DOCSLIB.ORG

DNA Methylation in OPG/RANK/RANKL Pathway Is Associated with Steroid-Induced Osteonecrosis of the Femoral Head

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
DNA Methylation in OPG/RANK/RANKL Pathway Is Associated with Steroid-Induced Osteonecrosis of the Femoral Head DNA Methylation in OPG/RANK/RANKL Pathway is Associated with Steroid-induced Osteonecrosis of the Femoral Head Menghu Sun Inner Mongolia Medical University Yuju Cao Zhengzhou Traditional Chinese Medicine Traumatology Hospital Xiaolong Yang The Second Aliated Hospital of Inner Mongolia Medical University Feimeng An Inner Mogolia Autonomous Region Hospital of Traditional Chinese Medicine Huiqiang Wu Inner Mogolia Autonomous Region Hospital of Traditional Chinese Medicine Jianzhong Wang ( [email protected] ) Inner Mongolia Medical University https://orcid.org/0000-0003-4031-1316 Primary research Keywords: OPG, RANK, RANKL, methylation, steroid-induced ONFH Posted Date: October 9th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-86952/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/18 Abstract Background: The dysregulation of OPG/RANK/RANKL signaling pathway is a key step in the occurrence of steroid-induced osteonecrosis of the femoral head (ONFH). This study aims to understand the degree of methylation of OPG, RANK and RANKL genes in steroid-related ONFH. Methods: A case-control study was designed, including 50 patients and 50 controls. The Agena MassARRAY platform is used to detect the methylation status of OPG, RANK and RANKL genes in the blood of subjects. The relationship between the methylation level of the CpG site of each gene and the steroid-related ONFH was analyzed. Results: In the CpG islands of the OPG, RANK and RANKL genes of steroid-related ONFH patients, a number of CpG sites with high methylation rate and high methylation level were found. Some hypermethylated CpG sites increase the risk of steroid-related ONFH. In addition, by constructing the receiver operating characteristic (ROC) curve, we also discovered a few hypermethylated CpG sites, which have predictive diagnostic value for steroid-related ONFH. Conclusion: Methylation in the OPG / RANK / RANKL signaling pathway increases the risk of steroid-related ONFH. Some hypermethylated CpG sites can be used as early prediction and diagnostic targets for steroid-related ONFH. Introduction Steroid-induced osteonecrosis of the femoral head (steroid-induced ONFH) is a disease caused by the massive application of steroids, which can lead to blood circulation disorders of the femoral head, bone cell ischemia, degeneration, necrosis, irreversible collapse of the femoral head and ultimately cause hip joint dysfunction (1). It is more common clinically. According to reports, the incidence of steroid-induced ONFH is increasing every year, and it is one of the most common non-traumatic ONFH, accounting for about 24.1% of the total number of patients with ONFH (2). However, the early diagnosis of this disease is dicult, and it often progresses to the late stage, requiring hip replacement surgery, which seriously affects the quality of life of patients (3). Therefore, the early diagnosis and treatment of the disease is the current research focus. The pathological process of steroid-induced ONFH is complicated. In the past, numerous scholars have proposed various theories for this, including lipid abnormalities, endothelial cell damage, coagulation defects, genetic polymorphism, apoptosis and autophagy, etc (4–6). In recent years, with the development of molecular biology and genetics, epigenetics, which studies the interaction between environmental signals and genomes, has received more and more attention. Among