nt paired end reads obtained from Pc3.

k-mer N50 in Nmax in # of contigs total number length of GC- size bp bp length in of gaps all gaps in content bp bp 35 154,199 625,570 1,131 31,940,445 1,286 34,988 49.0% 37 165,535 625,646 1,118 32,038,477 1,284 37,463 49.0% 39 161,156 625,578 1,122 32,170,232 1,271 38,751 49.0% 41 154,185 663,586 1,138 32,245,499 1,238 39,619 49.0% 43 145,237 634,272 1,154 33,647,548 1,191 40,215 49.0%

III. Comparison of SNPs using custom-made Perl scripts In order to identify differently inherited genomic regions inside the genome of ascospore isolate AS25-3 we first calculated the SNPs of the parental strains by mapping AS25 on P2niaD18. After this step, we predicted an AS25-3 consensus sequence based on P2niaD18 and compared the SNPs in the

Böhm et al. 2014 parental strains with the consensus sequence of the progeny by two custom-made Perl scripts, both are available upon request.

The first Perl script (SNP_comparison_vcf2vcfo.pl) reads in the vcf output file form mpileup, containing all SNPs in the parental strains AS25 and P2niaD18, and the sequence file containing the consensus sequence of the progeny AS25-3, which was constructed on the genome sequence of P2iaD18. In order to analyze the four consensus chromosomes of AS25-3 separately, we wrote each of the four consensus sequences into four online formatted fasta files. The perl script compares each SNP of the parental strains with the equivalent position of the consensus sequence of the progeny. Regions inside the consensus sequence that show a low coverage (<5×) or an unclear base calling due to an inconsistent mapping were marked by mpileup with small letters or “n”, instead of capitalized letters. To avoid a comparison with those regions, the text-based comparison differentiated between capitalize and non-capitalized letters. In addition, only parental SNPs with a quality score greater than 50 and an allele frequency of 1.0, hereafter referred to as high quality SNPs, were used for further analysis. The perl script compared all parental SNPs to their corresponding position inside the AS25-3 consensus sequence, using the reference and alternative nucleotide in column four and five of the vcf file. After comparison, the script adds two columns at the end of the vcf file, containing the name (P2niaD18 or AS25) of the parental strain that matched to the nucleotide of the consensus sequence and the compared nucleotide that was extracted from the AS25-3 consensus sequence. SNPs that did not match to one or the other parental strain were marked with a question mark “?”, representing an unclear or inconsistent result, just like SNPs that were located into regions with a low sequencing coverage of AS25-3. The extended vcf file, containing the two additional columns with the information of the origin of the SNPs inside the parental strains and the nucleotide determined from the consensus sequence of the progeny was renamed into vcfo. An example of the vcfo file format is listed below.

#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT Pc3_500PE_vs_P2_niaD18_sorted.bamORIGIN PROGENY P2_niaD18_chr1 30327 . G A 222 . DP=27;VDB=2.353843e-01;AF1=1;AC1=2;DP4=0,0,13,13;MQ=42;FQ=-105GT:PL:DP:GQ 1/1:255,78,0:26:99 Pc3 A P2_niaD18_chr1 33444 . G A 222 . DP=32;VDB=1.282691e-01;AF1=1;AC1=2;DP4=0,0,22,9;MQ=42;FQ=-120GT:PL:DP:GQ 1/1:255,93,0:31:99 P2niaD18 G P2_niaD18_chr1 424910 . T C 118 . DP=23;VDB=1.758079e-01;AF1=1;AC1=2;DP4=0,0,11,12;MQ=16;FQ=-96GT:PL:DP:GQ 1/1:151,69,0:23:99 ? t

The second Perl script (sliding-window-vcfo_stats_origin.pl) uses the vcfo file as input in order to perform a sliding window analysis by counting all assigned SNPs. The script prints out the number of SNPs assigned to each parental strain and all inconsistent results inside each window and performs a statistical survey. In order to determine the best sliding window sizes for our analyses, we performed analyses with 500 bp, 1 kb, 5 kb, 10 kb, and 20 kb windows. The best resolution was obtained for 10 kb large window sizes. 500 bp windows were used to analyze putative recombination sites in detail. Based on the results of the 10 kb sliding window analysis, all SNPs assigned to one or the other parental strain were calculated with the value of -1 or 1, respectively. For each window, the sum of these values was divided by the total number of analyzed high quality SNPs, including all inconsistent results. The resulting score for each window, which size ranges between -1.0 and 1.0, was used as an indication of the origin of the genomic region as seen in Fig. 5 and Fig. 6. All sliding windows that show a score of -1.0 or 1.0 can be clearly assigned to one or the other parental strain. Sliding windows with scores between -0.5 and 0.5 were considered as not reliable to predict the origin of the sequence. To demonstrate the influence of inconsistent or conflictive SNP assignments inside a single sliding window, some examples for the calculation are listed below.

Böhm et al. 2014

SNPs unique SNPs unique number of score assigned to P2niaD18 to AS25 total SNPs origin* 3 0 3 -1.0 P2niaD18 3 0 4 -0.75 P2niaD18 6 2 8 -0.5 P2niaD18 0 7 8 0.88 AS25 4 0 6 0.67 AS25 5 14 20 0.45 ? 2 0 6 0.33 ? 5 3 8 0.25 ? * ? = unclear or inconsistent result

Böhm et al. 2014

Supplementary Tables

Table S1. List of bacterial and fungal strains used in this study Strain Characteristics and genotype Mating type Reference or source Pc3 Wild type MAT1-2-1 Böhm et al., (2013) (syn. IB 08/921) NRRL 1951 Wild type MAT1-1-1 Gailey et al., (1946) Q176 Derivative of NRRL 1951 MAT1-1-1 Gailey et al., (1946) Wisconsin 54-1255 Derivative of Q176 MAT1-1-1 Gailey et al., (1946) P2niaD18 niaD- MAT1-1-1 Hoff et al., (2008) AS 25 progeny from Q176 x Pc3 MAT1-2-1 Böhm et al., (2013) AS25-3 progeny from AS25 x P2niaD18 MAT1-1-1 This study MAT1-2-1 T10 MAT1-2-1::ble This study MAT1-2-1 T1 MAT1-2-1::ble; Pcku70::nat1 This study MAT1-2-1 T4 MAT1-2-1::ble; Pcku70::nat1 This study MAT1-2-1::MAT1- MAT1-2-1::ble; Pgpd::MAT1-2- MAT1-2-1 This study 2-1 T5 1; ptrA MAT1-2-1::MAT1- MAT1-2-1::ble; Pgpd::MAT1-2- MAT1-2-1 This study 2-1 T8 1; ptrA MAT1-2-1::MAT1- MAT1-2-1::ble; Pgpd::MAT1-2- MAT1-2-1 This study 2-1 T24 1; ptrA Pc3::MAT1-2-1 T20 Pgpd::MAT1-2-1; ptrA MAT1-2-1 This study Pc3::MAT1-2-1 T23 Pgpd::MAT1-2-1; ptrA MAT1-2-1 This study Pc3::MAT1-2-1 T26 Pgpd::MAT1-2-1; ptrA MAT1-2-1 This study P2::MAT1-2-1 T1 Pgpd::MAT1-2-1; ptrA; niaD- MAT1-1-1 This study MAT1-2-1 P2::MAT1-2-1 T2 Pgpd::MAT1-2-1; ptrA; niaD- MAT1-1-1 This study MAT1-2-1 P2::MAT1-2-1 T5 Pgpd::MAT1-2-1; ptrA; niaD- MAT1-1-1 This study MAT1-2-1 XL1-Blue K12 recA1, endA1, gyrA96, thi1, Bullock et al., (1987) hsdR17, supE44, relA1, lac-, [F’ proAB, laclqZΔM15, Tn10(tetr)]

Böhm et al. 2014

Table S2. List of oligonucleotides used in this study # Oligonucleotide Sequence (5’-3’) Specificity 1 PtrpC_anti1 GGCATTCATTGTTGACCTCCACTAG trpC promoter 2 Tn5-phleo GCGCCTGATACAGAACGAATTGC Ble resistance gene 3 ApaI-MAT2 GGGCCCATGATGGCGAAAACCCTC MAT1-2-1 gene 4 MluI-MAT2 ACGCGTTTAGAACACGCTGTTCATAG MAT1-2-1 gene 5 APN1 ACTTTCATCTGGGCCAGCGAGTGG 5’ flank MAT1-2 locus 6 SLA2 GCCCGCCAGCGTCTGGGCGAAATG 3‘ flank MAT1-2 locus 7 MAT1-2- GCCTTGCCTCAATGGAGTTC MAT1-2-1 gene 1_forward 8 PcMAT2-s CCTTGGTGCACGCTGGAACAAT MAT1-2-1 gene 9 PcMAT2-a CCTGATCGTAGAGAATCATCCACTT MAT1-2-1 gene 10 Pc848_2170r CTTGAGTTCATCAGCCAGGTGGGTGA MAT1-2-1 gene ACTG 11 Pc_HMG_sense CGATGGCGTTCTTGACCTGG MAT1-2-1 gene 12 Pc_HMG_anti GCCTGAACAAAAGGCAGG MAT1-2-1 gene 13 calmodulin_for TTGTGAGTGACACCACACAC cmd gene 14 calmodulin_rev AGCTCGGCGGCGGAAATGAA cmd gene 15 rpb1_for CGGTTTCTGCCTTCTATCTT rpb1 gene 16 rpb1_rev CCCTCCTGCTCACAGCGTTG rpb1 gene 17 RPB2-7CR_PC CCCATGGCTTGTTTGCCCAT rpb2 gene 18 RPB2-5F_Pc GATGACCGTGACCACTTCGG rpb2 gene 19 PclA_sense TGTGGTATTACCGGGAAGTC pclA (Pc22g14900) gene 20 PclA_anti ACAATTCGTGCCTCGACTCC pclA (Pc22g14900) gene 21 Chry1 GAGTTTGACTCGGGTCTTCG Pc21g16000 gene 22 Chry4 AGCCAATTCCATCTGCTCTG Pc21g16000 gene 23 PcpenDE_s CTGCCACCAAAGAGATGATCC PcpenDE gene 24 PcpenDE_a CCTGGCGTTGAGCGCAGACCT PcpenDE gene 25 pcbC_s CACCCATGGCTTCCACCCCCAAGGCC PcpcbC gene AATG 26 pcbC_a GTGCCATGGCTGTCTGGCCGTTCTTG PcpcbC gene TTGATTAGAC 27 PcFluG-s CCACCATGCCCATAACCTATTGAA PcfluG gene 28 PcFluG-a GCAAATTTCCGATACAAAACCAAC PcfluG gene

Böhm et al. 2014

29 flbB_for GCCAATGGCATGGACCACTC PcflbB gene 30 flbB_rev TGACCAAGTGCTGTCAAGAG PcflbB gene 31 nsdD_for TAGCGTGGCTTCGCCTAATG PcnsdD gene 32 nsdD_rev TAGAGCACCGAGTAGGGAAG PcnsdD gene 33 Pc23g00420_for TAGAGACCACGGTGCCGAAC Pc2300420 gene 34 Pc23g00420_rev CATTCAAGCGTGCTAGATCC Pc2300420 gene 35 Pc24g01940_for GTCAGCACGCCTATAGACAC Pc24g01940 gene 36 Pc24g01940_rev CTCAGCAACCGGGATATTTC Pc24g01940 gene 37 Pc12g12190_for GCCTTCCAGCTATGCCTACG PcflbC gene 38 Pc12g12190_rev ACGCCCAGGTCTAGCGAAAG PcflbC gene 39 Pc13g04920_for TGAGCAACCAGCGCTCAATG PcstuA gene 40 Pc13g04920_for CTTGCGCCTAGTTCTCCTCC PcstuA gene 41 RT-MAT1-2- TGCCTTTTGTTCAGGCTGATT MAT1-2-1 gene 1_fw 42 RT-MAT1-2- AGTGAAAGGGGGAGAGAGTGG MAT1-2-1 gene 1_rev 43 NcSSU1 ATCCAAGGAAGGCAGCAGGC small subunit ribosomal RNA 44 NcSSU2 TGGAGCTGGAATTACCGCG small subunit ribosomal RNA 45 Pc3- ACTTGGTTGTGCCTGTGTTG Chromosomal contig29_for translocation 46 Pc3- GGCTGTGGCGTAACTGTATG Chromosomal contig29_rev translocation 47 Wis-contig_for AGTGGAAGTTCGGCCTGAAC Chromosomal translocation 48 Wis-contig_rev TCTACAGGACACGTGAGCAC Chromosomal translocation 49 AS25_chrI_1_fo TTCCTTGTCGGGCTTGTACC Verification of r recombination 50 AS25_chrI_1_re AGAGGATCGTGATGACCGAG Verification of v recombination 51 AS25_chrII_1_f CCTACCAACCTTGTTCAGAC Verification of or recombination

Böhm et al. 2014

52 AS25_chrII_1_r AGTTCTACTCCGTAGGGTGC Verification of ev recombination 53 AS25_chrII_2_f GAGGAAGGCATAGACCTTTC Verification of or recombination 54 AS25_chrII_2_r AGTTGTGAGTCATGCTCGTG Verification of ev recombination 55 AS25_chrIII_1_f TTGGCCAGGTTTATGGAGGC Verification of or recombination 56 AS25_chrIII_1_r TGGAGCGAACAGGCTACATG Verification of ev recombination 57 AS25_chrIV_1_f TGTTTCACCCGCCACTATAC Verification of or recombination 58 AS25_chrIV_1_r ACTCCATTCGAGCCACTTTG Verification of ev recombination 59 SNP_check1_for GACCAACACATCGCCAAACG Verification of SNPs 60 SNP_check1_rev GGATGACAAGGTACCTGTGC Verification of SNPs 61 SNP_check2_for CTTCTGCATCCTGCGATACC Verification of SNPs 62 SNP_check2_rev AGATCTGGCCATAGGAGTGC Verification of SNPs 63 SNP_check3_for AGTCAACGTCACCTCGACAG Verification of SNPs 64 SNP_check3_rev CTACACCACGAACGAGAGTC Verification of SNPs 65 SNP_check4_for ACATTCCGGAACGAGGAAGC Verification of SNPs 66 SNP_check4_rev CTCGGCATGTCAAAATCTGG Verification of SNPs 67 SNP_check5_for CATACCGCACCAAACACCTG Verification of SNPs 68 SNP_check5_rev ACCCTCCTCCTCTTCAACTG Verification of SNPs 69 SNP_check6_for CTCTGCCATTCCTCTTGGTC Verification of SNPs 70 SNP_check6_rev GCTGTGGATCAAAGGCAAGC Verification of SNPs 71 SNP_check7_for TATCTGGCATGGGCTCTTCG Verification of SNPs 72 SNP_check7_rev TGCAAGTGCCATTCTGGGTC Verification of SNPs

Böhm et al. 2014

Table S3. List of plasmids used in this study Plasmid Characteristics Reference or source pKOMAT 5’ flanking region of MAT1-2-1, trpC promoter of Böhm et al., 2013 A. nidulans, ble resistance gene of S. hindustanus, 3’ flanking region of MAT1-2-1 pT3T7-gpd gpd promoter of A. nidulans Böhm et al., 2013 pDrive-ptrA ptrA resistance gene of A. oryzae Böhm et al., 2013 pPgpd-MAT-2-ptrA gpd promoter of A. nidulans, MAT1-2-1 gene of This study P. chrysogenum, ptrA resistance gene of A. oryzae

Böhm et al. 2014

Supplementary Figure Legends

Fig. S1. Genomic organization of the MAT1-2 locus and a multiple alignment of the HMG domain proteins. The MAT1-2 protein sequence of Pc3 is compared to HMG mating-type proteins from the Fleming isolate NRRL1249B21 and other ascomycetes. Red: the HMG-box domain. Asterisks: DNA binding sites. Blue: the conserved isoleucine-serine motif, upstream of the conserved intron.

Fig. S2. Construction of MAT1-2-1 and complementation strains. A. Organization of the MAT1-2 locus in the reference strain, Pc3, and the derived knockout strains. The corresponding Southern hybridization confirmed the knockout and the phleomycin resistance cassette. B. Southern hybridization with MAT1-2-1-specific probes to verify successful rescue of the deletion strain.

Fig. S3. Construction of MAT1-2-1 overexpression strains. A. Overexpression construct generated to complement MAT1-2-1 deletion strains. The MAT1-2-1 gene is under the control of the gpd promoter of A. nidulans. B. Southern hybridization verifies ectopic integration of the MAT1-2-1 gene into strain Pc3 with 32P-labeled probes specific for MAT1-2-1. C. Southern hybridization with 32P-labeled probes specific for MAT1-2-1 verifies ectopic integration of MAT1-2-1 in P2niaD18. D. Transcriptional expression of MAT1-2-1 in overexpression strains, Pc3MAT2-OE. Strains were grown in liquid shaking cultures for 72 h. Values represent log2-transformed, average expression ratios of at least two biological replicates of three independently-derived MAT1-2-1 overexpression strains (n ≥ 3), relative to the reference Pc3.

Fig. S4. Quantification of light-dependent conidiospore formation in MAT1-2-1 overexpression strains in a background of (A) Pc3 or (B) P2niaD18. All strains were grown for 168 h under constant light or darkness. Error bars represent mean ± SD (n = 3) from three independent experiments.

Böhm et al. 2014

Fig. S5. Pellet formation in liquid shaking cultures formed by reference and recombinant MAT1-2 strains. The pellet phenotype is illustrated in representative micrographs.