them, DNA methylation is undoubtedly the most important eld. Studies have shown that DNA methylation plays a role in the occurrence and development of ONFH (7–9). However, none of these can fully explain its underlying mechanism. Although the cause is not clear, abnormal bone metabolism is a key step in the occurrence of steroid-induced ONFH, and the OPG/RANK/RANKL system is involved in this process (10). Receptor activator of nuclear factor-κ B (RANK) is a member of the tumor necrosis factor receptor (TNFR) family, located on the surface of osteoclasts and osteoclast precursor cells. Its transduction receptor RANKL is a cytokine necessary for osteoclast differentiation and is synthesized by osteoblasts and bone marrow stromal cells. RANK can stimulate the differentiation and maturation of osteoclasts by binding to RANKL receptors. Osteoprotegerin (OPG) belongs to the TNFR superfamily and is mainly secreted by osteoblasts in bone tissues and is a natural inhibitor of RANKL. OPG can block the binding of RANKL and RANK by competitively binding to RANKL, thereby inhibiting the activity and maturation of bone cells. OPG, RANK and RANKL together constitute the regulating axis for osteoclasts (11). It is currently believed that steroids mainly cause the imbalance in the bone reconstruction process of the femoral head through the OPG/RANK/RANKL signal pathway, inhibit bone formation, and cause bone loss and osteonecrosis (12). In this study, we used the Agena MassARRAY system to analyze the methylation status of the CpG islands of OPG, RANK and RANKL genes in the blood of steroid-induced ONFH patients and normal control subjects. The purpose is to study whether there is methylation in OPG/RANK/RANKL signaling pathway and the possible relationship between methylation level and steroid-induced ONFH. Materials And Methods Page 2/18 Subjects A total of 100 subjects were recruited for this study, including 50 steroid-induced ONFH patients and 50 healthy controls. All participants were from Zhengzhou Traditional Chinese Medicine (TCM) Traumatology Hospital in Henan Province. The case group composed of patients who were diagnosed with steroid-induced ONFH during hospitalization, and were classied using the latest Association Research Osteocirculatory System (ARCO) staging system (13). The control group consisted of healthy people who were examined at the same hospital physical examination center during the same period and matched the age and gender of the case group. All participants were Han people from northern China who lived in or around Zhengzhou without any kinship. The criteria for the cases included in this study are as follows: (1) ONFH patients diagnosed by magnetic resonance imaging (MRI) or computer tomography (CT) or X-ray (14); (2) Prior to the appearance of clinical manifestations of ONFH, patients had taken a dose equivalent to prednisolone with an average dose of 16.6 mg/day for one year. Or a maximum dose of 80 mg/day for more than a week (15); (3) The patient should not have a history of trauma or other hip joint diseases; (4) Other risk factors that may affect the results of the test were excluded (history of alcoholism; history of family genetic diseases; severe diseases or severe chronic diseases, such as cardiovascular and cerebrovascular diseases, diabetes, chronic renal insuciency, etc.). Control selection criteria: (1) Not suffering from ONFH; (2) The age and gender of the control group match the case group; (3) Other risk factors (such as congenital diseases, diabetes, cardiovascular disease, liver and kidney dysfunction, cancer, familial genetic diseases, etc.) are excluded. DNA extraction and methylation analysis According to the manufacturer's instructions, the whole blood genomic DNA extraction kit (GoldMag Co. Ltd., Xi’an, China) was used to extract total DNA from whole blood. The total DNA quality was evaluated using Nanodrop 2000 (Thermo Scientic, Waltham, Massachusetts, USA). EMBOSS (The European Molecular Biology Open Software Suite https://www.ebi.ac.uk/Tools/seqstats/emboss_cpgplot/ ) was used to analyze the existence of CpG islands in OPG (chr8:118951508 ~ 118952139), RANK (chr18:62324637 ~ 62326523) and RANKL (chr13:42573413 ~ 42574559) genes. We found a CpG island in the OPG gene sequence, spanning 193 to 411 bp (length 219 bp) (Fig. 1A); Two CpG islands were found in the RANK gene sequence, one CpG island spans 751 to 1,579 bp (length 829 bp), and the other CpG island spans 1,604 to 1,899 bp (length 296 bp) (Fig. 1B); A CpG island was found in the RANKL gene sequence, spanning 692 to 1,045 bp (length 354 bp) (Fig. 1C); Based on base-specic cleavage and MALDI-TOF mass spectrometry, EpiTyper MassArray (Agena, San Diego, California, USA) was used for quantitative methylation analysis of OPG, RANK and RANKL genes. EZ Bisulte Conversion Kit (Zymo Research, Orange, California, USA) is used for bisulte conversion of DNA in OPG, RANK and RANKL genomes. Then perform polymerase chain reaction (PCR) amplication. Add a 10-mer tag to each left primer to adjust the melting temperature difference, and add a T7 promoter tag to each right primer for transcription. The PCR primers needed in this study were designed according to Epidesigner (http://www.epidesigner.com/) and relevant literature, and synthesized by Beijing Augct Biotechnology Co., Ltd. The primer sequences are shown in Table 1. Page 3/18 Table 1 Primers used for this study Gene_ID Direction Left primer (5'→3') a Right primer (5'→3') b Product No of Length CpG’s (bp) OPG1 F TTTTTGTTGTTTTTTATAAAGTTAGTAGGA ACTACTACCACCTAATCTCCCAACC 185 6 OPG2 R GAAAGGTGTAAAGTTTGGTTTAGGA AAAAAACCAAATAACAACAACCTCC 265 21 RANK1 F AAGAAAAAGAGATAGTGGTTGTTGGT CAAATAATACCCAAACTCCCCTAAT 464 33 RANK2 R GGTTTTGATGTTGTTATTTTTTTTAAATGT CCTTCCCTATAAAAACTTTCAAATTC 491 38 RANK3 F ATTTGAAAGTTTTTATAGGGAAGGG AAACACTTAATTAAACAACACCTAAAA 349 12 RANKL1 F TAGAGGTGGGAGTGGAAGAGGTAGTT ATCCCCTAAAAAAATAACCACTCAC 497 46 RANKL2 R GATTTTTTGGGAAGGTGGTTATTTA CCAACAAAAACTACACCAAATACCT 235 19 F Forward primer; R Reverse primer. a 10-mer tag: aggaagagag; b T7
Load more

Recommended publications
  • ENSG Gene Encodes Effector TCR Pathway Costimulation Inhibitory/Exhaustion Synapse/Adhesion Chemokines/Receptors
    ENSG Gene Encodes Effector TCR pathway Costimulation Inhibitory/exhaustion Synapse/adhesion Chemokines/receptors ENSG00000111537 IFNG IFNg x ENSG00000109471 IL2 IL-2 x ENSG00000232810 TNF TNFa x ENSG00000271503 CCL5 CCL5 x x ENSG00000139187 KLRG1 Klrg1 x ENSG00000117560 FASLG Fas ligand x ENSG00000121858 TNFSF10 TRAIL x ENSG00000134545 KLRC1 Klrc1 / NKG2A x ENSG00000213809 KLRK1 Klrk1 / NKG2D x ENSG00000188389 PDCD1 PD-1 x x ENSG00000117281 CD160 CD160 x x ENSG00000134460 IL2RA IL-2 receptor x subunit alpha ENSG00000110324 IL10RA IL-10 receptor x subunit alpha ENSG00000115604 IL18R1 IL-18 receptor 1 x ENSG00000115607 IL18RAP IL-18 receptor x accessory protein ENSG00000081985 IL12RB2 IL-12 receptor x beta 2 ENSG00000186810 CXCR3 CXCR3 x x ENSG00000005844 ITGAL CD11a x ENSG00000160255 ITGB2 CD18; Integrin x x beta-2 ENSG00000156886 ITGAD CD11d x ENSG00000140678 ITGAX; CD11c x x Integrin alpha-X ENSG00000115232 ITGA4 CD49d; Integrin x x alpha-4 ENSG00000169896 ITGAM CD11b; Integrin x x alpha-M ENSG00000138378 STAT4 Stat4 x ENSG00000115415 STAT1 Stat1 x ENSG00000170581 STAT2 Stat2 x ENSG00000126561 STAT5a Stat5a x ENSG00000162434 JAK1 Jak1 x ENSG00000100453 GZMB Granzyme B x ENSG00000145649 GZMA Granzyme A x ENSG00000180644 PRF1 Perforin 1 x ENSG00000115523 GNLY Granulysin x ENSG00000100450 GZMH Granzyme H x ENSG00000113088 GZMK Granzyme K x ENSG00000057657 PRDM1 Blimp-1 x ENSG00000073861 TBX21 T-bet x ENSG00000115738 ID2 ID2 x ENSG00000176083 ZNF683 Hobit x ENSG00000137265 IRF4 Interferon x regulatory factor 4 ENSG00000140968 IRF8 Interferon