Fig. S6. Pellet formation in liquid shaking cultures. (Left) Quantification of pellet diameters formed from MAT1-2-1 deletion strains in liquid shaking CCM cultures. Measurements were taken at four different time points, as indicated. Error bars represent the mean ± SD of 240 random pellets from three independent strains. (Right) The pellet phenotypes are illustrated with representative micrographs.

Fig. S7. PCR verification of a chromosomal rearrangement in wild-type and penicillin- production strains. The wild-type strains, NRRL 1951 and Pc3, and ascospore isolate, AS25- 3, show the same chromosomal structure; in contrast, all low- and high-penicillin producers of the Wisconsin lineage (Q176, Wisconsin54-1255, and P2niaD18) have a different chromosomal organization at this locus.

Fig. S8. Best scoring Maximum Likelihood tree of combined partial calmodulin, RPB1, and RPB2 datasets. The bootstrap values from 500 replicates of the maximum likelihood analysis are shown at the nodes (after Houbraken et al. 2011).

Fig. S9. Comparison of Pc3 sequence to the published sequence of P2niaD18 (Specht et al., 2014). Genome sequencing of Pc3 reveals a high number of single nucleotide polymorphisms (SNPs) compared to the industrial strain. The number of SNPs within 10-kb windows is indicated with color. Locations of genes of particular interest are highlighted.

Fig. S10. Flow chart of bioinformatic analysis to identify differently inherited genomic regions in AS25-3. Illumina reads of ascospore isolates AS25 and AS25-3 were trimmed and mapped on the P2niaD18 reference genome sequence (MAT loci are indicated by colors: blue for MAT1-1, and red for MAT1-2). SNPs in the parental strains P2niaD18 and AS25, and the AS25-3 consensus sequence were predicted. To clearly assign SNPs on the AS25-3 genome, comparative analysis were performed using parental high-quality SNPs (quality score >50, and allele frequency = 1.0). After SNP allocation, sliding-window analysis provides the basis to calculate differently inherited genomic regions inside AS25-3.

Böhm et al. 2014

Supplementary Figures

Fig. S1.

Böhm et al. 2014

Fig. S2.

Böhm et al. 2014

Fig. S3.

Böhm et al. 2014

Fig. S4.

Böhm et al. 2014

Fig. S5.

Böhm et al. 2014

Fig. S6.

Böhm et al. 2014

Fig. S7.

Böhm et al. 2014

Fig. S8.

Böhm et al. 2014

Fig. S9.

Böhm et al. 2014

Fig. S10.

V GESAMTDISKUSSION 25

V. GESAMTDISKUSSION Der Hyphenpilz Penicillium chrysogenum ist der industriell genutzte Hauptproduzent des β-Lactam-Antibiotikums Penicillin, weshalb ihm eine hohe biotechnologische Relevanz zukommt. Daher ist die gezielte Stammoptimierung, im Speziellen die Steigerung der Syntheseleistung und die Verbesserung von Anzuchtbedingungen, von großem Interesse. Da P. chrysogenum bisher als asexuell galt, konnten sexuelle Kreuzungen nicht für die Stammoptimierung genutzt werden. Produktionseffizientere Stämme wurden daher mittels klassischer Mutagenese-Verfahren und anschließender Selektion erzeugt (Backus und Stauffer 1955, van den Berg 2010). Durch die seit 2008 öffentlich zugängliche Genom-Sequenz eines bereits optimierten Stammes konnten zudem Funktionsanalysen bestimmter Gene, die beispielsweise an der Penicillin- Biosynthese beteiligt sind, durchgeführt werden. Da die Synthese von Penicillin aber durch ein komplexes Netzwerk verschiedenster Faktoren kontrolliert wird, ist die Optimierung über konventionelle Mutagenese-Verfahren oder Veränderung einzelner Gene ein langwieriger Prozess. Im Rahmen dieser Arbeit konnte der sexuelle Zyklus mit der Erzeugung rekombinanter Ascosporen in P. chrysogenum induziert werden. Dies eröffnet die Möglichkeit der gerichteten Kreuzung von Stämmen mit positiven Eigenschaften für die Penicillin-Produktion. Zudem konnte die Funktion der Kreuzungstypgene aufgeklärt und mit für die Biotechnologie relevanten Prozessen, wie der Penicillin-Biosynthese, der asexuelle Sporulation und der Pelletbildung, in Verbindung gebracht werden. Die in dieser Arbeit erzielten Ergebnisse sollen nun im Kontext der aktuellen Forschung diskutiert und Perspektiven, die sich daraus für die Forschung und Industrie ergeben, dargestellt werden.

1. Die MAT-Transkriptionsfaktoren kontrollieren asexuelle Entwicklungsprozesse Hyphenpilze, wie P. chrysogenum, wachsen durch die Bildung eines dichten Netzwerks von Hyphen, deren Gesamtheit als Myzel bezeichnet wird. Äußere Faktoren, wie Licht, Nährstoffangebot, Sauerstoffzufuhr oder Signalpeptide, beeinflussen die Bildung spezialisierter Strukturen für die asexuelle oder sexuelle Entwicklung. So entwickelt P. chrysogenum für die Verbreitung asexueller Sporen Konidienträger, welche die Konidiosporen abschnüren. Der sexuelle Zyklus hingegen ist durch die Bildung von komplexen Fruchtkörpern, den Kleistothezien, mit sexuellen Ascosporen V GESAMTDISKUSSION 26

gekennzeichnet. Die Balance zwischen asexueller und sexueller Entwicklung wird in P. chrysogenum unter anderem durch den Faktor Licht kontrolliert. So erfolgt die Bildung von Fruchtkörpern ausschließlich in Dunkelheit und wird durch Lichteinfluss unterbunden (siehe Kapitel III). Die Produktion von Konidiosporen findet hingegen verstärkt unter Licht-Bedingungen statt, während sie in Abwesenheit von Licht gehemmt wird. Aus diesem Grund tritt in P. chrysogenum ein Licht-Dunkel-Effekt der asexuellen Sporulation auf. Im Licht wird in Wildtypstämmen im Vergleich zur Anzucht in vollständiger Dunkelheit etwa die doppelte Menge an Konidien gebildet (siehe Kapitel III, Hoff et al. 2010a). Diese Licht-kontrollierte Entwicklung der Reproduktionsmechanismen erfolgt ähnlich auch in anderen Hyphenpilzen, wie Aspergillus fumigatus oder Aspergillus nidulans (O'Gorman et al. 2009, Sarikaya Bayram et al. 2010). Lichtreize werden durch sogenannte Lichtrezeptoren wahrgenommen, die mit einem Chromophor verbunden die Energie des Lichts absorbieren und weiterleiten, wobei sie eine reversible Konformationsänderung durchführen (Chen et al. 2010). In Hyphenpilzen existieren für die verschiedenen Lichtqualitäten unterschiedliche Rezeptoren (Borkovich et al. 2004, Brown 2004, Blumenstein et al. 2005, Brandt et al. 2008). Für die Blaulicht-Erkennung sind neben den Cryptochromen die gut untersuchten white collar-Proteine verantwortlich. Die Wahrnehmung von rotem Licht erfolgt über Phytochrome, die von grünem Licht über Opsine. Die Lichtwahrnehmung ist besonders gut in A. nidulans und Trichoderma reesei untersucht (Tisch und Schmoll 2010). Daher soll am Beispiel von A. nidulans verdeutlicht werden, wie die Lichtregulation der Konidienbildung verläuft und welche Faktoren involviert sind. Der ankommende Lichtreiz wird von einem Lichtrezeptorkomplex aus den white collar- Proteinen LreA, LreB, dem Phytochrom FphA und dem globalen Regulator VeA wahrgenommen, der die Expression der Gene der flb- (fluffy with low brlA expression, flb) Kaskade induziert (Purschwitz et al. 2008). Die Gene fluG und flbA-E aus dieser Kaskade gehören zu den sogenannten upstream developmental activators (UDAs) der asexuellen Sporenbildung, deren Deletionsmutanten einen konidienlosen (fluffy) Phänotyp mit einer geringen Expression des Gens brlA aufweisen (Wieser und Adams 1995). brlA kodiert dabei für einen Transkriptionsfaktor, der für die korrekte Bildung des Konidienträgers verantwortlich ist. In Deletionsmutanten zeigen die Konidiophore V GESAMTDISKUSSION 27

ein unbestimmtes Längenwachstum ohne weitere Differenzierung, wodurch die Mutanten eine borstige (bristle) Erscheinung erhalten (Adams et al. 1988). Der Faktor FluG aktiviert die Expression der Gene für die Transkriptionsfaktoren FlbA, FlbB, FlbC und FlbE (Adams et al. 1998, Seo et al. 2006, Yu 2006). Gemeinsam mit FlbD führen diese dann zur Aktivierung der Expression des brlA-Gens (Yu et al. 2006). Dieses bildet zusammen mit den Genen abaA und wetA die zentrale, regulatorische Kaskade der Konidienbildung (Aguirre 1993, Adams et al. 1998). Die Gene brlA, abaA und wetA kodieren dabei für Transkriptionsfaktoren, die für die Bildung des Konidienträgers und der Sporenwand verantwortlich sind (Clutterbuck 1969, Aramayo und Timberlake 1993). In dieser Arbeit konnte durch die Analyse von Deletionsmutanten der Kreuzungstypgene, die eigentlich für die Kontrolle der sexuellen Entwicklung bekannt sind, interessanterweise ein regulierender Einfluss auf die asexuelle Sporulation von P. chrysogenum nachgewiesen werden (siehe Kapitel III und IV). Die Konidienbildung wird hier von den MAT-Proteinen Licht-abhängig reprimiert. In MAT1-1-1 Deletionsstämmen ist die asexuelle Sporulation im Licht im Vergleich zum Referenzstamm um etwa 25 % erhöht. Die Deletion von MAT1-2-1 ruft hingegen eine Erhöhung der Konidienbildung in Dunkelheit hervor; so werden in etwa gleich viele Sporen in Licht und Dunkelheit gebildet. MAT1-1-1 reprimiert somit die asexuelle Sporulation unter Licht-Bedingungen, MAT1-2-1 hingegen ist ein negativer Regulator der Konidiosporogenese in Dunkelheit. Folglich übernehmen die Kreuzungstyp-Loci neben der Kontrolle der sexuellen Entwicklung (siehe Kapitel III und IV) auch regulatorische Funktionen bei der asexuellen Entwicklung. Da die von den Kreuzungstypgenen kodierten Proteine DNA-bindende Eigenschaften besitzen, wird vermutet, dass sie als Transkriptionsfaktoren wirken und somit die Expression von Zielgenen aktivieren oder reprimieren können. In der Hefe S. cerevisiae konnte nachgewiesen werden, dass die MAT-Proteine als Transkriptionsfaktoren die Expression der Gene des Pheromonsystems und Meiose-induzierender Gene aktivieren (Van Heeckeren et al. 1998). Funktionsanalysen der Kreuzungstypgene mittels Deletionsmutanten wurden bereits in anderen Hyphenpilzen durchgeführt. In nahezu allen untersuchten Pilzen ist die vegetative Entwicklung nicht beeinflusst (Pöggeler et al. 2006b, Paoletti et al. 2007, V GESAMTDISKUSSION 28

Szewczyk und Krappmann 2010). Allerdings ist die Bildung der sexuellen Strukturen gestört. In Neurospora crassa und Sordaria macrospora findet die Bildung von Fruchtkörpern nicht statt; in A. nidulans werden nur kleine, unreife Fruchtkörper gebildet, die keine Ascosporen enthalten (Philley und Staben 1994, Ferreira et al. 1998, Klix et al. 2010). In Fusarium verticillioides konnte allerdings wie in dieser Arbeit P. chrysogenum ein Einfluss von MAT1-2-1 auf die asexuelle Sporulation beschrieben werden. Deletionsmutanten zeigten eine Reduktion der Konidienbildung unabhängig von den Licht-Bedingungen (Bodor et al. 2012). Da in F. verticillioides die Konidienbildung generell Licht-unabhängig erfolgt, kann ein direkter Vergleich nicht stattfinden. Dennoch zeigen diese Ergebnisse, dass die MAT-Transkriptionsfaktoren generell das Potential haben, neben der Regulation der sexuellen Entwicklung auch die asexuelle Entwicklung beeinflussen zu können. So könnte MAT1-2-1 in P. chrysogenum sicherstellen, dass durch die Hemmung der asexuellen Sporenbildung die sexuelle Entwicklung in Dunkelheit stattfinden kann. Eine ähnliche Regulation von asexueller und sexueller Entwicklung wird in A. nidulans durch die Proteine der Velvet-Familie, die eine neue Klasse von pilzlichen Regulatoren bilden, gewährleistet. Der globale Regulator VeA steuert Licht-abhängig die asexuelle und sexuelle Entwicklung und kontrolliert zudem den Sekundärmetabolismus (Kato et al. 2003, Calvo 2008). VeA gilt als negativer Regulator der Licht-abhängigen Konidienbildung und als Aktivator der sexuellen Entwicklung. Die Regulation der asexuellen Sporulation findet dabei über die Kontrolle der Expression des Gens brlA statt. VeA agiert allerdings nicht allein, sondern bildet einen heterotrimeren Komplex mit der Methyltransferase LaeA und dem Velvet-ähnlichen Protein VelB. Auch VelB ist ein Licht-abhängiger Regulator der asexuellen Sporulation (Bayram et al. 2008b). Über die Interaktion mit einem weiteren Protein der Velvet-Familie, VosA, in Dunkelheit wird die Konidienbildung gehemmt. Im Licht reprimiert LaeA die Bildung des VelB-VosA- Heterodimers, wodurch es zur Sporulation kommt und gleichzeitig die sexuelle Entwicklung, für die VelB notwendig wäre, unterdrückt wird (Sarikaya Bayram et al. 2010). Durch die Bildung eines Homodimers wirkt VosA aber auch als direkter Repressor der Licht-abhängigen Konidienbildung, indem es die brlA-Expression hemmt (Sarikaya Bayram et al. 2010, Park et al. 2012). Des Weiteren konnte gezeigt werden, dass VeA nicht nur Teil des Velvet-Komplexes mit LaeA und VelB ist, sondern, wie V GESAMTDISKUSSION 29

bereits erwähnt, mit dem Lichtregulator-Komplex aus LreA, LreB und FphA interagiert (Bayram et al. 2010). Somit könnte ein eingehendes Lichtsignal über die Rotlicht- und Blaulicht-Rezeptoren wahrgenommen genommen werden, die wiederum die Aktivität von VeA über eine direkte Protein-Protein-Interaktion kontrollieren. Gleichzeitig wird die veA-Expression über das Cryptochrom CryA reguliert (Bayram et al. 2008a). Somit erfolgt in A. nidulans die Licht-abhängige Regulation von Entwicklungsprozessen durch den Velvet-Komplex über eine direkte Interaktion mit dem Lichtrezeptor-Komplex (Bayram et al. 2010). Auch in P. chrysogenum sind die Velvet-Komponenten PcVelA, PcVelB und PcVosA an der Licht-abhängigen asexuellen Entwicklung beteiligt. Hier führt die Deletion von PcvelA zur gleichen Sporenzahl in Licht und Dunkelheit, was vermuten lässt, dass die Licht-Wahrnehmung über PcVelA vermittelt wird (Hoff et al. 2010a). Auch Doppel- Mutanten (ΔPcvelAΔPcvelB und ΔPcvelAΔPcvelC) zeigen einen Phänotyp, der unempfindlich gegenüber Licht ist. Mit den Daten aus der vorliegenden Arbeit gibt es demnach zwei Licht-abhängige Regulationswege in P. chrysogenum, deren mögliche Interaktion bislang noch unbekannt ist. In A. nidulans und A. niger sind zudem noch weitere nicht-proteinogene Faktoren von asexueller und sexueller Entwicklung beschrieben (Tsitsigiannis et al. 2004, Wadman et al. 2009). In beiden Pilzen gewährleisten endogene Oxylipine, sogenannte psi-Faktoren (precocious sexual inducer), als Hormon-ähnliche Signale die zeitliche Abstimmung und Balance zwischen Fruchtkörper-Bildung und der Produktion von Konidiosporen (Champe et al. 1987, Champe und el-Zayat 1989, Calvo et al. 2001). So führen die Oxylipine psiBα und psiCα zur sexuellen Entwicklung, während sie die asexuelle Sporenbildung hemmen, psiAα hingegen hat den umgekehrten Effekt (Champe et al. 1987, Champe und el-Zayat 1989). Die Synthese der Oxylipine erfolgt autooxidativ oder enzymatisch über Mono- oder Dioxygenasen (Blee 2002). Das Gen ppoA kodiert für eine Fettsäure-Dioxygenase, die an der Biosynthese des Oxylipins psiBα beteiligt ist. Die Deletion von ppoA führt zu einer reduzierten Menge an psiBα und gleichzeitig zu einer vermehrten Bildung von Konidiosporen, während die Produktion von Ascosporen abnimmt (Tsitsigiannis et al. 2004). Die Überexpression von ppoA hingegen hat den gegenteiligen Effekt. Somit verbinden auch Oxylipine die mitotische und V GESAMTDISKUSSION 30

meiotische Sporenentwicklung. In A. nidulans wird die Expression von ppoA durch VeA und das COP9-Signalosom vermittelt (Tsitsigiannis et al. 2004). Das COP9-Signalosom (CSN) ist ein Multiprotein-Komplex, der die zelluläre Signalweiterleitung und die Ubiquitin-abhängige Proteolyse miteinander verbindet und somit die Lebensdauer und Entwicklung vielzelliger Organismen beeinflusst. In Hyphenpilzen reguliert er Licht-abhängige Prozesse, wie die circadiane Rhythmik von N. crassa oder die Hemmung der sexuellen Entwicklung im Licht in A. nidulans (Braus et al. 2010).