    [Show full text]
  • A1068-CD86 Polyclonal Antibody
    BioVision 05/16 For research use only CD86 Polyclonal Antibody CATALOG NO: A1068-100 ALTERNATIVE NAMES: T-lymphocyte activation antigen CD86, Activation B7-2 antigen, B70, BU63, CTLA-4 counter-receptor B72, FUN-1, CD86, CD86, CD28LG2 Western blot analysis of CD86 in NCI-H292 cell line lysate AMOUNT: 100 µl IMMUNOGEN: KLH conjugated synthetic peptide between 269-298 amino acids from the C-terminal region of human CD86. MOLECULAR WEIGHT: 37 kDa HOST/ISOTYPE: Rabbit IgG SPECIES REACTIVITY: Human PURIFICATION: This antibody is purified through a protein A column, followed by peptide affinity purification. FORM: Liquid FORMULATION: Supplied in PBS with 0.09% (W/V) sodium azide. STORAGE CONDITIONS: Maintain refrigerated at 2-8°C for up to 6 months. For long term RELATED PRODUCTS storage store at -20°C in small aliquots to prevent freeze-thaw cycles. DESCRIPTION: This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by Human CellExp™ B7-2 /CD86, human recombinant (Cat. No. 7496-10, -50) antigen-presenting cells, and it is the ligand for two proteins at the CD86 (Human) ELISA Kit (Cat. No. K4175-100) cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte- Human CellExp™LAG3 /CD223, human recombinant (Cat. No. 7278-10, -50) associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this CD223 (LAG3) Polyclonal Antibody (Cat. No. A1067-100) protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response.
    [Show full text]
  • Molecular and Clinical Characterization of LAG3 in Breast Cancer Through 2994 Samples
    Molecular and Clinical Characterization of LAG3 in Breast Cancer Through 2994 Samples Qiang Liu Chinese Academy of Medical Sciences & Peking Union Medical College Yihang Qi ( [email protected] ) Chinese Academy of Medical Sciences and Peking Union Medical College https://orcid.org/0000-0001- 7589-0333 Jie Zhai Chinese Academy of Medical Sciences & Peking Union Medical College Xiangyi Kong Chinese Academy of Medical Sciences & Peking Union Medical College Xiangyu Wang Chinese Academy of Medical Sciences & Peking Union Medical College Yi Fang Chinese Academy of Medical Sciences & Peking Union Medical College Jing Wang Chinese Academy of Medical Sciences & Peking Union Medical College Research Keywords: Cancer immunotherapy, CD223, LAG3, Immune response, Inammatory activity Posted Date: June 19th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-36422/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/33 Abstract Background Despite the promising impact of cancer immunotherapy targeting CTLA4 and PD1/PDL1, a large number of cancer patients fail to respond. LAG3 (Lymphocyte Activating 3), also named CD233, is a protein Coding gene served as alternative inhibitory receptors to be targeted in the clinic. The impact of LAG3 on immune cell populations and co-regulation of immune response in breast cancer remained largely unknown. Methods To characterize the role of LAG3 in breast cancer, we investigated transcriptome data and associated clinical information derived from a total of 2994 breast cancer patients. Results We observed that LAG3 was closely correlated with major molecular and clinical characteristics, and was more likely to be enriched in higher malignant subtype, suggesting LAG3 was a potential biomarker of triple-negative breast cancer.
    [Show full text]
  • Diabetes in the Absence of LAG-3 Cutting Edge
    Cutting Edge: Accelerated Autoimmune Diabetes in the Absence of LAG-3 Maria Bettini, Andrea L. Szymczak-Workman, Karen Forbes, Ashley H. Castellaw, Mark Selby, Xiaoyu Pan, This information is current as Charles G. Drake, Alan J. Korman and Dario A. A. Vignali of September 24, 2021. J Immunol 2011; 187:3493-3498; Prepublished online 26 August 2011; doi: 10.4049/jimmunol.1100714 http://www.jimmunol.org/content/187/7/3493 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2011/08/26/jimmunol.110071 Material 4.DC1 http://www.jimmunol.org/ References This article cites 25 articles, 11 of which you can access for free at: http://www.jimmunol.org/content/187/7/3493.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 24, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Cutting Edge: Accelerated Autoimmune Diabetes in the Absence of LAG-3 Maria Bettini,* Andrea L.
    [Show full text]
  • Point Mutation in CD19 Facilitates Immune Escape of B Cell Lymphoma from CAR-­T Cell Therapy
    Open access Original research J Immunother Cancer: first published as 10.1136/jitc-2020-001150 on 6 October 2020. Downloaded from Point mutation in CD19 facilitates immune escape of B cell lymphoma from CAR- T cell therapy 1 1 1 1 1 1 Zhen Zhang, Xinfeng Chen, Yonggui Tian, Feng Li , Xuan Zhao, Jinyan Liu, 1 1,2,3,4 Chang Yao, Yi Zhang To cite: Zhang Z, Chen X, ABSTRACT relapses after CD19 CAR-T cell therapy are Tian Y, et al. Point mutation Background Tumor relapse due to mutation in CD19 can attributed to the antigen loss, indicating an in CD19 facilitates immune hinder the efficacy of chimeric antigen receptor (CAR)- T urgent need for investigating the mechanisms escape of B cell lymphoma from cell therapy. Herein, we focused on lymphoma patients CAR- T cell therapy. Journal underlying recurrence and for improving whose B cells exhibited a point mutation in CD19 of B cells 4 5 for ImmunoTherapy of Cancer the efficacy of CAR- T cell therapy. Inter- 2020; :e001150. doi:10.1136/ after CAR-T cell infusion. 8 + estingly, one of the specific mechanisms jitc-2020-001150 Methods The CAR- T and CD19 B cells from peripheral blood or bone marrow were assessed using flow of tumor escape that has been reported cytometry. Genome sequencing was conducted to identify suggests that exon mutations affecting the ► Additional material is + published online only. To view, the molecular characteristics of CAR- T and CD19 B cells CD19 gene and its splicing isoforms, leading please visit the journal online from pre-rela pse and postrelapse samples.
    [Show full text]
  • LAG-3: from Molecular Functions to Clinical Applications
    Open access Review J Immunother Cancer: first published as 10.1136/jitc-2020-001014 on 13 September 2020. Downloaded from LAG-3: from molecular functions to clinical applications Takumi Maruhashi , Daisuke Sugiura , Il- mi Okazaki , Taku Okazaki To cite: Maruhashi T, Sugiura D, ABSTRACT (PD-1) and cytotoxic T lymphocyte antigen Okazaki I, et al. LAG-3: from To prevent the destruction of tissues owing to excessive 4 (CTLA-4) significantly improved the molecular functions to clinical and/or inappropriate immune responses, immune outcomes of patients with diverse cancer applications. Journal for cells are under strict check by various regulatory ImmunoTherapy of Cancer types, revolutionizing cancer treatment. The mechanisms at multiple points. Inhibitory coreceptors, 2020;8:e001014. doi:10.1136/ success of these therapies verified that inhib- including programmed cell death 1 (PD-1) and cytotoxic jitc-2020-001014 itory coreceptors serve as critical checkpoints T lymphocyte antigen 4 (CTLA-4), serve as critical checkpoints in restricting immune responses against for immune cells to not attack the tumor Accepted 29 July 2020 self- tissues and tumor cells. Immune checkpoint inhibitors cells as well as self-tissues. However, response that block PD-1 and CTLA-4 pathways significantly rates are typically lower and immune-related improved the outcomes of patients with diverse cancer adverse events (irAEs) are also observed in types and have revolutionized cancer treatment. However, patients administered with immune check- response rates to such therapies are rather limited, and point inhibitors. This is indicative of the immune-rela ted adverse events are also observed in a continued need to decipher the complex substantial patient population, leading to the urgent need biology of inhibitory coreceptors to increase for novel therapeutics with higher efficacy and lower response rates and prevent such unwanted toxicity.