Auch in P. chrysogenum existiert ein Homolog zu ppoA, dessen Funktion und das Vorhandensein von Oxylipinen ist jedoch bisher noch nicht untersucht worden. Interessanterweise liegt das Homolog in den MAT1-1-1 Stämmen von P. chrysogenum nach 60 h um das 5,8-fache herunterreguliert vor (Wolfers 2013, Kapitel III). Dies könnte somit zu einer Reduktion des psiBα-Faktors führen und demnach zu einer vermehrten Sporenbildung, was den in den MAT1-1-1 Stämmen beobachteten Phänotyp erklären würde. Zusammenfassend lässt sich sagen, dass die Konidienbildung in Hyphenpilzen von einem komplexen Netzwerk reguliert wird, dem nun auch die Kreuzungstyp-Proteine zugeordnet werden können. Durch die funktionelle Charakterisierung konnte MAT1-2-1 eine weitere Funktion bei der asexuellen Entwicklung von P. chrysogenum zugesprochen werden. Der MAT1-2 Transkriptionsfaktor scheint die Keimung asexueller Sporen zu fördern (Kapitel IV). Interessanterweise wird ein gegenteiliger Effekt in Stämmen hervorgerufen, die beide MAT-Transkriptionsfaktoren enthalten. Die Sporenkeimung wird hier drastisch gehemmt, so dass nur etwa 20 % der asexuellen Sporen auskeimen können. Möglicherweise bilden die MAT-Transkriptionsfaktoren in diesen „künstlich homothallischen“ Stämmen Heterodimere, wodurch sich ihre DNA-Bindekapazität und -Spezifität verändert. Heterodimere Proteine spielen bei der Entwicklung von Pilzen, Pflanzen und Tieren eine wichtige Rolle. Gut untersuchte Beispiele sind hierbei die Kreuzungstyp-Proteine verschiedener Hefen (Jacobsen et al. 2002, Galgoczy et al. 2004). In Candida albicans, Kluyveromyces lactis und S. cerevisiae bilden die Proteine a1 und α2 einen heterodimeren Komplex, der Gene für die Aufrechterhaltung des haploiden Zustands unterdrückt und die Expression von Genen für den diploiden Zustand aktiviert (Booth et al. 2010). Auch in dem Basidiomyceten Ustilago maydis bilden die von den Kreuzungstypgenen kodierten Proteine bE und bW einen V GESAMTDISKUSSION 31

heterodimeren Komplex, der den Übergang vom haploiden Hefewachstum zur pathogenen, dikaryotischen Phase mit Hyphenwachstum fördert (Kämper et al. 1995). Die Proteine der Velvet-Familie aktivieren oder reprimieren verschiedenste Entwicklungsprozesse ebenfalls durch die Bildung von Komplexen aus Homo- und Heterodimeren. So reguliert in A. nidulans der VosA-VelB-Komplex, wie bereits erwähnt, die asexuelle Entwicklung und Sporenlebensfähigkeit, das Heterodimer VelB- VeA hingegen kontrolliert die sexuelle Entwicklung (Sarikaya Bayram et al. 2010). Auch die Transkriptionsfaktoren der sogenannten SOX (sex-determining region [SRY]- type high mobility group [HMG] box)-Familie aus dem Menschen verändern über die Bildung von Homo- bzw. Heterodimeren ihre DNA-Bindefähigkeit (Kasimiotis et al. 2000), und ebenso auch die Transkriptionsfaktoren der WRKY- (konservierte WRKY Domäne mit WRKYGQK-Sequenz am N-Terminus) Familie aus Pflanzen. Diese regulieren diverse Prozesse, wie die abiotische Stressantwort, die Seneszenz, die Samenentwicklung und die Embryogenese, indem sie über die Bildung verschiedener Homo- und Heterodimere die Transkription von Zielgenen aktivieren oder reprimieren (Bakshi und Oelmuller 2014). Die funktionelle Charakterisierung der Kreuzungstyp-Loci von P. chrysogenum zeigt, dass beide kodierten Transkriptionsfaktoren weitreichende Funktion in der Regulation von asexuellen Entwicklungsprozessen besitzen. MAT1-1-1 agiert als genereller Repressor der asexuellen Sporulation, möglicherweise über die Regulation der Expression von ppoA. MAT1-2-1 reprimiert die Licht-abhängige asexuelle Entwicklung und fungiert als Aktivator der Sporenkeimung. Diese Funktion kann durch die Bildung eines Heterodimers mit MAT1-1-1 umgekehrt werden. Welche Gene tatsächlich durch die MAT-Transkriptionsfaktoren direkt oder indirekt reguliert werden, ist Ziel zukünftiger Studien. Interessanterweise liegen in den MAT1-1-1 microarrays 18 putative Transkriptionsfaktoren signifikant hoch- bzw. herunterreguliert vor (Kapitel III). Dementsprechend könnte die Regulation von Entwicklungsprozessen in P. chrysogenum über die Kreuzungstyp-spezifische Kontrolle der Expression bestimmter Transkriptionsfaktoren erfolgen.

V GESAMTDISKUSSION 32

2. Hyphenmorphologie und Pelletbildung sind Kreuzungstyp-abhängig reguliert Viele Hyphenpilze werden für die industrielle Produktion von Sekundärmetaboliten, wie Antibiotika, sowie Proteinen genutzt. Dies erfolgt im großtechnischen Maßstab über den Prozess der Fermentation, der von verschiedenen Parametern beeinflusst wird. Einer der kritischsten Punkte bei der Fermentation von Hyphenpilzen ist deren Morphologie. Diese ist abhängig von der Konzentration und Lebensfähigkeit der Sporen, der Zusammensetzung und dem pH-Wert des Kulturmediums, der Temperatur, der Sauerstoffkonzentration, mechanischem Stress durch Belüftung und Rühren und den spezifischen Eigenschaften der eingesetzten Pilzstämme (Fomina und Gadd 2002). In Flüssigkulturen können zwei Formen des Wachstums auftreten, freies Myzel und Pellets. Pellets bestehen aus einem Netzwerk dichter, verzweigter und verwobener Hyphen, die stabile, kugelige Aggregate bilden (Wucherpfennig et al. 2010). Abhängig vom Produkt wird die eine oder andere Form für die Fermentation bevorzugt, daher müssen die Vor- und Nachteile von Myzel- und Pelletkulturen für das jeweilige biologische System gegeneinander abgewogen werden. In der Industrie wird bei Fermentationen zur Produktion von Penicillin durch P. chrysogenum die Bildung von Pellets präferiert, da die Fließeigenschaften der Kulturen aufgrund der geringeren Viskosität besser sind (Wucherpfennig et al. 2010). Somit kann ein leichteres Rühren und Belüften erfolgen, was den Herstellungsprozess energieärmer und somit kostengünstiger macht. Außerdem erfolgt in diesen Kulturen ein besserer Austausch von Nährstoffen und Sauerstoff und die Abtrennung der Pellets vom Medium kann leichter erfolgen. Nachteil bei der Fermentierung von Pelletkulturen ist der Mangel an Nährstoffen und Sauerstoff innerhalb der Pellets, der ab einer bestimmten Größe auftritt (Krull et al. 2013). Für die Entstehung von Pellets sind die oben genannten äußeren Faktoren, sowie das spezifische Hyphenwachstum der eingesetzten Pilzstämme verantwortlich. Drei Mechanismen führen zur Pelletbildung. Erstens kann ein Pellet aus einer einzelnen keimenden Spore durch Bildung eines dichten Hyphengeflechts entstehen. Zweitens können sich auch mehrere Sporen aneinanderheften und durch die gleichzeitige Keimung der verschiedenen Sporen ein Pellet bilden. Im dritten Fall lagern sich gekeimte Hyphenelemente lose zusammen und wandeln sich in ein Pellet um (Wucherpfennig et al. 2010). Abhängig vom Mechanismus können so verschiedene V GESAMTDISKUSSION 33

Pelletgrößen entstehen. Das Hyphenwachstum spielt dabei eine entscheidende Rolle und wird daher nachfolgend näher beschrieben. Die Keimung einer Spore und das Wachstum der entstehenden Hyphe ist ein komplexer Vorgang. Die Aktivierung von Sporen erfolgt bei ausreichendem Nährstoffangebot im Medium, woraufhin diese aufquellen. In der Regel entsteht ein Keimschlauch, der polar von der Spitze ausgehend mit einer linearen Wachstumsrate wächst. Innerhalb der Hyphe werden Proteine zur Zellwand-Synthese in Vesikeln vom Endoplasmatischen Retikulum zur Hyphenspitze transportiert sammeln sich am sogenannten Spitzenkörper, dem Vesikel-Sammel-Komplex (Riquelme 2013). Dieser bestimmt Form, Wachstumsrichtung und Wachstumsrate der Hyphe (Wucherpfennig et al. 2010). Bei weiterem Wachstum erfolgt die Bildung von Septen, welche die Hyphen in einzelne, miteinander verbundene Kompartimente unterteilt. Da die Vesikel die Septen nicht gleichzeitig passieren können, kommt es zu einer Anreicherung an dieser Stelle, woraufhin an den subapikalen Bereichen Verzweigungen auftreten. Eine weitere Hyphenspitze entsteht, die lateral zur Älteren wächst. Anschließend nehmen beide Hyphen erneut das Wachstum auf. Die Hyphe kann in einen apikalen, subapikalen und älteren Bereich unterteilt werden. Die subapikalen und älteren Bereiche besitzen zunehmend Vakuolen und sind nicht mehr am Wachstum beteiligt. In diesen Bereichen finden deshalb andere metabolische Prozesse statt als an der Spitze, wie beispielsweise die Produktion von Sekundärmetaboliten. Ein Beispiel hierfür ist die Produktion von Penicillin in den nicht mehr wachsenden und noch nicht vakuolisierten Bereichen der Hyphen von P. chrysogenum (Wucherpfennig et al. 2010). Die Sekretion von Metaboliten allerdings findet hauptsächlich an der Hyphenspitze statt, daher sind viele Verzweigungen und somit zahlreiche Hyphenspitzen für die Industrie von Vorteil (McIntyre et al. 2001, Barry et al. 2009). Die Analyse der rekombinanten MAT-Stämme ergab signifikante Veränderungen der Pelletmorphologie. Der Referenzstamm P2niaD18 bildet in der Regel kleine Pellets mit einer maximalen Größe von 500 µm im Durchmesser. Bereits nach 120-stündiger Anzucht beginnen diese in einzelne Myzelfragmente zu zerfallen, so dass nach 192 h Inkubation keine Pelletstrukturen mehr erkennbar sind. Sowohl MAT1-1-1 Deletions- als auch Überexpressionsstämme zeigen bereits nach 48 h Anzucht deutlich größere Pellets als die Referenzstämme (siehe Kapitel III). Die Deletionsstämme bilden im V GESAMTDISKUSSION 34

Zeitverlauf Pellets mit einem Durchmesser von über 3000 µm und weisen außerdem eine verzögerte Fragmentierung der Pellets auf. Auch die Überexpressionsstämme bilden deutlich größere Pellets, die sogar einen Durchmesser von über 6000 µm erreichen können und bleiben nach 192 h stabil. Für eine genauere Analyse der Pelletbildung wurde die Hyphenmorphologie mikroskopisch untersucht. Dabei zeigte sich, dass die größeren Pellets in den Knockoutstämmen durch eine vermehrte Bildung von Keimschläuchen hervorgerufen werden, die zudem noch einen Hyper-Branching- Phänotyp aufweisen, wohingegen die Sporen der Überexpressionsstämme vermehrt nur einen Keimschlauch bilden und ein verstärktes Längenwachstum der Hyphen ohne Verzweigungen zeigen. Somit wirkt MAT1-1-1 als Repressor der vermehrten Keimschlauchbildung und sorgt damit für ein stark polares Wachstum der Hyphen. Zudem wirkt MAT1-1-1 als Aktivator des Längenwachstums von Hyphen. Der Pellet- Phänotyp wird somit durch zwei gegensätzliche Entwicklungsprozesse hervorgerufen. In Deletionsstämmen verursachen vermehrte Verzweigungen die Bildung großer Pellets, in den Überexpressionsstämmen wird dies durch sehr lange Hyphen, die sich miteinander verhaken, bewirkt. Ein anderes Phänomen trat bei MAT1-2-1 Überexpressionsstämmen auf. Unabhängig vom Kreuzungstyp des Ausgangsstammes werden gleichzeitig Pellets verschiedenster Größen gebildet. Dabei entstehen Pellets mit einem Durchmesser von über 7000 µm, während auch Pellets mit einer Größe von 100 µm vorhanden sind. Die Analyse der Hyphenmorphologie ergab keine Veränderungen der Hyphenlängen, dafür konnte eine Zusammenlagerung der Sporen festgestellt werden. Es bildeten sich Cluster von 2-20 Sporen. So entstehen aus einzelnen keimenden Sporen kleinere Pellets und aus den zusammengelagerten Sporen, die gleichzeitig auskeimen, große Pellets, was das heterogene Bild der Pelletgrößen erklärt. MAT1-2-1 scheint daher die Oberflächen- Struktur und -Eigenschaften von asexuellen Sporen zur regulieren. Die Zusammenlagerung von Sporen oder Hyphen hängt von den physikochemischen und physiologischen Eigenschaften der Oberflächen ab (Prosser 1995). Es konnte bereits gezeigt werden, dass die Agglomeration von Sporen zur Pelletbildung führen kann und dies von verschiedenen Charakteristika der Sporenoberfläche, wie der elektrischen Ladung und der Hydrophobizität, abhängt (Clement et al. 1994, Jones 1994). Konidiosporen haben für eine bessere Verbreitung durch Luft eine wasserabweisende V GESAMTDISKUSSION 35

Oberfläche (Beever und Dempsey 1978). In A. nidulans wird die Hydrophobizität durch die zwei hydrophoben Proteine, DewA und RodA, die sich in der Sporenwand befinden, vermittelt (Stringer und Timberlake 1995). Die Konidien von dewA- und rodA- Deletionsmutanten sind leichter mit Wasser benetzbar als die der Wildtypstämme, da die Sporen weniger hydrophob sind (Stringer et al. 1991, Stringer und Timberlake 1995, Girardin et al. 1999). Es zeigte sich zudem, dass mit sinkender Hydrophobizität auch der Pelletdurchmesser kleiner wird, weshalb eine hohe Oberflächen-Hydrophobizität die Pelletbildung begünstigt. Die Stabilität der Zusammenlagerung der Sporen ist wiederum von der elektrostatischen Kraft, hydrophoben Interaktionen und chemischen Wechselwirkungen, wie Polysaccharid-Brücken, abhängig (Dynesen und Nielsen 2003). Die zusammengelagerten Sporen keimen gemeinsam aus und können sich dann wiederum mit anderen gekeimten oder ungekeimten Sporen und Aggregaten verbinden, wodurch sie sogenannte Super-Aggregate bilden (Dynesen und Nielsen 2003). Dies würde auch den Pelletphänotyp der MAT1-2-1 Überexpressionsstämme erklären. Es lässt sich zusammenfassen, dass die Pellet-Morphologie durch die Länge der Keimschläuche, ihre Anzahl und ihre Verzweigungen sowie durch die Hydrophobizität der Konidiosporen beeinflusst wird. MAT1-1-1 wirkt hierbei als Aktivator des Hyphenwachstums und sorgt gleichzeitig für ein polares Wachstum der Keimschläuche. MAT1-2-1 hingegen ist ein Regulator der Oberflächenbeschaffenheit der asexuellen Sporen. Somit bieten die Kreuzungstypgene Ansatzpunkte für die Optimierung der Pelletbildung in der Stammentwicklung.

3. MAT1-1-1 reguliert die Penicillin-Biosynthese Wie bereits erwähnt, ist P. chrysogenum der industriell genutzte Produzent des β-Lactam-Antibiotikums Penicillin. Die in dieser Arbeit verwendeten Stämme zur Analyse des MAT1-1 Locus sind Derivate des Original-Cantaloupe-Stammes NRRL 1951 (siehe Abb. 2). Durch konventionelle Mutagenese-Verfahren entstand aus diesem der Stamm P2niaD18, der bereits einen erhöhten Penicillin-Titer aufweist und der Referenzstamm der hier beschriebenen Analysen ist. Die Biosynthese von Penicillin umfasst drei enzymatische Vorgänge (Brakhage 2013, Kück et al. 2014). In einem ersten Schritt erfolgt die Bildung des Tripeptids L--(α-Aminoadipyl)-L-Cysteinyl-D-Valin aus den Aminosäuren L-α-Aminoadipinsäure, L-Cystein und L-Valin. Dieser Vorgang V GESAMTDISKUSSION 36

wird durch eine nicht-ribosomale Peptidsynthetase (NRPS), die δ-(L-α-Aminoadipyl)- L-Cysteinyl-D-Valin Synthetase (ACVS), die vom pcbAB-Gen kodiert wird, katalysiert. Darauf folgt ein Ringschluss durch die Isopenicillin-N-Synthase (IPNS), wodurch Isopenicillin N mit dem typischen viergliedrigen β-Lactam-Ring entsteht. Kodiert wird das für diese Reaktion verantwortliche Enzym durch das Gen pcbC. Im letzten Schritt wird die L-α-Aminoadipyl-Seitenkette durch die vom Gen penDE kodierte Isopenicillin-N-Acyltransferase (IAT) abgespalten. Das Endprodukt Penicillin G entsteht durch das Anfügen einer aromatischen Seitenkette (Ozcengiz und Demain 2013). Die für die Enzyme der Penicillin-Biosynthese verantwortlichen Gene pcbAB, pcbC und penDE liegen in einem in Pro- und Eukaryoten konserviertem Gencluster vor (Kück et al. 2014). Dabei liegt das pcbAB-Gen in entgegengesetzter Leserichtung zu den beiden anderen Genen (Brakhage 2013). pcbAB und pcbC werden so durch einen bidirektionalen Promotor kontrolliert, während das penDE-Gen über einen eigenen Promotor verfügt. Die Expression dieser Gene und somit die Regulation der Penicillin- Biosynthese unterliegen einer komplexen Kontrolle durch interne und externe Faktoren, wie globalen molekularen Regulatoren, dem pH-Wert des Mediums und der Kohlenstoff- oder Stickstoffquelle (Brakhage et al. 2004). Als molekulare Regulatoren der Penicillin-Biosynthese gelten vor allem die bereits erwähnten Velvet-Proteine PcVelA und PcLaeA. In P. chrysogenum wirkt PcVelA als transkriptioneller Aktivator des Penicillin-Biosynthese-Gen-Clusters. So ist die Expression der Gene pcbAB, pcbC und penDE in velA-Deletionsstämmen signifikant herunterreguliert (Hoff et al. 2010a). Dies hat zur Folge, dass der Penicillin-Titer um 80 % reduziert ist. Auch in A. nidulans ist die Penicillin-Produktion von der korrekten Expression von veA und laeA abhängig (Kato et al. 2003, Bayram et al. 2008b). Das komplexe regulatorische Netzwerk der Penicillin-Biosynthese ist noch nicht vollständig aufgeklärt; dies stellt jedoch eine Notwendigkeit für eine gezielte und effiziente Optimierung der Produktionsstämme dar. Die in dieser Arbeit durchgeführten Analysen zeigen, dass auch der MAT1-1-1 Transkriptionsfaktor als Aktivator der Penicillin-Biosynthese wirkt (siehe Kapitel III). In Hemmhoftests und HPLC-Analysen zeigt sich, dass der Penicillin-Titer in MAT1-1-1 Deletionsstämmen im Vergleich zum Referenzstamm P2niaD18 um 60 % reduziert ist. Diese Reduktion des Titers ist jedoch Zeit-abhängig und gleicht sich nach längeren Inkubationszeiten ab 96 h an. Die Herabregulation der Penicillin-Synthese in MAT1-1-1 V GESAMTDISKUSSION 37

Deletionsstämmen wird durch die signifikant verminderte Expression der drei Penicillin-Biosynthese-Gene pcbAB, pcbC und penDE hervorgerufen. Somit kontrolliert MAT1-1-1 über die Regulation der transkriptionellen Expression der Biosynthese-Gene die Penicillin-Produktion. Für MAT1-2-1 konnte keine regulatorische Funktion innerhalb der Penicillin-Biosynthese festgestellt werden. Dies kann jedoch in den für die funktionelle Analyse verwendeten Wildtyp-Stämmen begründet sein. In diesen Stämmen hat keine Optimierung der Penicillin-Produktion stattgefunden, wodurch generell nur sehr geringe Penicillin-Titer vorliegen. Änderungen der produzierten Penicillin-Menge sind somit nur schwer detektierbar. Zusammenfassend lässt sich sagen, dass beide von den Kreuzungstyp-Loci kodierten Transkriptionsfaktoren bislang unbekannte regulatorische Funktionen bei biotechnologisch relevanten Prozessen in P. chrysogenum übernommen haben. So wird die Transkription zahlreicher Gene kontrolliert, die an der Penicillin-Biosynthese, der asexuellen Sporulation und der Hyphen- und Pellet-Morphologie beteiligt sind. Dabei wirken die beiden Kreuzungstyp-Proteine nicht redundant, sondern kontrollieren spezifisch verschiedenste Prozesse, deren Unterschiede in Tabelle 2 zusammengefasst sind. MAT1-1-1 agiert als positiver Regulator der Penicillin-Biosynthese und des Hyphenwachstums, während die asexuelle Sporulation reprimiert wird. MAT1-2-1 hingegen wirkt als Aktivator der Sporenkeimung, der Agglomeration von Sporen und als Repressor des polaren Hyphenwachstums und der Licht-abhängigen Konidiosporogenese. Liegen beide Faktoren gemeinsam vor, wird wahrscheinlich durch die Bildung eines Heterodimers die Wirkungsspezifität verändert. Somit konnten für die Kreuzungstypgene bislang unbekannte Funktionen mit biotechnologische Relevanz in P. chrysogenum aufgedeckt werden. Daher eignen sich die Kreuzungstypgene als Ziele für die klassische Stammoptimierung. Dennoch haben sie ihre bekannte Funktion als Regulatoren der sexuellen Identität und Entwicklung nicht verloren, so dass durch Kreuzungen verschiedener MAT1-1 und MAT1-2 Stämme der sexuelle Zyklus in P. chrysogenum induziert werden konnte, worauf in den nächsten Kapiteln detailliert eingegangen werden soll.

V GESAMTDISKUSSION 38

Tabelle 2: Vergleichende Gegenüberstellung der regulatorischen Funktionen der MAT-Transkriptionsfaktoren. MAT1-1-1 MAT1-1-1 MAT1-2-1 + MAT1-2-1 Penicillin- Aktivator Kein Einfluss Kein Einfluss Biosynthese

Konidiosporo- Repressor der Repressor der Kein Einfluss Sporulation Licht-abhängigen genese Sporulation

Pellet- großer Pellets heterogene heterogene Morphologie Pelletgrößen Pelletgrößen

Sporen- n.d. Aktivator Repressor Keimung

Sporen- Kein Einfluss Verstärkte Verstärkte Agglomeration Zusammenlagerung Zusammenlagerung

Längenwachstum Aktivator Kein Einfluss Kein Einfluss von Hyphen

Polares Aktivator Repressor Aktivator Hyphenwachstum n. d. = nicht bestimmt

4. Der sexuelle Zyklus kann in P. chrysogenum induziert werden Viele biotechnologisch relevante Hyphenpilze gelten als asexuell, dabei würde die genetische Kreuzbarkeit einen optimalen Ansatz für die Stammoptimierung bieten. Durch die Identifizierung der Kreuzungstypgene konnten tatsächlich in einer immer größer werdenden Anzahl von als asexuell geltenden Pilzen erfolgreich Kreuzungen von Stämmen mit entgegengesetztem Kreuzungstyp durchgeführt werden (siehe Tabelle 1, Kapitel I). So konnte auch in P. chrysogenum durch das gezielte Ansetzen von Kreuzungen verschiedener MAT1-1 und MAT1-2 Stämme der sexuelle Zyklus mit der Bildung von Fruchtkörpern, die rekombinante Ascosporen enthalten, induziert werden V GESAMTDISKUSSION 39

(siehe Kapitel III). Für die Bildung von Fruchtkörpern mit rekombinanten Ascosporen sind in vielen Ascomyceten definierte Bedingungen erforderlich. So sind Haferflocken- Agar, Luftabschluss und Dunkelheit für die Fruchtkörper-Bildung in P. chrysogenum essentiell. Diese Bedingungen führten bereits in verschiedenen Aspergillus-Spezies erfolgreich zur Induktion des sexuellen Zyklus (Todd et al. 2007, O'Gorman et al. 2009, Horn et al. 2011, Arabatzis und Velegraki 2013). Für die Kreuzung von verschiedenen Aspergillus-Arten wurde ebenfalls ein Getreide-Agar verwendet und die Inkubation der Kreuzungen erfolgte in Dunkelheit. Die Sauerstoff-Bedingungen sind jedoch stringenter als in P. chrysogenum. Nach zweiwöchiger Inkubation wurden hier die Kreuzungsplatten in Plastikbeuteln luftdicht verschlossen (Horn et al. 2009a). Dieser völlige Sauerstoff-Abschluss konnte für P. chrysogenum nicht übernommen werden, da die Kulturen ihr Wachstum einstellten. Hier wird eine Reduktion des Sauerstoffs durch das Abdichten der Kreuzungsplatten mit Parafilm erreicht. Interessanterweise erfolgt die sexuelle Entwicklung in Trichoderma reesei und Pyronema confluens ohne Sauerstoff-Abschluss und unter konstanten Licht-Bedingungen (Seidl et al. 2009, Traeger et al. 2013). Somit scheinen die Bedingungen für die Induktion des sexuellen Zyklus in nah verwandten Gattungen, wie Penicillium und Aspergillus sehr ähnlich zu sein, während sie innerhalb der Ascomyceten sehr variabel sind. Für die Kreuzungsexperimente in P. chrysogenum wurden verschiedenste Stämme eingesetzt. Einerseits wurden Wildtyp-Stämme verwendet, unter denen sich Frisch- Isolate und Isolate aus Stammsammlungen befanden, andererseits wurden industrielle Produktionsstämme eingesetzt, die eine unterschiedliche Anzahl von Mutagenese- Verfahren durchlaufen haben. In 24 verschiedenen Kreuzungen konnte nach mehr- monatiger Inkubation die Bildung von Fruchtkörpern, den sogenannten Kleistothezien, beobachtet werden (siehe Kapitel III). Allerdings ließen sich keine rekombinanten Ascosporen nachweisen. Für die Produktion dieser war die Zugabe von Biotin in das Medium notwendig. Hierdurch ließ sich außerdem die Zeit bis zur Kleistothezien- Bildung stark verkürzen, sodass bereits nach fünf Wochen Inkubation Fruchtkörper entstanden. Die Notwendigkeit von Biotin für die sexuelle Entwicklung ist bereits seit langem für S. macrospora bekannt (Molowitz et al. 1976). Hier kann der sexuelle Zyklus nur nach Zugabe von Biotin vollständig abgeschlossen werden, wobei die genaue Wirkungsweise bei der Fruchtkörper-Bildung nicht bekannt ist. Da Biotin als V GESAMTDISKUSSION 40

prosthetische Gruppe bei der Carbamyl-Phosphat-Synthese wirkt, wird vermutet, dass eine Biotin-abhängige Carboxylierungs-Reaktion an der Fruchtkörper-Bildung beteiligt ist (Wellner et al. 1968). Durch das Einsetzen von Biotin bei Kreuzungen von P. chrysogenum konnte erstmalig die Fruchtkörper-Bildung mit der Produktion von rekombinanten Ascosporen abgeschlossen werden. So führte die Kreuzung des Wildtyp-Isolats Pc3 mit dem Stamm Q176, der früh innerhalb der Wisconsin-Linie liegt und bereits durch Mutagenese verändert ist (siehe Abb. 2), erfolgreich zum Abschluss der sexuellen Entwicklung und zur Isolierung von Ascosporen. Diese wurden anhand von elf molekularen Markern mittels Restriktionsfragmentlängenpolymorphismus (RFLP) und Southern-Hybridisierung des Kreuzungstyp-Locus auf genetische Rekombination untersucht (siehe Kapitel III). Von 150 der untersuchten Ascosporen zeigten 36 einen rekombinanten Genotyp und ließen sich durch die Verteilung ihrer Marker in fünf Rekombinationsgruppen aufteilen, die auf eine unabhängige chromosomale Verteilung hindeuten. Interessant ist dabei, dass die Marker nsdD und stuA, die auf demselben Chromosom des P. chrysogenum-Genoms vorliegen, in einigen Nachkommen von unterschiedlichen Elternstämmen vererbt wurden. Es hat somit eine intrachromosomale Rekombination stattgefunden. Auffallend war zudem eine starke Tendenz zur ersten Rekombinationsgruppe; 75 % der untersuchten rekombinanten Ascosporen zeigten diesen Rekombinationstyp. Dieser Umstand lässt sich möglicherweise durch die Verschiedenheit der Genome der Elternstämme erklären, die eine Rekombination bestimmter chromosomaler Bereiche verhindern könnten. Diese Unterschiede in der Genom-Struktur sind wahrscheinlich durch konventionelle Mutagenese mittels Einsatz von Röntgenstrahlung entstanden, die die Produktionsstämme während der Stammoptimierung durchlaufen haben (Elander 1983, Lein 1986). Die Behandlung mit Röntgenstrahlung ruft bevorzugt Chromosomenbrüche und somit Translokationen, Inversionen und Deletionen chromosomaler Bereiche hervor (Sax 1938, Erixon und Cedervall 1995). Anzeichen dafür zeigten sich bereits während der Kreuzung der verschiedenen Stämme der Wisconsin-Linie mit dem Wildtyp-Stamm Pc3. Während aus der Kreuzung von Pc3 mit dem Stamm Q176, der früh in der Wisconsin-Linie liegt, rekombinante Ascosporen hervorgegangen sind, wurden bei der Kreuzung von Pc3 mit dem Stamm P2niaD18, der weitere Mutagenese- Prozesse durchlaufen hat, zwar Fruchtkörper, aber keine Ascosporen identifiziert. V GESAMTDISKUSSION 41

Wurde der Stamm P2niaD18 allerdings mit einem rekombinanten Nachkommen der ersten Kreuzung (Pc3 × Q176), dem Stamm AS25, gekreuzt, konnte der sexuelle Zyklus mit der Bildung von Fruchtkörpern und rekombinanten Ascosporen abgeschlossen werden (siehe Kapitel IV). Es ist möglich, dass sich das Genom des Stammes AS25 durch die erste Kreuzung an die Chromosomen-Struktur der Produktionsstämme angepasst hat, so dass nun die Bildung rekombinanter Ascosporen möglich ist. Um dieser Hypothese nachzugehen, wurden Genom-Sequenzierungen der Stämme Pc3, AS25 und eines Ascosporisolats der Kreuzung zwischen P2niaD18 und AS25, genannt AS25-3, durchgeführt. Das Verwandtschaftsverhältnis dieser Stämme ist vereinfacht in Abbildung 3 dargestellt. Diese Sequenzen wurden dann mit den schon vorliegenden Genom-Sequenzen der Stämme Wisconsin54-1255 und P2niaD18 (van den Berg et al. 2008, Specht et al. 2014) verglichen, um einerseits chromosomale Inkompatibilitäten der Elternstämme aufzudecken und andererseits meiotische Rekombinationen in den Ascosporisolaten nachzuweisen (siehe Kapitel IV). Der Vergleich der Genom- Sequenzen der Wisconsin-Stämme Wisconsin54-1255 und P2niaD18 zeigte zahlreiche Punktmutationen, sogenannte single nucleotide polymorphisms (SNPs), sowie zwei große chromosomale Umlagerungen, die wahrscheinlich durch konventionelle Mutagenese während der Stammoptimierung entstanden sind. Diese Umlagerungen zeigen sich auch beim Vergleich der Genom-Sequenzen der Stämme P2niaD18 und Pc3. Dies scheint auch der Grund für die Inkompatibilität der beiden Stämme zu sein und erklärt, warum ihre Kreuzung nicht zu rekombinanten Ascosporen führte. Da der Stamm Q176 diese Umlagerungen nicht aufweist, weil er in der Entstehungsgeschichte noch vor dem Stamm Wisconsin54-1255 liegt, ist dieser Stamm hingegen mit dem Wildtyp Pc3 kreuzbar. Die Sequenzen der Nachkommen aus den Kreuzungen wurden über SNP-Analysen mit denen der Elternstämme verglichen. Auf diese Weise konnten mittels bioinformatorischer Analyse vorhergesagte rekombinante Regionen in den Sequenzen der Ascospor-Isolate verifiziert werden (siehe Kapitel IV). Diese Regionen zeigen, dass durch sexuelle Kreuzungen meiotische Rekombinationen entstanden sind. So erkennt man, dass die Sequenz einem Elternstamm zuzuordnen ist, die dann in eine Sequenz

V GESAMTDISKUSSION 42

Abb. 3: Stammbaum der für die Genom-Sequenzierung ausgewählten P. chrysogenum-Stämme. Aus der Kreuzung Q176 und Pc3 ist der Stamm AS25 hervorgegangen. Dieser wiederum wurde mit dem Stamm P2niaD18 gekreuzt, woraus der Stamm AS25-3 entstanden ist. Für die Genom-Sequenzierungen wurden die Stämme Pc3, AS25 und AS25-3 verwendet. Abgerundete Vierecke zeigen Wildtyp- bzw. durch Mutagenese erzeugte Stämme an, Trapeze weisen auf Ascosporisolate hin. Stämme, die den MAT1-1 Kreuzungstyp-Locus aufweisen, sind blau markiert, Stämme mit MAT1-2 Locus sind rot dargestellt. Die gestrichelte Linie deutet an, dass der Stamm P2niaD18 durch Mutagenese aus dem Stamm Q176 hervorgegangen ist.