    [Show full text]
  • Lymphocyte Activation Gene-3 – the Expression and Function in the Immune System
    Lymphocyte Activation Gene-3 – the expression and function in the immune system Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-naturwissenschaftlichen Fakultät der Universität Basel von Malgorzata Kisielow aus Edmonton, Kanada Basel, 2006 Genehmigt von der Philosphisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Antonius Rolink und PD. Dr. Patrick Matthias Basel, den 24 Mai 2005 Prof. Dr. Hans-Jakob Wirz 2 Mojej Mamie Mojemu Tacie 3 TABLE OF CONTENTS ABBREVIATIONS 7 SUMMARY 9 1. INTRODUCTION 11 1.1. The immune system 11 1.1.1. Players of adaptive immunity 12 1.1.1.1. B lymphocytes 12 - B2 B cells 13 - B1 B cells 13 - Marginal zone B cells 14 1.1.1.2. T lymphocytes 14 - αβ T cells 15 Helper T cells 15 Cytotoxic T cells 16 Regulatory T cells 16 NK T cells 17 - γδ T cells 18 1.1.1.3. Antigen Presenting Cells 18 - Denritic cells 19 1.1.1.4. Natural Killer Cells 21 1.1.2. Lymphocyte homeostasis 21 1.1.3. T cell responses 22 1.1.4. T cell-B cell collaboration in B cell responses 24 - Germinal Center reaction 27 1.2. Lymphocyte Activation Gene-3 28 1.2.1. Identification and the predicted structure 28 1.2.2. LAG-3 expression pattern 31 1.2.3. Regulation of Lag-3 expression 33 1.2.4. Suggested function of LAG-3 35 1.2.5. Mode of action of LAG-3 36 1.2.6. LAG-3 and cancer 38 2. THESIS OBJECTIVES 40 3.
    [Show full text]
  • Impact of IL-27 on Regulatory T Cell Responses
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2013 Impact of IL-27 on regulatory T cell responses Aisling Catherine O'Hara University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Allergy and Immunology Commons, Immunology and Infectious Disease Commons, and the Medical Immunology Commons Recommended Citation O'Hara, Aisling Catherine, "Impact of IL-27 on regulatory T cell responses" (2013). Publicly Accessible Penn Dissertations. 906. https://repository.upenn.edu/edissertations/906 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/906 For more information, please contact [email protected]. Impact of IL-27 on regulatory T cell responses Abstract Interleukin (IL)–27 is a heterodimeric cytokine with potent inhibitory properties. Thus, mice that lack IL–27–mediated signaling develop exaggerated inflammatory responses during toxoplasmosis as well as other infections or autoimmune processes. While regulatory T (Treg) cells are critical to limit inflammation, their oler during toxoplasmosis is controversial because this infection results in a dramatic decrease in the total numbers of these cells associated with reduced levels of IL–2. Because IL–27 suppresses IL–2, we initially hypothesized that it was responsible for the Treg cell “crash”. Thus, we examined the role of IL–27 and IL–2 and their effects on Treg cells during toxoplasmosis. We observed that although IL–2 production is enhanced in the absence of IL–27, this was not sufficiento t rescue Treg cell frequencies during infection. Rather, our data indicated that IL–27 promoted an immunosuppressive Treg cell population that displayed a T helper 1 (TH1) phenotype, characterized by the expression of T–bet, CXCR3, IL–10 and interferon (IFN)–γ.