übergeht, die auf den anderen Elternstamm zurückzuführen ist (siehe Kapitel IV). Die Zuordnung der Sequenzen erfolgte dabei über die Anordnung der detektierten SNPs zwischen den beiden Parental-Genomen. Diese Ergebnisse konnten anschließend mittels PCR-Amplifikation und erneuter Sequenzierung bestätigt werden. Die Genom-weite Analyse der SNPs im Ascospor-Isolat AS25 zeigte, dass ein Großteil der Sequenz vom Elternstamm Pc3 stammt und zudem eine hohe Anzahl allelischer SNPs vorliegt, die auf Duplikationen und Translokationen hindeuten. Somit könnte eine partielle Aneuploidie genomischer Bereiche vorliegen, wie es auch für Aspergillus flavus gezeigt werden konnte (Olarte et al. 2012). Bei Aneuploidie liegen einzelne Chromosomen zusätzlich zum üblichen Chromosomensatz vor oder fehlen. Sie entsteht während der sexuellen Entwicklung und konnte speziell in verschiedenen Hefen nachgewiesen werden (Ni et al. 2013). Es wird vermutet, dass durch Aneuploidie eine phänotypische und genotypische Varianz für die natürliche Selektion während der Evolution entsteht. So sind aneuploide Isolate von C. albicans und Cryptococcus neoformans Stress- resistenter, besonders gegenüber Antimykotika (Selmecki et al. 2006, Sionov et al. 2010). Ein Vorteil gegenüber spontanen Mutationen ist hierbei, dass durch den Verlust V GESAMTDISKUSSION 43

oder die Aufnahme eines Chromosoms der Ausgangszustand zurückerlangt werden kann. Das Genom des zweiten sequenzierten Ascospor-Isolats AS25-3 hingegen weist eine ausgewogenere Verteilung von Anteilen beider Eltern-Genome auf. Die erhöhte Rekombinationsrate wird daher wahrscheinlich, wie bereits aufgeführt, durch eine Anpassung der Chromosomen-Struktur während der ersten Kreuzung hervorgerufen. So scheint eine erhöhte Ähnlichkeit der Chromosomen zu einer erhöhten Rekombinationsrate zu führen. Es konnte bereits gezeigt werden, dass in asexuellen Arten verschiedene Genomstrukturen mit extremen Variationen innerhalb einer Art vorliegen, die durch das Fehlen der Meiose nicht angeglichen werden können (Kistler und Miao 1992). Auch in S. macrospora konnte gezeigt werden, dass Stämme mit stark abweichenden Chromosomen-Strukturen eine reduzierte Fertilität in Kreuzungen aufweisen (Pöggeler et al. 2000). Hier konnten Stämme mit unterschiedlichen Karyotypen identifiziert werden, die nach Kreuzung nur noch eine 40-prozentige Fertilität aufwiesen, was bedeutet, dass nur eine geringe Anzahl an lebensfähigen Ascosporen gebildet wurde. Dies könnte erklären, warum trotz aller Voraussetzungen, wie der Kreuzungstyp-Gene oder ein funktionales Pheromon-Pheromonrezeptorsystem, die sexuelle Entwicklung in zahlreichen Arten bislang nicht erfolgen konnte. Die erfolgreichen Kreuzungen der verschiedenen MAT1-1 und MAT1-2 Stämme zeigen, dass die Kreuzungstyp-Loci ihre bekannten Funktionen als Regulatoren der sexuellen Identität und Entwicklung in P. chrysogenum bewahrt haben. Kreuzungen von MAT-Deletionsstämmen konnten dies zudem weiter verdeutlichen. Das Fehlen des MAT1-1-1 Gens führte bei Kreuzungen zur Fruchtkörper-Bildung, Ascosporen ließen sich jedoch nicht nachweisen (siehe Kapitel III). Dies lässt darauf schließen, dass der sexuelle Zyklus nicht vollständig abgeschlossen werden kann und MAT1-1-1 auch an späteren Prozessen der sexuellen Entwicklung beteiligt ist. In Kreuzungen mit MAT1-2-1 Deletionsstämmen konnte selbst die Fruchtkörper-Bildung nicht induziert werden (siehe Kapitel IV). Ähnliche Ergebnisse lieferten Kreuzungsexperimente von S. macrospora (Klix et al. 2010). Hier führte das Fehlen des HMG- Transkriptionsfaktors ebenfalls nicht zur Bildung von Fruchtkörpern, wohingegen der MAT1-1-1 Transkriptionsfaktor zwar nicht für die Fruchtkörper-Bildung, aber für die Produktion von Ascosporen essentiell war. Diese Daten zeigen, dass die Kreuzungstyp- V GESAMTDISKUSSION 44

Abb. 4: Regulatorische Funktionen der Kreuzungstyp-Transkriptionsfaktoren in P. chrysogenum. Dargestellt sind die Gene MAT1-1-1 und MAT1-2-1 mit den jeweils kodierten Transkriptionsfaktoren. Pfeile deuten eine aktivierende Wirkung des Transkriptinsfaktors auf den jeweiligen Prozess an, Linien mit geradem Endpunkt zeigen eine reprimierende Regulation. MAT1-1-1 ist blau gekennzeichnet; MAT1-2-1 ist rot markiert.

Loci in P. chrysogenum zahlreiche Prozesse regulieren. Wie in Abbildung 4 zusammengefasst ist, wirken sie auf die sexuelle Entwicklung, ebenso wie auf die asexuelle Sporenbildung, die Penicillin-Biosynthese und die Morphologie. Zusammenfassend lässt sich sagen, dass der Nachweis für einen heterothallischen sexuellen Zyklus in P. chrysogenum erbracht werden konnte. Trotz großer chromosomaler Umlagerungen innerhalb der Genome der verschiedenen P. chrysogenum-Stämme konnte die sexuelle Entwicklung mit der Bildung von genetisch rekombinanten Nachkommen abgeschlossen werden. Zudem können durch Kreuzungen die Genome von Wildtyp-Stämmen und Produktionsstämmen angepasst und die Fertilität gesteigert werden. Dies eröffnet die Möglichkeit, sexuelle Kreuzungen für die Stammoptimierung von P. chrysogenum einzusetzen und so Stämme zu erzeugen, die für die Industrie relevante Eigenschaften verschiedener Stämme vereinen. Da während der sexuellen Entwicklung die Rekombination über das gesamte Genom verteilt erfolgt, entstehen in kurzer Zeit Nachkommen mit einer großen genetischen Varianz, die anschließend für die Selektion geeigneter Stämme zur Verfügung stehen (Aanen und Hoekstra 2007). Das Auftreten unerwünschter schädlicher Mutationen und V GESAMTDISKUSSION 45

die dadurch entstehende genetische Instabilität von Produktionsstämmen, wie sie bei Hochdurchsatz-Verfahren und zufälliger Mutagenese auftreten, wird dabei vermieden (Schoustra et al. 2010). Die sexuelle Fortpflanzung erlaubt somit die Rekombination interessanter und positiver Eigenschaften ohne weitere Mutationen einzubringen und bietet so auch die Möglichkeit, die Fitness industrieller Stämme wiederherzustellen (Hurst und Peck 1996, Zeyl und Bell 1997, Goddard und Hayes 2007, Schoustra et al. 2010). Ein weiterer Vorteil ist, dass Resistenzmarker gegen Antibiotika und Mutationen, wie die Deletion des ku70-Gens, die für die Steigerung der homologen Rekombinationsrate in Pilzstämme eingebracht wurde (Hoff et al. 2010b), durch das Kreuzen wieder entfernt werden können. Der sexuelle Zyklus in P. chrysogenum ermöglicht zudem die Anwendung klassischer Genetik. Somit eröffnet die Induktion des sexuellen Zyklus in P. chrysogenum zahlreiche Anwendungsmöglichkeiten für die Industrie und Forschung und trägt dazu bei, die sexuelle Entwicklung von Ascomyceten weiter aufzuklären.

VI ZUSAMMENFASSUNG 46

VI. ZUSAMMENFASSUNG Der Hyphenpilz Penicillium chrysogenum hat aufgrund seiner Produktion des β-Lactam-Antibiotikums Penicillin eine hohe biotechnologische Relevanz. Daher ist die gezielte Stammoptimierung mit der Steigerung der Syntheseleistung und der Verbesserung des Wachstumsverhaltens während der Fermentation von großem Interesse. In dieser Arbeit sollten die Beteiligung der durch die Kreuzungstypgene kodierten Transkriptionsfaktoren MAT1-1-1 und MAT1-2-1 an den regulatorischen Netzwerken des Sekundärmetabolismus und der Morphologie aufgeklärt und der sexuelle Zyklus in P. chrysogenum induziert, sowie rekombinante Ascosporen molekulargenetisch analysiert werden. Funktionelle Analysen beider Kreuzungstyp-Loci zeigten einen Einfluss auf die sexuelle Entwicklung, die Penicillin-Biosynthese, die asexuelle Entwicklung und die Morphologie. Dabei wirken die beiden Kreuzungstyp-Proteine nicht redundant, sondern kontrollieren spezifisch verschiedenste Prozesse. MAT1-1-1 agiert als positiver Regulator der Penicillin-Biosynthese und des polaren Hyphenwachstums, während die asexuelle Sporulation reprimiert wird. MAT1-2-1 hingegen wirkt als Aktivator der asexuellen Sporenkeimung und beeinflusst die Agglomeration und Oberflächenstruktur der Konidiosporen. Gleichzeitig wirkt er als Repressor des polaren Hyphenwachstums und der Licht-abhängigen Konidienbildung. Dabei haben die Kreuzungstyp- Transkriptionsfaktoren ihre bekannte Funktion als Regulatoren der sexuellen Entwicklung nicht verloren, so dass durch das Ansetzen von Kreuzungen der sexuelle Zyklus in P. chrysogenum induziert werden konnte. Über RFLP-Analysen und Genom- Sequenzierungen konnte der Nachweis erbracht werden, dass die Nachkommen dieser Kreuzungen genetisch rekombinant sind. Zudem konnten durch Kreuzungen die Genome von Wildtyp-Stämmen und Produktionsstämmen angepasst und die Fertilität gesteigert werden. Im Rahmen dieser Arbeit konnte die Funktion der Kreuzungstypgene in P. chrysogenum aufgeklärt und mit biotechnologisch relevanten Prozessen in Verbindung gebracht werden. Des Weiteren konnte der sexuelle Zyklus mit der Erzeugung rekombinanter Ascosporen in P. chrysogenum induziert werden. Dies eröffnet die Möglichkeit, sexuelle Kreuzungen für die gezielte Stammoptimierung von P. chrysogenum einzusetzen und so Stämme zu erzeugen, die für die Industrie relevante Eigenschaften vereinen. VII SUMMARY 47

VII. SUMMARY The filamentous fungus Penicillium chrysogenum is the main industrial producer of the β-lactam antibiotic penicillin. Thus, directed strain improvement to increase penicillin biosynthesis and optimize morphological features for fermentation processes is of particular interest. The aim of this work was to explore the involvement of the mating- type locus-encoded transcription factors MAT1-1-1 and MAT1-2-1 in secondary metabolism and morphology; and further the induction of the sexual life cycle in P. chrysogenum and the verification of sexual recombination in the derived ascospore progeny on the molecular level. Functional analyses provided evidence that both mating-type loci control sexual mating and also a wide range of other developmental processes like penicillin biosynthesis, asexual sporulation and hyphal morphology. However, the mating-type proteins are not redundant but rather control different aspects of the same processes. MAT1-1-1 acts as a positive regulator of penicillin biosynthesis and polar hyphal growth, whereas it represses asexual sporulation. On the other hand, MAT1-2-1 is an activator of asexual spore germination and influences agglutination and surface properties of conidiospores. At the same time, MAT1-2-1 acts as a repressor of polar hyphal growth and light- dependent asexual sporulation. However, both mating-type transcription factors maintained their functions in regulating sexual development. Crossing of strains with opposite mating types led to the induction of a sexual life cycle with the formation of fruiting bodies in P. chrysogenum. Using RFLP analysis and whole-genome sequencing, it was demonstrated that the progeny of crosses were genetically recombinant. In addition, genomes of wild-type and production strains were adapted by sexual recombination, thereby leading to an increase of fertility. This work revealed hitherto unknown regulatory functions of the mating-type genes in P. chrysogenum that are related to developmental processes of biotechnological relevance like penicillin biosynthesis and pellet morphology. Furthermore, the sexual cycle of P. chrysogenum was induced, resulting in recombinant ascospore progeny even in production strains. Thus, the use of sexual recombination will be a valuable tool for strain improvement to generate industrial strains with novel characteristics of biotechnological importance.

VIII LITERATUR 48

VIII. LITERATUR

Aanen DK, Hoekstra RF (2007) The evolution of obligate mutualism: if you can't beat 'em, join 'em. Trends Ecol Evol 22: 506-509

Adams TH, Boylan MT, Timberlake WE (1988) brlA is necessary and sufficient to direct conidiophore development in Aspergillus nidulans. Cell 54: 353-362

Adams TH, Wieser JK, Yu JH (1998) Asexual sporulation in Aspergillus nidulans. Microbiol Mol Biol Rev 62: 35-54

Aguirre J (1993) Spatial and temporal controls of the Aspergillus brlA developmental regulatory gene. Mol Microbiol 8: 211-218

Arabatzis M, Velegraki A (2013) Sexual reproduction in the opportunistic human pathogen Aspergillus terreus. Mycologia 105: 71-79

Aramayo R, Timberlake WE (1993) The Aspergillus nidulans yA gene is regulated by abaA. Embo J 12: 2039-2048

Arnaise S, Zickler D, Glass NL (1993) Heterologous expression of mating-type genes in filamentous fungi. Proc Natl Acad Sci U S A 90: 6616-6620

Arnaise S, Debuchy R, Picard M (1997) What is a bona fide mating-type gene? Internuclear complementation of mat mutants in Podospora anserina. Mol Gen Genet 256: 169-178

Arnaise S, Zickler D, Le Bilcot S, Poisier C, Debuchy R (2001) Mutations in mating- type genes of the heterothallic fungus Podospora anserina lead to self-fertility. Genetics 159: 545-556

Backus MP, Stauffer JF, Johnson MJ (1946) Penicillin yields from new mold strains. J Am Chem Soc 68: 152

Backus MP, Stauffer JF (1955) The production and selection of a family of strains in Penicillium chrysogenum. Mycologia 47: 429-463

Bakshi M, Oelmuller R (2014) WRKY transcription factors: Jack of many trades in plants. Plant Signal Behav 9: e27700

Bardwell L (2005) A walk-through of the yeast mating pheromone response pathway. Peptides 26: 339-350

Barry DJ, Chan C, Williams GA (2009) Morphological quantification of filamentous fungal development using membrane immobilization and automatic image analysis. J Ind Microbiol Biotechnol 36: 787-800

VIII LITERATUR 49

Bayram Ö, Biesemann C, Krappmann S, Galland P, Braus GH (2008a) More than a repair enzyme: Aspergillus nidulans photolyase-like CryA is a regulator of sexual development. Mol Biol Cell 19: 3254-3262

Bayram Ö, Krappmann S, Ni M, Bok JW, Helmstaedt K, Valerius O, Braus- Stromeyer S, Kwon NJ, Keller NP, Yu JH, Braus GH (2008b) VelB/VeA/LaeA complex coordinates light signal with fungal development and secondary metabolism. Science 320: 1504-1506

Bayram Ö, Braus GH, Fischer R, Rodriguez-Romero J (2010) Spotlight on Aspergillus nidulans photosensory systems. Fungal Genet Biol 47: 900-908

Beever RE, Dempsey GP (1978) Function of rodlets on the surface of fungal spores. Nature 272: 608-610

Benjamin CR (1955) Ascocarps of Aspergillus and Penicillium. Mycologia 47: 669- 687

Berbee ML, Taylor JW (1993) Dating the evolutionary radiations of the true fungi. Can J Bot 71: 1114-1127

Berbee ML, Yoshimura A, Sugiyama J, Taylor JW (1995) Is Penicillium monophyletic? An evaluation of phylogeny in the family Trichomaceae from 18S, 5.8 S and ITS ribosomal DNA sequence data. Mycologia 87: 210-222

Bistis GN (1998) Physiological heterothallism and sexuality in Euascomycetes: A partial history. Fungal Genet Biol 23: 213-222

Blakeslee AF (1904) Zygospore formation a sexual process. Science 19: 864-866

Blee E (2002) Impact of phyto-oxylipins in plant defense. Trends Plant Sci 7: 315-322

Blumenstein A, Vienken K, Tasler R, Purschwitz J, Veith D, Frankenberg-Dinkel N, Fischer R (2005) The Aspergillus nidulans phytochrome FphA represses sexual development in red light. Curr Biol 15: 1833-1838

Bodor Á, Nagygyörgy E, Hornok L (2012) Inactivation of the mat1-2-1 mating type gene results in reduced asexual sporulation and con10 expression in Fusarium verticillioides. Acta Phytopathologica et Entomologica Hungarica 47: 7-15

Böhm J (2010) Funktion des MAT1-1 Locus im -Laktam-Antibiotika-Produzenten Penicillium chrysogenum. Masterarbeit, Ruhr-Universität Bochum

Bölker M, Urban M, Kahmann R (1992) The a mating type locus of U. maydis specifies cell signaling components. Cell 68: 441-450

Booth LN, Tuch BB, Johnson AD (2010) Intercalation of a new tier of transcription regulation into an ancient circuit. Nature 468: 959-963 VIII LITERATUR 50

Borkovich KA, Alex LA, Yarden O, Freitag M, Turner GE, Read ND, Seiler S, Bell-Pedersen D, Paietta J, Plesofsky N, Plamann M, Goodrich-Tanrikulu M, Schulte U, Mannhaupt G, Nargang FE, Radford A, Selitrennikoff C, Galagan JE, Dunlap JC, Loros JJ, Catcheside D, Inoue H, Aramayo R, Polymenis M, Selker EU, Sachs MS, Marzluf GA, Paulsen I, Davis R, Ebbole DJ, Zelter A, Kalkman ER, O'Rourke R, Bowring F, Yeadon J, Ishii C, Suzuki K, Sakai W, Pratt R (2004) Lessons from the genome sequence of Neurospora crassa: tracing the path from genomic blueprint to multicellular organism. Microbiol Mol Biol Rev 68: 1-108

Brading PA, Verstappen EC, Kema GH, Brown JK (2002) A gene-for-gene relationship between wheat and Mycosphaerella graminicola, the Septoria tritici blotch pathogen. Phytopathology 92: 439-445

Brakhage AA, Spröte P, Al-Abdallah Q, Gehrke A, Plattner H, Tuncher A (2004) Regulation of penicillin biosynthesis in filamentous fungi. Adv Biochem Eng Biotechnol 88: 45-90

Brakhage AA (2013) Regulation of fungal secondary metabolism. Nat Rev Microbiol 11: 21-32

Brandt S, von Stetten D, Gunther M, Hildebrandt P, Frankenberg-Dinkel N (2008) The fungal phytochrome FphA from Aspergillus nidulans. J Biol Chem 283: 34605-34614

Braumann I, van den Berg M, Kempken F (2008) Repeat induced point mutation in two asexual fungi, Aspergillus niger and Penicillium chrysogenum. Curr Genet 53: 287-297

Braus GH, Irniger S, Bayram Ö (2010) Fungal development and the COP9 signalosome. Curr Opin Microbiol 13: 672-676

Brown LS (2004) Fungal rhodopsins and opsin-related proteins: eukaryotic homologues of bacteriorhodopsin with unknown functions. Photochem Photobiol Sci 3: 555-565

Bruhn L, Sprague GF, Jr. (1994) MCM1 point mutants deficient in expression of - specific genes: residues important for interaction with 1. Mol Cell Biol 14: 2534-2544

Burnett JH (2003) Fungal populations and species. Oxford University Press Inc., New York

Butler G, Kenny C, Fagan A, Kurischko C, Gaillardin C, Wolfe KH (2004) Evolution of the MAT locus and its Ho endonuclease in yeast species. Proc Natl Acad Sci U S A 101: 1632-1637

VIII LITERATUR 51

Butler G (2007) The evolution of MAT: the ascomycetes. In: Heitman J, Kronstad JW, Taylor JW, Casselton LA (eds.) Sex in fungi: molecular determination and evolutionary implications. ASM Press, Washington, D.C. pp. 3-18

Calvo AM, Gardner HW, Keller NP (2001) Genetic connection between fatty acid metabolism and sporulation in Aspergillus nidulans. J Biol Chem 276: 25766- 25774

Calvo AM (2008) The VeA regulatory system and its role in morphological and chemical development in fungi. Fungal Genet Biol 45: 1053-1061

Casselton LA, Olesnicky NS (1998) Molecular genetics of mating recognition in basidiomycete fungi. Microbiol Mol Biol Rev 62: 55-70

Champe SP, Rao P, Chang A (1987) An endogenous inducer of sexual development in Aspergillus nidulans. J Gen Microbiol 133: 1383-1387

Champe SP, el-Zayat AA (1989) Isolation of a sexual sporulation hormone from Aspergillus nidulans. J Bacteriol 171: 3982-3988

Chang S, Staben C (1994) Directed replacement of mt A by mt a-1 effects a mating type switch in Neurospora crassa. Genetics 138: 75-81

Chen CH, Dunlap JC, Loros JJ (2010) Neurospora illuminates fungal photoreception. Fungal Genet Biol 47: 922-929

Clarkson JP, Staveley J, Phelps K, Young CS, Whipps JM (2003) Ascospore release and survival in Sclerotinia sclerotiorum. Mycol Res 107: 213-222

Clement JA, Porter R, Butt TM, Beckett A (1994) The role of hydrophobicity in attachment of urediniospores and sporelings of Uromyces viciae-fabae. Mycol Res 98: 1217-1228

Clutterbuck AJ (1969) A mutational analysis of conidial development in Aspergillus nidulans. Genetics 63: 317-327

Coppin E, Debuchy R, Arnaise S, Picard M (1997) Mating types and sexual development in filamentous ascomycetes. Microbiol Mol Biol Rev 61: 411-428

Covert SF, Aoki T, O'Donnell K, Starkey D, Holliday A, Geiser DM, Cheung F, Town C, Strom A, Juba J, Scandiani M, Yang XB (2007) Sexual reproduction in the soybean sudden death syndrome pathogen Fusarium tucumaniae. Fungal Genet Biol 44: 799-807

De Carli L, Larizza L (1988) Griseofulvin. Mutat Res 195: 91-126

Debuchy R (1999) Internuclear recognition: A possible connection between euascomycetes and homobasidiomycetes. Fungal Genet Biol 27: 218-223 VIII LITERATUR 52

Debuchy R, Turgeon B (2006) Mating-type structure, evolution, and function in Euascomycetes. In: Growth, Differentiation and Sexuality. Springer, pp. 293-323

Debuchy R, Berteaux-Lecellier V, Silar P (2010) Mating systems and sexual morphogenesis in ascomycetes. In: Borkovich KA, Ebbole DJ (eds.) Cellular and molecular biology of filamentous fungi. ASM Press, Washington, D.C. pp. 501–535

Demain AL (2009) Antibiotics: natural products essential to human health. Med Res Rev 29: 821-842

Dietrich FS, Voegeli S, Kuo S, Philippsen P (2013) Genomes of Ashbya fungi isolated from insects reveal four mating-type loci, numerous translocations, lack of transposons, and distinct gene duplications. G3 (Bethesda) 3: 1225-1239

Dolan JW, Fields S (1991) Cell-type-specific transcription in yeast. Biochim Biophys Acta 1088: 155-169

Druzhinina IS, Schmoll M, Seiboth B, Kubicek CP (2006) Global carbon utilization profiles of wild-type, mutant, and transformant strains of Hypocrea jecorina. Appl Environ Microbiol 72: 2126-2133

Duntze W, Betz R, Nientiedt M (1994) Pheromones in yeasts. In: Growth, Differentiation and Sexuality. Springer, pp. 381-399

Dyer PS, Furneaux PA, Douhan G, Murray TD (2001) A multiplex PCR test for determination of mating type applied to the plant pathogens Tapesia yallundae and Tapesia acuformis. Fungal Genet Biol 33: 173-180

Dyer PS, Paoletti M, Archer DB (2003) Genomics reveals sexual secrets of Aspergillus. Microbiology 149: 2301-2303

Dyer PS (2007) Sexual reproduction and significance of MAT in the Aspergilli. In: Heitman J, Kronstad JW, Taylor JW, Casselton LA (eds.) Sex in fungi: molecular determination and evolutionary implications. ASM Press, Washington, D.C pp. 123-142

Dynesen J, Nielsen J (2003) Surface hydrophobicity of Aspergillus nidulans conidiospores and its role in pellet formation. Biotechnol Prog 19: 1049-1052

Elander R (1983) Strain improvement and preservation of β-lactam-producing microorganisms. In: Antibiotics. Springer, pp. 97-146

Erixon K, Cedervall B (1995) Linear induction of DNA double-strand breakage with X-ray dose, as determined from DNA fragment size distribution. Radiat Res 142: 153-162

VIII LITERATUR 53

Felsenstein J (1974) The evolutionary advantage of recombination. Genetics 78: 737- 756

Ferreira AV, An Z, Metzenberg RL, Glass NL (1998) Characterization of mat A-2, mat A-3 and matA mating-type mutants of Neurospora crassa. Genetics 148: 1069-1079

Fleming A (1929) On the antibacterial action of cultures of a Penicillium, with special reference to their use in the isolation of B. influenzae. Br J Exp Pathol 10: 226- 236

Fomina M, Gadd GM (2002) Influence of clay minerals on the morphology of fungal pellets. Mycol Res 106: 107-117

Fraser JA, Heitman J (2005) Chromosomal sex-determining regions in animals, plants and fungi. Curr Opin Genet Dev 15: 645-651

Fraser JA, Stajich JE, Tarcha EJ, Cole GT, Inglis DO, Sil A, Heitman J (2007) Evolution of the mating type locus: insights gained from the dimorphic primary fungal pathogens Histoplasma capsulatum, Coccidioides immitis, and Coccidioides posadasii. Eukaryot Cell 6: 622-629

Frisvad JC, Samson RA (2004) Polyphasic taxonomy of Penicillium subgenus Penicillium. A guide to identification of food and air-borne terverticillate Penicillia and their mycotoxins. Stud Mycol 49: 1-174

Galagan JE, Selker EU (2004) RIP: the evolutionary cost of genome defense. Trends Genet 20: 417-423

Galagan JE, Calvo SE, Cuomo C, Ma LJ, Wortman JR, Batzoglou S, Lee SI, Basturkmen M, Spevak CC, Clutterbuck J, Kapitonov V, Jurka J, Scazzocchio C, Farman M, Butler J, Purcell S, Harris S, Braus GH, Draht O, Busch S, D'Enfert C, Bouchier C, Goldman GH, Bell-Pedersen D, Griffiths-Jones S, Doonan JH, Yu J, Vienken K, Pain A, Freitag M, Selker EU, Archer DB, Penalva MA, Oakley BR, Momany M, Tanaka T, Kumagai T, Asai K, Machida M, Nierman WC, Denning DW, Caddick M, Hynes M, Paoletti M, Fischer R, Miller B, Dyer P, Sachs MS, Osmani SA, Birren BW (2005) Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae. Nature 438: 1105-1115

Galgoczy DJ, Cassidy-Stone A, Llinas M, O'Rourke SM, Herskowitz I, DeRisi JL, Johnson AD (2004) Genomic dissection of the cell-type-specification circuit in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 101: 18069-18074

Geiser DM, Pitt JI, Taylor JW (1998) Cryptic speciation and recombination in the aflatoxin-producing fungus Aspergillus flavus. Proc Natl Acad Sci U S A 95: 388-393

VIII LITERATUR 54

Geiser DM, Dorner JW, Horn BW, Taylor JW (2000) The phylogenetics of mycotoxin and sclerotium production in Aspergillus flavus and Aspergillus oryzae. Fungal Genet Biol 31: 169-179

Girardin H, Paris S, Rault J, Bellon-Fontaine MN, Latge JP (1999) The role of the rodlet structure on the physicochemical properties of Aspergillus conidia. Lett Appl Microbiol 29: 364-369

Glass NL, Grotelueschen J, Metzenberg RL (1990) Neurospora crassa A mating-type region. Proc Natl Acad Sci U S A 87: 4912-4916

Glass NL, Kuldau GA (1992) Mating type and vegetative incompatibility in filamentous ascomycetes. Annu Rev Phytopathol 30: 201-224

Goddard ME, Hayes BJ (2007) Genomic selection. J Anim Breed Genet 124: 323-330

Goddard MR, Godfray HC, Burt A (2005) Sex increases the efficacy of natural selection in experimental yeast populations. Nature 434: 636-640

Groenewald M, Groenewald JZ, Harrington TC, Abeln EC, Crous PW (2006) Mating type gene analysis in apparently asexual Cercospora species is suggestive of cryptic sex. Fungal Genet Biol 43: 813-825

Haber JE (2012) Mating-type genes and MAT switching in Saccharomyces cerevisiae. Genetics 191: 33-64

Hagen DC, Bruhn L, Westby CA, Sprague GF, Jr. (1993) Transcription of -specific genes in Saccharomyces cerevisiae: DNA sequence requirements for activity of the coregulator 1. Mol Cell Biol 13: 6866-6875

Hamann A, Feller F, Osiewacz HD (2000) The degenerate DNA transposon Pat and repeat-induced point mutation (RIP) in Podospora anserina. Mol Gen Genet 263: 1061-1069

Hawksworth D, Kirk P, Sutton B, Pegler D (1995) Ainsworth & Bisby s Dictionary of the fungi. CAB International, Wallingford, UK

Hawksworth DL, Rossman AY (1997) Where are all the undescribed fungi? Phytopathology 87: 888-891

Hawksworth DL (2011) A new dawn for the naming of fungi: impacts of decisions made in Melbourne in July 2011 on the future publication and regulation of fungal names. IMA Fungus 2: 155-162

Hawksworth DL, Crous PW, Redhead SA, Reynolds DR, Samson RA, Seifert KA, Taylor JW, Wingfield MJ, Abaci Ö, Aime C (2011) The Amsterdam declaration on fungal nomenclature. IMA Fungus 2: 105-112

VIII LITERATUR 55

Heitman J (2006) Sexual reproduction and the evolution of microbial pathogens. Curr Biol 16: 711-725

Henk DA, Eagle CE, Brown K, Van Den Berg MA, Dyer PS, Peterson SW, Fisher MC (2011) Speciation despite globally overlapping distributions in Penicillium chrysogenum: the population genetics of Alexander Fleming's lucky fungus. Mol Ecol 20: 4288-4301

Hennebert GL, Weresub L (1977) Terms for states and forms of fungi, their names and types. Mycotaxon 6: 207-211

Hibbett DS, Binder M, Bischoff JF, Blackwell M, Cannon PF, Eriksson OE, Huhndorf S, James T, Kirk PM, Lucking R, Thorsten Lumbsch H, Lutzoni F, Matheny PB, McLaughlin DJ, Powell MJ, Redhead S, Schoch CL, Spatafora JW, Stalpers JA, Vilgalys R, Aime MC, Aptroot A, Bauer R, Begerow D, Benny GL, Castlebury LA, Crous PW, Dai YC, Gams W, Geiser DM, Griffith GW, Gueidan C, Hawksworth DL, Hestmark G, Hosaka K, Humber RA, Hyde KD, Ironside JE, Koljalg U, Kurtzman CP, Larsson KH, Lichtwardt R, Longcore J, Miadlikowska J, Miller A, Moncalvo JM, Mozley-Standridge S, Oberwinkler F, Parmasto E, Reeb V, Rogers JD, Roux C, Ryvarden L, Sampaio JP, Schussler A, Sugiyama J, Thorn RG, Tibell L, Untereiner WA, Walker C, Wang Z, Weir A, Weiss M, White MM, Winka K, Yao YJ, Zhang N (2007) A higher-level phylogenetic classification of the fungi. Mycol Res 111: 509-547

Hicks J, Strathern JN, Klar AJ (1979) Transposable mating type genes in Saccharomyces cerevisiae. Nature 282: 478-473

Hoff B, Pöggeler S, Kück U (2008) Eighty years after its discovery, Fleming's Penicillium strain discloses the secret of its sex. Eukaryot Cell 7: 465-470

Hoff B, Kamerewerd J, Sigl C, Mitterbauer R, Zadra I, Kürnsteiner H, Kück U (2010a) Two components of a velvet-like complex control hyphal morphogenesis, conidiophore development, and penicillin biosynthesis in Penicillium chrysogenum. Eukaryot Cell 9: 1236-1250

Hoff B, Kamerewerd J, Sigl C, Zadra I, Kück U (2010b) Homologous recombination in the antibiotic producer Penicillium chrysogenum: strain Pcku70 shows up- regulation of genes from the HOG pathway. Appl Microbiol Biotechnol 85: 1081-1094

Horn BW, Moore GG, Carbone I (2009a) Sexual reproduction in Aspergillus flavus. Mycologia 101: 423-429

Horn BW, Ramirez-Prado JH, Carbone I (2009b) The sexual state of Aspergillus parasiticus. Mycologia 101: 275-280

VIII LITERATUR 56

Horn BW, Moore GG, Carbone I (2011) Sexual reproduction in aflatoxin-producing Aspergillus nomius. Mycologia 103: 174-183

Horn BW, Olarte RA, Peterson SW, Carbone I (2013) Sexual reproduction in Aspergillus tubingensis from section Nigri. Mycologia 105: 1153-1163

Houbraken J, Samson RA (2011) Phylogeny of Penicillium and the segregation of Trichocomaceae into three families. Stud Mycol 70: 1-51

Hurst LD, Peck JR (1996) Recent advances in understanding of the evolution and maintenance of sex. Trends Ecol Evol 11: 46-52

Idnurm A, Walton FJ, Floyd A, Heitman J (2008) Identification of the sex genes in an early diverged fungus. Nature 451: 193-196

Jacobsen S, Wittig M, Pöggeler S (2002) Interaction between mating-type proteins from the homothallic fungus Sordaria macrospora. Curr Genet 41: 150-158

James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ, Celio G, Gueidan C, Fraker E, Miadlikowska J, Lumbsch HT, Rauhut A, Reeb V, Arnold AE, Amtoft A, Stajich JE, Hosaka K, Sung GH, Johnson D, O'Rourke B, Crockett M, Binder M, Curtis JM, Slot JC, Wang Z, Wilson AW, Schussler A, Longcore JE, O'Donnell K, Mozley-Standridge S, Porter D, Letcher PM, Powell MJ, Taylor JW, White MM, Griffith GW, Davies DR, Humber RA, Morton JB, Sugiyama J, Rossman AY, Rogers JD, Pfister DH, Hewitt D, Hansen K, Hambleton S, Shoemaker RA, Kohlmeyer J, Volkmann-Kohlmeyer B, Spotts RA, Serdani M, Crous PW, Hughes KW, Matsuura K, Langer E, Langer G, Untereiner WA, Lucking R, Budel B, Geiser DM, Aptroot A, Diederich P, Schmitt I, Schultz M, Yahr R, Hibbett DS, Lutzoni F, McLaughlin DJ, Spatafora JW, Vilgalys R (2006) Reconstructing the early evolution of fungi using a six-gene phylogeny. Nature 443: 818-822

Jones E (1994) Fungal adhesion. Mycol Res 98: 961-981

Kahmann R, Bölker M (1996) Self/nonself recognition in fungi: old mysteries and simple solutions. Cell 85: 145-148