    [Show full text]
  • Circulating Exosomes Inhibit B Cell Proliferation and Activity
    cancers Article Circulating Exosomes Inhibit B Cell Proliferation and Activity Jan C. Schroeder , Lisa Puntigam, Linda Hofmann , Sandra S. Jeske, Inga J. Beccard, Johannes Doescher, Simon Laban, Thomas K. Hoffmann, Cornelia Brunner , , Marie-Nicole Theodoraki y and Patrick J. Schuler * y Department of Otorhinolaryngology and Head and Neck Surgery, Ulm University, 89075 Ulm, Germany; [email protected] (J.C.S.); [email protected] (L.P.); [email protected] (L.H.); [email protected] (S.S.J.); [email protected] (I.J.B.); [email protected] (J.D.); [email protected] (S.L.); T.hoff[email protected] (T.K.H.); [email protected] (C.B.); [email protected] (M.-N.T.) * Correspondence: [email protected]; Tel.: +49-731-500-59501 These authors contributed equally. y Received: 23 June 2020; Accepted: 24 July 2020; Published: 29 July 2020 Abstract: (1) Background: Head and neck squamous cell carcinoma (HNSCC) is characterized by a distinctive suppression of the anti-tumor immunity, both locally in the tumor microenvironment (TME) and the periphery. Tumor-derived exosomes mediate this immune suppression by directly suppressing T effector function and by inducing differentiation of regulatory T cells. However, little is known about the effects of exosomes on B cells. (2) Methods: Peripheral B cells from healthy donors and HNSCC patients were isolated and checkpoint receptor expression was analyzed by flow cytometry. Circulating exosomes were isolated from the plasma of HNSCC patients (n = 21) and healthy individuals (n = 10) by mini size-exclusion chromatography.
    [Show full text]
  • Lag-3 Mediates Acute Rejection & Memory in Mouse Transplantation
    Yale University EliScholar – A Digital Platform for Scholarly Publishing at Yale Yale Medicine Thesis Digital Library School of Medicine January 2018 Lag-3 Mediates Acute Rejection & Memory In Mouse Transplantation Jeffrey Mark Erfe Follow this and additional works at: https://elischolar.library.yale.edu/ymtdl Recommended Citation Erfe, Jeffrey Mark, "Lag-3 Mediates Acute Rejection & Memory In Mouse Transplantation" (2018). Yale Medicine Thesis Digital Library. 3393. https://elischolar.library.yale.edu/ymtdl/3393 This Open Access Thesis is brought to you for free and open access by the School of Medicine at EliScholar – A Digital Platform for Scholarly Publishing at Yale. It has been accepted for inclusion in Yale Medicine Thesis Digital Library by an authorized administrator of EliScholar – A Digital Platform for Scholarly Publishing at Yale. For more information, please contact [email protected]. LAG-3 MEDIATES ACUTE REJECTION & MEMORY IN MOUSE TRANSPLANTATION A Thesis Submitted to the Yale University School of Medicine In Partial Fulfillment of the Requirements for the Degree of Doctor of Medicine By Jeffrey Mark Erfe, MPH 2018 1 LAG-3 MEDIATES ACUTE REJECTION & MEMORY IN MOUSE TRANSPLANTATION Jeffrey Mark Erfe, Chao Yang, Dorothy Ndishabandi, Ivy Rosales, Rebecca White, Paul S. Russell, Robert B. Colvin, Joren C. Madsen, and Alessandro Alessandrini. Center for Transplantation Sciences, Massachusetts General Hospital, Boston, MA. (Sponsored by George Tellides, Section of Cardiothoracic Surgery, Yale University School of Medicine, New Haven, CT) ABSTRACT: Lymphocyte Activation Gene-3 (LAG-3) is a soluble protein and transmembrane protein receptor expressed on lymphocytes such as immunosuppressive regulatory T cells. Our goal was to evaluate the effect of LAG-3 on transplantation outcomes, specifically rejection and cellular memory response to donor antigen, by comparing graft survival and IFN-l secretion to donor antigen in C57BL/6 LAG-3-/- versus wild-type mouse recipients of DBA/2 grafts.