Kämper J, Reichmann M, Romeis T, Bölker M, Kahmann R (1995) Multiallelic recognition: nonself-dependent dimerization of the bE and bW homeodomain proteins in Ustilago maydis. Cell 81: 73-83

Kasimiotis H, Myers MA, Argentaro A, Mertin S, Fida S, Ferraro T, Olsson J, Rowley MJ, Harley VR (2000) Sex-determining region Y-related protein SOX13 is a diabetes autoantigen expressed in pancreatic islets. Diabetes 49: 555-561

VIII LITERATUR 57

Kato N, Brooks W, Calvo AM (2003) The expression of sterigmatocystin and penicillin genes in Aspergillus nidulans is controlled by veA, a gene required for sexual development. Eukaryot Cell 2: 1178-1186

Keller NP, Turner G, Bennett JW (2005) Fungal secondary metabolism - from biochemistry to genomics. Nat Rev Microbiol 3: 937-947

Kerenyi Z, Moretti A, Waalwijk C, Olah B, Hornok L (2004) Mating type sequences in asexually reproducing Fusarium species. Appl Environ Microbiol 70: 4419- 4423

Kirk P, Cannon P, Minter D, Stalpers J (2008) Ainsworth and Bisby´s Dictionary of the Fungi. CABI, Wallingford, UK

Kistler HC, Miao VP (1992) New modes of genetic change in filamentous fungi. Annu Rev Phytopathol 30: 131-153

Klar AJ (1987) The mother-daughter mating type switching asymmetry of budding yeast is not conferred by the segregation of parental HO gene DNA strands. Genes Dev 1: 1059-1064

Klix V, Nowrousian M, Ringelberg C, Loros JJ, Dunlap JC, Pöggeler S (2010) Functional characterization of MAT1-1-specific mating-type genes in the homothallic ascomycete Sordaria macrospora provides new insights into essential and nonessential sexual regulators. Eukaryot Cell 9: 894-905

Kostriken R, Strathern JN, Klar AJ, Hicks JB, Heffron F (1983) A site-specific endonuclease essential for mating-type switching in Saccharomyces cerevisiae. Cell 35: 167-174

Kronstad JW, Leong SA (1989) Isolation of two alleles of the b locus of Ustilago maydis. Proc Natl Acad Sci U S A 86: 978-982

Kronstad JW, Leong SA (1990) The b mating-type locus of Ustilago maydis contains variable and constant regions. Genes Dev 4: 1384-1395

Kronstad JW, Staben C (1997) Mating type in filamentous fungi. Annu Rev Genet 31: 245-276

Krull R, Wucherpfennig T, Esfandabadi ME, Walisko R, Melzer G, Hempel DC, Kampen I, Kwade A, Wittmann C (2013) Characterization and control of fungal morphology for improved production performance in biotechnology. J Biotechnol 163: 112-123

Kück U, Böhm J (2013) Mating type genes and cryptic sexuality as tools for genetically manipulating industrial molds. Appl Microbiol Biotechnol 97: 9609- 9620

VIII LITERATUR 58

Kück U, Bloemendal S, Teichert I (2014) Putting fungi to work: harvesting a cornucopia of drugs, toxins, and antibiotics. PLoS Pathog 10: e1003950

Kuhls K, Lieckfeldt E, Samuels GJ, Kovacs W, Meyer W, Petrini O, Gams W, Borner T, Kubicek CP (1996) Molecular evidence that the asexual industrial fungus Trichoderma reesei is a clonal derivative of the ascomycete Hypocrea jecorina. Proc Natl Acad Sci U S A 93: 7755-7760

Kurjan J (1993) The pheromone response pathway in Saccharomyces cerevisiae. Annu Rev Genet 27: 147-179

Leberer E, Thomas DY, Whiteway M (1997) Pheromone signalling and polarized morphogenesis in yeast. Curr Opin Genet Dev 7: 59-66

Lein J (1986) The Panlabs penicillin strain improvement program. In: Vanek Z, Hostalek Z (eds.) Overproduction of microbial metabolites; strain improvement and process control strategies. Butterworth Publishers, Boston pp. 105-139

Linde CC, Zala M, Ceccarelli S, McDonald BA (2003) Further evidence for sexual reproduction in Rhynchosporium secalis based on distribution and frequency of mating-type alleles. Fungal Genet Biol 40: 115-125

LoBuglio K, Taylor J (1993) Molecular phylogeny of Talaromyces and Penicillium species in subgenus Biverticillium. In: R. RD, W. TJ (eds.) The fungal holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics. CAB International, Wallingford, United Kingdom pp. 115-119

Logue ME, Wong S, Wolfe KH, Butler G (2005) A genome sequence survey shows that the pathogenic yeast Candida parapsilosis has a defective MTLa1 allele at its mating type locus. Eukaryot Cell 4: 1009-1017

Malloch D, Cain R (1972) The Trichocomataceae: ascomycetes with Aspergillus, Paecilomyces, and Penicillium imperfect states. Can J Bot 50: 2613-2628

Malloch D, Cain R (1973) The Trichocomaceae (ascomycetes): synonyms in recent publications. Can J Bot 51: 1647-1648

Martinez D, Berka RM, Henrissat B, Saloheimo M, Arvas M, Baker SE, Chapman J, Chertkov O, Coutinho PM, Cullen D, Danchin EG, Grigoriev IV, Harris P, Jackson M, Kubicek CP, Han CS, Ho I, Larrondo LF, de Leon AL, Magnuson JK, Merino S, Misra M, Nelson B, Putnam N, Robbertse B, Salamov AA, Schmoll M, Terry A, Thayer N, Westerholm-Parvinen A, Schoch CL, Yao J, Barabote R, Nelson MA, Detter C, Bruce D, Kuske CR, Xie G, Richardson P, Rokhsar DS, Lucas SM, Rubin EM, Dunn-Coleman N, Ward M, Brettin TS (2008) Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina). Nat Biotechnol 26: 553-560

VIII LITERATUR 59

McIntyre M, Eade JK, Cox PW, Thomas CR, White S, Berry DR, McNeil B (2001) Quantification of autolysis in Penicillium chrysogenum by semiautomated image analysis. Can J Microbiol 47: 315-321

Metzenberg RL (1990) The role of similarity and difference in fungal mating. Genetics 125: 457-462

Metzenberg RL, Glass NL (1990) Mating type and mating strategies in Neurospora. Bioessays 12: 53-59

Milgroom MG (1996) Recombination and the multilocus structure of fungal populations. Annu Rev Phytopathol 34: 457-477

Miller LK, Brooks R (2005) The effects of genotype, age, and social environment on male ornamentation, mating behavior, and attractiveness. Evolution 59: 2414- 2425

Molowitz R, Bahn M, Hock B (1976) The control of fruiting body formation in the ascomycete Sordaria macrospora Auersw. by arginine and biotin: a two-factor analysis. Planta 128: 143-148

Monroy F, Sheppard DC (2005) Taf1: a class II transposon of Aspergillus fumigatus. Fungal Genet Biol 42: 638-645

Montiel MD, Lee HA, Archer DB (2006) Evidence of RIP (repeat-induced point mutation) in transposase sequences of Aspergillus oryzae. Fungal Genet Biol 43: 439-445

Nasmyth KA (1982) The regulation of yeast mating-type chromatin structure by SIR: an action at a distance affecting both transcription and transposition. Cell 30: 567-578

Nauta MJ, Hoekstra RF (1992) Evolution of reproductive systems in filamentous ascomycetes. II. Evolution of hermaphroditism and other reproductive strategies. Heredity (Edinb) 68 ( Pt 6): 537-546

Nelson MA (1996) Mating systems in ascomycetes: a romp in the sac. Trends Genet 12: 69-74

Ni M, Feretzaki M, Sun S, Wang X, Heitman J (2011) Sex in fungi. Annu Rev Genet 45: 405-430

Ni M, Feretzaki M, Li W, Floyd-Averette A, Mieczkowski P, Dietrich FS, Heitman J (2013) Unisexual and heterosexual meiotic reproduction generate aneuploidy and phenotypic diversity de novo in the yeast Cryptococcus neoformans. PLoS Biol 11: e1001653

VIII LITERATUR 60

Nielsen J (1997) Physiological engineering aspects of Penicillium chrysogenum. World Scientific Publishing, Singapore

Norvell LL (2011) Fungal nomenclature. 1. Melbourne approves a new Code. Mycotaxon 116: 481-490

Nowrousian M, Kück U (2006) Comparative gene expression analysis of fruiting body development in two filamentous fungi. FEMS Microbiol Lett 257: 328-335

O'Gorman CM, Fuller HT, Dyer PS (2009) Discovery of a sexual cycle in the opportunistic fungal pathogen Aspergillus fumigatus. Nature 457: 471-474

Ogawa H, Sugiyama J (2000) Evolutionary relationships of the cleistothecial genera with Penicillium, Geosmithia, Merimbla and Sarophorum anamorphs as inferred from 18S rDNA sequence divergence. In: Samson R, Pitt J (eds.) Integration of Modern Taxonomic Methods for Penicillium and Aspergillus. Harwood Academic Publishers, Amsterdam pp. 149-161

Olarte RA, Horn BW, Dorner JW, Monacell JT, Singh R, Stone EA, Carbone I (2012) Effect of sexual recombination on population diversity in aflatoxin production by Aspergillus flavus and evidence for cryptic heterokaryosis. Mol Ecol 21: 1453-1476

Orr G, Ghosh G, Roy K (1977) The genera Gymnascella, Arachniotus, and Pseudoarachniotus. Mycologia 126-163

Paoletti M, Rydholm C, Schwier EU, Anderson MJ, Szakacs G, Lutzoni F, Debeaupuis JP, Latge JP, Denning DW, Dyer PS (2005) Evidence for sexuality in the opportunistic fungal pathogen Aspergillus fumigatus. Curr Biol 15: 1242-1248

Paoletti M, Seymour FA, Alcocer MJ, Kaur N, Calvo AM, Archer DB, Dyer PS (2007) Mating type and the genetic basis of self-fertility in the model fungus Aspergillus nidulans. Curr Biol 17: 1384-1389

Park HS, Ni M, Jeong KC, Kim YH, Yu JH (2012) The role, interaction and regulation of the velvet regulator VelB in Aspergillus nidulans. PLoS One 7: e45935

Pel HJ, de Winde JH, Archer DB, Dyer PS, Hofmann G, Schaap PJ, Turner G, de Vries RP, Albang R, Albermann K, Andersen MR, Bendtsen JD, Benen JA, van den Berg M, Breestraat S, Caddick MX, Contreras R, Cornell M, Coutinho PM, Danchin EG, Debets AJ, Dekker P, van Dijck PW, van Dijk A, Dijkhuizen L, Driessen AJ, d'Enfert C, Geysens S, Goosen C, Groot GS, de Groot PW, Guillemette T, Henrissat B, Herweijer M, van den Hombergh JP, van den Hondel CA, van der Heijden RT, van der Kaaij RM, Klis FM, Kools HJ, Kubicek CP, van Kuyk PA, Lauber J, Lu X, van der Maarel MJ, Meulenberg R, Menke H, Mortimer MA, Nielsen J, Oliver SG, Olsthoorn VIII LITERATUR 61

M, Pal K, van Peij NN, Ram AF, Rinas U, Roubos JA, Sagt CM, Schmoll M, Sun J, Ussery D, Varga J, Vervecken W, van de Vondervoort PJ, Wedler H, Wosten HA, Zeng AP, van Ooyen AJ, Visser J, Stam H (2007) Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513.88. Nat Biotechnol 25: 221-231

Peterson S (1993) Molecular genetic assessment of relatedness of Penicillium subgenus Penicillium. The Fungal Holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics 121-128

Peterson SW (2000) Phylogenetic analysis of Penicillium species based on ITS and LSU-rDNA nucleotide sequences. Integration of modern taxonomic methods for Penicillium and Aspergillus classification 163-178

Peterson SW (2008) Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 100: 205-226

Peterson SW, Horn BW (2009) Penicillium parvulum and Penicillium georgiense, sp. nov., isolated from the conidial heads of Aspergillus species. Mycologia 101: 71- 83

Philley ML, Staben C (1994) Functional analyses of the Neurospora crassa MT a-1 mating type polypeptide. Genetics 137: 715-722

Pitt J (1993) Speciation and evolution in Penicillium and related genera. The fungal holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics Wallingford, CAB International 113-117

Pitt JI (1974) A synoptic key to the genus Eupenicillium and to sclerotigenic Penicillium species. Can J Bot 52: 2231-2236

Pitt JI (1979) The genus Penicillium and its teleomorphic states Eupenicillium and Talaromyces. Academic Press, London

Pitt JI, Hocking AD (1997) Fungi and food spoilage Blackie Academic and Professional, London

Pitt JI, Samson RA, Frisvad JC (2000) List of accepted species and their synonyms in the family Trichocomaceae. In: Samson R, Pitt JI (eds.) Integration of Modern Taxonomic Methods for Penicillium and Aspergillus Classification. Harwood Academic Publishers, Amsterdam pp. 9-49

Pitt JI, Hocking AD (2009) Fungi and food spoilage. Springer, Dordrecht, Heidelberg, London, New York

Pöggeler S, Risch S, Kück U, Osiewacz HD (1997) Mating-type genes from the homothallic fungus Sordaria macrospora are functionally expressed in a heterothallic ascomycete. Genetics 147: 567-580 VIII LITERATUR 62

Pöggeler S (2000) Two pheromone precursor genes are transcriptionally expressed in the homothallic ascomycete Sordaria macrospora. Curr Genet 37: 403-411

Pöggeler S, Kück U (2000) Comparative analysis of the mating-type loci from Neurospora crassa and Sordaria macrospora: identification of novel transcribed ORFs. Mol Gen Genet 263: 292-301

Pöggeler S, Masloff S, Jacobsen S, Kück U (2000) Karyotype polymorphism correlates with intraspecific infertility in the homothallic ascomycete Sordaria macrospora. J Evol Biol 13: 281-289

Pöggeler S (2001) Mating-type genes for classical strain improvements of ascomycetes. Appl Microbiol Biotechnol 56: 589-601

Pöggeler S (2002) Genomic evidence for mating abilities in the asexual pathogen Aspergillus fumigatus. Curr Genet 42: 153-160

Pöggeler S, Nowrousian M, Kück U (2006a) Fruiting-body development in ascomycetes. In: Growth, Differentiation and Sexuality. Springer, pp. 325-355

Pöggeler S, Nowrousian M, Ringelberg C, Loros JJ, Dunlap JC, Kück U (2006b) Microarray and real-time PCR analyses reveal mating type-dependent gene expression in a homothallic fungus. Mol Genet Genomics 275: 492-503

Pöggeler S, Hoff B, Kück U (2008) Asexual cephalosporin C producer Acremonium chrysogenum carries a functional mating type locus. Appl Environ Microbiol 74: 6006-6016

Prosser J (1995) Kinetics of filamentous growth and branching. In: The growing fungus. Springer, pp. 301-318

Purschwitz J, Müller S, Kastner C, Schöser M, Haas H, Espeso EA, Atoui A, Calvo AM, Fischer R (2008) Functional and physical interaction of blue- and red-light sensors in Aspergillus nidulans. Curr Biol 18: 255-259

Pyrzak W, Miller KY, Miller BL (2008) Mating type protein Mat1-2 from asexual Aspergillus fumigatus drives sexual reproduction in fertile Aspergillus nidulans. Eukaryot Cell 7: 1029-1040

Raper CA, Raper JR (1966) Mutations modifying sexual morphogenesis in Schizophyllum. Genetics 54: 1151-1168

Raper CA (1983) Controls for development and differentiation of the dikaryon in basidiomycetes. In: Bennett JW, Ciegler A (eds.) Secondary metabolism and differentiation in fungi. Marcell Dekker, Inc, New York pp. 195-238

VIII LITERATUR 63

Raper KB, Thom C (1949) A manual of the Penicillia. Williams & Wilkins Comp., Baltimore

Ravindra A, Weiss K, Simpson RT (1999) High-resolution structural analysis of chromatin at specific loci: Saccharomyces cerevisiae silent mating-type locus HMRa. Mol Cell Biol 19: 7944-7950

Rice WR (2002) Experimental tests of the adaptive significance of sexual recombination. Nat Rev Genet 3: 241-251

Riquelme M (2013) Tip growth in filamentous fungi: a road trip to the apex. Annu Rev Microbiol 67: 587-609

Ropars J, Dupont J, Fontanillas E, Rodriguez de la Vega RC, Malagnac F, Coton M, Giraud T, Lopez-Villavicencio M (2012) Sex in cheese: evidence for sexuality in the fungus Penicillium roqueforti. PLoS One 7: e49665

Rydholm C, Dyer PS, Lutzoni F (2007) DNA sequence characterization and molecular evolution of MAT1 and MAT2 mating-type loci of the self-compatible ascomycete mold Neosartorya fischeri. Eukaryot Cell 6: 868-874

Samson RA, Houbraken J, Thrane U, Frisvad JC, Andersen B (2010) Food and indoor fungi. CBS-KNAW Fungal Biodiversity Centre Utrecht

Samson RA, Yilmaz N, Houbraken J, Spierenburg H, Seifert KA, Peterson SW, Varga J, Frisvad JC (2011) Phylogeny and nomenclature of the genus Talaromyces and taxa accommodated in Penicillium subgenus Biverticillium. Stud Mycol 70: 159-183