    [Show full text]
  • Lymphocyte-Activation Gene 3 (LAG-3) Immune Pathway
    Lymphocyte-Activation Gene 3 (LAG-3) About LAG-3 LAG-3 Lymphocyte-activation gene 3 (LAG-3) is an immune checkpoint receptor protein found on the cell surface of effector T cells and regulatory T cells (Tregs) and functions to control T cell response, activation and growth.1 TCR T cells are a type of white blood cell that are part of the immune system. Activation of cytotoxic T cells by antigens enables them to 1 kill unhealthy or foreign cells. Inactive T cell Antigen MHC Dendritic cell (APC) LAG-3 and LAG-3 and LAG-3 and Immune Function T Cell Exhaustion Cancer • After a T cell is activated to kill its • However, in certain situations where T • Because of its critical role in regulating target cell, LAG-3 expression is cells experience prolonged exposure to an exhaustion of cytotoxic T cells and Treg increased to turn off the immune antigen, such as cancer or chronic function, LAG-3 has become a target of response, so that the T cell does not go infection, the T cells become desensitized study in the cancer field. on to attack healthy cells.2 and lose their ability to activate and multiply in the presence of the antigen.4 • In cancer, LAG-3 expressing exhausted • Inhibition of the immune response is cytotoxic T cells and Tregs expressing accomplished through activation of • The desensitized T cell will also LAG-3 gather at tumor sites.5,6 the LAG-3 pathway, which can occur progressively fail to produce cytokines via binding of LAG-3 to a type of (proteins that assist in the immune • Preclinical studies suggest that inhibiting antigen-presenting complex called response) and kill the target cells.4 LAG-3 allows T cells to regain their MHC II.
    [Show full text]
  • Preclinical Development of the Anti-LAG-3 Antibody REGN3767
    Author Manuscript Published OnlineFirst on August 8, 2019; DOI: 10.1158/1535-7163.MCT-18-1376 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Characterization of the Anti-LAG-3 Antibody REGN3767 Preclinical Development of the Anti-LAG-3 Antibody REGN3767: Characterization and Activity in Combination with the Anti-PD-1 Antibody Cemiplimab in Human PD-1xLAG-3 Knock-In Mice Elena Burova, Aynur Hermann, Jie Dai, Erica Ullman, Gabor Halasz, Terra Potocky, Seongwon Hong, Matt Liu, Omaira Allbritton, Amy Woodruff, Jerry Pei, Ashique Rafique, William Poueymirou, Joel Martin, Douglas MacDonald, William Olson, Andrew Murphy, Ella Ioffe, Gavin Thurston, and Markus Mohrs1 Regeneron Pharmaceuticals, Inc., Tarrytown, NY 10591 1Corresponding author: Markus Mohrs, Regeneron Pharmaceuticals, 777 Old Saw Mill River Road, Tarrytown, NY 10591. Phone: 914-847-1122; Fax: 914-847-7453; E-mail: [email protected] Running title: Characterization of human anti-LAG-3 antibody REGN3767 Keywords: LAG-3, Checkpoint blockade, Monoclonal antibody, Immunotherapy, Cancer Disclosure of Potential Conflicts of Interest All authors are employees of Regeneron Pharmaceuticals, but otherwise have no conflicts of interest to declare. Financial support statement This work is funded by Regeneron Pharmaceuticals, Inc. Electronic work count Abstract: 228 Words of text: 4684 Number of figures and tables Figures: 6 1 Downloaded from mct.aacrjournals.org on September 27, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 8, 2019; DOI: 10.1158/1535-7163.MCT-18-1376 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]