Sarikaya Bayram Ö, Bayram Ö, Valerius O, Park HS, Irniger S, Gerke J, Ni M, Han KH, Yu JH, Braus GH (2010) LaeA control of velvet family regulatory proteins for light-dependent development and fungal cell-type specificity. PLoS Genet 6: e1001226

Saupe S, Stenberg L, Shiu KT, Griffiths AJ, Glass NL (1996) The molecular nature of mutations in the mt A-1 gene of the Neurospora crassa A idiomorph and their relation to mating-type function. Mol Gen Genet 250: 115-122

Sax K (1938) Chromosome Aberrations Induced by X-Rays. Genetics 23: 494-516

Schoch CL, Sung GH, Lopez-Giraldez F, Townsend JP, Miadlikowska J, Hofstetter V, Robbertse B, Matheny PB, Kauff F, Wang Z, Gueidan C, Andrie RM, Trippe K, Ciufetti LM, Wynns A, Fraker E, Hodkinson BP, Bonito G, Groenewald JZ, Arzanlou M, de Hoog GS, Crous PW, Hewitt D, Pfister DH, Peterson K, Gryzenhout M, Wingfield MJ, Aptroot A, Suh SO, Blackwell M, Hillis DM, Griffith GW, Castlebury LA, Rossman AY, Lumbsch HT, Lucking R, Budel B, Rauhut A, Diederich P, Ertz D, Geiser DM, Hosaka K, Inderbitzin P, Kohlmeyer J, Volkmann-Kohlmeyer B, Mostert L, O'Donnell VIII LITERATUR 64

K, Sipman H, Rogers JD, Shoemaker RA, Sugiyama J, Summerbell RC, Untereiner W, Johnston PR, Stenroos S, Zuccaro A, Dyer PS, Crittenden PD, Cole MS, Hansen K, Trappe JM, Yahr R, Lutzoni F, Spatafora JW (2009) The Ascomycota tree of life: a phylum-wide phylogeny clarifies the origin and evolution of fundamental reproductive and ecological traits. Syst Biol 58: 224-239

Schoustra S, Rundle HD, Dali R, Kassen R (2010) Fitness-associated sexual reproduction in a filamentous fungus. Curr Biol 20: 1350-1355

Schulz B, Banuett F, Dahl M, Schlesinger R, Schafer W, Martin T, Herskowitz I, Kahmann R (1990) The b alleles of U. maydis, whose combinations program pathogenic development, code for polypeptides containing a homeodomain- related motif. Cell 60: 295-306

Scott DB, Stolk AC (1967) Studies on the genus Eupenicillium Ludwig. II. Perfect states of some penicillia. Antonie Van Leeuwenhoek 33: 297-314

Scott DB (1968) The genus Eupenicillium Ludwig. In: Report no 272. Council for Scientific and Industrial Research Pretoria, South Africa pp. 1–150

Seidl V, Seibel C, Kubicek CP, Schmoll M (2009) Sexual development in the industrial workhorse Trichoderma reesei. Proc Natl Acad Sci U S A 106: 13909- 13914

Selker EU, Cambareri EB, Jensen BC, Haack KR (1987) Rearrangement of duplicated DNA in specialized cells of Neurospora. Cell 51: 741-752

Selmecki A, Forche A, Berman J (2006) Aneuploidy and isochromosome formation in drug-resistant Candida albicans. Science 313: 367-370

Seo JA, Han KH, Yu JH (2004) The gprA and gprB genes encode putative G protein- coupled receptors required for self-fertilization in Aspergillus nidulans. Mol Microbiol 53: 1611-1623

Seo JA, Guan Y, Yu JH (2006) FluG-dependent asexual development in Aspergillus nidulans occurs via derepression. Genetics 172: 1535-1544

Sharon A, Yamaguchi K, Christiansen S, Horwitz BA, Yoder OC, Turgeon BG (1996) An asexual fungus has the potential for sexual development. Mol Gen Genet 251: 60-68

Shenoy BD, Jeewon R, Hyde KD (2007) Impact of DNA sequence-data on the taxonomy of anamorphic fungi. Fungal Divers 26: 1-54

Shiu PK, Glass NL (2000) Cell and nuclear recognition mechanisms mediated by mating type in filamentous ascomycetes. Curr Opin Microbiol 3: 183-188

VIII LITERATUR 65

Sionov E, Lee H, Chang YC, Kwon-Chung KJ (2010) Cryptococcus neoformans overcomes stress of azole drugs by formation of disomy in specific multiple chromosomes. PLoS Pathog 6: e1000848

Snyder W, Georgopoulos S, Webster R, Smith S (1975) Sexuality and genetic behavior in the fungus Hypomyces (Fusarium) solani f. sp. cucurbitae. Hilgardia 43: 161-185

Specht T, Dahlmann TA, Zadra I, Kürnsteiner H, Kück U (2014) Complete genome sequence of the penicillin producer Penicillium chrysogenum (Wisconsin 54- 1255) and its derived industrial strain P2niaD18. unpublished Staben C, Yanofsky C (1990) Neurospora crassa a mating-type region. Proc Natl Acad Sci U S A 87: 4917-4921

Stolk AC (1968) Studies on the genus Eupenicillium ludwig III. Four new species of Eupenicillium. Antonie Van Leeuwenhoek 34: 37-53

Strathern JN, Klar AJ, Hicks JB, Abraham JA, Ivy JM, Nasmyth KA, McGill C (1982) Homothallic switching of yeast mating type cassettes is initiated by a double-stranded cut in the MAT locus. Cell 31: 183-192

Stringer MA, Dean RA, Sewall TC, Timberlake WE (1991) Rodletless, a new Aspergillus developmental mutant induced by directed gene inactivation. Genes Dev 5: 1161-1171

Stringer MA, Timberlake WE (1995) dewA encodes a fungal hydrophobin component of the Aspergillus spore wall. Mol Microbiol 16: 33-44

Swilaiman SS, O'Gorman CM, Balajee SA, Dyer PS (2013) Discovery of a sexual cycle in Aspergillus lentulus, a close relative of A. fumigatus. Eukaryot Cell 12: 962-969

Szewczyk E, Krappmann S (2010) Conserved regulators of mating are essential for Aspergillus fumigatus cleistothecium formation. Eukaryot Cell 9: 774-783

Takada M, Udagawa S (1988) A new species of heterothallic Talaromyces. Mycotaxon 31: 417-425

Tatchell K, Nasmyth KA, Hall BD, Astell C, Smith M (1981) In vitro mutation analysis of the mating-type locus in yeast. Cell 27: 25-35

Taylor JW (1995) Molecular phylogenetic classification of fungi. Arch Med Res 26: 307-314

Thom C (1910) Cultural studies of species of Penicillium. Bull Bur Anim Ind US Dep Agric 111: 1-109

Thom C (1930) The Penicillia. The Williams & Wilkins Co., Baltimore VIII LITERATUR 66

Tisch D, Schmoll M (2010) Light regulation of metabolic pathways in fungi. Appl Microbiol Biotechnol 85: 1259-1277

Todd RB, Davis MA, Hynes MJ (2007) Genetic manipulation of Aspergillus nidulans: meiotic progeny for genetic analysis and strain construction. Nat Protoc 2: 811- 821

Traeger S, Altegoer F, Freitag M, Gabaldon T, Kempken F, Kumar A, Marcet- Houben M, Pöggeler S, Stajich JE, Nowrousian M (2013) The genome and development-dependent transcriptomes of Pyronema confluens: a window into fungal evolution. PLoS Genet 9: e1003820

Tsitsigiannis DI, Zarnowski R, Keller NP (2004) The lipid body protein, PpoA, coordinates sexual and asexual sporulation in Aspergillus nidulans. J Biol Chem 279: 11344-11353

Turgeon BG (1998) Application of mating type gene technology to problems in fungal biology. Annu Rev Phytopathol 36: 115-137

Turgeon BG, Yoder OC (2000) Proposed nomenclature for mating type genes of filamentous ascomycetes. Fungal Genet Biol 31: 1-5 van den Berg MA, Albang R, Albermann K, Badger JH, Daran JM, Driessen AJ, Garcia-Estrada C, Fedorova ND, Harris DM, Heijne WH, Joardar V, Kiel JA, Kovalchuk A, Martin JF, Nierman WC, Nijland JG, Pronk JT, Roubos JA, van der Klei IJ, van Peij NN, Veenhuis M, von Dohren H, Wagner C, Wortman J, Bovenberg RA (2008) Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat Biotechnol 26: 1161-1168 van den Berg MA (2010) Functional characterisation of penicillin production strains. Fungal Biology Reviews 24: 73-78

Van Heeckeren WJ, Dorris DR, Struhl K (1998) The mating-type proteins of fission yeast induce meiosis by directly activating mei3 transcription. Mol Cell Biol 18: 7317-7326

Varga J (2003) Mating type gene homologues in Aspergillus fumigatus. Microbiology 149: 816-819

Wada R, Maruyama J, Yamaguchi H, Yamamoto N, Wagu Y, Paoletti M, Archer DB, Dyer PS, Kitamoto K (2012) Presence and functionality of mating type genes in the supposedly asexual filamentous fungus Aspergillus oryzae. Appl Environ Microbiol 78: 2819-2829

Wadman MW, de Vries RP, Kalkhove SI, Veldink GA, Vliegenthart JF (2009) Characterization of oxylipins and dioxygenase genes in the asexual fungus Aspergillus niger. BMC Microbiol 9: 59 VIII LITERATUR 67

Weiss K, Simpson RT (1998) High-resolution structural analysis of chromatin at specific loci: Saccharomyces cerevisiae silent mating type locus HMLalpha. Mol Cell Biol 18: 5392-5403

Wellner VP, Santos JI, Meister A (1968) Carbamyl phosphate synthetase. A biotin enzyme. Biochemistry 7: 2848-2851

Wieser J, Adams TH (1995) flbD encodes a Myb-like DNA-binding protein that coordinates initiation of Aspergillus nidulans conidiophore development. Genes Dev 9: 491-502

Wolfers S (2013) Bioinformatische und funktionelle Analysen bei dem β-Lactam- Antibiotika-Produzenten Penicillium chrysogenum: Regulatorische Netzwerke von Licht- und MAT-Locus gesteuerten Prozessen. Dissertation, Ruhr- Universität Bochum

Woo PC, Chong KT, Tse H, Cai JJ, Lau CC, Zhou AC, Lau SK, Yuen KY (2006) Genomic and experimental evidence for a potential sexual cycle in the pathogenic thermal dimorphic fungus Penicillium marneffei. FEBS Lett 580: 3409-3416

Wucherpfennig T, Kiep KA, Driouch H, Wittmann C, Krull R (2010) Morphology and rheology in filamentous cultivations. Adv Appl Microbiol 72: 89-136

Yu JH (2006) Heterotrimeric G protein signaling and RGSs in Aspergillus nidulans. J Microbiol 44: 145-154

Yu JH, Mah JH, Seo JA (2006) Growth and developmental control in the model and pathogenic aspergilli. Eukaryot Cell 5: 1577-1584

Yun SH, Berbee ML, Yoder OC, Turgeon BG (1999) Evolution of the fungal self- fertile reproductive life style from self-sterile ancestors. Proc Natl Acad Sci U S A 96: 5592-5597

Yun SH, Arie T, Kaneko I, Yoder OC, Turgeon BG (2000) Molecular organization of mating type loci in heterothallic, homothallic, and asexual Gibberella/Fusarium species. Fungal Genet Biol 31: 7-20

Zeyl C, Bell G (1997) The advantage of sex in evolving yeast populations. Nature 388: 465-468

IX EIGENANTEIL AN PUBLIKATIONEN 68

IX. EIGENANTEIL AN PUBLIKATIONEN

Sexual reproduction and mating-type-mediated strain development in the penicillin-producing fungus Penicillium chrysogenum Böhm J, Hoff B, O´Gorman CM, Wolfers S, Klix V, Binger D, Zadra I, Kürnsteiner H, Pöggeler S, Dyer PS, Kück U (2013) Proceedings of the National Academy of Sciences 110 (4): 1476-1481

Planung (P): 60 % Experimentelle Durchführung (E): 70 % Verfassen des Manuskripts (M): 30 %

Teile der Abbildung 2B und die Abbildung S2B stammen aus meiner eigenen Masterarbeit. Die Abbildungen 3, S3A und S4, sowie die Tabelle S2 wurden von Herrn Simon Wolfers zur Verfügung gestellt. Abbildung 4 wurde von Frau Prof. Dr. Stefanie Pöggeler/Volker Klix zur Verfügung gestellt. Abbildung S2A stammt aus meiner eigenen Bachelorarbeit. Teile der Tabelle S1 wurden von Frau Céline O`Gorman zur Verfügung gestellt.

A MAT1-2 wild-type strain from Penicillium chrysogenum: Functional mating-type locus characterization, genome sequencing, and mating with an industrial penicillin-producing strain Böhm J, Dahlmann TA, Gümüser H, Kück U (2014)

Planung (P): 40 % Experimentelle Durchführung (E): 45 % Verfassen des Manuskripts (M): 35 %

Die Abbildungen 4B und S5B wurden von Herrn Hendrik Gümüser zur Verfügung gestellt. Die Abbildungen 5, 6, 7, S7, S9 und S10 sowie die Tabellen 1 und 2 wurden von Herrn Tim Dahlmann zur Verfügung gestellt. Abbildung S4B wurde von Frau Rebecca Brekau zur Verfügung gestellt. X LEBENSLAUF 69

X. LEBENSLAUF Persönliche Daten Name: Julia Böhm Geburtsdatum: 30.07.1983 Geburtsort: Recklinghausen Familienstand: Ledig

Schulausbildung August 1990 – Juni 1994 Grundschule Kohlkamp August 1994 – Juni 2003 Freiherr-vom-Stein Gymnasium Abschluss: Allgemeine Hochschulreife

Berufsausbildung September 2003 – Juni 2005 Ausbildung zur biologisch-technischen Assistentin Abschluss: Staatlich geprüfte biologisch- technische Assistentin

Hochschulausbildung Oktober 2005 – September 2008 Studium der Biologie (Bachelor of Science), Ruhr- Universität Bochum, Abschlussarbeit: „Funktionelle Analyse des Mating-Type-Locus in dem β-Laktam-Produzenten Penicillium chrysogenum“ angefertigt am Lehrstuhl für Allgemeine und Molekulare Botanik; Christian Doppler Labor für „Biotechnologie der Pilze“, Betreuer: Prof. Dr. U. Kück

Oktober 2008 – Dezember 2010 Studium der Biologie (Master of Science), Ruhr- Universität Bochum, Abschlussarbeit: „Funktion des MAT1-1 Locus im β-Laktam-Antibiotika- Produzenten Penicillium chrysogenum“ angefertigt am Lehrstuhl für Allgemeine und Molekulare Botanik; Christian Doppler Labor für „Biotechnologie der Pilze“, Betreuer: Prof. Dr. U. Kück

Seit Februar 2011 Promotionsstudium an der Ruhr-Universität Bochum, Dissertation: „Kreuzungstypgene und Sexualzyklus bei dem Penicillin-Produzenten Penicillium chrysogenum“ angefertigt am Lehrstuhl für Allgemeine und Molekulare Botanik, Christian Doppler Labor für „Biotechnologie der Pilze“, Betreuer: Prof. Dr. U. Kück

IV LEBENSLAUF 70

Publikationen

Böhm J, Hoff B, O'Gorman CM, Wolfers S, Klix V, Binger D, Zadra I, Kürnsteiner H, Pöggeler S, Dyer PS, Kück U (2013) Sexual reproduction and mating-type-mediated strain development in the penicillin-producing fungus Penicillium chrysogenum. Proc Natl Acad Sci U S A 110: 1476-1481

Kück U, Böhm J (2013) Mating type genes and cryptic sexuality as tools for genetically manipulating industrial molds. Appl Microbiol Biotechnol 97: 9609- 9620

Böhm J, Dahlmann TA, Gümüser H, Kück U (2014) A MAT1-2 wild-type strain from Penicillium chrysogenum: Functional mating-type locus characterization, genome sequencing, and mating with an industrial penicillin-producing strain. (prepared for submission)

Kongressbeiträge

Böhm J, Hoff B, Wolfers S, Pöggeler S, O’Gorman C, Kück U (2011) Mating Type Loci in Penicillium chrysogenum regulate asexual and hyphal development, Abstracts, 10. VAAM-Symposium “Molecular Biology of Fungi”, Marburg, 11. – 14. September 2011, Poster

Böhm J, Hoff B, O’Gorman C, Wolfers S, Pöggeler S, Kück U (2012) Evidence for sexual recombination in Penicillium chrysogenum. Abstracts, 11th European Conference on Fungal Genetics, Marburg, 30. März - 02. April 2012, Poster

Böhm J, Hoff B, Wolfers S, O’Gorman C, Dyer P, Pöggeler S, Kück U (2013) Sexual reproduction and mating type function in the penicillin producing fungus Penicillium chrysogenum. Abstracts, 27th Fungal Genetics Conference, Asilomar (USA), 12. – 17. März 2013, Poster und Vortrag

ERKLÄRUNG

Hiermit erkläre ich, dass ich die Arbeit selbständig verfasst und bei keiner anderen Fakultät eingereicht und dass ich keine anderen als die angegebenen Hilfsmittel verwendet habe. Es handelt sich bei der heute von mir eingereichten Dissertation um sechs in Wort und Bild völlig übereinstimmende Exemplare. Weiterhin erkläre ich, dass digitale Abbildungen nur die originalen Daten enthalten und in keinem Fall inhaltsverändernde Bildbearbeitung vorgenommen wurde.

Bochum, den

(Julia Böhm)